Datasets:

BEE-spoke-data

/

fineweb-synergy-20k

like 0

CollegeDekho, an online platform connecting colleges and students Girnar Soft, the parent company of India’s leading online automobile marketplace CarDekho.com, recently invested US $1 million in a disruptive education start-up, CollegeDekho. CollegeDekho is formed by a set of entrepreneurs who are passionate about education and wanted to solve the bottlenecks in the college admissions process. With the funding, Girnar Soft has yet again underlined its mission of developing tech-driven industry solutions for various industry verticals that can help circumvent the traditional roadblocks associated with them. The investment was secured due to the vision as well as the cohesive management and entrepreneurial team behind CollegeDekho. Explaining the reasons behind the investment, Amit Jain, CEO and co-founder, Girnar Soft, said, “Higher education in India is a market segment that requires a fresh approach to overcome the incumbent inertia. We quite liked the idea of a disruptive development that could assist students in making more informed choices. Additionally, the synergy and the strength of the vision driving the team at CollegeDekho also played a vital role in convincing us to invest so deeply into the venture.” Ruchir Arora, CEO and founder, CollegeDekho, commented, “In India at any point of time there are ~30mn students enrolled in ~36000 colleges. Despite being the third largest higher education market in the world, it is hugely underpenetrated and offers significant growth potential. CollegeDekho has been established to provide a transparent, open platform that facilitates interaction between students and colleges. Through this venture, we aim to provide students with authentic, comprehensive and unbiased information. This will help them in evaluating and selecting the career option most suited to their interests and proficiency.” Incepted as a medium to connect students to colleges, CollegeDekho will leverage its proprietary and unique technology platform to match student preferences to prospective colleges. CollegeDekho will be using the funds for developing its platform, building its team and marketing. Girnar Soft’s investment would serve as the seed funding for the venture, with more funds expected to be raised in due course of time. Also Read: CarDekho.com Acquires Zigwheels.com - Times Internet Invests in Girnar Software Source : CarDekho

|By Business Wire|| |March 20, 2014 08:05 AM EDT|| Citrix today announced customers who are transforming their businesses with Citrix mobile workspace solutions, demonstrating how its virtualization, networking and cloud services technologies empower new ways for people to work better. With consumerization, mobility and BYOD continuing to impact and evolve the workplace, industry analysts estimate the emerging mobile workspaces market is set to grow 15 times in the next three years1. With Citrix XenDesktop®, XenApp®, XenMobile®, ShareFile®, GoToMeeting® and NetScaler® offerings, Citrix continues to provide a complete mobile workspace solution that securely delivers apps, desktops, files and services to any user, on any device over any network – all with an intuitive user experience. As a result, workers gain access to a portable, always on, always connected working environment that follows them no matter where they go, no matter what device they choose to use, and no matter what method of connectivity they happen to be leveraging. No other vendor provides the breadth of capabilities – from app and desktop virtualization, to secure mobile app and device management, to cloud networking – that are needed to enable the delivery of comprehensive and personalized mobile workspaces. The mobile and cloud era is marked by the rapid emergence of devices, app platforms, millennial generation, social media and globalization that are driving dramatic changes in how IT organizations respond. With 61 percent of information workers today now working outside the office2 and using an average of three or more devices a day for work purposes3, and 72 percent of workers feeling unequipped with the technology necessary to get their jobs done outside the office4, organizations are struggling with how to embrace business mobility. Moreover, technology decision makers are seeing security challenges in how to provide technology to these workers, with 67 percent expressing concerns about data protection on mobile devices5. Today’s forward-thinking IT organizations are leveraging mobile workspace solutions from Citrix to enable seamless access to mobile, web and Windows apps, data and collaboration tools, while securely delivering services regardless of where or how they need to be accessed. As a result, they are achieving increased business agility and transforming the way their employees and customers work. Here are a few examples of how Citrix customers are leveraging the power of a mobile workspace: - Mobile workspaces deliver access to patient records. A large U.S. healthcare organization needed a solution to protect highly sensitive patient records while enabling clinicians and doctors to access documents from anywhere. With the implementation of a Citrix mobile workspace strategy, the organization is now able to meet HIPAA compliance requirements and deliver real-time access to critical patient information. - Mobile workspaces enable Department of Justice to meet compliance requirements. A state Department of Justice (DOJ) provides its employees, including law enforcement officers, with secure access to critical criminal justice information on mobile devices while meeting department and government compliance policies. Describing the technology as a “law enforcement game changer,” the DOJ highlighted that the Citrix mobile workspace solution has enabled them to increase productivity across multiple departments. - Mobile workspaces enable collaboration. The need for secure mobility isn’t just limited to traditional businesses. An elementary school leverages Citrix collaboration technology to hold classes during a snowstorm to keep from tacking on make-up days at the end of the school year. Teachers were able to broadcast the scheduled lessons to their students via iPads, allowing the students to attend classes from home in a safe and secure environment. “Mobile workspaces are playing a key role in addressing the new organizational imperative around secure mobility,” said Mark Bowker, senior analyst, Enterprise Strategy Group. “The Citrix mobile workspace solution addresses these needs by providing security and control for IT, while giving employees the flexibility to work from anywhere, on the device of their choice with access to all the apps, data and collaboration tools they need to work like they are in the office.” “Citrix has been providing customers access to apps and data since it was founded 25 years ago,” said Steve Daheb, chief marketing officer, Citrix. “As technology has become a seamless part of people’s work and personal lives, Citrix has removed the barriers for secure delivery of apps, desktops, files and services to any user, on any device, anywhere. The variety of examples from our customers speak for themselves. Each of them is leveraging the industry’s most complete mobile workspace solution from Citrix to empower people to choose when, where and how work gets done, giving them a new level of freedom, flexibility and choice that is helping organizations to succeed in this dynamic and transformative mobile era.” Mobile Workspace Strategy and Innovation at Citrix Synergy 2014 The Citrix Synergy™ conference will take place May 6-8, 2014, at the Anaheim Convention Center in Los Angeles, California. This global event will provide strategic insights into mobile workspaces, including: - Mobility strategy: BYOD, flex-work and telework, secure app, data and device mobility, business continuity, security and compliance - Mobility in key industries: healthcare, financial services, education, public sector - Mobility technologies: enterprise mobility management, desktop and app virtualization, secure data sharing, app stores, cloud networking and public/private/hybrid clouds - Blog: Mobile Workspaces Enable Organizations To Keep Up With a Changing Workforce - Blog: Mobile Workspaces – The Future of Work (and Life) - Video: Mobile Workspaces Offer New Ways to Work - Infographic: Mobile Workspaces Enable People with New Ways to Work Citrix (NASDAQ:CTXS) is a leader in virtualization, networking and cloud services to enable new ways for people to work better. Citrix solutions help IT and service providers to build, manage and secure virtual and mobile workspaces that seamlessly deliver apps, desktops, data and services to anyone, on any device, over any network or cloud. This year Citrix is celebrating 25 years of innovation, making IT simpler and people more productive with mobile workstyles. With annual revenue in 2013 of $2.9 billion, Citrix solutions are in use at more than 330,000 organizations and by over 100 million people globally. Learn more at www.citrix.com. This release contains forward-looking statements which are made pursuant to the safe harbor provisions of Section 27A of the Securities Act of 1933 and of Section 21E of the Securities Exchange Act of 1934. The forward-looking statements in this release do not constitute guarantees of future performance. Those statements involve a number of factors that could cause actual results to differ materially, including risks associated with the impact of the global economy and uncertainty in the IT spending environment, revenue growth and recognition of revenue, products and services, their development and distribution, product demand and pipeline, economic and competitive factors, the Company’s key strategic relationships, acquisition and related integration risks as well as other risks detailed in the Company’s filings with the Securities and Exchange Commission. Citrix assumes no obligation to update any forward-looking information contained in this press release or with respect to the announcements described herein. The development, release and timing of any features or functionality described for our products remains at our sole discretion and is subject to change without notice or consultation. The information provided is for informational purposes only and is not a commitment, promise or legal obligation to deliver any material, code or functionality and should not be relied upon in making purchasing decisions or incorporated into any contract. Citrix®, XenApp®, XenDesktop®, XenMobile®, Citrix Sharefile®, NetScaler®, GoToMeeting® and Citrix Synergy™ are trademarks of Citrix Systems, Inc. and/or one or more of its subsidiaries, and may be registered in the U.S. Patent and Trademark Office and in other countries. All other trademarks and registered trademarks are property of their respective owners. 1 Gartner, Inc., Market Guide for Workspace Aggregators, January 2, 2014 2 Forrester Research Inc., Business Technographics Application and Collaboration Workforce Survey, Q4 2013 4 Forrester Research Inc., Business Technographics Telecom And Mobility Workforce Survey, Q2 2013 5 Forrester Research Inc., Business Technographics Security Survey, Q2 2013 Traditional on-premises data centers have long been the domain of modern data platforms like Apache Hadoop, meaning companies who build their business on public cloud were challenged to run Big Data processing and analytics at scale. But recent advancements in Hadoop performance, security, and most importantly cloud-native integrations, are giving organizations the ability to truly gain value from all their data. In his session at 19th Cloud Expo, David Tishgart, Director of Product Marketing ... Oct. 24, 2016 10:30 AM EDT Reads: 2,524 SYS-CON Events announced today that StarNet Communications will exhibit at the 19th International Cloud Expo, which will take place on November 1–3, 2016, at the Santa Clara Convention Center in Santa Clara, CA. StarNet Communications’ FastX is the industry first cloud-based remote X Windows emulator. Using standard Web browsers (FireFox, Chrome, Safari, etc.) users from around the world gain highly secure access to applications and data hosted on Linux-based servers in a central data center. ... Oct. 24, 2016 10:30 AM EDT Reads: 2,080 SYS-CON Events announced today that Cemware will exhibit at the 19th International Cloud Expo, which will take place on November 1–3, 2016, at the Santa Clara Convention Center in Santa Clara, CA. Use MATLAB functions by just visiting website mathfreeon.com. MATLAB compatible, freely usable, online platform services. As of October 2016, 80,000 users from 180 countries are enjoying our platform service. Oct. 24, 2016 10:30 AM EDT Reads: 816 Virgil consists of an open-source encryption library, which implements Cryptographic Message Syntax (CMS) and Elliptic Curve Integrated Encryption Scheme (ECIES) (including RSA schema), a Key Management API, and a cloud-based Key Management Service (Virgil Keys). The Virgil Keys Service consists of a public key service and a private key escrow service. Oct. 24, 2016 10:15 AM EDT Reads: 1,054 SYS-CON Events announced today that eCube Systems, the leading provider of modern development tools and best practices for Continuous Integration on OpenVMS, will exhibit at SYS-CON's @DevOpsSummit at Cloud Expo New York, which will take place on June 7-9, 2016, at the Javits Center in New York City, NY. eCube Systems offers a family of middleware products and development tools that maximize return on technology investment by leveraging existing technical equity to meet evolving business needs. ... Oct. 24, 2016 10:00 AM EDT Reads: 4,482 Effectively SMBs and government programs must address compounded regulatory compliance requirements. The most recent are Controlled Unclassified Information and the EU’s GDPR have Board Level implications. Managing sensitive data protection will likely result in acquisition criteria, demonstration requests and new requirements. Developers, as part of the pre-planning process and the associated supply chain, could benefit from updating their code libraries and design by incorporating changes. Oct. 24, 2016 09:45 AM EDT Reads: 1,682 The best way to leverage your Cloud Expo presence as a sponsor and exhibitor is to plan your news announcements around our events. The press covering Cloud Expo and @ThingsExpo will have access to these releases and will amplify your news announcements. More than two dozen Cloud companies either set deals at our shows or have announced their mergers and acquisitions at Cloud Expo. Product announcements during our show provide your company with the most reach through our targeted audiences. Oct. 24, 2016 09:15 AM EDT Reads: 4,660 Fact is, enterprises have significant legacy voice infrastructure that’s costly to replace with pure IP solutions. How can we bring this analog infrastructure into our shiny new cloud applications? There are proven methods to bind both legacy voice applications and traditional PSTN audio into cloud-based applications and services at a carrier scale. Some of the most successful implementations leverage WebRTC, WebSockets, SIP and other open source technologies. In his session at @ThingsExpo, Da... Oct. 24, 2016 09:00 AM EDT Reads: 2,307 SYS-CON Events announced today that Isomorphic Software will exhibit at DevOps Summit at 19th International Cloud Expo, which will take place on November 1–3, 2016, at the Santa Clara Convention Center in Santa Clara, CA. Isomorphic Software provides the SmartClient HTML5/AJAX platform, the most advanced technology for building rich, cutting-edge enterprise web applications for desktop and mobile. SmartClient combines the productivity and performance of traditional desktop software with the simp... Oct. 24, 2016 09:00 AM EDT Reads: 3,474 Fifty billion connected devices and still no winning protocols standards. HTTP, WebSockets, MQTT, and CoAP seem to be leading in the IoT protocol race at the moment but many more protocols are getting introduced on a regular basis. Each protocol has its pros and cons depending on the nature of the communications. Does there really need to be only one protocol to rule them all? Of course not. In his session at @ThingsExpo, Chris Matthieu, co-founder and CTO of Octoblu, walk you through how Oct... Oct. 24, 2016 08:15 AM EDT Reads: 3,143 SYS-CON Events announced today that Embotics, the cloud automation company, will exhibit at the 19th International Cloud Expo, which will take place on November 1–3, 2016, at the Santa Clara Convention Center in Santa Clara, CA. Embotics is the cloud automation company for IT organizations and service providers that need to improve provisioning or enable self-service capabilities. With a relentless focus on delivering a premier user experience and unmatched customer support, Embotics is the fas... Oct. 24, 2016 08:00 AM EDT Reads: 847 The Internet of Things (IoT), in all its myriad manifestations, has great potential. Much of that potential comes from the evolving data management and analytic (DMA) technologies and processes that allow us to gain insight from all of the IoT data that can be generated and gathered. This potential may never be met as those data sets are tied to specific industry verticals and single markets, with no clear way to use IoT data and sensor analytics to fulfill the hype being given the IoT today. Oct. 24, 2016 07:30 AM EDT Reads: 2,557 DevOps is speeding towards the IT world like a freight train and the hype around it is deafening. There is no reason to be afraid of this change as it is the natural reaction to the agile movement that revolutionized development just a few years ago. By definition, DevOps is the natural alignment of IT performance to business profitability. The relevance of this has yet to be quantified but it has been suggested that the route to the CEO’s chair will come from the IT leaders that successfully ma... Oct. 24, 2016 07:30 AM EDT Reads: 16,435 More and more brands have jumped on the IoT bandwagon. We have an excess of wearables – activity trackers, smartwatches, smart glasses and sneakers, and more that track seemingly endless datapoints. However, most consumers have no idea what “IoT” means. Creating more wearables that track data shouldn't be the aim of brands; delivering meaningful, tangible relevance to their users should be. We're in a period in which the IoT pendulum is still swinging. Initially, it swung toward "smart for smar... Oct. 24, 2016 07:15 AM EDT Reads: 933 @ThingsExpo has been named the Top 5 Most Influential M2M Brand by Onalytica in the ‘Machine to Machine: Top 100 Influencers and Brands.' Onalytica analyzed the online debate on M2M by looking at over 85,000 tweets to provide the most influential individuals and brands that drive the discussion. According to Onalytica the "analysis showed a very engaged community with a lot of interactive tweets. The M2M discussion seems to be more fragmented and driven by some of the major brands present in the... Oct. 24, 2016 05:45 AM EDT Reads: 11,381

Richard Sproat felt energized by the interdisciplinary research environment he found while working at Bell Labs and AT&T Labs. His desire to continue doing research in that type of setting was one reason Sproat came to the Beckman Institute and the University of Illinois in 2003. “One of the things that was always very nice about Bell Labs—which was quite different from what I knew the case to be in academia—was that I could walk down the hall and talk to an engineer, or a computer scientist or psychologist, all on the same hallway,” Sproat said. “You would never get that in a typical academic environment. So one of the things that was so appealing about Beckman is you do have people with all kinds of backgrounds and we really do work together. So it was really the interdisciplinary nature that was the pull here.” What the business world did not quite prepare him for was the juggling act that often comes with being a full-time professor and researcher at a place like Beckman. “One of the things I have to admit is that when I came to academia I didn't really know what the term busy meant,” Sproat said with a laugh. “It's not so much the amount of work; the issue is the number of things that I have to keep juggling at the same time.” A member of Beckman's Artificial Intelligence group who holds faculty appointments in both the Department of Electrical and Computer Engineering and the Department of Linguistics, Sproat has more than a half-dozen current research projects. Sproat's research interests center on various aspects of speech processing, as well as writing systems, and all of his work has a computational component to it. His interests include such topics as language modeling for colloquial Arabic speech recognition, named entity detection and transliteration for multiple languages, and prediction of prosody from text for affective speech synthesis. Sproat said the named entity detection project is one of two he is currently spending a lot of his time on. It involves creating software that can pick out the same words or phrases in streams of news texts from varying languages, including ones with completely different scripts such as Chinese and English. The other key project, funded by a Critical Research Initiative grant from the University of Illinois, is for developing methods for second-language fluency assessment. That project is part of a collaboration with Beckman colleagues Chilin Shih, Kay Bock, Brian Ross, and Mark Hasegawa-Johnson. They are looking at developing ways to assess and improve second- language fluency, an important topic in our increasingly global economy. There is hope the project will lead to a new center on campus for second language learning. If it happens, the center would truly be interdisciplinary, Sproat said. Bock is a psycholinguistic, Ross is a psychologist, while Hasegawa-Johnson tackles speech issues from an engineering perspective. Sproat said the second language project and a future center would have both research and practical implications that could lead to a quantitative measure of fluency and improve the teaching of second languages. “There's a whole bunch of issues out there to be investigated,” Sproat said. “This center could serve as a test bed for developing these kinds of ideas across the board.” This article is part of the Fall 2006 Synergy Issue, a publication of the Communications Office of the Beckman Institute.

Baku. 3 May. REPORT.AZ/ According to the protocol No 8 of the Supervisory Board of the AtaBank OJSC dated March 15, 2016 new organizational structure of the Bank has been approved, Report was told in the bank. Also the new structure of the Management Board of the Bank has been formed. Mr. Sabuhi Aliyev appointed to the position deputy Chairman of the Board of AtaBank OJSC. It should be noted that In 2006 – 2014 Mr. Aliyev worked in AtaBank OJSC, worked as director of the Legal Department. In 2014 - 2016 Mr. Aliyev worked in Synergy Group OJSC as director of the Legal Department, Member of the Board – director of the Legal Department and Member of the Supervisory Board. Mr. Aliyev has Doctor of Philosophy (PhD) degree in the area of law. Currently the Board consist of five members. Mr. Dayanat Guliyev – Chairman of the Board and the deputy Chairmans of the Board – Etibar Babashli, Emil Amirov, Rauf Huseynov and Sabuhi Aliyev. Functioning since 1993 AtaBank OJSC is one of the biggest commercial organizations of Azerbaijan. Today AtaBank is a hi-tech universal bank. AtaBank OJSC is functioning with 26 branches and divisions in Baku and in the regions of Azerbaijan. AtaBank OJSC is a universal bank rending full complex of services to corporate and private clients.

When I was twelve-years-old, the championship for my favorite song and video belonged to one-hit rap wonder Kwame's song "Ownlee Eue." The guy had style, could rap and also had some of the illest dancers and tightest beats to dance to like, ever. Thus, nearly 25 years later, it should be patently obvious why I (and you, too) should be very much of the belief that South Korean artist G-Dragon is the next great American pop superstar. If rap is going to be an intrinsic part of the future of EDM in the United States - and a combination of rap and EDM are at the vanguard of our idea of what constitutes the best of popular music - then it stands to reason that G-Dragon may soon become the most dominant star in American mainstream music. In what may be a glimpse of the future, Coup D'Etat, G-Dragon's latest album features producers Diplo, Baauer, and Boys Noize, as well as rapper Missy Elliott. Given these factors, as well as G-Dragon's flawless execution to date, all signs point to this album being where rap and dance connect for perfect synergy. How does a young man who lives 6,000 miles away from the contiguous United States put together an album that on the surface extols the virtues of what is perfect about rap and dance as the best pop music in this country for the current era? Psy. Answering the mega-successful "Gangnam Style" superstar is a simpler fix than contemplating its contributing factors. Foremost, while Americans may believe themselves to be post-racial, many are certainly not post-ignorant in understanding how the digital era has unified the globe across racial, cultural and intellectual lines. Both Psy and the possibly ascendant G-Dragon are signed to powerful Korean label YG Entertainment. Started by then-Korean pop star Yang Hyun-suk in 1998, the label has grown exponentially, seemingly following a model similar to legendary New Orleans-based rap imprint Cash Money Records. Add in the fact that Korean pop music has a very pop-driven and progressive dance-friendly flair, and the space exists for the powerful style that will more-than-likely affect Billboard's American charts sooner rather than later. If studying the rise of G-Dragon and wanting to understand how, by American terms, he's uniquely equipped to be a star, consider the idea that G-Dragon is the Korean equivalent of Lil Wayne meets Justin Timberlake meets Lady Gaga. Not unlike Lil Wayne being featured on tracks as early as the age of 13, G-Dragon was signed to YG Entertainment as a "trainee" at the age of 12. As a member of successful boy band BIGBANG, he reached the top of the Korean pop charts, and like JT has been successfully spun away from the band as a solo act. Even further, his interest in fashion and design along with a bizarre yet captivating androgynous look makes him an artist with a unique visual appeal, similar to Lady Gaga. Blend that concoction and amplify it with sounds like the trap-as-EDM of his latest single "Coup D'Etat," and you have something certainly worth time and consideration. Psy's role as a legendary Korean pop star who kicked open all of the doors in America is important as well. Prior to signing with YG Entertainment in 2010, Psy already had released four platinum-selling albums in Korea. By 2012, that number had reached six, "Gangnam Style" from Psy 6 (Six Rules), Part 1 being his most popular song of his career. YG aligning the red-hot Psy with Scooter Braun (of managing Justin Bieber fame) to assist with breaking him in America was an incredibly successful move. Somewhere between the portly rapper fulfilling every Asian stereotype that Americans had forgotten they'd loved since the era of Jackie Chan, a hook sung in English, a choreographed dance, and a video with infinite re-watch value, both Psy and "Gangnam Style" opened doors. In G-Dragon expanding the idea of what America has already come to expect from K-Pop artists, he possibly has more sustainable superstar potential than his South Korean label-mate. Insofar as his inspirations, G-Dragon counts the Wu-Tang Clan as arguably the most significant. Just as progressive EDM artists in America who have embraced rap to success have been fans of the genre long before ever becoming involved as artists, the same goes for their South Korean counterparts. A new age pure pop artist whose first inclination in hearing a pop track is how to handle it more like the ODB than Mariah Carey is intriguing. Add to this the fact that he also comes into the situation from a position of already being globally successful, there's a level of calm instead of thirst that informs their performance as well. Even though the artist may not be speaking English as a first language, confidence and charisma are physical traits that know no barriers in communication. When I was twelve-years-old, a rapper in polka dot pantsuits with a blond Gumby haircut reinvented the way that I imagined rap music. Now, similarly, a blonde-haired South Korean with a lot more happening on the fashion tip than big, bold circles could potentially run circles around an American hip-hop culture still slow to embrace EDM. Are these the #newrules that Jay Z was talking about? If so, I am all for them.

Feeling festive yet? The Docklands venue will host three days of festive fun from Thursday, November 19 to Saturday, November 21. Those who crave one of a kind gifts - or simply a break from the high street shopping scene - can pick up an array of gifts and food and drink goodies. Product exhibitors include Bamboo Pillow, Bottle Bling, Ethica Cosmetics and Cheese Mill. Foodie options also includes selections of fine wines, chocolate and luxury sweeties. Workshop sessions offer visitors the chance to get hands-on and creative with craft designs. To accompany the retail therapy, live band Synergy will be pumping out the festive tunes. Tickets to Simply Christmas include free entry into Stitching, Sewing and Hobbycrafts which features a giant knitted Christmas tree. From 10am-5pm, Nov 19-21, £8, Excel Also Online: How to get to Simply Christmas at The Excel

# CodePro AnalytiX CodePro AnalytiX is a product that assists developers, who use Eclipse-based IDEs, in delivering continuous quality improvement throughout the entire code development cycle. AnalytiX, with over 850 rules and metrics, delivers a rich se CodePro AnalytiX is a product that assists developers, who use Eclipse-based IDEs, in delivering continuous quality improvement throughout the entire code development cycle. AnalytiX, with over 850 rules and metrics, delivers a rich set of tools that analyze and improve your Java applications. Machine Gear Eclipse Plug-in The Discovery Machine Eclipse Gear Plugin is a wizard which aids a developer in calling a Discovery Machine Gear from Java code. This plugin launches a wizard within Eclipse that will gather information about a gear, and then generate and insert code into a Java editor to call that gear. Actuate BIRT is a commercial offering based on open source BIRT and benefits from the rich capabilities of the Eclipse platform and a very active community of users. Actuate BIRT provides the convenience of a one-button install, and support for production deployments via the purchase of Actuate-backed indemnification, maintenance, professional services and Mevenide aims at integrating Maven into Standard IDEs, focusing paritcularly to Netbeans and Eclipse. Eclipse version allows you to keep your POM and your project definition in synch, to run Maven from the IDE, allows to easily edit and validate your POMs thanks a MultiPageEditor, and provides Jelly editing capabilities. Commonclipse is an eclipse plugin for jakarta commons-lang users. It features automatic generation of the following methods using commons-lang builders: toString(), hashcode(), equals(Object), compareTo(Object). 2.x Extension for Eclipse Maven Integration for Eclipse provides tight integration for Maven into the IDE. Dependency management for Eclipse build path based on Maven's pom.xml, download required dependencies automatically, quick search for Ibiblio repository and launching Maven from within Eclipse. The jagzilla eclipse plugin is the eclipse module for jagzilla, which basically is a java based interface to the bugzilla database. Current release requires direct access to bugzilla database, release 2.0 of the plugin will be able to use the REST interface. boneclipse-logging adds classpath variables to your eclipse workspace to the four most common logging utilities (apache commons, log4j, logkit, jdk1.4) and allows menu-driven addition of logging statements to your code (including automated addition of static field and imports). Configurable decorator for icons and labels in Package Explorer and other views. Can be adjusted to decorate labels or colorize icons depending on substring matching (optional using regular expressions). Java2Html converts Java (and other) source code (complete files or snippets) to HTML, RTF, TeX and XHTML with syntax highlighting. Evolvica is a Java Framework for development of resp. experimentation with genetic algorithms. It can be used for fast creation of all (?) kinds of evolutionary algorithms and intends to provide a library of reference implementations of common operators. Note that Evolvica is designed as a stand-alone application aside of Eclipse but it can of course be used as a plugin inside an existing Eclipse installation. Turnhout is a eclipse plugin to search google. Right click on any word or selected text in the editor and click "Web Search". I have tested this only on Windows XP and Windows 2000. I don't know if it works on Linux Whats New (Version 1.1.1) [30 June, 2005]: * Added preference to change the Simteec is a small Eclipse plugin for easy code generation. It it based upon the velocity template engine. Code is generated by specifying a template- and a properties-file, which is needed to define the variables for the The COMPORSYS Code Generation Tool Plug-In for Eclipse empowers the Eclipse Platform to automatically generate J2EE Connector Architecture (JCA) CCI Record classes from Cobol Copybooks. Plug-in provides \'preprocess\' Ant task runnable in or outside Eclipse. Allows you to maintain multiple Java, XML, etc. source variants from a single source base, e.g., multiple project SKUs built on multiple Eclipse versions, without complexity of CVS branch/merge. This extension for Eclipse and IBM WebSphere Studio contains a wizard to create new methods in a class through a guided dialog. You can select from predefined method types, the parameters and exceptions. The frontend is inspired by the wizard in VisualAge which was no longer provided in Eclipse/WSAD Plugin for searching within the Eclipse workbench. Provides an extension-point for search pages and comes with three pages for searching preference pages, menu items and views. The CodeRelief Eclipse plugin generates the code for the equals(), hashCode() & toString() methods. All you do is select the class variables you want to include & VOILA, you have the code for the method. All this in the comfort of your Eclipse IDE. Nirvana is an open source email client written in Java, C, and C++. It is coded using SWT and SwingWT. The first in it's class. Nirvana combines SWT's native look and feel with outstanding graphics and an inuative user interface to create arguably the easiest to use email client ever. Packed with next generation features along side of old stand-bys, you'll find enough to keep you interested and enough to feel like it's an old friend. WOJ is a set of services giving access to projects documentations & sources without any settings in your IDE. WOJ power comes from its integration into IDEs and its ease of use. It can be used transparently even with your existing projects without any effort from your part. A plugin for the Eclipse IDE implementing NumericalChameleon: a powerful numerical convertor, supporting more than 2300 units in 78 categories (physics, radixes, exchange rates, unicode, etc). Fully integrated in the bluEclipse is an Eclipse plug-in reproducing most of the basic functions of the popular Java tool/editor BlueJ. It implements most of its functions like generation of UML-like class diagrams, instantiation of objects from the class diagram, inspection of classes and objects at runtime, invoking methods/library classes on demand etc. QuickREx is a regular-expression test tool. It gives you a view in which you can enter test-texts and try regular expressions. The expressions are evaluated against the test-text on the fly, matches are highlighted and you can navigate between the matches and contained groups. JInto is a plugin for Eclipse that lets the developer easily edit and maintain resource bundles (files that hold the localized strings for an application). It features parallel editing of all language versions (side by side), warnings when no text has been provided for a specific key, or when the text for one key is identical for different languages, and a search wizard to locate unused (strings that are defined but not referenced in the source code) and undefined (strings that are referenced, but not actually defined in the resource bundle) keys, as well as a "reference search" that shows where in the code a specific key is referenced. It has been tested under Windows and Linux. Eclipse 3.0.x is still supported by The Plug-In offers some tiny tools for working with HTML. Formatting: paragraph, bold, italic, underline, headings 1 through 3 Lists and Tables: bullet lists, numbered lists, conversion of plain text to lists or tables Links and images: links to local resources as HREF or IMG, capture image-contents from the system clipboard to local resource and generate a link to it Changes in 1.1.0. Multi Clipboard gives you a clipboard for text- and source-code editor contents that holds multiple entries. You can configure the plug-in to save the contents of your Multi Clipboard to a file when Eclipse is closed. Contents are then reloaded when Eclipse is opened. You can even configure the plug-in to enable editing the contents of the Multi Clipboard. RSS View is an RSS/Atom reader that keeps you always up-to-date. Unlike standard news readers, it is designed to integrate into Eclipse and coexist with your workbench. You have everything at one place. RSS View may also improve your development process by integrating your bug tracker, development forum or wiki directly in your IDE. Features include grouping and filtering news feed items, offline feeds, and several customizations. V1.3.0 improved user experience by adding an instant HTML preview (on mouse over) that replaced the tooltip preview. ConcernMapper is a plug-in for Eclipse that allows you to organize fields and methods into arbitrary modules called concerns. In brief, ConcernMapper allows you to reorganize the modularity of a software system in a way that suits your needs, without altering its "official" structure or behavior. It also allows you to keep a permanent record of the code associated with various concerns. yWorks is proud to announce the availability of yWorks Ant Explorer, a powerful tool to visualize and explore your Ant build scripts. Ant Explorer Benefits Ant build scripts can become hard to understand once they reach a certain "critical mass." Myriads of targets with Gordian dependencies or complex relationships of properties can easily spoil any attempts of maintenance for a developer. Core CSAPI is a set of Java class files that provide pure Java access to a Telelogic Synergy Server. Communications between classes and the server have been modeled after the Perl API provided by Telelogic, and usse the same entry point on server side. Basically it loosely tries to reproduce socket communications generated by the Perl API client. OpenRules, Inc. offers methodology, practical tools and services that enable business analysts to work in concert with software developers to create and maintain Rules-based Web applications with complex business and presentation logic. OpenRules is a full-scale business rule engine that is based on commonly used tools such as MS Excel and Eclipse and Open Source Libraries for Business Rules Management and Web Eclipse JarRetriever is a plug-in for Eclipse that allows developers to easily search for and download jar files from Maven repositories. The plug-in adds an "Add a Jar from the Internet" option to the right-click menu for each Java project. Selecting this runs a wizard which lets you search for a library, and shows all known versions. After you select the required version, it is downloaded to a location of your choosing and added to the project classpath. Not a plugin but a tool for managing Eclipse configurations. You probably have accumulated a number of desktop icons for running various copies of Eclipse using different command line parameters. This leads to clutter on the desktop and makes it difficult to share Eclipse configurations with colleagues. The eLaunch program was created to eliminate this clutter and to manage Eclipse configurations. Using the eLaunch program, multiple Eclipse configurations can be created and managed within a single tool. Legacy Composer is the first legacy application integration solution built entirely on the open source Java development environment Eclipse SDK with a singular design goal to simplify the integration of complex legacy applications across the enterprise. Legacy Composer is a flexible solution for real-time, non-intrusive integration of all legacy applications. ECalc is an Eclipse calculator plug-in for evaluating mathematical expressions. Features include command history, variables (including the automatic "ans"), bitwise operations, and some common mathematical functions. It is licensed under a BSD-style license. TotalAccess is a free and easy to use Eclipse (3.1.1/3.1.2) plug-in that allows you to create web automation and business process flow solutions. TotalAccess provides powerful and accurate screen scraping for web pages and 3270 screens. You can also use TotalAccess to develop web application testing solutions by recording user interactions and verifying results. TotalAccess lets you develop on one developer computer and deploy to multiple end user computers, with no licensing fee for either. The BIS Antidecompiler(tm) 2006 Plugin for Eclipse protects your Java source code from the recompilation and the reverse engineering and your algorithms and ideas from the plagiarism. In addition it also allows you to protect from decompilation evaluation versions of your Java applications. Refactoring Annotations convey information about the Extract Method refactoring in a more specific manner than most tools, especially when refactoring preconditions are not met. Eclipse Plugin that provides a GUI for dynamic language interpreters. It's extensible (via the Plugin system), so it's easy to add support for new interpreters. Support is available for JVM based languages like JRuby, When you are developing Eclipse Plugins sometimes you need to "spy" other plugins to learn "how they do it that amazing thing". For example: what classes use the Package Explorer View? What classes are involved in each item in the packages tree? What class launch the editor that you are using right now? How can I obtain the values in a StructuredSelection? What values has the ActivePart? Wicked Shell - A non-evil eclipse plugin providing an integrated shell. This plugin enables the use of the system shell directly from the eclipse IDE. It supports different shell types for Windows which are Cmd.exe, Cygwin's bash.exe and MSYS's sh.exe. Additionally, custom shell may be defined. FLABot is a fault-localization and debugging tool for Eclipse plug-ins, which is based on architectural information for aproximating those regions of code where faults are most likely originated. This is a joint project developed at the ISISTAN Research Institute (Facutly of Sciences, UNICEN University) and supported by Intel Corporation. Dynamic Slicing Tool for Java JSlice is dynamic slicing tool for Java programs. It collects and analyzes an execution trace (for slicing) in a compressed form. Dynamic slicing is a technique for program debugging and understanding. So, if during program execution, the values of some variables were "unexpected", the corresponding slice can be inspected to explain the reason for the SmartInspect is an advanced logging tool for debugging and monitoring .NET, Java and Delphi applications. It helps you to identify bugs, find solutions to customer problems and gives you a clear understanding of how your software works in different environments and under different circumstances. SmartInspect assists you even where regular debuggers fail: It is possible to easily debug distributed systems, multi-threaded applications, software on production systems and inspect software that runs at your customer's Allows you to format a whole Java package in one go. Only install this plugin when you are still using Eclipse 2.0. This functionality comes standard in Eclipse 3.0 and up. LangTags GCSP is a Eclipse RCP Tool for Google Code Search. GCSP Feathers: Run as Eclipse RCP or Eclipse Plugin. Display more results for one search. Search Java SubClass Search C# SubClass Filter C-Style Comments,Java Imports,Java Package,C#Using to saving your time. Inspector for Eclipse UI Inspector for Eclipse shows information for selected SWT controls, views/editors, perspectives, actions and associated data in the Eclipse IDE (Tags for Software Engineering Activities) TagSEA aims to be a robust, extendable framework with exemplary tools used for tagging and waypointing source code, resources, or whatever you would like within Eclipse. TagSEA began because of the fact that software projects represent a large amount of source code which can often be difficult to manage and navigate. Recent developments in the web have shown that the concept of tagging is effective for helping to find and navigate through interesting information on the web. TagSEA applies this concept of tagging to source code. But it does more as well. Scriptura is a high performance enterprise personalization solution that combines document creation, output production, multi-channel delivery and web application development into one easy-to-use software suite. The Scriptura Designer provides an intuitive, what-you-see-is-what-you-get design interface. Users design output templates and define conditional logic and production characteristics without the need to program. - Project Management Tool airTODO is a minimalist project management tool, intended for customer, project, module, operation, task and time management. airTODO composed as single file with both, client and server functionality, which can work with local and/or remote repositories. The goal of the Flexess project is to provide an extensible security framework for Java applications. The name Flexess comes from: FLEXible accESS. Flexess is a component-based product, which adds to the application access management capabilities. The solution allows to separate security aspects from the main application logic. traverse HTML documents, handle events, perform animations, and add Ajax interactions to your web pages. jQuery is designed to change the way that assistance,but does not support jQuery. Tikal Update Manager is a YUM-like graphical user interface, which wraps Eclipse and Callisto-format update sites, adding intuitive discover/install/update/remove functionality for Eclipse plugins & features and other bundled packages.

Are two minds better than one? The answer seems obvious but I've been asking myself this question throughout my life and could never find a definite answer. During my school years, both in high school and college, I've been invited to be part of study groups before big exams. At times I found them valuable but most of the time I avoided them as they were time consuming and ineffective. I've continued to wrestle with versions of this question throughout my professional life. As an IT manager I stressed the need for regular weekly management meetings but in the end, many of those meeting ended up causing delays and wasting time. Even now in my current life as a solo entrepreneur, I prefer to rely on my own brain to come up with ideas and sort things out. Lately, however, I started to realize the power of having two and sometimes three brains working together. Over the course of the past year I've been part of multiple Mastermind Groups and the benefits were quite immediate and significant. In this post, I would like to share with you why a Mastermind Group is such a key component for anyone who's serious about reaching big goals and why I would highly recommend it for anyone who wants to move their business, career, or their lives in a more focused manner. But before I get ahead of myself and talk about these benefits, some of you may be wondering: "What the heck is a Mastermind Group?" Simply put, it’s a group of like-minded individuals with a common interests who meet together (online or offline) on a regular basis to brainstorm, support, and assist one another in their business endeavors. It's important to note that a Mastermind Group is not a coaching session or a networking group. While a group can decide to bring in a paid facilitator or share leads and opportunities with each other, the primary focus of a Mastermind Group is the accountability support and brainstorming among the group members. Mastermind Groups have been around for a while now, but it only took off with Napoleon Hill’s famous book " Think and Grow Rich ". Napoleon Hill interviewed over 500 wealthy people to see if there were any common characteristics between them. He published his results as ‘Think and Grow Rich’, which became and still is a best seller. One of the key characteristics that all the people interviewed seemed to share is that they had a Mastermind Group. Hill describes a Mastermind Group as: "The coordination of knowledge and effort of two or more people, who work toward a definite purpose, in the spirit of harmony" "Now that's great,” you may be thinking, but... "Why should I start a Mastermind Group?" Mastermind Groups are a prime example of synergy: the total is greater than the sum of the individual parts. When you put two people together and have them work on a common goal, you don’t have two brains. Rather you actually have three; the third being a mixing of the first two brains... There is literally an exponential growth of creativity, ideas and suggestions as you increase the size of the group. (Though from my personal experience, a group of 3 people can hit the limit of efficiency so you want to weigh the pros and cons of a large group size) This new synergy also means that you get the opportunity broaden your own perspective and hear other people’s ideas. When you have a few like-minded people in your group and everyone is focused, you can get an overwhelming amount of great feedback. This is especially true when you start talking about your biggest obstacle or opportunity. Another major benefit of being part of a Mastermind Group is accountability. Putting your goals out there and sharing them with people who respect you can be a very strong motivator. We all get off track a little now and then due to busy schedule or lack of energy and for some of us it may take time to get back up to full speed. And if you're self-employed like me, you know how easy it is to put off goals, or justify not achieving them. In a Mastermind Group you feel accountable to your fellow group members and that keeps you from losing sight of your goals. * P.S. If accountability becomes a problem (i.e. people are not following up on what their promises), I always recommend using leverages. There are two types of leverages: sticks and carrots. Sticks are basically punishments while carrots are rewards. Tip: money can be a great stick (i.e. fine) and a great carrot (i.e. prize). Now that you know the benefits of being part of a mastermind group, here are a few recommendations of how to find a group and how to run it based on my personal experience. How to find (or start) a Mastermind Group? First, I'd like to mention that when I encourage you to think of a Mastermind Group, I don't necessarily want you to think of it as being a permanent, long-term group that is going to last forever. People stay in a Mastermind Group because they see value in it. When new commitments arise or and priorities start to shift, people may leave and you'll find new members or join a new group. So, like many things in life, it will probably go through a life-cycle. Just be aware of it and make sure that there is enough value for everyone. Now, the word 'value' is important here. You want to join a group or add people to an existing group that can add value to every other person. I applaud you if you want to help or teach others but a Mastermind Group is not the place for it. You're in this to grow. Make a list of people who share similar values to yours and that have massive potential to help you be where you want to be in the future. Be Picky. Look for people who have experienced levels of success and who are willing to make a sustained commitment to show up each time. And now the big question: How to run a Mastermind Group? There's quite a lot of advice out there about how to run a Mastermind Group, but after experimenting with different models, I settled on a process that has proven highly effective. The Mastermind Groups I facilitate meet at least once a month through Skype for approximately 45 minutes. We operate on a structured process that enables the participant to explore new ideas and commit to a course of action. It includes the following 3 main components: - Check-in: Time to say what we've been working in since we last spoke, indicate if we reached our last month's goals and share some success stories. - Feedback & Brainstorming: Time to provide specific feedback regarding reached and unreached goals and bounce ideas off one another in order to foster creativity and generate solutions to a problem - Goal setting: Time to set goals for the next month, announce our primary goal and set penalties for failing to attain primary goals. Finally, but not less important, we make sure we have fun with it. A few ideas, suggestions and recommendations - Each meeting focus on a different member of the group and review his or her biggest challenges/opportunities (Often referred as the "Hot Seat"). There’s also a lot of value that members get from listening to ideas and solutions generated for others. - During the Feedback & Brainstorming stage, try to focus on how to make the other Mastermind members more successful. - Set a few ground rules and be disciplined about your start and end times. - If the conversation starts to veer off course, make an effort to get it right back on track so that people feel it's worth their time to be part of these meetings. - After the meeting has ended, share your goals via email or through your online goals application for added accountability. - If needed, keep the dialogue going via email/phone in between meetings. You can also create your own email discussion list for free by going to groups.google.com. - Before you start a Mastermind Group, make sure you commit for an agreed period of time. I suggest that the minimum time should be 3 months. You need time to connect to one another, to form trust, respect and rapport. - Consistency is key. Keep to a regularly scheduled time and ensure all members are punctual. Note that if meetings are too far apart, momentum is lost. - Communication is important. If your Mastermind date is getting close and you haven't heard from everyone, make sure you send out something to the group. - Remember, all Masterminds have a lifetime. There will inevitably come a point where either you're Mastermind is scheduled to end or you just feel it's losing its effectiveness. You'll want to end it with positive tone. - It might be worth it for you to join (or start) more than one Mastermind Group. Simply pick a key area in your life and find the right people for the group. - Make sure your group is small enough to ensure that everyone can participate (I like to be part of a 3 person group). Smaller groups tend to work in a more cohesive manner. - Construct it in a way that EVERYONE in the group participates. - Start with success stories instead of failures. Positive atmosphere does matter. Something that help to set the right tone and mindset for the rest of session. - Hold all comments until someone finishes speaking. I usually write my questions and suggestions on a notepad while I listen to others. - If you conduct your sessions using Skype, consider using a free MP3 Skype Recorder to record mp3s of your calls. - Don't treat the Mastermind Group like a class. There is no need to lecture others. Instead, encourage everyone to work with each other like a peer advisory board. - Select at least one goal to be completed by the next meeting and hold others accountable for their goals. - It really helps if everyone shares similar values and it’s even better if they have similar interests (i.e. entrepreneurship, personal development, etc.). - Make sure you have a good facilitator. Masterminds are not half as effective if not well facilitated - time is wasted, agenda is not clear, conversations go off-topic, there's lack of follow-through, etc So, are two minds better than one? Like many things in life the answer is…it depends. I find that when there is a need to come up with new ideas or get feedback, the answer is yes. But when the need is to execute those ideas or to make a decision about them... well, the answer from my perspective is usually no. The essential idea I want you to take from this post is that utilizing multiple minds in the form of a Mastermind Group is extremely valuable and effective way to achieve your goals. Think of a Mastermind Group as a Board of Directors for your life, business, or both. Wouldn't it be fun to to have a group of advisors who are already doing what you're doing and who motivate you on regular basis? I'll let you answer it 🙂 Live Your Dreams! P.S If you're interested in me facilitating your own mastermind group or having a one-on-one mastermind session with me, please fill out the form in this link. This service is offered on a session-by-session basis AND the number of slots opened. Beside managing the structure for each session, I also provide advice, feedback, ideas, and resources. Tal is unbelievably reliable at organising mastermind sessions, and always ensures that we stay on-topic. Despite this, he's a lot of fun to speak to, enjoys a laugh, and possesses multi-disciplinary insight that's exceedingly rare. Basically, he's one of those people that you wish you could clone. Ashley Bloom I have been involved with a mastermind group that Tal initiated and was the key facilitator of. Tal has come up with a structure for these mastermind sessions that I found to be extremely effective and efficient. I found Tal to have great active listening skills and he was instrumental in keeping the sessions going and not exceeding the allocated time. Michael Ginsburg P.S If you found this article helpful, please forward it to someone you love and click the sharing buttons below. The world is a better place when people actively follow their dreams. Photo Credit: MIT OpenCourseWare

SmartCompany’s Smart50 Awards recognises Australia’s 50 fastest-growing small and medium-sized businesses and many of this year’s crop started off at home. One of those companies is Dynamiq, an international risk management firm which now turns over $25 million a year. The company counts helicoptering clients out of a blockaded Bangkok airport and accompanying media teams covering the Arab Spring amongst its recent projects. However, Anthony Moorhouse, the jet-setting founder of Dynamiq, founded the business around his kitchen table with start-up capital of $19,000 on the basis of solid business planning, sound financial principles and innovative strategies. “Those same factors have brought Dynamiq from the kitchen table into four continents and various countries including not only Australia, but the United States, Thailand, India, Papua New Guinea and many countries in Africa,” says Moorhouse. Similarly, Grace Chu founded her consultancy business FirstClick Consulting from home while pregnant. “When I started FirstClick consultancy, I was pregnant with my son at the same time,” she says. “I have always loved the synergy of how the company grows as my child grows but, as you might imagine, it was a stressful time when we first started out.” For the founder of E-Web Marketing, 25-year-old Gary Ng, it wasn’t working from his kitchen table but rather his bedroom that helped him keep costs down when he started up his business. “I worked from my bedroom “office”, surviving on instant noodles and SPAM sandwiches,” Ng says. Searching for an edge against his competitors, Ng’s bedroom fast became an all-day, all-night operation as he decided to set up a 24-hour hotline to design and put up posters for E-Web Marketing’s internet plans around universities and bus stops. “Manned solely from my bedroom, my hotline regularly got calls between the 3am and 5am, from people who had just seen my poster while waiting for the bus,” he says. “But those late night chats were worth it because they worked. “The money from our reseller program boosted E-Web’s cashflow to the point where I could invest more into other marketing initiatives.” Ng says these humble beginnings for his business helped him learn the value of doing less with more. To be eligible for the Smart50, companies must have revenue of more than $500,000 and must produce revenue growth in each of the past three financial years, with companies ranked on average annual growth over that period. Top spot on the Smart50 list was taken out by Audio Active Australia, which has recorded average annual growth of 262.5% over the past three years, and had sales of $6.1 million in 2011-12.

I bought some some about a year ago when they first came out.I also ended up using them thru-out my system. Plinius SA 100 MK III Bel Canto Pre-1 Audiomeca Mephisto II I have also tried a lot of cables out there and never heard as much effortles inner detail. Instruments and voices took on the most natural sound I have heard to date. I've found the Gabriel Gold ICs to be first rate. In my system, they beat Harmonic Tech and Cardas Neutral Ref, which I consider to b a tough wire to beat. The Gabriels brought out dynamic textures without adding brightness or glare. A terrific wire at a terrific price. I hope they come out with a speaker version. They seem to be made of the same gold alloy wire that a lot of other people are using. What kind of connectors are they using? Has anyone compared them to the other gold alloy based ICs like the z-squared? I have completely outfitted my system with Gabriel Gold Revelalation and Extreme IC'c and speaker wire. The sound is so lifelike and involving it's scary. Layers and layers upon music.Soundstaging,imaging and detail The GG's look and sound nothing like the Z-Squared and use a totally different material.(I owned Z-Squared about a year ago) I would have to say that cosmetically and sonically the only cable I have owned that came anywhere near the sound of the GG's were the Stealth Indra IC's. If you can get a hold of a pair of these great cables(build quality/sonics)I say go for it. They pop up now and then on auction direct from the designer and can usually be had for a steal. I picked up a pair of the Revelation interconnects and I could not believe what I heard. Natural timbre,detail with layers and layers of retrieval. These cables are truer to the music than any other cable that I have ever heard. I purchased a balanced pair at auction about a year ago as an experiment. IMO: They are excellent ICs and are well worth what I paid for them. I have recommended them several times on Audiogon threads for their high price to performance ratio. PS: I believe speaker cables are available but I haven't heard them. They sure are! I just got a pair of the Gabriel Gold Revelation interconnects and they are simply outstanding. Tonality and structure of the instruments and voice are nothing like I ever heard before. I actually didn't believe electronics could sound this true to the music.The best money I ever spent on any audio product. Just an update.I started this thread some time ago after hearing the Gabriel Gold Extreme interconnects. I now feel compelled to elaborate on the newer model called the Revelation 1.These cables to my dismay are even better. The depth and layering is off the charts.I still think my Extreme cables are up there with the finest in the world,but the Revelation 1 cables are simply a "Revelation".I still have friends bring other cables over and we do the comparison thing,but when all is done The Gabriel Golds always and easily come out on top. Who and where can they be purchased from....prices? Phillykid-check out the auctions or you can contact the designer thru his Agon site if you wish. His user name is sts I own two pair of the original Gabiel Gold interconnects and was shocked at the transpariency of these IC's. They are an instant change for the better. Open, detailed and just plain musical. I recently ordered two pair of the Gabriel Gold Extreme's from Steve and will post my findings after they break in 100 hours or so. Steve is about the music as are the Gabriel Gold IC's. After purchasing the Gabriel Gold Revelation through a recent auction I must say my expectations have more than been met. I set some lofty sights for this cable based on what I have heard from others that have bought it. Once these babies fully broke in I heard tonality like never before. There is no exagerated bass here! Complex drum passages.(Patricia Barber-Cafe Blue- track Nardis) take on a sacry realism.Articulation,speed and seperation are incredible) These cables are simply true to instrument character,voice and the recording. The cables excell at layering and removing congestion by simply allowing each instrument to sound the way it should .It is hard to explain but every little musical detail comes through so easily that you find your self hearing things that you never heard before. But not in an analytical way. No concentrating on the recording to hear it.It just happens! I think this is done because of the accurate reproduction of the instruments.I am still baffled(but who cares).I feel like I am listening to real music now. Looking to get more. These is no word for what the cables did for me. I am stupidly happy. What makes these cables different than a DIY pair that you can make yourself? Appears to be terminated with Eichman Bullet plugs and the signal wire Audio Metallurgy. I just don't understand the $$$ spent on these cables. Has anyone had any experience using them in full-range systems combined with tube SET amps? Reb1208 -These cables are nothing like a DIY cable. Have you seen them? or heard them? The wire is nothing like the Audio Metallurgy wire and the internal design is quite complicated. If you owned Stealth Indra,Nordost and Virtual then heard and seen these cables you would realize what a bargain they are. Just muy opinion on the sound,however regarding build quality,design and material this is a fact In my opinion the Eichmann connector is one of,if not the best out there.It does not interfere with the cable.The less interaction the better.Some people will pay big dollars for audio jewelry that looks beefy and sounds like @#$%. I love the forum for discussion,however,I am always bewildered when some who does not own,heard or seen a product in person always seems to have the keenest insight. I own the GG's and would say that the build quality and sound of these cables rival if not surpass anything that I have heard in 30 years.Stealth Indra could be considered DIY along with Shunyata and many other meticulously hand built cables. I have to agree. The forum should be a positive format for members to share information.For someone to make assessments of a product whether it be a cable,component,etc without any personal experience,knowledge of,or even information supplied by another member is not called for. "no soup for you" First of all, I meant no insult. DIY cables does not imply amateur build quality. In fact, often DIY cables are of the highest quality. My reference to the use of the Eichman bullet plug was one of approval. As was the use of a "similiar" wire made by Audio Metallurgy. A wire that is of a gold plated alloy construction. I'm sure the GB are well made and sound good, and use a proprietary alloy wire. Based upon the desription of the performance the GB cables produce, as documented in this thread. I hear a "similiar" presentation from my own DIY cables made from the Gold Alloy wire that is available here on Audiogon. Its easy to make conclusions about other cables but its a disservice to the designer and the folks who review this thread for 'authentic' info. To draw the following conclusion..."Based upon the desription of the performance the GB cables produce, as documented in this thread. I hear a "similiar" presentation from my own DIY cables made from the Gold Alloy wire that is available here on Audiogon". I would suggest you participate in the auction and try one for yourself and do the comparisons then report back. Its the more sensible thing to do than drawing conclusions. As for how it matches with a SET system, the GG fits an important requirement and that is speed without grain. This cable is quick has great PRAT and combine all this detail galore. An example, I played "the best of Mickey Hart" cut 7 Temple Caves and I could not believe the bass information. Its a real tease to hear not just the bass transient but the air and space as it resonates in the "room". SET's are not known for bass but the information is there and its wonderfull to experience. The Revelation IC is outstanding! I just ordered another pair. I'm considering some of these cables now. Besides Bobf's saying he prefers them to the Stealth Indra, could anyone else share their experiences? What cables did you compare the GG to? What areas did the GG's exceed the other cables in? Hi John-good to hear your east coast voice up and at 'em. To my ear and in my experience, the Gabriel Golds are the best cable on the market. I realize that's a bold statement, but I have had them in my system for a couple of years and have no intention of ever changing them. They are the most accurate, neutral, and perfectly paced cables I have heard. The extension and detail offered are absolutely grainless and full at the same time; this is, in my opinion, their strongest suit, although I can find no faults in any area. The bible black silence of the background is adorned with an accurately portrayed soundstage with mesmerizing 3-d characters....this fully rounded image is another of their strong suits. I have the Extreme's and have not heard the Revelations. If I wax and gush it's because....well. I wax and gush over them; they are what I have been looking for in an interconnect for 15 years. They give me a goofy grin just thinking about them and they are the only part of my system I never consider changing in all of my ever curious and obsessive participation in the madness that is this hobby. Prior to having them in my system it seemed I was always trying to make up for a shortcoming in one cable with a different cable in another position in the chain. The GG Extremes are now the only cable i have in my system (4 pairs). I have found that I really appreciate the sound of amalgams over pure metals whether flying solo or in combo (i.e. a copper hot and a sliver return). When properly alchemied, the amalgams seem to offer all the best of the pure copper, carbon, silver or gold cables without their individual shortcomings. To that end, I have long been a fan of Siltech, especilaly with my amps of choice, Plinius. Other cables that i have had include Stealth PGS (_XL, _3D) and Metacarbons, Analysis Plus Solo Crystal and Golden Oval, all of the G3 Siltech incluing SQ88 and FTM4sg, all manner of Cardas. Harmonic Tech, Acoutic Zen, DH Labs, Empirical Audio, Discovery, Zu Cable..anyway, those are the ones that I can recall without squinching my eyes and rubbing my templews with tiger balm or something like that. As for the terminations as mentioned above, some of my equipment won't accept the Eichhmann's because the rca receptacles are just too deep and won't allow the terminations to ground properly. I have one pair with the copper Eichmann's, one with the previous silver Gelco's that you see on Audioquest and two pairs that I had reterminated with Bocchino B7's. The previous Gelco's were great and I wish the Eichmann's worked in all my equipment, because if Steve says they sound better, then they do. He has a great ear and, from what I understand, a great group of audiophile friend's and connaisseur's that rule by blind democracry with sonic sound tastings and testings. Only the best of the changes survive and what has emerged is a tasty treat not only for the ear, but for the brain with an aural endorphin bonanza! There's magic in them there cables: that's it and that's that. Enjoy the tunes! WOW! Thank you so much for that very detailed reply. You defintely have wet my whistle. I will certainly have to investigate these cables further now. I've already been in contact with Steve about a pair of speaker cables. I'll probably look to try some interconnects now as well. Currently I'm using Jade Audio Gold and Vermeil interconnects and PAD Dominus speaker cable. To many power cords to even start mentioning, but the Stealth Dream is my current favorite. I'm just about tapped out from several equipment and cable upgrades over the last few months, but these cables certainly sound intriguing. I wish Steve had a website, so there was a little more clarification on his cable design, hierachy and pricing. I will have to sell some of my extra cables/cords and scrap up the dough to try some of these babies. They do sound like my cup of tea. One last question, about burn-in. Do they sound great right out of the box, or do they take a couple hundred hours to burn in? Thanks again Art, and happy listening. I would like to know if anyone can compare and contrast the new Synergistic Research Telsa cables to the Gabriel Golds. They both seem to be very solid and I'm wondering if the GGs will actually better the generally more expensive Teslas, which have also been acknowledged to be an exceptional value at their price point. My experience with the Gabriels is that they don't require the long break-in periods of some other ICs out there. Maybe 40 hours or even less compared to 100-200 hours that many other cables require. Perhaps other owners will post their break-in experience with these cables. geojap-i could extend my list of cables i have owned to another 10 or 15 pretty easily, all of which have been replaced with the gg esxtremes. granted, most of them not head to head comparison, but a fair number of the higher end ones were a/b'ed. you would likely bd beter off doing your own comparison and letting =us all know your results...enjoy the journey! john-no worries. we have exchanged some cable and gear a couple of times and i think our aural tastes are sort of similar. i think it would be worth you while to sell off some power cords and try some of steve's ic's. it would great to hear your impressions. anyway, right out of the box is damn good, but after a 200 hours or so, you'l be even more inpressed. i really don't think i have anything to add to the description taken in toto given by bobf and darealjaydee and myself. i do have a little jones for the revelations..... as oscar wilde sez, 'i can resist anything except temptation itself!' you would likely bd beter off doing your own comparison and letting =us all know your results. Budburma, I agree with you. That is going to be what happens, I think. excellent, geojap! i look forward to hearing what you hear! also, fwiw, your house remodel is an amzing testimony to how far we all can go to get the thing we're looking for. congrats, and rock on! your right, rja, 200 hours is more than you need, but 40 may be a little short for a full break in. but, it's one of those last few percent/rate of return curve things...... Okay.....I have now read all of your reviews on these cables...and if my cable man John McGrogan2 is looking into these then....my ears are open. I have been searching for a pair of 3m bired wired speaker cables to match my Rowland - Avalon set up for the past two years and nothing has interested me. Some of the prices are just plain insane.....so guys any idea what stev would charge for his cables ? ....and has anybody got his speaker cables ???? LOL, this is turning into some kind of a reunion here, running into Art and yourself in the same thread. So I'm your cable guy, huh Gary? I've been told that I resemble that Jim Carrey character at times. :) Actually Pat (Rx8man) first told me about the Gabriel, and he hasn't even heard them yet. I did e-mail Steve off-line and asked him about pricing for a custom pair of Revelation speaker cables. In his reply, he asked me what kind of terminations and how much I wanted to pay. I thought this was a bit odd, but I replied anyway. He told me he'd consider it and get back to me. Granted, that's not your typical cable company operating procedures, but I can't help but think that maybe these are not typical cables. There certainly is a lot of buzz, though I do admit to some trepidation, as I've never heard 'alloy' cables before. I've heard pure copper, silver and gold, silver clad copper and gold clad silver, but never alloys. I would recommend you just e-mail Steve, tell him what you are looking for, and see what he says. There doesn't appear to be any set price list anywhere. Art and Rja, thanks for the break in estimates. John and I go back to the prehistoric days when power cords were still in their infancy, talk about reunions !! There will be three sets of gold interconnects compared in my system within the next month, the Gabriel Revelations mentioned here and two others, should prove an interesting journey. jmcgrogan-I believe your pricing question may somewhat be addressed in an ad running in conjuction with the present auction. Pat, I await to hear about your impressions. I actually broke mine in twice, originally when I purchased them and then after double cryoing by Cryogenics International. Also, my pair are balanced, don't know whether that has any bearing. Darealjaydee, thanks, I've seen that ad. However, it only has a price for a standard 8 foot single wire pair. It does not address prices for bi-wire or longer/shorter lengths. Anyone looking for anything other than a 8 foot single wire pair will need to contact Steve. Like I said, I'm not sure even Steve knows the prices of non-standard lengths. That may be why he asked me how much I wanted to pay. :) jmcgrogan-I looked at the ad again, there is only reference to 8ft lengths in speaker wire pricing.There is pricing on bi-wire though.I know from experience that some manufacturers don't like making short runs.I got a 6ft pair of Gabriel Gold Revelations and it was not a problem. hey now, a rainy sunday and the terminals were humming@a-gon. steve is exceptionally easy to work with, but letting the customer set the price is on a different astral plane! rja-the gg's wire is already cryo'ed, did the aftermarket cryo treatment make a difference? pat-what are the other two gold cables? i have heard and compared the analysis plus and still own the gabriels. jade audio (thanks, john) looks interesting...i really do like amalgams though.... anyone tried steve's pc's? The other two are Jade Hybrids and KCI Au Pur79. regarding the pricing.I myself really appreciate that Steve tries to work with members if possible.I know he has set pricing on standard lengths and that the auction prices vary,but after I got 1 pair of GG's on auction and wanted speaker wire Steve tried his best to work with me.I've dealt with Steve enough to know that he works with people and is more than fair.I don't believe he let's customers set the price. Maybe he may ask "what I have in mind " to gauge my budget or needs.How hany other places can you get a product of this quality from some one who actually cares and tries to help.I myself hope that he continues to auction and works with folks instead of having the cables go into mass production with price increases. This is just my opinion I would say that the cryoing I did made little or no difference. Again, I bought the cables as an experiment so I did the cryo thing. I checked with Steve to make sure that cryoing was OK from a damage stand point. He suggested that additional treatment probably wouldn't make much difference and he was right. darealjaydee-right on! the gg's are fairly priced and steve is as helpful as he can possibly be, but he does (of course) have set prices. i was making a bit of joke by referring to that as another 'astral plane' and hope it wasn't taken poorly. Rx8man....kci? i'll have to take a look! thanks! I bought a GG Revelation IC for my headphone rig (CD->headphone amp, RCA) and I've been very pleased with the results. Steve was very helpful both before and after the sale, I felt completely safe all the way! I haven't had too expensive cabling in this rig before, so it's hard to compare with the top stuff out there at this point. It clearly beats anything I've thrown at it so far, but mind you those are all cheaper cables. The sound I'm getting is best described as natural, open, very detailed and somewhat warm and seducive. Don't think it's murky and muddy, quite the opposite.. Very crisp and clear, but still a bit of warmth to it! Listening fatigue doesn't exist at all, I can listen to this rig all days long without tiring. I ran into a weird situation when briefly testing the IC on a very high end rig that I've so far been unable to explain. Put simply, it was awful. It could just be that it needed to settle for a couple of hours, or it could be something else (hardware failure, severe mismatch with something else - I don't know). I'll be getting my long-awaited big rig in the few coming weeks and I intend to further explore the GGs then. :) Nobody mentioned they look great by the way, hehe.. Get them in the black jacket with gold stripes on, that looks great! They're also very easy to handle: flexible and extremely light. They weigh practically nothing! I was quite surprised by that to be honest. As for burn-in, I noticed marked improvements after a few days of continous play, so I'd say 75-100 hours before you do any critical listening. Still now, after 500+ hours, I think it sounds better than it did in the first week, so it continues to improve. Did anybody compare to Virtual Dynamics or Synergistic Research cables..? I will be comparing the Extremes to Virtual Dynamics Master ICs. osgorth-check out the post by budburma on 4/14/07 I think he's tried even more cables than me!Something must have been wrong with 1 of the components or something to achieve a result like you stated with the big rig?I've been communicating with a few members who have the GG's and one of the biggest strengths besides the sound seems to be their synergy with everything there hooked up with.The results you're hearing with the headphone rig is what you should have heard in the big rig system.I just had a friend over yesterday to listen to my all GG system and he was floored.Miles Davis was over having a beer with us or at least he was there in the room Bobf, yeah, I will certainly check this once I get my new rig delivered.. I told Steve too, I can't believe what I was hearing, it was nothing like what I experience with my headphones. I'll report back once the stuff gets here! Did anybody try the GG speaker cables by the way? Power cables? That should be an interesting a-b considering the differences in price,etc I've heard some good things about Virtual Dynamics and Jade.Some interesting comparisons are sure to come in the future it seems I didn't mean to insinuate that Steve is letting the customer set the price. He has his standard prices on his standard lengths. He doesn't have pricing on non-standard lengths though. That's why when I e-mailed him to ask what a 1 meter pair of Revelation speaker cables (monoblock amps) would cost, he e-mailed me back and told me he hadn't made a 1 meter pair yet. He then asked me "Did you have a price in mind?". I replied with my thoughts. Then he told me he would think about my offer and get back to me. That was on 4/13, as of 4/16, I haven't heard back from him though. So I didn't mean to infere that the customer was setting the price. I did find it very strange though for a manufacturer to ask me how much I was willing to pay though. That was a first, for me anyway. I haven't heard any Gabriel's yet, however, from reading the threads it would seem they are more comparable to the Jade and Stealth cables than to the Virtual Dynamics. I've owned Stealth, Jade and Virtual Dynamics, amongst many others. The Virtual Dynamics will sound more powerful and dynamic than the Stealth or Jade, but they are also have a more forward presentation that I did not care for. The VD cables also had less of a three dimensional stage, and didn't present the natural sounding instrumental colors and hues that I get from Jade, Stealth, and PAD cables. This of course is all just my opinion. I do know many VD fans who love that forward, dynamic and powerful sound. They love the excitement of that front row presentation. So it's all depending on your musical tastes. I would say that Virtual Dynamics is in an entirely different camp than Jade, Stealth PAD and from what I've read, the Gabriel's as well. Which camp you wish to be in is your call.

- In situ conservation, sustainable use of biological diversity and the fair and equitable sharing of benefits arising from the use of genetic resources are dependent upon properly maintaining sufficient natural habitat. Protected areas, together with conservation, sustainable use and restoration initiatives in the wider land-and seascape are essential components in national and global biodiversity conservation strategies. They provide a range of goods and ecological services while preserving natural and cultural heritage. They can contribute to poverty alleviation by providing employment opportunities and livelihoods to people living in and around them. In addition, they also provide opportunities for research including for adaptive measures to cope with climate change, environmental education, recreation and tourism. As a result, most countries have developed a system of protected areas. The protected-area network now covers about 11 per cent of Earth's land surface. Less than 1 per cent of the Earth's marine area is covered. The central role of protected areas in implementing the objectives of the Convention has been repeatedly emphasized in decisions of the Conference of Parties. They form a vital element of the various thematic programmes of work, namely, marine and coastal biological diversity, inland water ecosystems biological diversity, dry and sub-humid lands biological diversity, forest biological diversity and mountain biological diversity. - Given their many benefits, protected areas are important instruments for meeting the Convention's targets of significantly reducing the rate of biodiversity loss by 2010. However, according to the best available data on the status and trends on protected areas (see UNEP/CBD/SBSTTA/9/5), the current global systems of protected areas are not sufficiently large, sufficiently well-planned, nor sufficiently well-managed to maximize their contribution to biodiversity conservation. Therefore, there is an urgent need to take action to improve the coverage, representativeness and management of protected areas nationally, regionally and globally. - The Convention on Biological Diversity works with many partner organizations, conventions and initiatives in facilitating conservation and sustainable use through protected areas. These include the IUCN World Commission on Protected Areas (WCPA); the UNEP World Conservation Monitoring Centre (UNEP-WCMC); the International Maritime Organization (IMO); the World Resources Institute (WRI); The Nature Conservancy (TNC); the World Wide Fund for Nature (WWF); the UNESCO Man and Biosphere programme (MAB); the UNESCO World Heritage Convention; the Convention on Wetlands of International Importance especially as Waterfowl Habitat (Ramsar Convention); the Convention on the Conservation of Migratory Species of Wild Animals and the associated agreements; the Convention on Trade in Endangered Species of Wild Fauna and Flora (CITES); (EU) the United Nations Forum on Forests (UNFF); the Global Environment Facility (GEF), International Convention for Regulation of Whaling (ICRW); Food and Agriculture Organization of the United Nations (FAO); UN Convention on the Law of the Sea (UNCLOS); indigenous organizations, other stakeholders and industry; and various regional agreements and programmes. - The present programme of work on protected areas features goals and activities that are specific to protected areas. Some elements of existing programmes of work on forests, inland waters, dry and sub-humid lands, coastal and marine and mountain biological diversity as well as the Global Strategy for Plant Conservation and the Global Taxonomy Initiative also apply to protected areas. The goals and activities contained in these existing programmes of work should also be applied and implemented, as and whenever appropriate for their respective protected areas. Other relevant guidelines developed under cross-cutting issues of the CBD should also be taken into account when implementing the programme of work. - The World Summit on Sustainable Development, in its Plan of Implementation, has stated that the achievement of the 2010 target requires new and additional financial and technical resources for developing countries, and that the progress in establishment and maintenance of a comprehensive, effectively managed, and ecologically representative global system of protected areas is of crucial importance for achieving the 2010 target. The WSSD also called for provision of financial and technical support for activities in this field, recognizing that funding for this purpose generally should consist of a mixture of national and international resources and include the whole range of possible funding instruments such as public funding, debt for nature swaps, private funding, remuneration from services provided by protected areas, and taxes and fees at the national level for the use of ecological services. II. Overall purpose and scope of the programme of work - The overall purpose of the programme of work on protected areas is to support the establishment and maintenance by 2010 for terrestrial and by 2012 for marine areas of comprehensive, effectively managed, and ecologically representative national and regional systems of protected areas that collectively, inter alia through a global network contribute to achieving the three objectives of the Convention and the 2010 target to significantly reduce the current rate of biodiversity loss at the global, regional, national and sub-national levels and contribute to poverty reduction and the pursuit of sustainable development, thereby supporting the objectives of the Strategic Plan of the Convention, the World Summit on Sustainable Development Plan of Implementation and the Millennium Development Goals. - The programme of work consists of four interlinked elements intended to be mutually reinforcing and cross-cutting in their implementation. It was developed bearing in mind the need to avoid unnecessary duplication with existing thematic work programmes and other ongoing initiatives of the Convention on Biological Diversity, and to promote synergy and coordination with relevant programmes of various international organizations. Parties are encouraged to apply where appropriate the objectives and activities from these thematic work programmes and the work on cross-cutting issues. - The Convention's work on protected areas takes into account the ecosystem approach. The ecosystem approach is the primary framework for action under the Convention, and its application will help reach a balance between the three objectives of the Convention. Multiple-use protected areas applied in an ecosystem approach context can, for example, help meet specific goals relating to conservation, sustainable use and the fair and equitable sharing of benefits arising from the use of genetic resources. The ecosystem approach provides a framework within which the relationship of protected areas to the wider landscape and seascape can be understood, and the goods and services flowing from protected areas can be valued. In addition, the establishment and management of protected area systems in the context of the ecosystem approach should not simply be considered in national terms, but where the relevant ecosystem extends beyond national boundaries, in ecosystem or bioregional terms as well. This presents a strong argument for and adds complexity to the establishment of transboundary protected areas and protected areas in marine areas beyond the limits of national jurisdiction. Any work under this programme on marine and coastal protected areas should be consistent with decision VII/5 on Marine and Coastal biodiversity. - The programme of work is intended to assist Parties in establishing national programmes of work with targeted goals, actions, specific actors, time frame, inputs and expected measurable outputs. Parties may select from, adapt, and/or add to the activities suggested in the current programme of work according to particular national and local conditions and their level of development. Implementation of this programme of work should take into account the ecosystem approach of the Convention on Biological Diversity. In implementing the programme of work, Parties are encouraged to pay due regard to the social, economic and environmental costs and benefits of various options. In addition, Parties are encouraged to consider the use of appropriate technologies, source of finance and technical cooperation, and to ensure, through appropriate actions, the means to meet the particular challenges and demands of their protected areas. - The implementation of the programme of work will contribute to achieving the three objectives of the Convention. / A global network provides for the connections between Parties, with the collaboration of others, for the exchange of ideas and experiences, scientific and technical cooperation, capacity building and cooperative action that mutually support national and regional systems of protected areas which collectively contribute to the achievement of the programme of work. This network has no authority or mandate over national or regional systems.

Agni Energie ("AGNI"), a global leader in the field of renewable and alternative clean energy technology, has been awarded yet another contract in Malaysia to build its second biomass to energy plants in the state of Sarawak. The Grand Saline (Texas) school district is implementing $700,000 in facility enhancements to improve operations and efficiency in its buildings. TAC Energy Solutions will complete the work as a performance contract and guarantees that the district will save $40,000 in annual utility costs. New voluntary renewable energy option is now available to over 2.2 Million Virginia residential and commercial customers For the first time ever in Europe after hugely successful editions in North America and in Asia Pacific, Frost & Sullivan will be hosting the Growth, Innovation and Leadership Congress 'GIL 2009: Europe' on 19-20 May, at the Sofitel St James in London. Morningstar Corporation is pleased to announce the introduction of a solar string calculator on its website. The stimulus package announced by Australia's Prime Minister Kevin Rudd has missed opportunities to simultaneously improve Australia's sustainability in energy use and reduce greenhouse gas emissions, according to Western Australia's largest peak body for the sustainable energy sector. Western Australia's largest peak body for enterprises across the sustainable energy sector has welcomed an agreement between from Synergy and Carnegie Corporation that will create new renewable energy projects in Western Australia. Leading energy efficiency group Easy Being Green has strongly backed the Rudd Government's package to make homes more energy efficient by increasing the solar hot water rebate and providing insulation for 2.7 million Australian households. Evergreen Solar, Inc. (Nasdaq: ESLR), a manufacturer of STRING RIBBON' solar power products with its proprietary, low-cost silicon wafer manufacturing technology, announced today it has appointed Chinua Ejeka as Applications and Field Support Engineer for Europe. EnerWorks has made a bold statement of its commitment to solar cooling with its technology now powering the largest solar thermal heating and cooling installation in the world. The Geothermal Resources Council s extending an invitation to students to submit abstracts for presentation at its 2009 Annual Meeting in Reno, Nevada, October 4-7, 2009. Limited gas pipeline connectivity and rising natural consumption rate in the domestic market will force Spain to import more LNG in the coming years. New measures to stimulate the economy can also address energy security and greenhouse gas emissions, according to Western Australia's largest peak body for enterprises across the sustainable energy sector. Most accurate, consistent, comprehensive global wind dataset just a click away at 3TIER Web site The Dominican government signis an agreement with Sarasota, Florida firm Sunovia Energy Technologies for the installation of the country's first solar energy plant Records 16651 to 16665 of 19540 Solar & Wind - Featured Product The QuickBOLT is THE affordable mounting solution for Asphalt Shingle Roofs. Not only is it the lowest cost system in the industry, it also maintains the fastest install time of any mounting system available. Unlike other Asphalt Mounting systems that require bulky flashing, the QuickBOLT uses a small EPDM washer and is 100% waterproof! Part # QBKit2

Russian IPO Rollercoaster In 2011 domestically companies earned an estimated $10 billion from IPOs, says Vedomosti. The losses from postponed deals stand at around $7.3 billion, Kommersant reports. Ten Russian companies went public in 2011, with a half of placements taking place in London. Russia’s retailer Magnit and precious metals producer Polymetal Plc werethe only players that managed to gain from their secondary market placements overall. The time was right as the companies placed in December and October, when markets were positive, Andrey Amelin, strategy analyst at VTB capital explained to Vedomosti. The general trend was negative, as the companies going for either IPO or SPO have lost an average of 30% this year, calculates Amelin. Mechel, one of the country’s biggest steel-makers and miners, saw its preferred shares going down about 80% below their offer price. Meanwhile alcohol producer Synergy’s common shares lost 60%, Nomos Bank’s and food producer Rusagro’s wentdown by 50%. Even Yandex, the owner of the leading Russia language search engine, is currently being traded 20% lower than its IPO price, although it was the biggest 2011 placement and gained 40% in the first day of trading This was rather the result of a market meltdown during the second half of the year, than problems within the very companies, analysts agree. Russian companies made around 75% of their gains from placements during February – May 2011. “Further growth of the shares will be mostly the case of general investor interest in the Russian market, the oil prices and whether anti crisis measures by the companies will prove successful,” Andrey Chulak, a co-Head of Investment and Banking at Deutsche Bank, explained to Vedomosti.

Understanding Self is the key to developing human resource - Human Resource Development is definitely an activity which needs to be emphasised, understood and implemented in all earnestness and sincerity. - The major pre-requisite is the acceptance of the fact that each person has the basic potential to be a key resource in one way or another. The immediate corollary that emerges is that if the efforts of individuals are harnessed in such a manner that a positive integration (some call it synergy) takes place then there is no limit to the resultant achievements. - Humility has been an over worked virtue and may be that is why most persons tend to be very low-key in their assessment of people. Many people have a very low rating of their own potential and (not amazingly) have an even lower rating of others. - Transferred to the organizational setting such a person would be satisfied with a non- risk taking, low-profile style of working and would prefer taking a non-controversial stance on most issues staying immersed in routine activities performed in the way “perfected” over the last 25-30 years. - Many ask “Is change possible?” One way of responding to such a query is to ask the person to delve over the matter in two ways: one, quietly introspect and visualize one self over the years and them try to answer in what manner one has changed over the years And two, talk to a few close friends and spouse asking them as to how they have seen you over the years. - The key to understanding and developing others lies in understanding and accepting oneself - one’s values, attitude, way of behaving etc. The richness of the understanding which emerges from the abstraction of one’s own experience is tremendous. Almost like the emergence of a beautiful butterfly from its cocoon. One might be tempted to think about the unfounded fears which had prevented the emergence of such a joyous self. The extension of these abstractions of learning to the organizational situation would help in unblocking the immense unutilized potential of one’s sub-ordinates high lighting its vital role in helping to improve the inter-personal climate of the organization. Those learnings which are generated out of one’s own experiences would be the most potent ones for experimentation and implementation (followed by periodic evaluation and course correction). - The rationale behind this is that if one’s negative experiences can have such a lasting impact on one’s functioning the positive experiences would have an equal (if not more) impact. For example, the satisfaction and emotional closeness that is felt by members of a team that has successfully implemented a project on schedule. In moments of despair, recalling that experience would help in regaining one’s composure and hope of success .Here a note of caution would normally prevails as most of us have been conditioned to be stingy on appreciation & recognition the idea being to prevent the ego of people from bloating ! A way out is by taking small (and steady) steps instead of a mighty leap. The status quo (or whatever) will have to be gradually replaced; any drastic change will be viewed in a questionable manner. People would also like to test whether the new behavioural patterns displayed are stable ones or are they just a flash in the pan. The anomalous situation that developed in an engineering department is a good example. The manager attended a training seminar where the leadership styles were discussed and instrumented feed back was given. The instrument (questionnaire) was to be filled up by the manager (a) as he saw himself and (b) as to how he saw his subordinates perceiving him. After the seminar the manager came back and told his people about this questionnaire and its interpretation as applied to him. The parting shot was: “The findings reveal that you like me very much as your boss. So you had better start liking me!” - The respect of the subordinates has to be earned and will not be available on demand. It is a bringing-down-to-earth thought that the manager is at all times being critically watched by all the persons working under him. Any incongruous step -mismatch of thought words and behaviour - immediately produces ripples. This can be chanelised by the manager by being sensitive not only to self but by being perceptive what other people are saying (verbally and non-verbally.) - The person who has understood self (yet is not so obsessed with self to be blind to others) has taken the first step - recognized his own potential as a human resource .This unblocks his ability to channelise the potential of the human resources working with him in organizationally relevant ways. Let us all rise to the challenge of the times (recognized at the national level as evident from the formation of the ministry of human resource development) and work towards optimizing the utilization of the existing human resources at the same time preparing the human resources to tackle the challenges of the current century.

Windows Natural Scrolling and Synergy A little over a year ago, I wrote about setting up “natural scolling” on Windows. I tried it for a week or so and never quite got used to it. One of the biggest setbacks was the software I use to connect my Windows and Linux boxes together as one large desktop: Synergy. My mouse and keyboard are hooked up to a Windows box. When the mouse scrolls off the left side of the screen, Synergy takes over and passes the mouse movements and keyboard sequences to the Linux box’s desktop. I get what feels like a large, sweeping, cross-OS desktop. It turns out that the AutoHotkey mappings to reverse the scroll wheel did not get transmitted across to Synergy. They only worked on one half of my desktop. This is not just annoying, but really messes with your muscle memory of which way to scroll. I recently heard John Siracusa mention in a recent episode of Hypercritical that he is right-handed, but uses the mouse with his left hand. He switched mouse-handedness long ago because he started to feel the beginnings of tendinitis and/or carpal-tunnel syndrome in his right arm and didn’t want to see it worsen. Because I’ve been feeling tendinitis come and go, despite breaks and exercises, I thought I would try something similar. I feel that the majority of my discomfort comes from scrolling so I thought I would try using my left hand for the majority of scrolling and simple movements. I happen to have a spare Apple Magic Trackpad, which I brought into work and hooked up. I set it up to the left of my keyboard, but am keeping the mouse to the right. The trackpad is okay for pointing, scrolling, and clicking. Dragging and right-clicking are much more difficult (at least with the Windows drivers). For me, those are much more rare operations than scrolling and selecting — I mainly navigate specification documents and code trees — so the mouse is still available on the right. I initially tried this for a day and it mostly worked, except for scrolling. I’m so used to touch-scrolling on my Mac that the regular (non-natural? unnatural?) trackpad scrolling kept throwing me for a loop. AutoHotkey still did not work across Synergy. A little more research was required. The key to getting this working and usable was discovering how to reverse scrolling down at the OS level, rather than up in the application layer (as AutoHotkey does). There are actually just some registry keys to toggle in HKEY_LOCAL_MACHINE/SYSTEM/CurrentControlSet/Enum/HID that will reverse scroll-direction at a layer deeper than AutoHotkey and deeper than Synergy. I ran across this blog post that explains how to find the “ FlipFlopWheel” keys within the above-mentioned HID path and toggle them. This isn’t the solution for everyone — regedit can be a scary and dangerous tool in the hands of the uninitiated — but it worked for me. I now have a left-handed trackpad set up with natural scrolling for day-to-day navigation and a right-handed mouse set up for more tricky operations. So far, things are good.

Sundance 2014 Dispatch: GREEN PRINCE and A MOST WANTED MAN Yet two films at Sundance this year occupy similar kinds of moral space. The fact that one is a documentary, and one a fiction film based on a novel written soon after 9/11, makes the connection in some ways even more remarkable. Green Prince tells the story of a unique connection between two men. Mosab Hassan Yousef is the son of one of the founders of the Palestinian militant group Hamas. Arrested at the age of 17, he placed under the protection of Shin Bet, the Israeli equivalent of the CIA or MI6. There he meets his handler, Gonen Ben Yitzchak, who eventually turns him into a critical informant for the Israelis. It wouldn't do justice to the film to detail the back-and-forths that take place after this initial encounter, for much of the pleasure from the work delves from the surprise. Suffice it to say, there has rarely been a work, documentary or no, that so thoroughly details both the inner machinations of the Hamas operations, or the interrogation and handling efforts of the hyper secretive Shin Bet. For those on either side of the Palestinian/Israeli conflict there's much to learn from the film. Just as the Prince must make his way through a moral quagmire, fighting disillusionment at the cost of betrayal, so to does the film portray the situation in its many facets and complexities. Shot with a stark, almost noir look, the talking head interviews are intercut well, showcasing often the radically different perspectives each participant brings to the table. Yet it is their shared goals that are the most remarkable - it's easy, after all, to peg in the Middle East the many differences, much harder to find deep and abiding connections and similarities under the facade of conflict. In a fictional setting, A Most Wanted Man takes a similar tack, the betrayal of fathers in order to make what is for the sons a morally superior choice. Here we have two sons, one of a Russian military officer, one a spokesperson for Muslim charitable organizations, and we see how each much make a similar choice to that of the Green Prince in order to choose a better path. Anton Corbijn is perhaps best known as a photographer, having shot many iconic album covers, and here he brings his artistic eye to another post-cold war spy setting. Like his previous film The American, Corbijn's film feels a bit like a throwback, a deliberate and quiet film that nonetheless has loads of impact. With the likes of Rachel McAdams, Robin Wright and Willem Dafoe, we get a whole bunch of heavy hitting performances, providing the kind of rich drama that films like this thrive on. Yet it is on Philip Seymour Hoffman's shoulders that much of the film sits, and his disheveled, cigarette-fueled German spy character provides another of his inimitable sad-sack characters that he brings to the screen better than pretty much anyone. I was thinking the film had a very Le Carré vibe to it throughout, though I'm often comparing every spy thriller to Tinker Tailor for better or worse. When I saw that the screenplay by Andrew Bovell was based on one of Le Carré's later works it all kind of made sense. This isn't a Bourne film, this is all about sly glances and moments of procedure, a game of chess between players of different skill sets. As such, it lacks some of the fireworks that might be demanded of an audience, but it also lacks some of the rich, sophisticated character beats that Tinker pulled off so beautifully. As it stands, but Green Prince and A Most Wanted Man are decent films worth seeing. For me, however, it was this inadvertent synergy that in some ways elevated both, asking similar questions about loyalty versus duty, and how various institutions on either side prove to be more powerful and intractable than any ideology, be it good or ill. Separate, they're fine films, but seen in proximity, they may actually better than the sum of their parts. Do you feel this content is inappropriate or infringes upon your rights? Click here to report it.

BPA (Bisphenol A) is a chemical found in polycarbonate plastics, paper products, CDs and in the lining of many food tins. Animal studies have shown that exposing a male rat foetus to BPA can significantly alter its production of testosterone. BPA has association with breast and prostate cancer, infertility, Type 2 diabetes and obesity. BPA (BISPHENOL A) is a dirty word for anybody in the know. Essentially, it is a hormone disrupting chemical found in polycarbonate plastics (used in some baby bottles, office and drinking water bottles), paper products (receipts, toilet paper, newspapers, tickets, magazines, business cards), CDs and in the lining of many of our food tins. BPA is just one of a growing number of hormone disrupting chemicals that has permeated our everyday life. Of concern is that, unlike any other toxins that we’ve previously been exposed to, these chemicals exert their effect at levels far below what is considered to be harmful. Research shows that it is the timing and duration of exposure and not the dose that determines what impact these chemicals have on the body, which makes children most vulnerable to them. Like any hormone, the body is programmed to react to minute levels – levels that are typically found in everyday products. So the lower the levels, the greater the response. In contrast, at high levels, the hormone receptors in our body shut down altogether through a process known as receptor downregulation. Animal studies have demonstrated that exposing a male rat foetus to BPA can significantly alter its production of testosterone. The authorities’ way of regulating hormone disrupting chemicals, by providing acceptable limits in everyday products, is futile as these chemicals can cause serious adverse health effects at levels well below what is currently accepted. BPA has been banned in children’s products in Canada, France, Denmark, and the European Union because of its association with breast and prostate cancer, infertility, early puberty in girls, type-2 diabetes, obesity and attention deficit hyperactivity disorder. There are inherent problems with the way in which science evaluates hormone disrupting chemicals like BPA. Our regulatory authorities wait until there is concrete scientific evidence that an agent can cause harm, essentially waiting for the disease to occur in the population before they react. This underlying presumption of ‘innocent until proven guilty’ enables hazards to remain on the market where they may harm our (children’s) health. Asbestos and lead dust are two such examples. Just because there is insufficient scientific evidence to prove that an agent is harmful, doesn’t mean it is safe. Historically the problem may lie with technology. Setting a ‘safe’ level of chemicals in consumer products is meaningless as it does not account for the total exposure to thousands of chemicals in multiple products, let alone those in our food, air and water. These limits do not consider the impact of chemical synergy. For example if sodium lauryl sulphate – the foaming agent in your shampoo – combines with an amine (such as triethanolamine), it may result in the formation of nitrosamines which are carcinogenic. Disturbingly, you will find this combination in the majority of your personal care products. It fails to account for the fact that breastfed babies are at the end of the food chain. Numerous chemicals such as the pesticide DDT and polychlorinated biphenyls (PCBs) have been found in higher levels in a child’s blood in proportion to their body weight, than most adults. There is a misguided assumption that all products on our shelves have been rigorously tested for safety. While this may be so for the great majority of Australian made products, the importation of hazardous products is an unfortunate yet common occurrence. Part of the problem lies with the inconsistencies in Occupational Health and Safety laws, or lack of, amongst countries. Another issue is the lack of resources to check the hundreds of thousands of shipping containers that reach our shores. Consequently product recall is an ongoing phenomenon. Children are not adults, and yet these limits are based on adult exposure. Infants and children are inherently different from adults because they breathe more air, drink more water and eat more food relative to their body weight. They also have a higher metabolic and absorption rate, compromised immune system as well as a decreased capacity to detoxify and excrete chemicals. In addition, children are exposed to significantly higher levels of airborne pollutants when compared with adults because they put objects in their mouths and their breathing zone is closer to the floor. Children are uniquely susceptible to environmental pollutants and yet, despite this awareness, there is currently little or no legislation to protect children from these hazards. What we require is a radical shift in the way we assess new technologies coming onto the market and this can be achieved with the ‘precautionary principle’. It works on the premise that, if an agent cannot be proven to be completely safe, care or avoidance should be implemented. This is the underlying philosophy of building biology. Global warming is a prime example of the precautionary principle because the stakes of not acting – the extinction of the human race and every other species – are too high. Based on the precautionary principle, it is up to the companies who wish to bring new technologies and products onto the market to prove their safety before they are released on the market.

Constraints on Spontaneous Entrainment Past research has revealed that a person's rhythmic limb movements become spontaneously entrained to an environmental rhythm if a.) visual information about the environmental rhythm is available and b.) its frequency of the environmental rhythm is near that of the person's movements. Further, this research has demonstrated that if the eyes track the environmental stimulus, the spontaneous entrainment to the environmental rhythm is strengthened. Experiments were performed to investigate two hypotheses that could explain this eye-tracking enhancement of spontaneous entrainment. One hypothesis is that eye tracking allows for the pick up of important coordinative information at the turn-around points of a movement trajectory. Another hypothesis is that the limb movements entrain to the moving eyes through a neuromotor synergy linking the eyes and limb. Results of these experiments will help delineate the informational and dynamical constraints that can impact the acquisition of skilled actions. © Owned by the authors, published by EDP Sciences, 2011

The Balancing Act: Controls and User Interface by Terminus Zaire, Contributor — Category: Editorials As we anticipate the release of The Elder Scrolls Online, we expect Zenimax to make an effort on their part to ensure that the game not only meets our expectations as the greatest MMO of 2013, but is also a game befitting a place in the Elder Scrolls series. Combining the economic, cultural and mechanical game characteristics of an RPG into an MMO can be disastrous if the elements of the game aren't analyzed first. As the active community supporting TESO, it will be our job to give feedback in relation to these system mechanics to ensure that the game remains fun and popular as it lives up to its full potential. During the Beta, Zenimax will be mining the testers for information to ensure that all ES lore is taken into account, character response and depth is realistic, bugs or other mechanical issues are nonexistant, but most importantly: if the game balances out. Balance involves more than simply the strength of the classes and special abilities available to players when they first join the game. It can include the rewards from quests, the experience rates received from every skill available in the game, the power of specific weapons in relation to their rarity; the list goes on forever. The Balancing Act will be released prior to the Beta and once the NDA is lifted to discuss issues that will arise if The Elder Scrolls Online is designed with an imbalance in one particular aspect of the game, and how this will ultimately affect the entire game play as a whole. This series will discuss the warning signs of these imbalances, and what Zenimax can do to reverse or minimize the impact of the results of them. This issue, The Balancing Act will analyze one aspect of The Elder Scrolls that helped to define it as a series: the user interface and controls. While the history and lore of the Elder Scrolls is one of the most important qualities of TES, Bethesda has gained respect from RPers everywhere by being able to successfully design a UI that allows for nearly total game immersion. The control system of a game is what allows players to directly interact with the world they see around them. A broken UI and control system could be comparable to a broken leg; both leave you unable to interact with the world around you in the way you best see fit. When the system is damaged and doesn't let you reach your full potential, it greatly inhibits your ability to appreciate your experience and become immersed into the game. The controls will be relatively similar to that of previous Elder Scrolls games, although some changes have been made. Players will control their characters through the WASD keys, and your mouse controls the reticle that directs your character's view and direction. Your mouse is also your primary attack and block tool, with the E key being used for all general interaction with the world. You can still hold Shift to sprint using Stamina, but the ability to sneak has been moved to the Alt key; the Control key now allows access to the in-game menus and map, along with the customization of your hotbar. The T key allows you to quickly open your quest log, and the R key may be used for consumables during combat. Finally, a hotbar will utilize the numbers 1-6 on your keyboard for special attacks and abilities during combat. Matt Firor has claimed that, "…there are a couple of new moves, like a really fast left click then right click will stun someone, plus things like double-tapping a key to roll away” and there is speculation that other abilities will be added as well. Moving into the available menus and UI, the in-game menu will consist of a Main Menu tab, a Quest Journal, Character Settings, the Inventory, Skill Progression, and a Misc tab for other settings. While many people believe that no pictures of the actual user interface exist online, there are two available from videos that have been publicly released by Zenimax themselves. Although the quality is low, we can still get a more specific idea of just how minimalistic they plan to make the UI: I’d like to emphasize that the date these pictures were taken is unknown; they could have been taken the month they were published in June, or 3 years ago. We can tell that these images were taken moments apart though, based on the color of the clothes on people in the room. Based on the similarities between the design of the minimap when compared to the introduction videos, we can assume that the information we can obtain from them is relatively accurate. However, everything in the Alpha and Beta testing is subject to change, including the layout shown above. These images support the knowledge of the fact that the player chat will be located in the bottom left, and the minimap will be in the bottom right. Between these two will be the hotbar, along with the indicators for what consumable item, shield and/or weapon you have equipped. If engaged in combat, our magicka and stamina bars will appear in the top right corner of our screen (look closely at the second image). We’ll be able to see our opponent’s health at the top center of our screen, along with their hostility towards us and their combat level (see below). One of the most important and widely used tools that will be at our disposal is our minimap and compass. The ESO compass appears to be a cross between the styles of Morrowind and Oblivion/Skyrim in that it not only shows your location on the local map, but also identifies nearby points of interest and enemies in the area. This design is necessary due to the fact that players will need to be much more aware of their surroundings at all times, especially in PvP zones. If players aren't satisfied with the layout, rumor has it that we'll be able to move the different interface elements to anywhere on the screen. There will most likely be some who wish to use the old style compass regardless, so hopefully Zenimax has prepared a method to ease the concerns of these worried RPGers. One element that Elder Scrolls fans will love is the fact that we’ll be seeing a very similar control system to what we used in Skyrim. Although some small changes were made to the keys controlling sneak and opening your menus, the fundamental controls will help to ensure that TESO feels just like an Elder Scrolls game. While Zenimax has utilized the system already employed by Bethesda, they’ve also added their own spin by including the hotbar to implement new and original combat strategies into the game. Hotbars have never been featured in the Elder Scrolls series, but have become commonplace in nearly every major MMO on the market today. Although the hotbar will be a vital tool in every battle that players contend in, the mouse is going to be the primary tool for inflicting or preventing damage to our characters. Hotbars allow players to plan their battles more strategically, while the use of the mouse for live action combat allows for a deeper immersion into the battle itself. If one of these elements becomes more important than the other, battles could become purely spamming your abilities on your keyboard or breaking your finger by using your basic attack as quickly as possible. To ensure that this doesn't happen, the power of each attack style will need to be designed very carefully, along with how many resources in attributes each attack takes up. Communicating with your allies during a battle or during game play will be vital to your success as a team, so the chat bar and other communication systems need to be implemented flawlessly. Because movement and interacting with the world relies directly on your keyboard, a system must be devised to allow you to quickly switch from moving your character to communicating with nearby allies. There isn't very much information on the web in regards to the in-game chat, primarily because most of the Alpha testers have never mentioned it. Although this information is scarce, discussions in regards to communicating with your enemies during PvP in Cyrodiil have become increasingly common as the release of Beta testing draws closer. Because TESO will be incorporating pre-existing social networks such as Facebook or Google+, some speculate that we’ll be able to communicate using a built-in voice chat. Although everyone will be able to communicate with the chat box, voice chat would hopefully be reserved solely for friends and guilds if added. However, a conflict comes into place when we can’t talk to our enemies in PvP, but members of our guilds are from other Alliances. Allowing players to communicate with their enemy can have unexpected results, such as diplomacy between enemy guilds or abuse of the alliance point system. The final topic that I’ll discuss is one that has recently exploded with debate, and will probably stay a very important topic until Zenimax releases a statement with more information: first person view. While a first person view does already exist in TESO, many Elder Scrolls veterans became angered when they realized that it isn’t a true first person in that players won’t be able to see their hands and weapons. As someone who has played the past 3 Elder Scrolls games in first person, I can easily agree with the argument that having a realistic first person view is vital to roleplaying and total immersion. The success of The Elder Scrolls has been directly related to this immersion aspect, and Zenimax should be doing everything in their power to support it. However, MMO veterans understand that nearly every battle in TESO is going to be fought in third person because we’re going to need to be more actively aware of our surroundings. Based on the fact that Zenimax had no plans on improving the first-person view already implemented, it appears that they believed that adding a view of this nature simply wasn't viable. In Skyrim, there are hundreds of different weapon styles, varying from the material of the weapon to the weapon style itself. If you multiply this by the number of attack types you can do (normal, power attacks, running attacks, etc) it results in over 300 different attacks that your character can do. TESO will have all of these weapons and attack styles, but there will also be special abilities with the hotbar that you can use for all of those weapon types. This changes the number of attack styles from the hundreds to the thousands; and that doesn't even include Synergy moves! If Zenimax added in a realistic first person view, they would need to design both the third-person and first-person combat styles, eating up time and resources that could be used on more important aspects of the game. One option that's been mentioned that could fix this problem involves automatically zooming out to third-person view once you enter combat, but that would remove the point of a realistic first-person view altogether! Ultimately, Zenimax will be limited in their ability to create a balance between designing The Elder Scrolls Online as both an RPG for Elder Scrolls veterans and an MMO for hardcore gamers. While making their best effort to ensure the TESO plays just like the previous ES games, the basic mechanics that most players are used to will be turned on their head when we begin to incorporate a multiplayer design. Although Zenimax will be making an effort to update any aspects of the game that the players disagree with, their primary focus will be ensuring that the game's content is strong enough to provide players with years of entertainment. Cosmetic features such as a realistic first-person view and player housing are at the bottom of the list when it comes to core content updates. This is no reason to be discouraged! Zenimax is still working to ensure that all lore, basic combat mechanics, and everything that helps to make the Elder Scrolls a great series is still added; but only if the additions of these elements make sense. Personally I would love to see the addition of a realistic first-person view, but I'd much rather see Zenimax focus their efforts on the core game mechanics. It's important to remember that this doesn't mean that we as members of the community can’t disagree with their choices; it will be our job to provide Zenimax with constructive feedback on the creation of The Elder Scrolls Online to assist them in making it both the game we expect and deserve. It's their job to cater to us, the customers, and that may include focusing on parts of the game that the developers would have otherwise left alone. Thanks for reading! Feel free to discuss any of the information in this article, or anything related to the controls and user interface that will exist in TESO. Remember to follow all forum rules, and respect others' opinions that differ from your own. A new article of The Balancing Act will be releasing every Tuesday afternoon, so stay tuned for more in the future! The following 16 users Like Terminus Zaire's post: Alaxor, Atrox, dragonfell, Ewan, Frostmourne, Grall Noctrin, Infamous, Izzil, Knightmare, Kynareth, Najla, SNESSUKKA, Syntace, Tabbycat, Tajah, Vandalus |Comments on The Balancing Act: Controls and User Interface|

Archive for category Infections Unless you’ve been living under a rock (and even if you have) you can’t help but have noticed the headlines about all the viruses we’re seeing lately. Measles in Ohio – the largest outbreak in the US since 1996. Polio in Syria and Iraq – a resurgence of a once eradicated virus as war leads to a breakdown in the vaccination efforts. MERS – a second case reported in the US of a “new” zoonotic infection from the Middle-East. There was a whole session devoted to these “emerging” infections at the recent Pediatric Academic Societies meeting in Vancouver. There are many lessons that we can take away from these events. Firstly, that the well-fought victories we have won against vaccine-preventable infections are actually more of a fragile truce. Given enough of a susceptible population many of these viruses are ready to recur. Measles is an obvious example: probably the most infectious disease known to man, and a plane ride away from ongoing outbreaks in Europe and Africa. One of the most embarrassing exports from my homeland of England has to be the disgraced Andrew Wakefield (I won’t do him the honor of calling him a “doctor”) who pedaled fabricated data to support his efforts to sell a “safe” measles vaccine to a fearful British public. But what about polio? For the first time in years we have seen a significant increase in cases worldwide, as the safety of those administering the vaccinations has been threatened by war. Even as India can now claim itself Polio-free for the first time, I’m starting to wonder if and when we might expect our first case of imported polio to the US from the northern African countries or the Middle East, as the vaccine delayers and refusers leave us with an increasingly vulnerable population. Secondly, that the pathogens just keep on coming! The Middle Eastern Respiratory Syndrome virus is a coronavirus, only the sixth known to infect humans. It is entirely distinct from the SARS coronavirus, and we’re still trying to piece together exactly how humans are catching and spreading it. Thankfully human-to-human transmission seems to be inefficient, which is just as well as asymptomatic infection seems to be rare, and the mortality rate is about 40%! It’s just as well it has absolutely nothing in common with a virus that causes the common cold that could mean its transmission might become easier…oh, wait….never mind…. The third lesson I took away from the PAS meeting was just how adept we have become at chasing these infections down. Modern sequencing technologies allow us to send patient specimens from an outbreak of an unknown infection, and within a few days we can have a full-length genome sequence and a phylogenetic tree of its nearest and dearest. MERS was isolated in good old fashioned virus culture by a doctor in Saudi Arabia, then confirmed through collaborative efforts in the UK and Netherlands, and reported publicly through global mailing lists prior to publication. Infectious Disease doctors and epidemiologists are recognizing the ease of global spread of infection, especially novel infections, and the need to work together if we are to stay ahead of them. But it’s not just exotic imports we have to worry about. The epidemiology of infections in the Americas is changing too. Florida has already become a place where Dengue fever can be picked up without the need for a passport, and as our climate changes that may change too. I saw three cases of imported Dengue in Connecticut last year, and all we need is the Aedes aegypti mosquito to set up shop here and our imported cases can become local! (Chronic Dengue in Connecticut, anyone?) Just about the only positive thing to come out all of this, is that it’s pretty much guaranteed that my job will stay interesting for years to come. If there’s one thing that all Sci Fi nerds should know, it’s the catchy catchphrase of the cybernetic hive mind of The Borg – “Resistance is Futile”. True aficionados will recall the battle for Earth after the defeat at Wolf 359, where Captain Picard, captured and now “Locutus of Borg” was used by the Federation to destroy the Borg cube and save the Earth, proving that resistance, after all, was not futile. In the same vein, many people view treating bacteria resistant to antibiotics as a futile endeavor. But it’s not as simple as all that. In order to understand why, we have to break down what it really means when we label a bacterial isolate as “Sensitive”, “Resistant” or “Intermediate”. The core principle of bacterial resistance is the MIC, or minimum inhibitory concentration. The MIC is the concentration of a drug that will inhibit growth of that bacteria in the lab, in the old days tested using doubling-dilutions of drug and seeing which test tube the bacteria first grew in. The MIC was the dilution above that level (so if bacteria grew at a dilution of 1:32 but not in 1:16, the MIC would be 1:16). You can then give that value in terms of milligrams of drug. Now, here is the key point. When we state that a particular MIC corresponds to being “sensitive” we mean that for THAT BUG and THAT DRUG it will kill the organism in the BLOOD, assuming normal dosing. MICs cannot be compared between bugs. And more importantly they can’t be compared between drugs! You should NOT pick your drug based purely on the MIC that the lab reports out. In fact, a good lab will not report out the MICs, but will instead simply interpret them for you to say sensitive, resistant or intermediate (a weird concept, where the MIC is neither high enough to be considered truly resistant, but not low enough to be truly sensitive either – a clue that it isn’t a black and white interpretation). Unless you’re an ID doc or a pharmacist and you know what you’re doing, you have no need to know the MIC at all. The choice of drug should be based usually on the class of drug, and the location and type of infection you’re dealing with. I’d rather use oxacillin to treat staph with an MIC of 2 than vancomycin for the same infection with an MIC of 1, and I’d certainly never use rifampin by itself despite a potential MIC of 0.03. If the infection is in a different body location, especially somewhere like the spinal fluid or brain where the blood-brain barrier can prevent drugs from getting in, then the MIC doesn’t apply. If only 20% of your blood level of drug gets into the spinal fluid, knowing that your bacteria is “sensitive” to blood levels isn’t entirely reassuring. In fact, for some bacteria the lab will report out separate “meningitis” MIC levels to take this into account, and many drugs have “meningitic dosing” which is much higher that normal dosing (remember, sensitivity MIC refers to that bug, that drug, in the blood, using normal dosing). Some drugs don’t even get into the spinal fluid at all – you’d never use cefazolin to treat staph meningitis for example, although for almost every other type of infection it’s one of the best anti-staph drugs out there. The opposite may be true for urinary infections, as many drugs are concentrated in the urine, so urine levels may be 10-100 times the blood level, and even “Resistant” organisms will be killed. But when you’re faced with a nasty bloodstream infection, or a pneumonia, or cellulitis where the MIC is probably helpful enough, and it’s resistant, what can you do? It can depend on the resistance mechanism. Streptococcus pneumoniae has an altered binding protein, so simply swamping the bug with excessive penicillins might be enough to work. Staphylococcus aureus has a beta-lactamase that will destroy basic penicillins, and adding a beta-lactamase inhibitor will defeat that mechanism, or moving to a higher class of drug like a cephalosporin (first generation, of course). But what about tougher bugs with weird mutations, pumps that remove antibiotics from the bacteria or porin mutations that prevent the antibiotic from getting into the bug in the first place? Sometimes a higher dose by itself isn’t enough. With some of the beta-lactam drugs the important concept is “time above the MIC” rather than sheer dose of drug. If the MIC is 32 but you can get blood levels of 33 for 24 hours a day using a continuous infusion, that will be enough to kill the infection, even though using traditional dosing that would be considered resistant. Prolonged infusion is a halfway house to try to achieve the same end, and can also be used to extend the total exposure of the organism to the drug “area under the curve” of a graph of drug concentration over time. And you can also simply use higher doses, assuming the drug isn’t toxic enough to limit that approach. Incidentally this is why vancomycin is a crappy drug – sure, it kills MRSA, but the limits between effective and toxic are quite narrow, and you can’t increase the dose much at all without dinging the kidneys. Another approach is the use of multiple drugs at once, targeting different bacterial biologic mechanisms. Intuitively it makes sense – attack the cell wall AND protein synthesis, or DNA replication, and you ought to kill it off faster. Often this approach is not simply additive – there is synergy between the two drugs such that 1+1=4 when it comes to killing ability. Relatively inactive drugs like the aminoglycosides (gentamicin, tobramycin) or rifampin, can be very effective when paired with a beta-lactam or other cell-wall agent. I call them the SALT drugs. Synergistic Although Lousy Therapeutically. And you’d never eat salt by itself, always with something else….unless you’re a goat. One very interesting report of lab work with an old drug called colistin and vancomycin showed that if you put the two together, vancomycin could be effective against bacteria that it would normally have no activity at all against. The colistin punched holes in the bacterial membrane that allowed the vancomycin in to act on the inner cell wall. (WARNING – lab report only, do not try with real patients….yet…). So when we are faced with resistant organisms, it’s never truly a totally lost cause. There are always ways to try to optimize either the dose or the timing of doses to keep drug levels up, or combinations to try, or novel ideas. But there’s no guarantee of success, in the same way that even with sensitive bacteria there are still going to be treatment failures. Ultimately we need new drugs, and new drug classes. If we have to go up the development chain to counter old resistance mechanisms, all we’re going to go is promote the evolution of new resistance mechanisms. Even the newest anti-MRSA 5th generation cephalosporins are modifications of penicillin, when all is said and done. We really haven’t come very far at all. I joke that, as a Peds ID doc, it is my duty to say this at least once a day… Ok, I may not literally be slapping people upside the head, but there are certainly times when I’m doing it in my mind. The situation is common enough – a patient, parent or doctor, faced with symptoms consistent with an infectious disease, considers using antibiotics to treat bacteria. After all, we know that bacteria kill people, right? But in many of these situations the patient really has a viral infection – and viruses aren’t affected by antibiotics. So at the very least we’re wasting money and drugs. Worst case scenario? We’re promoting drug-resistant bacteria, antibiotic allergies and side effects – that in some cases can be life-threatening. But aren’t there clues to help us make the distinction? Real clinical signs and symptoms? Well, lets review a few. White pus on the tonsils Everyone is familiar with the feeling of an awful sore throat, and having a doctor peer down and having you say “Ahhhh…” What are they looking for. Probably something like this: This is a classic appearance of “Strep Throat” – a bacterial infection that aside from being painful in its own right can go on to lead to serious complications, such as rheumatic heart disease, kidney disease, a form of arthritis and a weird neurologic disorder called “Sydenham’s Chorea”. Fortunately it has no drug resistance so simple penicillin/amoxicillin will kill it (so if your doc tries to give you “stronger” antibiotics please feel free to slap them). The trouble is, this isn’t a picture of strep throat. I grabbed this from an article on “Mono”. Infectious Mononucleosis can be indistinguishable from strep throat, but antibiotics do nothing for it. The “pus” you see isn’t really pus, it’s just a nasty-looking white gunk your tonsils make. A bad sore throat can be caused by influenza, adenovirus, RSV, metapneumovirus, rhinovirus….you get the idea. It can be hard to tell strep throat from any of the other many possibilities, but in general if you DON’T have a runny nose or a cough, and the lymph nodes in your neck hurt then it’s PROBABLY strep. But it could be a virus. Strep tests and cultures help – and holding off on treatment until the test comes back is a sensible plan. What about ear infections? Another common bane of pediatrics (almost every young child I see with a prolonged illness has at some point been diagnosed with an “ear infection” before arriving at the correct diagnosis – I once saw a kid with a brain tumor get that diagnosis…). The symptoms are notoriously non-specific (ear pulling, fussiness, fever) and a good ear exam in a small, squirming child can be difficult! A crying baby can turn their ear drums pink…and voila! An ear infection! But even assuming your exam is good and the ear drum really does look nasty, how do we know its a bacterial infection? Despite the appearance of a rip-roaring otitis media (bright red, bulging ear drum, fluid behind it) it can be a viral infection too. Most of what you see is the BODY’S response to the infection remember. Clinical trials of antibiotic use have shown with without antibiotics, ear infections tend to get better just as quickly as with them. Complications from untreated bacterial infections do exist, and can be quite serious, but are rare. It is prudent to consider a “wait and see” approach to ear infections to see if it gets better by itself. I don’t want your kid to get mastoiditis any more than you do, but if it does happen I want it to be treatable with the best antibiotics! Most of the time when we’re treating ear infections we’re not even treating the child…we’re allowing the adults in the house to get a good nights sleep…;-) Cough, fever, patches on chest x-ray Pneumonia? Guess what. Usually a virus, at least in kids, before they become immune to everything. Without proper testing though this can be harder to tell apart, and we’re getting into the realm of “sick kid” here. Almost every doc will feel a little weird ignoring a possible bacterial pneumonia, even if they really do think its viral. But the high rate of viral infections, along with the risk of increasing drug resistance, is why the current recommendations for antibiotic treatment of pneumonia in children start with plain old amoxicillin. RSV, metapneumovirus, influenza, adenovirus – they can all cause pneumonia. In the Bad Old Days viruses like measles and varicella could also do it, and they were quite nasty! With symptoms like a runny nose, rash, lots of sick contacts, the chances of it being a viral infection are quite high. Sitting it out for a few days is again a reasonable option – because you know if you see a doc and get a chest x ray they’ll start you on antibiotics, and we don’t want that, right? Very high fevers, difficulty breathing, chest pain with pneumonia, coughing up junk – always worth getting checked out. All of us have at some point experienced symptoms of a sinus infection. Fever, pressure, tons of snot, headache. They are truly miserable things. I hear all the time how “we knew it was bacterial because he had green snot”. Sorry, but that’s not all that helpful. The greenness of snot comes from the cells your body is sending in to kill the infection, which will tend to be neutrophils whether it’s a virus or bacteria. (Neutrophils don’t really kill viruses, but they’re just reacting to the inflammation there). Neutrophils have the awesome ability to create highly-reactive chemicals, one of which is called “superoxide” which gets converted to hydrogen peroxide which then reacts with chloride ions in salt to produce….bleach. The green color you see is actually the neutrophils and the enzyme they are using to create the bleach (myeloperoxidase), not the infection itself. You’ll get green snot regardless of what’s causing the infection, and it’s a good sign – a sign that your immune system is in full swing. Severe sinusitis will produce lots of snot, for sure, but lots of snot doesn’t necessarily mean its a severe sinusitis, and certainly doesn’t prove it’s bacterial. If symptoms have lasted for a couple of weeks with no improvement, that’s a red flag for something non-viral. Fever is a normal immune response which effectively suppresses bacterial and viral infections. It hurts them far more than it hurts the patient. A fever by itself won’t necessarily cause any harm at all – and high fever may or may not indicate bacterial infection. A fever is just a clue – a reason to look and figure out what’s going on. One you’ve figure out it’s a virus based on symptoms (runny nose, viral rash etc) then you’re good. And don’t worry if fever keeps coming back, it will do that until the infection is gone, which may take a week or more. The height of the fever is only slightly predictive of the risk of bacterial infection – but influenza, adenovirus, EBV can all cause pretty good-going fevers of 102F and up. I’m far more interested in what ELSE is going on in addition to the fever. Febrile seizures, convulsions caused by fevers in young children, are more closely associated with a rapidly rising fever than a high fever itself. If your child has a fever of 104.5F and has sat there for an hour, chances are good they’re not going to seize from that. Addendum – Mark Crislip recently posted on fevers over at Science Based Medicine! So that’s a rough overview of the various common viral infections. It really is surprising how often we do get sick from something that will simply run its course. Our immune system is pretty robust. That’s not to say that in exceptional circumstances viruses can’t or shouldn’t be treated (herpes, influenza, chickenpox, measles, adenovirus, CMV and EBV all have some form of treatment to try even if the therapies are nowhere near as effective as antibiotics are on bacteria) but for respiratory infections in particular we would be far better served by reassurance that our symptoms are more consistent with a virus than a bacteria, and that most of the time it will sort itself out. A large chunk of the inappropriate usage of antibiotics stems from over-treatment of viral respiratory infections – so next time you see your doctor for something like this consider asking about tips for symptomatic relief rather than an antibiotic prescription. A few other studies: prescribing antibiotics doesn’t necessarily save time. Antibiotic overuse, even based on physician diagnosis, worse with criteria-based diagnosis. Understanding why physicians overprescribe – many different reasons. Good advice can be found on the CDC website. I have been told that I must credit my wife for originally coming up with the idea for the “IT’S A VIRUS” slapping Batman meme, and Quickmeme helped me create it. Ermahgerd! It’s MIRZAH! MRSA, affectionately pronounced “mur-sah”, and the abbreviation for “methicillin resistant staphylococcus aureus”, has become the epidemic of our time. Everyone thinks they know what it is. Few actually have a good handle on what it really means, especially with kids. MRSA was first described back in good old Blighty in the 1960’s, not long after the drug methicillin was released in an attempt to combat the rise in penicillin-resistant staphylococcus aureus. In the modern era methicillin is no longer available, due to kidney toxicities that are much less in the current selection of anti-staph penicillins (nafcillin and oxacillin), but the MRSA tag remains in use. In practical, and literal terms, it simply means that the organism in question is resistant to that particular antibiotic. Well, whoopdedoo. Lets just pick another. Except you can’t. The way in which staph becomes resistant to methicillin is through the production of an altered protein that renders the bug resistant to EVERY antibiotic in that entire FAMILY of antibiotics. Penicillin? Gone. Cephalosporins? Gone. Beta-lactamase inhibitors? Useless. Carbapenems? Fat chance. So you go to another class – quinolones, aminoglycosides, tetracyclines, sulfonamides – but none of them are especially active against staph and…wait for it….MRSA is often resistant to these drugs too. The first place in which MRSA was discovered was in healthcare settings – long-term care facilities and hospitals. The overuse and abuse of antibiotics selected for strains of bacteria that had acquired all sorts of resistance genes. In fact, the gene for hospital-acquired MRSA is a multi-segment behemoth that carries with it all sorts of additional genes, so the whole lot are inherited together. MRSA infections were associated with severe, invasive disease and death, usually in adults already weakened by other diseases. Due to delays in starting the right treatment, and being forced to use second-line, less effective drugs like vancomycin, MRSA infections add to hospital stays and healthcare costs. Like to the tune of $60,000 apiece. Just as the world was getting used to dealing with MRSA in hospitals, we started hearing about it in the community. People were showing up with skin abscesses, boils and other infections that were, in about half of cases, growing out MRSA. Worse, they didn’t seem to have any link to the typical risk factors of diabetes, renal failure, cancer, prolonged hospital stay etc. And even more scarily, this was being seen in kids. But they’re different from the old hospital-acquired MRSA cases. The community MRSA gene cassette is far smaller, lacking the resistance genes of the hospital MRSA. We have a small, but reliable list of antibiotics to use to treat it. Invasive disease is unusual, skin infections are the norm. I have not, yet, seen a real hospital-acquired strain of MRSA in a child. I have seen a few kids pick up MRSA while in the hospital, but it’s always been the “community” strain brought in by visitors, family or other patients. Diagram of MRSA gene cassettes – hospital (top, types I thru III) versus community (bottom, types IV thru VI) Right now, I see a steady stream of kids with MRSA in my clinic and in the hospital. By far the vast majority are recurrent skin infections, often bouncing around various family members. Parents, reading up on MRSA online are understandably freaked out. Friends and relatives shun their kids, for fear of picking it up. Furnishings and furniture are steam-cleaned and thrown out, course after course of an antibiotic is given to treat each infection, but they never seem to go away. Even pets end up getting “swabbed” and tested in the lab, and yes, some are sent on their way as the presumed culprit. None of this matters. The truth of the matter is, while MRSA does indeed cause a good chunk of these kind of infections, it’s not got the hold on it. Just as many regular, sensitive staph (MSSA) cause these things. Fully one third of the population carries staph aureus on them – and clearly one third of the population is not suffering from recurrent skin infections. Carrying staph doesn’t mean you’ll get infections. And, annoyingly, you can test negative for staph from a swab (typically done from the nose) and still have infections elsewhere, such as the armpit, legs, or buttocks. We’re exposed to staph everywhere, all the time – and we mostly don’t even know it. That’s if we don’t have it already. The reason why the skin infections keep happening is due to an entirely separate set of genes, related to immune evasion and skin invasion, which although more common in MRSA are also in some MSSA. (They are, interestingly, mostly absent in the hospital MRSA strains.) The way to get rid of it, if the levels are high enough for these infections to keep happening, is simply to decolonize the skin. That can be done with chlorhexidine washes and bactroban nasal ointment (a two week protocol), but you also have to prevent re-colonization, a more difficult proposition. Bathroom surfaces need to be bleached, towels washed daily (paper towels for hand washing) and EVERYONE in the household needs to have this done. There’s no point focusing on little Johnny with his butt abscesses if mommy and daddy, who are carriers, give him a hug and spread it back. I never promise that with this approach staph will go away entirely. What we do know is that, if everything is done at once, you CAN eradicate staph at least temporarily from the skin. What we also know is that a third of the population carries staph….so wait long enough and you’ll get it again. I hope to merely reduce the frequency of outbreaks. In my experience…this seems to work. Except in situations where kids have severe eczema or other skin issues, or where they’re not following EVERY step of the plan, I generally don’t see these kids back again. So that’s prevention – what about cure? How should we treat these kinds of infections when they do show up? One drug that has seen a resurgence of late is bactrim – trimethoprim-sulfamethoxazole. A combination drug that is designed to inhibit the bacteria’s use of a chemical called folate which is a key component of DNA creation. It sounds good on paper, stop the bacteria from growing and it’ll die. In the lab, staph is often 99% sensitive or more (good odds when your risk of resistance to other staph drugs is around 50%!). The trouble is, in an abscess there is pus. And pus is basically dead and dying cells and bacteria. That’s a lot of DNA hanging around. Using bactrim in that setting is a lot like telling a farmer he can’t grow any more food, but putting him in a grocery store. He ain’t gonna starve any time soon. Bactrim also ignores the risk of strep, which are the other cause of skin infections and which are inherently resistant to bactrim. As such, deliberately targeting MRSA with this kind of approach actually results in MORE treatment failures than using a simple staph drug like cephalexin, even though that shouldn’t work with MRSA! You WILL get treatment failures with cephalexin too of course, and some with the other drugs like clindamycin, doxycycline etc. But it’s as if one should ignore the MRSA when planning your treatment. Drain abscesses (you usually don’t even need antibiotics if you do that) and then use a regular “skin infection” drug to minimize side effects and maximize your chances of success. These days we have NO ideal drug for empiric therapy of skin infections – but we certainly do worse if we panic about MRSA and try to tackle that first. Weird. Of course sick patients are a different matter – even though the risk of severe invasive disease is low, the consequences are dire. You should ALWAYS cover a very sick patient with vancomycin or other MRSA drug until you know what you’re dealing with. So I don’t panic about MRSA. I see it all the time. It’s annoying. It’s rarely dangerous. I know that if you focus on it to the detriment of the regular staph and strep you do worse. If someone is a carrier or has an active infection, good hand washing and covering any draining sites is enough to keep it at bay. No need to decontaminate entire schools just because a kid has been found to have MRSA. No need to put everyone on vancomycin if they’re not sick. And if they ARE sick, please don’t use vancomycin by itself, cos its a crappy drug and we only use it because we have to. Don’t bother swabbing just to check for carriage – positive results aren’t worth acting on unless the patient is sick (or, perhaps, due for surgery soon…that’s a whole other issue), and negative results are useless if the patient is actively infected. Deal with the infections, attempt decolonization, move on. Repeat if necessary. MRSA – it’s a pain in the butt. And not just for the patients. “No maternal history of herpes” When dealing with a newborn baby with a fever, those are words that strike fear into my heart. Wait, what? You said no maternal history? Yep, that’s right. Neonatal herpes simplex virus (HSV) is a topic that is full of counterintuitive statements, and far too much confusion. The wrong people get tested, the wrong people get treated, the wrong babies get worked up aggressively. When other docs diligently rattle off the “pertinent” aspects of the maternal history and clinical examination of the baby, in my mind I’m mostly saying “Don’t care, don’t care, don’t care….” before I interject and ask about test results that often haven’t been ordered. Based purely on a numbers game, thanks to things like vaccination and Group B Strep prophylaxis, many early onset infections in newborns have been reduced. There is simply less infectious disease hanging around. But as a result, viral infections like neonatal herpes are proportionately becoming larger players – in some hospitals it is as common as bacterial meningitis. And neonatal HSV is a killer. HSV comes in three distinct flavors – the least lethal is skin-eye-mucus membrane (SEM) disease. This is how many people expect to see herpes – a rash, typically vesicular (clear fluid-filled little blebs) and maybe some eye discharge or mouth sores. Most pediatricians, if they see something like this, appropriately freak out a little bit. SEM disease by itself isn’t too dangerous, and if treated properly is almost never fatal. Herpes is tricky though – in babies it can mimic other rashes, so you really do need a low threshold to consider it. ANY neonatal rash that doesn’t fit a normal neonatal rash (so know your neonatal rashes!) deserves a workup. There is nothing more sobering than to run a case of a neonatal rash by an ID doc and to have them tell you with complete sincerity that “You can save this baby’s life. Get them to an ER. Now.” Untreated SEM disease can progress to infection of the brain. The most obvious presentation is disseminated disease – which weirdly enough can occur before SEM disease…first week of life or so. The kids are sick – really sick. They can be in shock, bleeding, in liver failure and struggling to breath as the virus overwhelms pretty much every organ system. The problem here is that even faced with this situation bacterial infection is considered immediately, and herpes can still be overlooked or thrown into the mix as an afterthought. Again, good neonatologists and pediatricians will be all over this from the start, having experienced their share of disasters in the past. Disseminated herpes is mostly fatal without treatment – and even with therapy about a third will still die, many of the survivors left with significant disabilities. The last type of herpes infection is of the brain. Typically presenting later in the neonatal period (3-4 weeks of age, rarely later) herpes encephalitis of the newborn is devastating. Herpes causes a hemorrhagic encephalitis, meaning that it chews your neurons up into a bloody pulp. To a brain that has barely begun its developmental process, this is a disaster. Even if the baby survives they may be blind, deaf, paralyzed or have significant developmental delays. From how I describe it above you might assume it would be easy to spot these kids. Well, it is – once it’s too late. The success of treating HSV depends to a large extent on how quickly you can start acyclovir – one of the few medicines we have that can treat viral infections (it’s pretty much only used for HSV). Acyclovir can shut down virus replication, but does nothing for those cells already infected. The difficulty with HSV lies in the nuances of the medical history. Let’s try some armchair science for a bit. Would you, as a baby, rather get HSV from a mother who is having a recurrent outbreak of HSV, with low-levels of virus, and have her give you antibody protection through the placenta…or would you prefer to catch HSV from a mother who is having her FIRST outbreak (which may be without symptoms) with high-levels of virus and no antibody protection? Well, you may ask, how likely is that? The answer is Very. About 90% of all neonatal HSV cases come from mothers with no history of HSV. If your mom DOES have HSV and has a recurrent outbreak, the risk of transmission is about 5%. For a new case – its closer to 50%. Maternal history of HSV is relatively PROTECTIVE for the baby. But the focus is on the mothers who test positive for HSV during pregnancy. They get put on valtrex (an oral version of acyclovir which is well absorbed), when it has not been shown to sufficiently reduce transmission. They may get a C-section, when that hasn’t been shown to help either (except maybe in the case of active lesions at the time of delivery…and even then it’s unreliable). The mothers who are HSV-negative are ignored, when they are those at highest risk of passing HSV to their babies. In an ideal world, their sexual partners should be tested and if THEY are positive THEY should be put on valtrex to reduce outbreaks and educated about the risks. But the fathers aren’t the patient….so nobody does that. A big myth about HSV is that all babies with it look sick. Well, they do eventually – but to start with they look pretty normal. I have heard docs say that a baby looked “too good to tap” – meaning they didn’t perform a spinal tap to check for meningitis or HSV encephalitis. Or they don’t test sufficiently for HSV, or don’t start treatment with acyclovir while test results come back (these same babies are almost universally started on antibiotics for presumed bacterial infection). Published case series of proven HSV cases shown over and over again that babies with HSV present with relatively innocuous symptoms. “poor feeding” “fever” “sleepiness” before the more obvious symptoms of “shock” “seizure” or “respiratory distress”. Remember, by the time the baby is sick from HSV the damage has already been done, and you can only try to stop it from getting worse and hope the kid recovers. With bacterial infections we can kill them directly with antibiotics and the damage is usually secondary to the infection, and not because the bacteria are literally eating up your cells and blowing them apart as HSV does. Even with successful treatment, symptomatic HSV in babies has a slow recovery. So how do you deal with this uncertainty? You can’t trust the mothers history, you can’t trust the baby’s physical examination or symptoms…what do you do? My approach is to have a low threshold for suspecting HSV in neonates. ANY baby getting worked up for a possible bacterial infection needs to have a workup and empiric treatment for HSV as well. Babies with weird symptoms (especially rashes or neurologic symptoms) need to have HSV considered FIRST, before bacterial causes. HSV is not only potentially devastating – its treatable, and therefore the bad outcomes are preventable. Fortunately the Committee of Infectious Diseases of the American Academy of Pediatrics has published recommendations – albeit in a rather inaccessible set of paragraphs. I can summarize them here though: Spinal tap for HSV PCR of spinal fluid. Liver enzyme testing for disseminated disease – chest x ray if respiratory symptoms. Surface cultures from eye, mouth, rectum and any skin lesions. Start acyclovir – do not stop until all tests are negative. Do ALL of this this for EVERY BABY with suspected HSV. Repeat spinal tap on kids with positive CSF to ensure clearance after 21 days – continue therapy if still positive. A big mistake I see people making is in testing the spinal fluid to “rule out HSV” but do not doing the rest of the workup. Spinal fluid testing for HSV no more rules out SEM or disseminated disease than a urine culture can diagnose meningitis. I have seen cases missed (or nearly missed) because someone didn’t do the whole thing. You NEED the liver enzyme testing to rule out disseminated disease, and it matters. Treatment for simple SEM is 14 days – treatment for disseminated or CSF disease is 21 days. I have seen a handful of kids with positive CSF tests but with totally normal looking spinal fluid (eg no white cells, normal protein levels etc). The trouble is HSV, as bad as it is, isn’t all that common among the hundreds of kids you will see with suspected neonatal infection. And many of THEM will be obviously HSV. So many kids get a semi-workup and we get away with it because “whoops, the CSF is positive!” and you treat for 21 days even though you didn’t check the liver enzymes. But I’ve also seen the opposite – kids who were partially worked up and the diagnosis was missed, or delayed, or the severity was under-appreciated. All too often the “standard of care” let’s these kids slip through the cracks – which is inexcusable in my mind when there are experts who put it down in writing exactly how to work up these cases. So let’s raise the standard. Totally useless history: Mom has no history of HSV Mom got Valtrex Mom got a C-section Baby looks well REAL risk factors for neonatal HSV: Prolonged rupture of membranes Active lesions at time of delivery NO maternal history of HSV Age less than 21 days Seizures or lethargy “Sepsis” not responding to antibiotics (oops! too late! – better call your lawyer…) PCR/Culture of skin lesions, eyes, mouth, rectum Liver enzyme testing Chest X ray (if symptomatic) Acyclovir 20mg/kg/dose IV every 8 hours Until all tests are negative (typically 2-3 days empirically) 14 days for proven SEM disease 21 days for disseminated or CNS disease And if you’re not sure…get a consult… I was recently asked “what is a line infection?” and I realized that it would take more than 140 characters to explain everything about it. I also figured it would be a good topic to educate on, since as a whole line infections are very badly managed. Briefly, a line infection refers to a bacterial (or fungal) infection of a central line, usually in a vein but an arterial line could get infected too. The classic case is a catheter tip infection with bacteria in the bloodstream. The patient may have a fever, and may be quite sick indeed. One might ask; “How the heck does that happen??!!”. Actually, surprisingly easily. Lines can be infected from two ends – the outside end is open to the air and is accessed every time a medication or IV nutrition is put through it. If sterile technique is not used bacteria can get into the line. Heck, even with sterile technique bad luck plays a part too. These bugs are often skin bacteria that are normally fairly wimpy or considered “contaminants” when grown in blood cultures (meaning they were picked up from the skin as the needle went in, not that the lab contaminated them!). The inner end is safely inside a blood vessel, which is sterile, but if bacteria get into the bloodstream for other reasons they can stick to the plastic line, since bacteria as a rule LURVE to stick to non-biologic stuff. These can be any kind of bug, but are more likely to be bacteria from the gut who wandered off accidentally in the bloodstream and find a home there before the immune system can kill them off. Once a line infection is established, we have a problem. Plastic lines have no bloodstream and no immune system. Bacteria can produce slimely stuff (called a biofilm) that coats the infection and acts as a barrier to the immune system, and some antibiotics. Imagine smearing peanut butter on a table, then trying to get it off with your finger. Even after a good swipe you’ll leave a smear behind. Now imagine trying to clean it off by dripping detergent onto it. That’s what it’s like trying to clear a line of a line infection. The only way to guarantee clearing a line is to pull it out and put a new one in. Pulling a line is not a lightly-undertaken job though. If someone has a line they probably have a reason for it – long-term nutrition, chemotherapy, antibiotics etc. If you pull that line you may interrupt their usual doses, for days at a time. Line sites get scarred and if you do this enough you can run out of new sites to use! So it’s paramount to diagnose a line infection properly. Imagine the following: a kid with a line gets a fever. They come to the hospital and blood cultures are drawn from the line. They grow a staph aureus. OH NO! He has a staph aureus line infection right? Not necessarily. Blood drawn from the line is just blood – this could be any other staph bacterial bloodstream infection, such as from a bone or joint infection, endocarditis (infection in the heart) or something else. We need to know whether the line has more bacteria than the rest of the blood stream. This is where most people go wrong – you MUST MUST MUST draw multiple cultures, including a culture from some place else (and yes, this means sticking a needle in someone – suck it up). Ideally you need quantitative cultures, where you draw a fixed volume of blood then plate it out and count the colonies. If the line cultures grow significantly more than the periphery, it’s a line infection. If it’s the same, it is a bacterial bloodstream infection, but not a line infection. BIG difference. If you can’t do “quants” you can time how long the cultures take to turn positive in the lab. Most experts consider a difference of a few hours to be significant. Once you know it is a line infection, you can think about what you’re doing. Most people get started on broad-spectrum antibiotics to cover all the likely bacteria. Once you know your bug though, you can tailor therapy. Non-Aureus staph for example may actually be cleared using a couple of weeks of antibiotics. Enterococcus or staph aureus are tougher, gram-negative bacteria from the gut are even worse. Pseudomonas or candida/other fungi are practically impossible to clear, don’t even try. What’s the harm in trying? Time. You waste time. You have a kid sitting in the hospital getting IV antibiotics. You may send them home…and you may be able to show that the blood cultures turn negative….but you stop those antibiotics and WHAM the peanut butter smear you didn’t quite clean off has grown back into a big old dollop of yuck again. You’ve wasted 2 weeks at least, several days of hospital time AND now you’re back at square one and you have to pull the line you should have pulled two weeks ago. The two biggest errors I see people try with line infections are: not correctly testing for line infection with sufficient blood cultures; trying to salvage an unsalvageable line. People are fooled into thinking they have cleared a line infection, when in fact they may have been treating a bacteremia from another source and just THOUGHT they were treating a line infection. This reinforces the incorrect belief that clearing line infections is easy… I get consulted on these kids. I can rarely offer specific guidance unless the correct workup has been done. I have seen kids get lines out that I am sure were not infected, and I have seen kids treated for weeks for an infection that could have been cured with a 30 minute procedure to pull the line out. There are evidenced-based guidelines on this issue published by the Infectious Disease Society of America – ID docs KNOW how to manage line infections – and yet our guidelines, and our specific advice, is often ignored. Best reason I was ever given for not removing an infected line? “We can’t take it out, we’re using it for the dopamine”. Yeah, well maybe if you stopped using it the patient wouldn’t be in shock any more…

- Autoline Industries Ltd |Managing Director||Shivaji T Akhade| |Whole-time Director||Sudhir V Mungase| |Director||C A Vijay K Thanawala| |Chairman||Prakash B Nimbalkar| |Chairman Emeritus||Vilas V Lande| |Executive Director & CEO||Umesh Chavan| |Company Secretary||Ashish Gupta| Autoline Industries Ltd is an integrated Design-Engineering-Manufacturing ancillary company of automobile components and assemblies to the leading OEMs in the automobile industry. The company is engaged in manufacturing various auto parts/ sheet metal components for passenger cars, sports utility vehicles (SUV), commercial vehicles, two wheelers, three wheelers, tractors, etc. The company has 11 manufacturing facilities which manufacture more than 400 products for various vehicle segments. They also have design centers at Pune, Chennai, USA and Italy. The company has two segments, namely Press Sheet Auto Components and Assemblies and others. The principal products of the company include manufacturing of sheet metal auto components, subassemblies and main assemblies. Their customers include Bajaj Auto Ltd, Tata Motors Ltd, Kinetic Engineering Ltd, Mahindra & Mahindra Ltd, Walker Exhaust (India) Pvt Ltd, Cummins USA, American Axle FIAT India Pvt Ltd and Ashok Leyland. Autoline Industries Ltd was incorporated on December 16, 1996 as a private limited company with the name Autoline Stampings Private Ltd. Initially, the company was established as a partnership firm known as Autoline Pressings in January 1995. They set up the first manufacturing facility at Kudalwadi, Chikhali, Pune with one 150 T C frame press and supporting machinery. In June 1996, they obtained the Vendor Code for direct supplies to Bajaj Auto Ltd and in September 1996, they obtained the Vendor Code for direct supplies to Tata Motors Ltd. (then TELCO). In December 1996, the company was converted into private limited company and thus formally incorporated. In June 1997, the company expanded the facilities at Kudalwadi by acquiring adjacent land, adding 250/300 T press, setting quality systems, etc. for supplies to Bajaj Auto, Tata Motors and Kinetic Engineering Ltd. In January 1998, they received CQ certification from Tata Motors for supplying on DSL basis (Direct Supply Online, without inspection at OEM). In October 1998, the company set up their second manufacturing facility at Chakan with Presses ranging from 250 T to 600 T and supporting facilities for Tata Motors prestigious INDICA car project on the basis of Letter of Intent. In August 1999, they set up a tool room at Chakan. In December 1999, they set up CAD/CAM facilities with the latest software available for Tool Making. In April 2001, the company acquired Amogh Engineers, a Rs 40 million company manufacturing Brake Assembly for Tata Motors 407/709 models. They also entered into export of brake shoes to UAE, Singapore, Germany, etc. In June 2003, the company took over smaller pressing companies (Tier II and III) locally supplying to Tata Motors Ltd. with their Dies & Tools. In December 2003, the company set up their third manufacturing unit at MIDC, Bhosari on 54,000 sq ft land with a modern light press shop facilities (Press Range 40 T to 300 T) for small and medium components for Bajaj Auto, Tata Motors, Walker Exhaust, Kinetic, etc. In October 2004, the companys Chakan unit got ISO/ TS 16949: 2002 certification from TUV (Rh), Germany. In December 2004, they purchased 15 acres of land in Chakan prime area near to existing factory for future expansion. In February 2005, their Bhosari Unit got ISO/TS 16949: 2002 certification from TUV (Rh), Germany. In November 2005, the company acquired Western Pressing Pvt. Ltd, a company manufacturing tubular cross members, silencers and Exhaust Systems and thus, making Western Pressing Pvt. Ltd as a wholly owned subsidiary company. In March 2006, they acquired 51% stake in Dimensions Engineering Software Services Pvt Ltd, a company with 40 people into CAD/CAM/CAE & Design Engineering Services making the company a Concept to Delivery company. In January 2007, the company their initial public offerings and their shares were listed on Bombay Stock Exchange and National Stock Exchange on January 31, 2007. In March 2007, the company commenced commercial production of skin panel like door assembly at Chakan Unit II. Also, they acquired 100% stake in Autoline Dimensions Software Pvt Ltd. In May 2007, the company acquired 51% stake in US firm, Detroit Engineering Products, Inc (DEP). In October 2007, the company received Letters of Intent for new business from customers like Daimler Chrysler India Pvt Ltd, Cummins Power Generation, USA and Tata Daewoo, South Korea. Also, they acquired 100% stake in Nirmiti Autocomponents Pvt Ltd, a company engaged in the business of pedal systems, door hinges and manufacturing of sheet metal components and fabricated small assemblies which is having manufacturing facilities at Pune and Uttarakhand. In December 2007, they formed Autoline Industries USA, Inc as a wholly owned subsidiary company. In February 2008, the company and Sharjah Cement & Industrial Development Co (SCIDC), UAE entered into shareholders agreement with Autoline Industrial Parks Limited, Pune a subsidiary company of the company and formed a joint venture company for the purpose of setting up and development of industrial parks relating mainly to Auto Ancillary Units, Design Engineering Units etc. In May 2008, the company constructed factory shed and started manufacturing operations for Silencers, Exhaust Systems, etc. at Mahalunge, Chakan, Tal- Khed. In June 2008, they commissioned the State of the art Tool Room on built up area of 60000 sq ft on 2 acres of land and started commercial production. In September 2008, they acquired 100% stake in Koderat Investments Ltd, making it as a wholly owned subsidiary company. In October 2008, the company received Best performance award for excellence in cost effectiveness in sheet metal business at National Vendor meet of Tata Motors Ltd. In November 2008, they exported their first consignment to Cummins Power Generation, USA. In April 2009, the company set up manufacturing facility at Rudrapur, Uttarakhand and commenced commercial production of medium and large stamped parts. In July 2009, they acquired land at Rudrapur, Uttarakhand, adjacent to existing plots at Uttarakhand. In February 2010, the company received Best performance award for excellence in Quality in sheet metal business at National Vendor meet of Tata Motors Ltd. In March 2010, Autoline Industries, Inc. USA, a wholly owned subsidiary of the company received General Motors Supplier of the Year Award - 2009. In May 2010, Tata Motors Ltd ranked Chakan plant -1 as number one in sheet Metal family and 4th in all PCBU suppliers. In September 2010, they received new business orders from OEMs like - Volkswagen, Daimler India, Ashok Leyland, Nissan, General Motors etc. The company is in the process of setting up additional manufacturing facility at Rudrapur, Uttarakhand which is expected to be completed during the financial year 2010-11. The company proposes additional assembly lines here, weld line for Ace Frame, weld line for Assembly Door Inner - Ace, Weld facility for Load Body Cross Member, Weld facility for Assembly Control Mounting bracket, Small presses for child parts etc. for upcoming models of Tata Motors Ltd, and is expected to take care of the large volume growth at Uttarakhand. The company proposes to amalgamate Western Pressing Ltd and Nirmiti Autocomponents Pvt Ltd with the company. The amalgamation will achieve a synergy in operations and enjoy economies in operations resulting in maximizing the overall shareholder value. The company has applied for Mega Project status for Chakan Unit 1, Chakan Unit II & III plants located at Chakan, Pune under the Government of Maharashtra Scheme and have complied with various conditions of the Scheme. The company is waiting for necessary approvals to enable further action. Survey Nos 313 314 320 - 323, Nanewarkadi Chakan Taluka Khed,Pune, Tell. : +91-2135-664865/6 Website : http://www.autolineind.com Email : email@example.com

- Also known as: BIIB033 - Route of Administration: Intravenous Infusion - Type: Humanized monoclonal antibody - Reparative therapy - Emerging treatment for: RRMS - Status: In Phase II of clinical trials Anti-LINGO-1 inhibits LINGO-1, to promote neuroprotection and remyelination. How it Works LINGO-1 is a protein exclusive to the CNS and expressed by neurons and oligodendrocytes. LINGO-1 can inhibit important processes including myelination, neuronal survival, axonal regeneration, and oligodendrocyte differentiation. Anti-LINGO-1 inhibits LINGO-1 in an effort to promote neuroprotection and remyelination in MS patients. Research and Results Phase I studies ( NCT01052506, NCT01244139) examined the effect of ascending doses of BIIB033 or placebo in healthy and MS participants. Results revealed BIIB033 was well tolerated. No serious adverse effects were reported (headache was the most common reported side effect). Results from these phase I studies encouraged further investigation. A phase II study (SYNERGY) examined the effect of BIIB003 treatment (at various doses) in combination with Avonex (an approved interferon beta-1a treatment) in RRMS participants. Results from this study did not meet the primary endpoints (improvement of neuro-physical and/or cognitive function and/or disability) or secondary endpoints. A second phase II study (RENEW) investigated the safety and efficacy of BIIB003 treatment in participants affected by acute optic neuritis. Results of the trial were recently announced by Biogen Idec and demonstrated significant improvements in optic nerve performance after 32-week follow-up compared to placebo. The study showed no effect on secondary endpoints, including changes in optic nerve thickness and improvement in visual function. Adverse Effects Reported Anti-LINGO-1 appears to be well tolerated. Future studies will provide further insights into possible adverse effects. Tran, J et al. Safety, tolerability and pharmacokinetics of the anti-LINGO-1 monoclonal antibody BIIB033 in healthy volunteers and subjects with multiple sclerosis. Presented at: 64th American Academy of Neurology Annual Meeting. New Orleans, LA, USA 21-28 April 2012 (P02.021).

Since Star City Restaurant joined the constellation of Christmas City eateries in February, word of mouth about this down-home, family restaurant has buzzed louder and louder till the decibel level finally indicated time for investigation. The buzz, I've concluded, is well deserved. Not that my meal there was perfect, but the synergy created by this restaurant's comfort-style fare, truly congenial atmosphere and easy-to-afford prices make it a place that's worth going back to again and again. In a neighborhood not far from Bethlehem's Liberty High School, Star City has taken up quarters in the former Collins Restaurant, which dished up its fare from the spot for half a century. The dining rooms are rather nondescript. Tongue-and-groove wainscoting and cream wallpaper with a coordinating border at chair rail height cover the walls; there are few prints or wall decorations. Both wooden booths and freestanding tables offer seating, and Tiffany-style lights add a dash of style. Star City is a paper placemat kind of restaurant comfortable, easygoing, without pretension. That theme carries through to the food, of course, but it's also obvious in the ambience. When Aristos Sarantidis who owns the restaurant along with his wife, Amy seated us, we found ourselves chatting like we'd known him for years. Star City is the first restaurant he's owned (he's also the cook and the baker), but he's been in the business since 1975 when he started washing dishes for a dollar an hour, he told us. During our meal, I spied him paying similar attention to diners throughout the restaurant. His convivial spirit and his passion for the ''good home cooking'' his restaurant serves up engaged customers, making us feel like old friends instead. Our server was just as friendly and engaging, and ever attentive to our needs. When it comes to Star City's fare, you name it and they probably have it. The standard menu includes entrees such as chicken croquettes, fresh roasted turkey, fresh breaded veal parmesan and Star City steak (10 ounces of chopped sirloin with onions, gravy and melted cheese). Featured the day I visited were broiled fresh perch, baked macaroni and cheese casserole with stewed tomatoes, cabbage and noodles and cornflake crusted chicken breast with apple cream sauce. Sandwiches of all sorts run the gamut from cold turkey to turkey wrap to the open-faced hot turkey variety with mashed potatoes and gravy. There are munchies like Buffalo wings, chicken fingers and potato skins, and the salad selection includes Caesar with grilled chicken or fried shrimp, Greek salad, and a tuna fish salad platter with potato salad and coleslaw. Soup tells a lot about a cook and a kitchen, and the corn chowder and clam chowder that we started dinner with suggested homemade. The former featured big pieces of carrot and large chunks of potato, and the latter offered clear clam flavor. Both, however, were tepid. Rolls a cut above standard fare for a family restaurant were served with cinnamon butter, a lovely touch, along with plain butter. At Sarantidis' recommendation, I ordered the ''BBQ St. Louis style spare ribs & chicken breast combo.'' The plate overflowed with a whole boneless, skinless breast of chicken and two short racks of ribs, both succulent with an excellent, sweet-and-smoky-style sauce that's a favorite. And just as the cook promised, the rib meat did, indeed, fall off the bone. Star City's cinnamon butter was especially tasty on my baked sweet potato; creamy cole slaw was standard fare. My companion's gargantuan portion of New England butter crumb scrod, which, literally, covered the plate, featured a thick, yet crunchy coating and mild, flaky fish that boasted just a hint of sweetness. Unseasoned and lukewarm baby carrots were cooked beyond al dente; a baked potato was standard fare. Star City's desserts are made at the restaurant, so a sampling seemed de rigueur. From temptations such as Kentucky butter rum cake, oversized apple dumplings, cherry custard, carrot cake, raspberry custard and coconut custard, I selected an old favorite coconut cream pie. A cream-based layer, rather than meringue, topped the smooth custard of this excellent pie. Dinner for two including tax, tip and beverages totaled $30.76. But since we took leftovers enough home for two more meals, it seemed more like dinner for four, which made the price even more reasonable. Susan Gottshall is a freelance restaurant reviewer for Go Guide. Gottshall, who tells it like it is, attempts to remain anonymous during restaurant visits. All meals are paid for by The Morning Call. Features Editor Linda O'Connell

The Gold Price in Focus Gold, the most extraordinary metal, where increased demand can reduce supply, where selling pressure tends to increase supply, where commodity demand can be replaced by investment demand, where the price can be driven higher by factors unrelated to its use as a metal. - Gorgeous gold, a focal point of monetary value and unprintable! In the final part of this series of articles, we bring into focus all the factors that contribute to making the gold price, with their relative influences. Unlike any other commodity the gold price factors develop a synergy, interacting,? giving each other additional impetus magnifying the impact of each individual factor beyond its inherent weight.? Hence to understand the price we have to be able to fit each factor together into the whole picture and see how they interact with each factor. We have used the illustration of the sea to do this, as it is the nearest parallel we know that explains just how the gold price works. The market place, in our illustration is therefore the beach, where the lines of waves define the price. In broad sweeps the three major influences on these lines in the sand are: - • Macro economic factors resemble the Currents'? of the sea. - It is these that create a climate of stability or instability against which, like a thermometer, the gold price works? The greater the structural instability in the global economy or its major parts reflect, the higher the gold price and consequential demand for gold rises. The less important 'tides', 'waves', or 'shore surf', are completely dominated by this 'current'. • The 'Tides' are factors precipitated by the 'Currents' in the medium term, albeit they constitute major medium term influences in themselves. • The individual 'Waves' are the very short to medium term precipitants of both 'Currents' and 'Tides'. These factors define the actual price of gold. These waves make all the sound and fury on the beach finally drawing the lines in the sand, namely the gold price itself. At times, very short term and capricious influences, like the weather [media reports - dealers influence on the price - speculative pressures - etc] give these waves their most expressive features. The fundamental or macro-economic factors have long term affects on the gold price and can set the scene and control the underlying direction of the price for up to a decade or longer. In the last fifty years the most telling factor in the history of gold in that period has been the international spread of the U.S. $ and the state of the economy backing it. The recent history of the $ / Gold relationship can be broken into these main periods: - • Breakdown of the post-war fixed value of the $ and other currencies in terms of gold. This lasted until the $ was devalued not once, but twice, against gold, finally floating against both it and other currencies in the early 1970's. • The rise of the gold price reflecting the cheapening of the $ in terms of its over issuance and the inflationary environment that persisted for the next around fifteen years until gold hit $850 an ounce. • The period that began in 1980's when the U.S., the I.M.F., followed by attacks on gold by individual nations, in support of the U.S., sold gold down in price against the $ until 1999. • The period from 1999, when the world's leading Central Banks, announced that they would sell no more gold than the sales that had already been arranged, prior to September 1999, until now. When the major gold price boom began to be experienced in the late 1960's and early 1970's, the major macro-economic factor was the decay of the $. Originally this decay began with the instabilities produced by excessive printing and exporting of the U.S.$, which were known as 'Eurodollars' [$ outside the States]. Growing into the global reserve currency, it replaced sterling, helped enormously by the pricing in $ of oil, by the entire world. With most economies importing oil, no other currency could compete effectively. The U.S. kept a firm grip on these "external" $. In time the volume of $ held worldwide, rose to 76% of the world's savings and 85% of the world's trade. Gold highlighted the overprinting of the $ and rose in price to $850 an ounce in response. It had to be discredited so as to remove this condemnation of the $. The international, open market auctions of gold were designed to suppress the price of the metal. So the $ prevailed, not just over gold but over all others currencies. As if to emphasise the point, the future of the U.S. economy, plus the fall of the $ against others currencies, is now critical to the well being of the entire global economy. Why, because as the extent of the $ hegemony grew, so its relative influence on the world's stability also grew. Indeed, as of now, the control that the U.S. government has on world finances is irresistible, making the $ the most effective instrument of imperialism ever seen.? The U.S. $ is so unstoppable an influence that its control is manifesting itself slowly, but surely, over all other financial instruments world-wide.? The $ is now the currency of the global financial empire of the United States.? It is now the fulcrum of global stability. A Change in the "Current"? - A restoration of real growth expectations over the longer term in the U.S. will swing the macro economic current back to a falling gold price. A willingness on the part of the rest of the world to have the U.S. currency in total domination? would have to follow, before there was a restoration of confidence in the $. In turn, should this confidence be restored in this way, the threat from the Euro would diminish and the gold price resume its falling trend. But this seems to be a most unlikely future, at the moment! Central Banks - The first reaction to this 'current' will be the Central Banks of the world. Perspicaciously eying the future, their first reaction to the $'s future was the "Washington Agreement" in September 1999, which guided us all to the attitude of the Central Banks, then and in the future, towards gold. In this agreement they reinforced the "Reserve Asset" role of gold. Perhaps they foresaw the dangers creeping up on the $ and the future role of gold. The agreement was a timely precaution giving an early warning that the falling gold price trend was to halt and the gold price to rise, once the turnaround was complete. Central Banks have not and will not be capricious in their attitude to gold, selling one moment, retaining gold the next.? No, gold is and will be far too important to the sound functioning of the global monetary system, in potential crises, such as the one we described above. The Central Banks attitude to gold will be the most important "tidal" influence on the market there will be. Second only to the macro-economic factors, Central Bankers form the central point of the "Tidal" factors. They can? influence the market in three major ways. First, by selling gold, as they are currently doing. Second, by not selling gold. Thirdly, by buying gold. They are currently sellers of 400 tonnes a year, until September of next year. To gauge this influence we ask you the reader to imagine that they do not sell this tonnage. The result? The supply / demand picture would change as quickly a an extra weight being dropped onto an evenly balanced set of scales. The gold price would take off not simply by their absence, but by their obviously positive attitude to gold. Next their buying of gold. If they were to use the tactics Britain, the I.M.F. and the U.S. have used in selling gold and went to the open market with a public announcement that they were going to buy gold, again the price would roar in its upward path. Today in line with the "Washington Agreement", individual Central Bank sales are not preceded by public statements, so as to not disturb the markets into pushing the price down. But seeking to act prudently and in the interests of themselves and their citizens, Central Banks buy in the shadows, minimising the impact on the gold price, if possible. So we see Central Banks like those of Russia and China buying locally produced gold rather than go to the open market, where they would be like a cat among the pigeons. Their behaving like this and buying 'off-market', impacts only on the supply of gold to the market coming through, byway of a reduction of new supplies to the gold market[not selling gold]. Hence, the principal "Tidal" effect in the gold market is the activity of the Central Banks. ? Producer de-Hedging - The second major tidal effect arose as a consequence of the actions of the Central Banks. Gold Producers built their hedge positions to maximise income in a falling market. When it became clear that the Central Banks were no longer going to sanction a falling gold price, these? 'hedge' positions were re-examined, in light of the "Washington Agreement" It became clear to them over time that they were vulnerable to a situation where the gold price they had achieved, through their 'hedges', could turn out to be lower than current gold prices. Such a prospect was unacceptable and defeated their commercial objectives as well as those of their shareholders. The gold price then established a rising foundation, so gold Producers accelerated the exiting of their hedges as quickly as the market would bear, without pushing the gold price into orbit. By exiting the hedge prematurely, with the "contango" [interest rate profits from selling forward] in their hands as part of their profits, as well as the contract price, in a still profitable deal, led, in most cases, to the Producers doing better than selling their gold at current gold prices. Only now are the prices achieved in the "hedges" either at current prices, or below them. The Central Bankers, with regard to the industries continued soundness, acted responsibly, in warning the market of their future actions in the gold market. It was a consequential reaction to these prospects for the gold price, that caused Gold Producers to the extraordinary act of becoming major buyers of gold. The process of de-hedging has produced hundreds of tonnes of demand for gold in the last two or so years. We now see the de-hedging process continuing until hedge positions are down to manageable levels when measured against rising gold prices. New gold supply - A less important "tidal" factor is the reducing supply of new gold to the market. Much argued about and a potential hangover from the days of the dropping gold price over such an extended period, exploration for new supplies has dropped off considerably to the point that a declining quantity of newly mined gold is forecast for the future, by many. Because it takes around five years from the discovery of a gold deposit to it supplying gold to the market, the volumes of gold available to the market have been constricted for 5 years more or less, irrespective of the market price of gold. A price averaging around $350 - $450 may well bring about a wave of exploration. South Africa could be the exception to this, as the government of S.A. eyes the profits of the mining companies, as well as their shareholding with rapacious eyes. If they continue this approach, they may well discourage future investment, irrespective of the price of gold, because of the uncertainty of potential profits. Investment? Demand - As the "current" factors, followed by the "Tidal" factor of the Central Bankers activities and intentions, establish themselves as near term realities, so the next consequential factor appears in the market place. Stemming from institutional and informed high wealth individuals, longer term? Investors, constantly seeking the highest net returns from their investments, appear in the market. ? They are the last major "Tidal" factor entrants to the market, not because they don't accept the instability waiting in the near and far future, but needing to get the exit and entrance points right in all investments, they act when they see the imminent prospect of falling prices on other investments before entering gold investments, just ahead of their price rises. Following both the 'current' factors and major 'tidal' factors, they are, in themselves, a 'tidal' influence. Once they make their appearance, they are persistent buyers over a period, holding their investments for the longer term. Their buying capacity is enormous, indeed a one percent shift of investments from the world's Stock Exchanges alone, would send gold prices towards four figures. When they are seen on the 'beach' make sure you are in the market. Remember the maxim; if you see a Swiss Banker jump out of a window, follow him, there's money to be made on the way down! A new trend in investment demand has now been established by the World Gold Council. A new type of Investor, the "small man", could well become a new 'tidal' influence. He buys shares like "Gold Bullion Limited" and the about to be listed "Equity Gold Trust" in New York, where each share represents one tenth of an ounce of gold. At last gold is within his reach in a user friendly manner. Demand from this source is likely to be even longer term and could rise to proportions that could throw the scales off-balance, fairly soon. If China follows a similar path and allows individuals to own gold, as expected fairly shortly, the demand from the two investment sources is set to be a long term, incoming 'tide'. As completely reactive elements of the gold price the waves are short term, rising and falling constantly irrespective of the currents and tides. But in response to the current and tidal factors, they, as 'waves' on the 'beach' called the market, are what we all see in the day to day gold price.? As observers, this is what we see. This is what is reported day by day in the media. Much is made of each rise and each fall. Indeed we through our Technical Analysis, as you have experienced in "Changing Tack" as well as "Gold-Authentic Money" have made excellent profits from these waves, far more than the straightforward tidal influence of trends. These 'wave' influences are made up of "Speculators", "Commercials" and "Dealers", who have the very short and short term gold price factors in sharp focus in front of them. Speculators - Commercials - Dealers Each of these individuals seeks to profit from his own activity, using the market to push and profit, from the price on any pressures he can bring to the market. Commercials have other motives, doing all they can to avoid gold price risks, as their business is to add value to the gold, through their work.? Consequently, they buy when they believe they see a sustainable stable gold price and withdraw from the market when they believe the price is volatile or overpriced. Such actions can and do add volatility to the gold price. Speculators and dealers profit from movements in the gold price not in a static price, so do all they can to make the gold price go their way. They make or respond to media reports, like the weather affects the waves of the sea. The media, in turn, do all they can to highlight volatile factors. After all a report that simply reports "a change in the weather approaching", is not nearly as effective as a report saying "the gentle tranquillity of the day, was threatened by a storm bearing down on the defenceless village". While newspapers continue to report no good or neutral news, the gold market will find itself battered by any story, true or false that can gain our attention. The intention of the media is to whip up the 'surf' so as to keep our attention. But at times, these weather influences can have a calming affect [in the absence of dramatic news] on the sea, allowing us to see the underlying currents and the tides clearly and without the distractions of wind and surf, such as when the gold price is in a 'consolidation' phase. At times the winds may be howling, whipping up the wave and surf to give the dramatic appearance of more important features, then subsiding in a moment, back to a calmness, sweeping away the driving force they appeared to have, such as when speculative influences became convinced that the war in Iraq was a key factor in the gold price. The rise in the gold price was $70+ at that time, as was its subsequent fall, leaving the price right back where it started. In trying to dominate the gold price, which they did for the short term, all their efforts to run the price up were defeated by the inactivity of all other players, who stood on the sidelines, watching the speculators, 'full of sound and fury, signifying nothing' until they gave up their positions, before minding their place and waited for the major influences to return to the fore. The gold price before and during the Iraqi war beautifully illustrated the point that, at no time do these 'weather influences' have the power to override either the 'tides' or 'currents' of the sea, which always return to dominate the gold price. Having covered the shape of the gold price sea, we need to see just how they come together, to finally set the line in the sand, the gold price. The synthesis of the Gold Price As with our illustration of the sea, so gold market factors can work together or seemingly against each other like a wave running up the beach in an ebb tide. • Currents dominate unchallenged, with all other factors touching a forelock to them in responding reaction. • "Tidal" factors consequent on the 'currents', are the first distinctly visible influences acting so effectively that all other, lesser, factors follow their direction eventually. • The 'waves' themselves often seem to be reacting in an opposite manner to these fundamentals, but always follow their lead acting in line with 'currents' and 'tides', whilst they move too and fro, making the market active and often volatile, at all times, sometimes moving up the beach in an ebb tide and sometimes down when the tide rises. With the different objectives of the different participants at different times, the make-up of the price itself changes in a completely different manner to other commodity price structures. Each factor adds a layer onto the gold price, coming in at different times to each other, each having the potential to dominate at different times and with different weights. • Of late the long term Speculators [waves] have held sway in massive quantities. Or were they Investors in disguise? • Seasonal physical buyers [Commercials] are stronger this year than seen for some time, adding a strong inward flow to the sea. Their appearance being seasonal causes speculators to pre-empt their demand pushing the price up ahead of their presence. Commercials being hardened veterans are not fooled by this volatility, standing back until it settles and a price level convincingly, established. These two 'wave' effects, are constantly watch the 'tides'. • The Major 'current' effect these days, is the decay of the $ and the threat from the Euro, promising instability in currency values, making the 'safe haven' of gold attractive, long term. • Central Banks are warning the market of a new Central Bank Gold Agreement, on the same lines as the "Washington Agreement" in September 1999. Consistent with this is their determination not to 'disturb' the gold market, but to announce future sales post September 2004, as the German, the Dutch and the Swiss have been doing of late. Looking at their behaviour in the light of the "Washington Agreement" it is clear that there will be little departure from the underlying principles of that agreement. Despite this 'tidal' influence both the media and the 'waves' of the gold market do their utmost to incite volatility and uncertainty in the future of these agreements. • The perspicacious Investors have recently made themselves visible. They are not driven by the 'waves' at all, except in their decisions on entrance and exit points. Their inherent power, once they decide, 'en masse' that the time is right, the Investor could impact on the gold price with a volume that would astound the market.? But the Central Bankers, in particular, are aware of this possibility and tread lightly, so as not to precipitate such a flood. The Investor can certainly drive the Jewellery trade out of the market and replace him, as the Speculators did in the last run up. ? • The Central Banker, should he turn buyer from the open market, would do so as unobtrusively as possible, hoping to leave the market price to fundamental and market factors outside his influence. Should the Central Banks wish to openly go to the gold market as buyers, it would be to acquire large, very large amounts. The precedent set by history is for nations to confiscate gold owned by individuals within their borders and to bid the price up to up to 75% higher than market price, so as to shake out those holding gold as an investment, waiting for higher prices and not for security of value. These were the actions of the United States from 1933 to 1935 and set a precedent for stormy days. The Gold Price Focussed The sea flows in tides up and down the beach. The swells of the sea give a powerful shape to this momentum, but it is the shore itself where the waves can either reach a crescendo in spectacular "surf", or the tranquil lapping of the shore, as at dawn. So are the 'currents', 'tides' and 'waves' of the gold market as they synthesise to bring us the gold price. From morning until night the gold price moves, in the hands of the 'waves' sometimes erratically, sometimes within small bands and spreads. It can then jump 'the limit' up or down as price forces come together with the underlying forces to force the price into the right place. The majority of this volatility comes from Speculators, who could, if allowed to, distort any stable market. This is why huge volumes of gold are traded, where possible, away from the market. The main players do exert a steadying influence on them and frequently kick the gold price a few $, back into line. The 'currents and 'Tides' prefer to avoid these capricious distortions by buying in a far more civilised manner at the "Fix" in the morning and afternoon, in London, where the main Bullion Banks come together representing both themselves and their large clients, [who make up by far the greater bulk of daily demand] and weigh the demand and supply of gold at that particular session, and agree a price where all deals are transacted, at the price agreed upon at this "Fix". In London, the price outside those sessions only reflect 'peripheral' transactions and arbitrage situations in other world markets, that don't want to wait for the "Fix". The prices outside the "Fix" are at the mercy of the 'waves', the dealers themselves, as well as the speculators and smaller players, reacting to conditions and situations they find themselves in and made dramatic in the press. After London hours, New York, the home of the large Speculator, takes the reins and makes the price. These two main markets essentially decide daily prices and will keep doing so until China makes its presence felt, as is expected, in the next year or so. Tocom in Japan fills the gap in Asian hours, but responds primarily to the other markets as a junior 'member'. With the gold market, superficially linked, to "breaking news" the market is an interesting and exciting place. Recent special situations have seen contrived situations, where market players took delivery of gold from short positions, forcing the "shorts' to buy gold to cover their positions, resulting in gold prices moving $8 in one minute. So moment to moment assessments of the value of gold through the 'open' market price, should always be balanced by the "fixes" to get a reasonable price for gold, during Europe's day. Comex and Tocom, do not have such a system, ensuring all players 'join the scrum' in the market place. ? With the low profile nature of the underlying forces, no market is so dependant on the major fundamental influences as is the gold market. These influences will override, surreptitiously usually, but forcefully always, until the gold price reflects the will of 'currents' and 'tides'. With these diverse structural levels in the gold market, there is a persistent recipe for both an illiquid and a volatile 'open' market and gold price. "Gold-Authentic Money" - Newsletter? - Med-Long Term Technicals and insights on gold and macro-economy ……… $249 per annum [rising to $349 end November] "Changing Tack" ………………… $349 [plus "Market Alerts"] ……… $199 per half Year Ultra-Short & Short Term Technicals "Changing Tack - Gold & Precious Metal Shares" ……… $345 per quarter [plus "Market Alerts"] ……… $595 for six months "Changing Tack" + Share performance guide ……… $948 per annum. DAILY TECHNICAL ADVICE ?- Tony Henfrey is available to GUIDE YOU on your ultra-short term moves covering commodities, indices, currencies, bonds, etc! [Contact us for a trial at a special $100 price for the month]

This month's ArchiTalk topic is "tools." Be sure to read some of the other posts by others at the end of my own. I will admit upfront that I was a little too occupied with something else that starts with "Super" over the weekend. No, my team was not in the big dance, but it was held just over 10 miles away from our house. Enough excuses, I wanted to focus this month's ArchiTalk on Super Tools we have – our hands. When the topic of this month's ArchiTalk came up several weeks ago, it got me thinking... When I was in architecture school, one of my design studios had a project where we each were assigned a construction tool (something relatively small) and I was given the chalkline. I don't think this is one of the first tools people think about when you think construction. It's really just a piece of string with some chalk on it. You don't construct anything with the chalkline itself, but it's a super important tool for construction to happen properly. Snapping the chalky string once pulled taught, creates a straight construction line for workers to abide by. Of the many uses of a chalkline, one immediate memory from our Contemporary Cottage project was when it was used to show the saw-cut lines for our concrete floor's control joints. Another thought I had when thinking about 'tools' were the tools I use on a daily basis as an architecture professional. When talking with other architects, one of the questions we ask one another is, "hey, what software are you guys using?" I've gotten into a comfortable niche working with SketchUp and LayOut but I know I'm usually the odd man out. In this area, smaller firms tend to use VectorWorks, some people are still using AutoCAD, and larger firms are using Revit. Big generalization here, I know. Very seldom do I come across someone that's using Chief Architect – just as seldom as I see people using SketchUp and LayOut the way I have been using them. A big influence in my SketchUp & LayOut workflow has been Nick Sonder. You can check him out here: So what do chalkiness, drafting and drafting software have to do with one another? Well, they're all tools that we use with our hands. This got me thinking about the even larger picture. How damn cool is it that we get to participate in this thing called architecture and construction using our hands as the main tool?! I mean, I draw lines on paper with my hands whether by pen, pencil, or computer software (so actually, I draw on the computer, and that gets spit out on paper) and then people use their hands to put up the actual construction! From thoughts in someone's head, to an actual structure, by means of many peoples' hands as tools. I think that's super. Hands, they're a Super Tool. Below is a blog roll of other posts related to this month's topic of "tools" we use as architecture professionals: Bob Borson - Life of An Architect (@bobborson) Marica McKeel - Studio MM (@ArchitectMM) 3 Tools to Get Our Clients Engaged and Involved Jeff Echols - Architect Of The Internet (@Jeff_Echols) The Best Tool In Your Toolbox Lee Calisti, AIA - Think Architect (@LeeCalisti) Lora Teagarden - L² Design, LLC (@L2DesignLLC) The Tools That Help Make #AREsketches Jeremiah Russell, AIA - ROGUE Architecture (@rogue_architect) Jes Stafford - MODwelling (@modarchitect) One Essential Tool Eric T. Faulkner - Rock Talk (@wishingrockhome) Architools - Mind Over Matter Rosa Sheng - Equity by Design (@EquityxDesign) 10 Power Tools to Kickstart Equitable Practice Michele Grace Hottel - Michele Grace Hottel, Architect (@mghottel) #ArchiTalks 17 "Tool" Meghana Joshi - IRA Consultants, LLC (@MeghanaIRA) Tools of an Architect #Architalks 17 Amy Kalar - ArchiMom (@AmyKalar) ArchiTalks #17: Three Tools for Change Brian Paletz - The Emerging Architect (@bpaletz) Can we talk? Michael LaValley - Evolving Architect (@archivalley) Why An Architect's Voice Is Their Most Important Tool Eric Wittman - intern[life] (@rico_w) it's ok, i have a [pen] Brinn Miracle - Architangent (@simplybrinn) Synergy: The Value of Architects Emily Grandstaff-Rice - Emily Grandstaff-Rice FAIA (@egrfaia) Tools for Learning Jarod Hall - di'velept (@divelept) Something Old and Something New Greg Croft - Sage Leaf Group (@croft_gregory) Jeffrey A Pelletier - Board & Vellum (@boardandvellum) Helpful tools found within an Architecture blog Aaron Bowman - Product & Process (@PP_Podcast) Sharpen Your Tools Kyu Young Kim - Palo Alto Design Studio (@sokokyu) Jared W. Smith - Architect OWL (@ArchitectOWL) Construction: An Architect's Learning Tool Keith Palma - Architect's Trace (@cogitatedesign) (CTRL A) (Command-A)- Edit

Although the effects of sanguinarine, a benzophenanthridine alkaloid, on the inhibition of some kinds of cancer cell growth have been established, the underlying mechanisms are not completely understood. This study investigated possible mechanisms by which sanguinarine exerts its anticancer action in cultured human bladder cancer cell lines (T24, EJ, and 5637). Sanguinarine treatment resulted in concentration-response growth inhibition of the bladder cancer cells by inducing apoptosis. Sanguinarine-induced apoptosis was correlated with the up-regulation of Bax, the down-regulation of Bid and XIAP, the activation of caspases (-3, -8, and -9), and the generation of increased reactive oxygen species (ROS). The ROS scavenger N-acetyl cysteine (NAC) completely reversed the sanguinarine-triggered apoptotic events. In addition, sanguinarine effectively increased the activation of the c-Jun N-terminal kinase (JNK) and the expression of the early growth response gene-1 (Egr-1), which was recovered by pretreatment with NAC. Furthermore, knockdown of Egr-1 expression by small interfering RNA attenuated sanguinarine-induced apoptosis, but not the JNK inhibitor, indicating that the interception of ROS generation blocked the sanguinarine-induced apoptotic effects via deregulation of the expression of Egr-1 proteins. Taken together, the data provide evidence that sanguinarine is a potent anticancer agent, which inhibits the growth of bladder cancer cells and induces their apoptosis through the generation of free radicals. Citation: Han MH, Park C, Jin C-Y, Kim G-Y, Chang Y-C, Moon S-K, et al. (2013) Apoptosis Induction of Human Bladder Cancer Cells by Sanguinarine through Reactive Oxygen Species-Mediated Up-Regulation of Early Growth Response Gene-1. PLoS ONE 8(5): e63425. doi:10.1371/journal.pone.0063425 Editor: Subhash Gautam, Henry Ford Health System, United States of America Received: February 19, 2013; Accepted: April 1, 2013; Published: May 22, 2013 Copyright: © 2013 Han et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (2012-0000476 and 2012046358). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Benzo[c]phenanthridine alkaloids (BAs) are a relatively small group of isochinoline alkaloids, which have been detected in many plant species of the families Papaveraceae, Fumariaceae, Ranunculaceae, and Rutaceae . Sanguinarine is a quaternary ammonium salt belonging to this group of BAs. It has been extracted from some plants, including bloodroot (Sanguinaria canadensis L.), the Mexican prickly poppy Argemone mexicana L., Chelidonium majus, and Macleaya cordata. , . Sanguinarine has been shown to possess strong antibacterial and anti-inflammatory properties –. Recent data have also demonstrated that this compound can induce apoptosis in a variety of cancer cell lines in vitro; however, it does not show any toxic effects on normal cells when administered at similar doses –. Reactive oxygen species (ROS) are highly reactive molecules. They include superoxide anion radicals, hydrogen peroxide, singlet oxygen, and hydroxyl radicals. ROS are generally derived from the normal metabolism of oxygen, and mitochondria are the primary source of ROS. Although basal levels of ROS serve as a physiological regulator in normal cell proliferation and differentiation, high levels of ROS can cause severe damage to DNA and proteins, leading to apoptosis –. In addition, excessive oxidative stress particularly targets mitochondria, causing a loss of mitochondrial membrane potential (ΔΨm) and mitochondria-mediated apoptosis –. Recent studies suggest that the generation of ROS by sanguinarine initiates cascades of cell death signals in some human cancer cell lines in vitro , , . Reactive oxygen species (ROS) are highly reactive molecules. They include superoxide anion radicals, hydrogen peroxide, singlet oxygen, and hydroxyl radicals. ROS are generally derived from the normal metabolism of oxygen, and mitochondria are the primary source of ROS. Although basal levels of ROS serve as a physiological regulator in normal cell proliferation and differentiation, studies have shown that high levels of ROS can cause severe damage to DNA and proteins, leading to apoptosis –. In addition, excessive oxidative stress particularly targets mitochondria, causing a loss of mitochondrial membrane potential (ΔΨm) and mitochondria-mediated apoptosis –. Recent studies have suggested that the generation of ROS by sanguinarine initiates cascades of cell death signals in some human cancer cell lines in vitro , , . Among many redox-regulated genes, the early growth response-1 (Egr-1), a zinc-finger transcriptional factor, is of interest because it is rapidly and transiently induced by a number of extracellular stimuli – and by all inducers of ROS-mediated signaling and inflammation –. Therefore, Egr-1 can play a critical role in coordinating cellular events following oxidantive stress –. However, the role of Egr-1 in apoptosis signaling pathways activated by ROS in cancer cells treated with sanguinarine has not been delineated. The present study used the human bladder cancer cell lines, T24, EJ, and 5637, to examine the cytotoxic efficacy of sanguinarine and to investigate the molecular mechanisms underlying the apoptotic activity caused by sanguinarine. The results showed that the sanguinarine-induced apoptotic signaling pathways modulated the activity of Bcl-2 and the inhibitor of apoptosis protein (IAP) family proteins and led to mitochondrial dysfunction, the activation of caspases, and the induction of Egr-1. The results also suggested that ROS are critical regulators of the sanguinarine-induced apoptotic events. Materials and Methods Cell Culture and Cell Viability Assay Human bladder cancer cell lines (T24, EJ, and 5637) were obtained from the American Type Culture Collection (Rockville, MD, USA). The cells were cultured in RPMI 1640 medium, supplemented with 10% fetal bovine serum (FBS, Gibco-BRL, Gaithersburg, MD, USA) and 1% penicillin-streptomycin at 37°C in a humid environment containing 5% CO2. Sanguinarine (Sigma-Aldrich Chemical Co., St. Louis, MO, USA) was dissolved in methanol as a stock solution at a 10 mM concentration and was stored in aliquots at −20°C. For the cell viability study, cells were seeded in 6-well plates at a density of 1×105 cells per well. After 24 h stabilization, the cells were treated with various concentrations of sanguinarine for a further 24 h. Following treatment, the viability of the cells was determined with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich) assay, which is based on the conversion of MTT to MTT formazan by mitochondrial enzymes. Nuclear Staining with DAPI After treating the cells with sanguinarine for 24 h, they were harvested, washed in ice-cold phosphate-buffered saline (PBS), and fixed with 3.7% paraformaldehyde (Sigma-Aldrich) in PBS for 10 min at room temperature. The fixed cells were washed with PBS and stained with a 4,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) solution (2.5 µg/ml) for 10 min at room temperature. Changes in the nuclear morphology of the cells were analyzed using a fluorescence microscope (Carl Zeiss, Germany). Flow Cytometry Analysis for the sub-G1 Phase The cells were harvested and washed once with PBS, fixed in ice-cold 70% ethanol, and stored at 4°C. Prior to the analysis, the cells were washed once again with PBS, suspended in 1 ml of a cold propidium iodide (PI, Sigma-Aldrich) solution containing 100 mg/ml RNase A, 50 µg/ml PI, 0.1% (w/v) sodium citrate, and 0.1% (v/v) NP-40 and further incubated on ice for 30 min in the dark. Flow cytometric analyses were carried out using a flow cytometer (FACS Calibur; Becton Dickinson, San Jose, CA, USA), and Cell-Quest pro software was used to determine the relative DNA content based on the presence of red fluorescence . Detection of Apoptosis by Annexin-V FITC Staining The cells were washed with PBS and resuspended in an annexin-V binding buffer containing 10 mM HEPES/NaOH (pH 7.4), 140 mM NaCl, and 2.5 mM CaCl2. Aliquots of the cells were incubated with annexin-V fluorescein isothiocyanate (FITC, R&D Systems; Minneapolis, MN, USA), mixed, and incubated for 15 min at room temperature in the dark. PI at a concentration of 5 µg/ml was added to distinguish the necrotic cells. The apoptotic cells (V+/PI−) were measured with a flow cytometer. Measurement of Intracellular ROS ROS production was monitored using the stable nonpolar dye 2,7 dichlorofluorescein diacetate (DCFH-DA, Sigma-Aldrich). The cells were seeded in 24-well plates and incubated in the presence or absence of sanguinarine for different periods of time. Later, the cells were incubated with 10 mM DCFH-DA for 30 min. The ROS production in the cells was monitored with a flow cytometer using the Cell-Quest pro software . The production of intracellular ROS was also monitored by the fluorescence emission of DCFH-DA within the cells using a fluorescent microscope. Protein Extraction and Western Blotting The cells were harvested and washed twice in PBS at 4°C. Total cell lysates were lysed in a lysis buffer (40 mM Tris [pH 8.0], 120 mM, NaCl, 0.5% NP-40, 0.1 mM sodium orthovanadate, 2 µg/ml aprotinin, 2 µg/ml leupeptin, and 100 µg/ml phenymethylsulfonyl fluoride). The supernatants were collected, and the protein concentrations were measured using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. For the Western blot analysis, equal amounts of protein extracts were extracted from SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Schleicher & Schuell, Keene, NH, USA) by electroblotting. The membranes were blocked with 5% nonfat dry milk in PBS with Tween 20 buffer (PBS-T) (20 mM Tris [pH 7.5], 100 mM NaCl, and 0.1% Tween 20) for 1 h at room temperature. The membranes were then incubated overnight at 4°C with the primary antibodies, probed with enzyme-linked secondary antibodies, and visualized by enhanced chemiluminescence (ECL; Amersham Corp, Arlington Heights, IL, USA) according to the recommended procedure. The primary antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA) and Cell Signaling Technology Inc. (Boston, MA, USA). Peroxidase-labeled donkey antirabbit immunoglobulin and peroxidase-labeled sheep antimouse immunoglobulin were purchased from the Amersham Corp. In vitro Caspase Activity Assay The caspase activities were determined by colorimetric assays using caspase-3, -8, and -9 activation kits according to the manufacturer’s protocol (R&D Systems). Briefly, the cells were lysed in a lysis buffer for 30 min in an ice bath. The supernatants were collected and incubated at 37°C with the reaction buffer, which contained dithiothreitol and the substrates Asp-Glu-Val-Asp (DEVD)-p-nitroaniline (pNA) for caspase-3, Ile-Glu-Thr-Asp (IETD)-pNA for caspase-8, and Leu-Glu-His-Asp (LEHD)-pNA for caspase-9. The optical density of the reaction mixture was quantified spectrophotometrically at a wavelength of 405 nm. Treatment with Small Interfering RNA The cells were seeded in a 6-well plate at an initial density of 1.5×105 cells per well. After 24 h of stabilization, they were transfected with 100 nM of small interfering RNA (siRNA) against human Egr-1 or an equal quantity of nonspecific irrelevant RNA (Dharmacon, Chicago, IL, USA) using a transfection reagent (Genefectine, Genetrone Biotech, Seoul, Korea), according to the manufacturer’s instructions. Following 24 h of transfection, the cells were incubated under the indicated conditions. The data are expressed as means ± SD. Statistical comparisons were performed using SPSS 12.0 followed by Fisher’s test. Significant differences between the groups were determined using the unpaired Student’s t-test. A p value <0.05 was accepted as an indication of statistical significance. Effects of Sanguinarine on Cell Viability and Apoptosis Induction To investigate whether sanguinarine inhibited the proliferation of bladder cancer cells, three bladder cancer cell lines (T24, EJ, and 5637) were stimulated with the indicated concentrations of sanguinarine for 24 h, and an MTT assay was performed. As shown in Fig. 1, the treatment with sanguinarine decreased the viability of the bladder cancer cells in a concentration-dependent manner. Thus, further experiments were performed to determine whether this inhibitory effect of sanguinarine on the viability of the cells was the result of apoptotic cell death. First, DAPI staining determined morphological changes in the cells, as shown in Fig. 2A. Treatment with 1.5 µM sanguinarine resulted in a significant number of cells with chromatin condensation, loss of nuclear construction, and formation of apoptotic bodies, whereas these features were not observed in control cells. Second, flow cytometric analysis for the detection of hypodiploid cell populations determined the degrees of apoptosis in the cells treated with sanguinarine. As indicated in Fig. 2B, the addition of 1.5 µM sanguinarine to the bladder cells resulted in increased accumulations of cells in the sub-G1 phase. Third, flow cytometry analyses with annexin V and PI staining determined the magnitude of the apoptosis elicited by sanguinarine. As shown in Fig. 2C, the numbers of annexin V-positive cells showed marked increases in the sanguinarine-treated cells compared to the untreated control cells. Consequently, these data suggest that bladder cancer cells may undergo apoptosis after exposure to sanguinarine. T24, 5637, and EJ cells were treated with the indicated concentrations of sanguinarine for 24 h, according to the measurements of cell viability with an MTT assay. Data are reported as means ± SD of three independent experiments. Significantly different from the control, *p<0.05. (A) The cells were incubated with 1.5 µM sanguinarine for 24 h and then stained with DAPI. The stained nuclei were then observed under a fluorescent microscope (magnification, ×400) using a blue filter. (B) To quantify the degree of apoptosis induced by sanguinarine, the cells were evaluated for sub-G1 DNA content using a flow cytometer. (C) The cells were stained with FITC-conjugated annexin-V and PI for flow cytometry analysis. The apoptotic cells were determined by counting the percentage of annexin V(+), PI(−) cells and the percentage of annexin V(+), PI(+) cells. Data are reported as means ± SD of three independent experiments. Significantly different from the control, *p<0.05. Modulation of Bcl-2 and IAP Family Proteins, and Activation of Caspase by Sanguinarine The role of the Bcl-2 and the IAP family proteins was determined by Western blotting to investigate which mechanisms were involved in the sanguinarine-induced apoptosis in the bladder cancer cells. As shown in Fig. 3A, the treatment of the bladder cancer cells with 1.5 µM sanguinarine did not cause significant changes in the expression of the antiapoptotic proteins Bcl-2 and Bcl-xL. However, the levels of proapoptotic Bax increased and those of the antiapoptotic protein XIAP decreased in response to sanguinarine. In addition, the reduction in proapoptotic Bid proteins showed a marked increase with sanguinarine treatment in all the bladder cancer cell lines. To determine whether sanguinarine-induced apoptosis was associated with the activation of caspases, the expression and the activity of caspases in the sanguinarine-treated cells were examined. The results showed that the sanguinarine treatment down-regulated the levels of the procaspase-3 proteins and increased the levels of active-caspase-3. The levels of procaspase-8 and -9 proteins were also down-regulated in the sanguinarine-treated cells (Fig. 3B). For further quantification of the proteolytic activation of procaspase-3, -8, and -9, the lysates equalized by the protein from the cells treated with sanguinarine were assayed for their enzymatic activities. As shown in Fig. 3C, the sanguinarine treatment markedly increased their caspase activities. Subsequent Western blot analyses showed the progressive proteolytic cleavage of the poly (ADP-ribose) polymerase (PARP) protein, which is a downstream target of the activated caspase-3 , in the cells after the sanguinarine treatment (Fig. 3B). (A and B) After 24 h incubation with sanguinarine, the cellular proteins were separated by SDS-polyacrylamide gels and transferred onto nitrocellulose membranes. The membranes were probed with the indicated antibodies, and the proteins were visualized using an ECL detection system. To confirm equal loading, actin was used as an internal control. (C) To assay the in vitro caspase activity, aliquots were incubated with DEVD-pNA, IETD-pNA, and LEHD-pNA as substrates for caspase-3, -8, and -9, respectively, and then the released fluorescence products were measured. Each point represents the mean ± SD of the representative experiments performed at least three times. A Student’s t-test (*p<0.05 vs. untreated control) was used to analyze the statistical significance of the results. Sanguinarine-induced Apoptosis is Associated with the Generation of ROS To determine whether sanguinarine-induced apoptosis was associated with ROS-mediated oxidative stress, intracellular ROS production was measured with the DCFH-DA fluorescence assay using a flow cytometer. As indicated in Fig. 4A, when the cells were exposed to sanguinarine, the level of intracellular ROS drastically increased at 30 min (more than an 8-fold increase compared to the control), and it decreased with time thereafter. Prior treatment of the cells with a well-known ROS scavenger, N-acetylcysteine (NAC), greatly diminished this heightened ROS level in the sanguinarine-treated cells. The production of intracellular ROS was also monitored by the fluorescence emission of DCFH-DA within T24 cells using a fluorescent microscope. The increased intensity of DCF-DA staining observed in the sanguinarine-treated cells was time-dependently abrogated to control levels in the presence of NAC (Fig. 4B). To determine whether sanguinarine-induced ROS production was attributable to the apoptosis induction, the cells were treated with NAC for 1 h and co-incubated with sanguinarine for a further 24 h. As shown in Fig. 5A, the inhibitory effects of NAC on sanguinarine-induced ROS production correlated with a marked inhibition of apoptotic cell death measured by the flow cytometer. Furthermore, blocking the generation of ROS by pretreating the cells with NAC prevented the sanguinarine-induced activation of caspases, the cleavage of PARP, and the modulation of Bcl-2 and IAP family proteins (Fig. 5B and C). Taken together, these data suggest that a ROS-generating system plays an essential role in sanguinarine-induced apoptosis in bladder cancer cells. (A) The cells were incubated with 1.5 µM sanguinarine for the indicated times, or they were pretreated with 10 mM NAC for 1 h and further treated with 1.5 µM sanguinarine for the indicated times. They were then stained with DCFH-DA. ROS generation was measured using a flow cytometer. Each point represents the mean of representative experiments performed twice. (B) DCFH fluorescence in T24 cells grown under the same conditions as (A) was determined under fluorescence using a green filter. At least five fields were viewed in each of the experiments. (A) The cells were treated with or without NAC (10 mM) for 1 h before challenge with 1.5 µM sanguinarine for 24 h. They were collected and stained with FITC-conjugated annexin-V and PI for flow cytometry analysis. Data are reported as means ± SD of three independent experiments. A Student’s t-test (*p<0.05 vs. untreated control; #p<0.05 vs. sanguinarine-treated cells) was used to analyze the statistical significance of the results. (B) They were then harvested, and the indicated proteins were detected by Western blot analysis. Actin was used as an internal control. (C) To assay the in vitro caspase activity, aliquots were incubated at 37°C for 1 h, and the released fluorescence products were measured. Each point represents the mean ± SD of representative experiments performed at least three times. A Student’s t-test (*p<0.05 vs. untreated control; #p<0.05 vs. sanguinarine-treated cells) was used to analyze the statistical significance of the results. Sanguinarine-induced Apoptosis is not Associated with the Activation of JNK Many previous reports indicated that cytotoxic ROS signaling appeared to be mediated, in part, by activation of the c-Jun-N-terminal kinase (JNK) cascade rather than the p38 mitogen-activated protein kinase (MAPK) or the extracellular signal-regulated kinase (ERK) –. Thus, the current study investigated the involvement of JNK in sanguinarine-induced apoptosis. As shown in Fig. 6A, the phosphorylation of JNK was detectable after as little as 15–30 min of sanguinarine treatment and persisted for at least 1–4 h of the treatment. However, the ROS scavenger NAC completely blocked the enhanced phosphorylation of JNK (Fig. 6B). These results indicated that the JNK pathway was activated in a ROS-dependent manner in response to the presence of sanguinarine. To determine whether the activation of JNK participated in apoptosis, the effect of a specific JNK inhibitor, SP600125, on the sanguinarine-treated cells was tested. The results showed that the SP600125 pretreatment did not attenuate the accumulation of apoptotic cells relative to cells treated with SP600125 alone (Fig. 6C). The data indicate that ROS-dependent JNK phosphorylation does not occur upstream of sanguinarine-induced apoptosis in bladder cancer cells. (A) The cells were treated with sanguinarine for the indicated times, or (B) they were pretreated with NAC for 1 h and challenged with sanguinarine for 24 h. They were then harvested, and the indicated proteins were detected by Western blot analysis using anti-p-JNK, anti-JNK antibodies, and an ECL detection system. (C) The cells were treated with or without SP600125 for 1 h before challenge with sanguinarine for 24 h. The cells were analyzed using a flow cytometer to determine annexin-V. Data are reported as means ± SD of three independent experiments. For statistical analysis, the t-test was performed (*p<0.05 vs. untreated cells). Association of ROS-dependent Up-regulation of Egr-1 with Sanguinarine-induced Apoptosis Finally, the potential relationship between sanguinarine-induced apoptosis and Egr-1 expression was investigated. As shown in Fig. 7A, time-course analyses demonstrated that 1.5 µM of sanguinarine induced Egr-1 proteins within 2 h, and these did not return to baseline for 4 h. As sanguinarine generated ROS within 0.5 h, levels of ROS decreased after 2 h (Fig. 4), and the expression of Egr-1 by sanguinarine maximally increased over the 2–4 h treatment period, potential ROS-induced regulation of the induction of Egr-1 was investigated. Immunoblotting data indicated that blocking the generation of ROS by pretreatment of the cells with NAC markedly eliminated sanguinarine-induced Egr-1 proteins in the three cell lines (Fig. 7B). To investigate the role of Egr-1 in sanguinarine-induced apoptosis, Egr-1 gene expression was successfully down-regulated using Egr-1 siRNA (Fig. 7C). Its effect on PARP cleavage, as well as on apoptosis induction, was then evaluated. As shown in Fig. 7D and E, the inhibition of Egr-1 expression effectively mitigated the sanguinarine-induced degradation of PARP and the accumulation of apoptotic sub-G1 cells. The results confirm that the induction of apoptosis by sanguinarine occurs in an Egr-1-dependent manner and that an increase in ROS generation is required for activation of Egr-1 and the occurrence of sanguinarine-induced apoptosis in bladder cancer cells. The cells were treated with sanguinarine for the indicated times (A) or treated with or without NAC for 1 h before challenge with sanguinarine for 2 h (B). Then, equal amounts of proteins (30 µg) were separated on SDS-polyacrylamide gels and transferred to nitrocellulose membranes. The membranes were probed with anti-Egr-1 antibody, and the proteins were visualized using an ECL detection system. (C–E) The cells were transfected with siRNA against human Egr-1 using a transfection reagent. After 24 h of transfection, the cells were treated with sanguinarine for another 2 h (C) or 24 h (D and E). They were then harvested, and the indicated proteins were detected by Western blot analysis (C and D). Furthermore, the cells were evaluated by a flow cytometer for annexin-V (D). The results are expressed as the mean ± SD of three independent experiments. The statistical significance of the results was analyzed with a Student’s t-test (*p<0.05 vs. untreated control; #p<0.01 vs. sanguinarine-treated cells). To study the mechanisms by which sanguinarine treatment induces apoptosis in bladder cancer cells, the present study examined a number of markers associated with apoptotic cell death. The mechanism of apoptosis is divided into two pathways: an extrinsic death receptor–mediated apoptotic pathway and an intrinsic mitochondria-mediated apoptotic pathway. Caspase activation is generally considered a key hallmark of apoptosis in these pathways. The extrinsic pathway is activated at the cell surface when a specific death ligand binds to its corresponding cell-surface receptor. In this pathway, caspase-8 acts as an initiator caspase, which activates the downstream effector caspases, such as caspase-3, -6, and -7. On the other hand, the intrinsic pathway has an apoptotic signal originating from within the cells, and it relies on the permeabilization of mitochondrial membranes to release apoptogenic mitochondrial proteins into the cytosol, thereby activating the initiator caspase-9. The activated caspase-9 initiates downstream events by directly cleaving and activating effector caspases, generating a fragment that activates the mitochondrial pathway , . Apoptosis can also be regulated by several gene products, such as the Bcl-2 family of antiapoptotic and proapoptotic proteins, and the IAP family proteins, which are able to bind and inhibit caspases , . In the mitochondrial death pathway, the ratio of expression of the proapoptotic proteins such as Bax and Bak and the antiapoptotic proteins such as Bcl-2 and Bcl-xL ultimately determines cell death or survival. In addition, caspase-8 mediates the intrinsic pathway via cleavage of the proapoptotic Bid protein, a BH3-only protein, to a truncated Bid (tBid) through translocation from the cytosol to the mitochondria, triggering mitochondrial dysfunction, followed by activation of caspase-9 . This study demonstrated that the expression of the proapoptotic Bax showed an increase in sanguinarine-induced apoptosis, whereas the amount of antiapoptotic Bcl-2 and Bcl-xL remained relatively unchanged (Fig. 3A). The data also demonstrated that sanguinarine treatment induced apoptosis through activation of two initiator caspases, caspase-8 and -9, which were involved in the extrinsic and intrinsic pathways, respectively, as well as effector caspase-3 (Fig. 3B and C), which was associated with concomitant cleavage of PARP, an activated caspase-3 target substrate protein (Fig. 3B) . Additionally, sanguinarine treatment reduced the expression of XIAP, a member of the IAP family of proteins (Fig. 3A), which have been reported to exert antiapoptotic effects because they function as direct inhibitors of activated caspases , . Furthermore, exposure of cells to sanguinarine led to a significant reduction in the whole Bid, indicating that the proapoptotic protein, Bid, was truncated (Fig. 3A). Thus, the present data indicate that both extrinsic and intrinsic pathways may have contributed, at least in part, to the sanguinarine-induced apoptosis of the human bladder cancer cells. Mounting evidence suggests that damaged mitochondria stimulate ROS generation and that disproportionate production of ROS induces apoptosis via the intrinsic pathway by causing damage to mitochondria through activation of caspases –. The data showed that sanguinarine treatment resulted in significantly increased ROS generation early in the process. Co-culture with NAC, a commonly used ROS scavenger, effectively blocked ROS generation (Fig. 4). In addition, blocking the generation of ROS completely prevented apoptosis (Fig. 5A) and recovered the sanguinarine-induced activation of caspases, the degradation of PARP, and the down-regulation of XIAP and whole Bid expression (Fig. 5B and C). These results indicated that ROS generation by sanguinarine is required for apoptosis induction in bladder cancer cells. Recent studies have indicated that various apoptotic stimuli can rapidly activate MAPKs, which include JNK, ERK, and p38MAPK. Among them, the JNK pathway, as an upstream signaling pathway of caspase-3, may play an important role in triggering apoptosis in response to free radicals generated by ultraviolet radiation or direct application of H2O2 , . Thus, the current study investigated whether this signal pathway was involved in the apoptotic effect of sanguinarine in bladder cancer cells. The data indicated that JNK phosphorylation occurs rapidly, within 30 min of sanguinarine treatment, and persists for at least 1–6 h after sanguinarine exposure (Fig. 6A). Pretreatment with NAC efficiently inhibited increased levels of JNK phosphorylation (Fig. 6B). However, SP600125, a specific inhibitor of JNK, did not attenuate the sanguinarine-induced apoptosis (Fig. 6C), suggesting that ROS-dependent JNK activation by sanguinarine cannot act as a mediator of the proapoptotic effects of sanguinarine in human bladder cancer cells. Egr-1 is a member of the immediate-early gene family, and it can be rapidly induced by various stimuli –, , .http://www.ncbi.nlm.nih.gov/pubmed/11331872 The Egr-1 protein plays a pivotal role in the regulation of cell growth, differentiation, and apoptosis. However, studies analyzing the functions of Egr-1 have yielded contradictory findings, with reports of both cytoprotective and proapoptotic functions in tumor cells. Although thttp://www.ncbi.nlm.nih.gov/pubmed/11948693he proapoptotic activity of Egr-1 may depend on the cell type and the nature of the stimulus, Egr-1-mediated apoptosis is associated with regulation of the expression of many tumor suppressor genes such as Egr-1 target genes –. In addition, the promoter site of Egr-1 contains the oxidative stress-responsive DNA sequences region , and most inducers of ROS-mediated signaling pathways increase the levels of Egr-1 –, . Therefore, the current study evaluated the involvement of Egr-1 in ROS-dependent apoptosis of bladder cancer cells by sanguinarine. The data indicated that sanguinarine markedly increased the levels of Egr-1 proteins after 2 h. Blocking the generation of ROS with NAC diminished this effect (Fig. 7A and B). Furthermore, the inhibition of Egr-1 expression by siRNA-mediated knockdown significantly decreased the apoptosis by sanguinarine (Fig. 7C and E). Although the reduction in PARP degradation was only partial (Fig. 7D), the results indicated that Egr-1 plays an important role as a gene regulator in the apoptosis of bladder cancer cells treated with sanguinarine. In conclusion, the present data indicate that human bladder cancer cells undergo apoptosis in response to treatment with sanguinarine and that this occurs through a mitochondria-mediated pathway, which requires ROS generation upstream and the subsequent activation of caspases. The results of this study also suggested that Egr-1, as a target gene of ROS, plays an important role in the regulation of sanguinarine-induced apoptosis. The current data may provide increased understanding of the mechanisms underlying the anticancer activity of sanguinarine, and further dissection of the mechanisms may lead to the development of therapeutic approaches for the attenuation of bladder cancer. Conceived and designed the experiments: MHH WJK YHC. Performed the experiments: MHH CP CYJ. Analyzed the data: MHH GYK YCC. Contributed reagents/materials/analysis tools: GYK SKM. Wrote the paper: MHH YHC. - 1. Laster LL, Lobene RR (1990) New perspectives on Sanguinaria clinicals: individual toothpaste and oral rinse testing. J Can Dent Assoc 56: S19–30. - 2. Mahady GB, Beecher CW (1994) Quercetin-induced benzophenanthridine alkaloid production in suspension cell cultures of Sanguinaria canadensis. Planta Med 60: 553–557. doi: 10.1055/s-2006-959570 - 3. Tandon RK, Singh DS, Arora RR, Lal P, Tandon BN (1975) Epidemic dropsy in New Delhi. Am J Clin Nutr 28: 883–887. - 4. Mitscher LA, Park YH, Clark D, Clark GW 3rd, Hammesfahr PD, et al (1978) Antimicrobial agents from higher plants. An investigation of Hunnemannia fumariaefolia pseudoalcoholates of sanguinarine and chelerythrine. Lloydia 41: 145–150. - 5. Walterová D, Ulrichová J, Preininger V, Simánek V, Lenfeld J, et al. (1981) Inhibition of liver alanine aminotransferase activity by some benzophenanthridine alkaloids. J Med Chem 24: 1100–1103. doi: 10.1021/jm00141a019 - 6. Vavrecková C, Ulrichová J, Hajdúch M, Grambal F, Weigl E, et al. (1994) Effect of quaternary benzo[c]phenanthridine alkaloids sanguinarine, chelerythrine and fagaronine on some mammalian cells. Acta Univ Palacki Olomuc Fac Med 138: 7–10. - 7. Ahmad N, Gupta S, Husain MM, Heiskanen KM, Mukhtar H (2000) Differential antiproliferative and apoptotic response of sanguinarine for cancer cells versus normal cells. Clin Cancer Res 6: 1524–1528. - 8. Adhami VM, Aziz MH, Reagan-Shaw SR, Nihal M, Mukhtar H, et al. (2004) Sanguinarine causes cell cycle blockade and apoptosis of human prostate carcinoma cells via modulation of cyclin kinase inhibitor-cyclin-cyclin-dependent kinase machinery. Mol Cancer Ther 3: 933–940. - 9. Park H, Bergeron E, Senta H, Guillemette K, Beauvais S, et al. (2010) Sanguinarine induces apoptosis of human osteosarcoma cells through the extrinsic and intrinsic pathways. Biochem Biophys Res Commun 399: 446–451. doi: 10.1016/j.bbrc.2010.07.114 - 10. Tsukamoto H, Kondo S, Mukudai Y, Nagumo T, Yasuda A, et al. (2011) Evaluation of anticancer activities of benzo[c]phenanthridine alkaloid sanguinarine in oral squamous cell carcinoma cell line. Anticancer Res 31: 2841–2846. - 11. Lee JS, Jung WK, Jeong MH, Yoon TR, Kim HK (2012) Sanguinarine induces apoptosis of HT-29 human colon cancer cells via the regulation of Bax/Bcl-2 ratio and caspase-9-dependent pathway. Int J Toxicol 31: 70–77. doi: 10.1177/1091581811423845 - 12. Chang MC, Chan CP, Wang YJ, Lee PH, Chen LI, et al. (2007) Induction of necrosis and apoptosis to KB cancer cells by sanguinarine is associated with reactive oxygen species production and mitochondrial membrane depolarization. Toxicol Appl Pharmacol 218: 143–151. doi: 10.1016/j.taap.2006.10.025 - 13. Hussain AR, Al-Jomah NA, Siraj AK, Manogaran P, Al-Hussein K, et al. (2007) Sanguinarine-dependent induction of apoptosis in primary effusion lymphoma cells. Cancer Res 67: 3888–3897. doi: 10.1158/0008-5472.can-06-3764 - 14. Matkar SS, Wrischnik LA, Hellmann-Blumberg U (2008) Sanguinarine causes DNA damage and p53-independent cell death in human colon cancer cell lines. Chem Biol Interact 172: 63–71. doi: 10.1016/j.cbi.2007.12.006 - 15. Kim S, Lee TJ, Leem J, Choi KS, Park JW, et al. (2008) Sanguinarine-induced apoptosis: generation of ROS, down-regulation of Bcl-2, c-FLIP, and synergy with TRAIL. J Cell Biochem 104: 895–907. doi: 10.1002/jcb.21672 - 16. Choi WY, Kim GY, Lee WH, Choi YH (2008) Sanguinarine, a benzophenanthridine alkaloid, induces apoptosis in MDA-MB-231 human breast carcinoma cells through a reactive oxygen species-mediated mitochondrial pathway. Chemotherapy 54: 279–287. doi: 10.1159/000149719 - 17. Simon HU, Haj-Yehia A, Levi-Schaffer F (2000) Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5: 415–418. doi: 10.1023/a:1009616228304 - 18. Skulachev VP (2006) Bioenergetic aspects of apoptosis, necrosis and mitoptosis. Apoptosis 11: 473–485. doi: 10.1007/s10495-006-5881-9 - 19. Wang MF, Liao YF, Hung YC, Lin CL, Hour TC, et al. (2011) Hydroxydibenzoylmethane induces apoptosis through repressing ornithine decarboxylase in human promyelocytic leukemia HL-60 cells. Exp Mol Med 43: 189–196. doi: 10.3858/emm.2011.43.4.023 - 20. Sukhatme VP, Cao XM, Chang LC, Tsai-Morris CH, Stamenkovich D, et al. (1988) A zinc finger-encoding gene coregulated with c-fos during growth and differentiation, and after cellular depolarization. Cell 53: 37–41. doi: 10.1016/0092-8674(88)90485-0 - 21. Virolle T, Adamson ED, Baron V, Birle D, Mercola D, et al. (2001) The Egr-1 transcription factor directly activates PTEN during irradiation-induced signalling. Nat Cell Biol 3: 1124–1128. doi: 10.1038/ncb1201-1124 - 22. Kim JH, Jeong IY, Lim Y, Lee YH, Shin SY (2011) Estrogen receptor beta stimulates Egr-1 transcription via MEK1/Erk/Elk-1 cascade in C6 glioma cells. BMB Rep 44: 452–457. doi: 10.5483/bmbrep.2011.44.7.452 - 23. Yan SF, Lu J, Zou YS, Soh-Won J, Cohen DM, et al. (1999) Hypoxia-associated induction of early growth response-1 gene expression. J Biol Chem 274: 15030–15040. doi: 10.1074/jbc.274.21.15030 - 24. Jones N, Agani FH (2003) Hyperoxia induces Egr-1 expression through activation of extracellular signal-regulated kinase-1/2 pathway. J Cell Physiol 196: 326–333. doi: 10.1002/jcp.10308 - 25. Mishra S, Fujita T, Lama VN, Nam D, Liao H, et al. (2006) Carbon monoxide rescues ischemic lungs by interrupting MAPK-driven expression of early growth response 1 gene and its downstream target genes. Proc Natl Acad Sci USA 103: 5191–5196. doi: 10.1073/pnas.0600241103 - 26. Shin DY, Kim GY, Li W, Choi BT, Kim ND, et al. (2009) Implication of intracellular ROS formation, caspase-3 activation and Egr-1 induction in platycodon D-induced apoptosis of U937 human leukemia cells. Biomed Pharmacother 63: 86–94. doi: 10.1016/j.biopha.2008.08.001 - 27. Aggeli IK, Beis I, Gaitanaki C (2010) ERKs and JNKs mediate hydrogen peroxide-induced Egr-1 expression and nuclear accumulation in H9c2 cells. Physiol Res 59: 443–454. doi: 10.1016/j.yjmcc.2008.02.064 - 28. Kang JM, Kim N, Kim JH, Oh E, Lee BY, et al. (2010) Effect of aging on gastric mucosal defense mechanisms: ROS, apoptosis, angiogenesis, and sensory neurons. Am J Physiol Gastrointest Liver Physiol 299: G1147–1153. doi: 10.1152/ajpgi.00218.2010 - 29. Downes CP, Walker S, McConnachie G, Lindsay Y, Batty IH, et al. (2004) Acute regulation of the tumour suppressor phosphatase, PTEN, by anionic lipids and reactive oxygen species. Biochem Soc Trans 32: 338–342. doi: 10.1042/bst0320338 - 30. Fantini D, Vascotto C, Deganuto M, Bivi N, Gustincich S, et al. (2008) APE1/Ref-1 regulates PTEN expression mediated by Egr-1. Free Radic Res 42: 20–29. doi: 10.1080/10715760701765616 - 31. Sakamoto K, Iwasaki K, Sugiyama H, Tsuji Y (2009) Role of the tumor suppressor PTEN in antioxidant responsive element-mediated transcription and associated histone modifications. Mol Biol Cell 20: 1606–1617. doi: 10.1091/mbc.e08-07-0762 - 32. Tak JK, Lee JH, Park JW (2012) Resveratrol and piperine enhance radiosensitivity of tumor cells. BMB Rep 45: 242–246. doi: 10.5483/bmbrep.2012.45.4.242 - 33. Lazebnik YA, Kaufmann SH, Desnoyers S, Poirier GG, Earnshaw WC (1994) Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 371: 346–347. doi: 10.1038/371346a0 - 34. Papa S, Zazzeroni F, Pham CG, Bubici C, Franzoso G (2004) Linking JNK signaling to NF-kappaB: a key to survival. J Cell Sci 117: 5197–5208. doi: 10.1242/jcs.01483 - 35. Bubici C, Papa S, Dean K, Franzoso G (2006) Mutual cross-talk between reactive oxygen species and nuclear factor-kappa B: molecular basis and biological significance. Oncogene 25: 6731–6748. doi: 10.1038/sj.onc.1209936 - 36. Zhang Z, Teruya K, Eto H, Shirahata S (2011) Fucoidan extract induces apoptosis in MCF-7 cells via a mechanism involving the ROS-dependent JNK activation and mitochondria-mediated pathways. PLoS One 6: e27441. doi: 10.1371/journal.pone.0027441 - 37. Debatin KM (2004) Apoptosis pathways in cancer and cancer therapy. Cancer Immunol Immunother 53: 153–159. doi: 10.1007/s00262-003-0474-8 - 38. MacKenzie SH, Clark AC (2008) Targeting cell death in tumors by activating caspases. Curr Cancer Drug Targets 8: 98–109. doi: 10.2174/156800908783769391 - 39. Hunter AM, LaCasse EC, Korneluk RG (2007) The inhibitors of apoptosis (IAPs) as cancer targets. Apoptosis 12: 1543–1568. doi: 10.1007/s10495-007-0087-3 - 40. Kaufmann T, Strasser A, Jost PJ (2012) Fas death receptor signalling: roles of Bid and XIAP. Cell Death Differ 19: 42–50. doi: 10.1038/cdd.2011.121 - 41. Kelekar A, Thompson CB (1998) Bcl-2-family proteins: the role of the BH3 domain in apoptosis. Trends Cell Biol 8: 324–330. doi: 10.1016/s0962-8924(98)01321-x - 42. Kim BC, Kim HG, Lee SA, Lim S, Park EH, et al. (2005) Genipin-induced apoptosis in hepatoma cells is mediated by reactive oxygen species/c-Jun NH2-terminal kinase-dependent activation of mitochondrial pathway. Biochem Pharmacol 70: 1398–1407. doi: 10.1016/j.bcp.2005.07.025 - 43. Circu ML, Aw TY (2010) Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol Med 48: 749–762. doi: 10.1016/j.freeradbiomed.2009.12.022 - 44. Depre C, Tomlinson JE, Kudej RK, Gaussin V, Thompson E, et al. (2001) Gene program for cardiac cell survival induced by transient ischemia in conscious pigs. Proc Natl Acad Sci USA 98: 9336–9341. doi: 10.1073/pnas.171297498 - 45. Aicher WK, Sakamoto KM, Hack A, Eibel H (1999) Analysis of functional elements in the human Egr-1 gene promoter. Rheumatol Int 18: 207–214. doi: 10.1007/s002960050086 - 46. Rauscher FJ 3rd (1993) Tumor suppressor genes which encode transcriptional repressors: studies on the EGR and Wilms' tumor (WT1) gene products. Adv Exp Med Biol 348: 23–29. doi: 10.1007/978-1-4615-2942-2_2 - 47. Ahmed MM (2004) Regulation of radiation-induced apoptosis by early growth response gene in solid tumors. Curr Cancer Drug Targets 4: 43–52. doi: 10.2174/1568009043481704 - 48. Kim SO, Kwon JI, Jeong YK, Kim GY, Kim ND, et al. (2007) Induction of Egr-1 is associated with anti-metastatic and anti-invasive ability of β-lapachone in human hepatocarcinoma cells. Biosci Biotechnol Biochem 71: 2169–2176. doi: 10.1271/bbb.70103 - 49. Datta R, Taneja N, Sukhatme VP, Qureshi SA, Weichselbaum R, et al. (1993) Reactive oxygen intermediates target CC(A/T)6GG sequences to mediate activation of the early growth response 1 transcription factor gene by ionizing radiation. Proc Natl Acad Sci USA 90: 2419–2422. doi: 10.1073/pnas.90.6.2419

During the Electronica USA/Embedded Systems Conference (San Francisco, Calif.), product initiatives using RapidIO interconnect technology were presented by six member companies of the RapidIO Trade Association. At the meeting, the Association also reviewed its new RapidFabric communications spec. The Association is promoting RapidIO as an ISO-certified, open-standard that promises to seamlessly enable chip-to-chip, board-to-board, control, backplane and data plane interconnections as used in emerging networking, communications and embedded systems (detailed information on the RapidIO specification, products, design tools, member companies, and membership is available at the Association's Web site). With the steady---and predictable---increase in microprocessor clock speeds, system bandwidth requirements are moving beyond the capabilities of any bus architecture. Enter RapidIO as a next-generation switch fabric interconnect architecture for embedded systems. Optimized for both high bandwidth and low latency, RapidIO provides a direct memory-mapped interface (evolved from microprocessor buses) that can be implemented in part of an FPGA or in a small corner of a microprocessor chip. With these features, RapidIO is initially targeted at high-performance embedded applications such as networking, storage, multimedia, and signal processing. Members Propel The Technology Back to the meeting---and its consequences for you. Members in attendance at the Electronica USA/Embedded Systems Conference included Analog Devices, Enea Embedded Technology, Mercury Computer Systems, Texas Instruments, Tundra Semiconductor, and Xilinx. "RapidIO's embedded silicon, software, systems, and OEM companies continue to propel this technology," notes John G. Metz from markey analysis company Metz International. "Research conducted for our Bus Wars report shows that RapidIO will continue to maintain its lead, attaining projected revenues of approximately $2 billion in 2008." (More information is available on the Bus Wars reports at Metz's Web site. The RapidFabric spec is expected to help RapidIO address the needs of communications fabrics developers. It will provide communications equipment makers with protocol-independent encapsulation of any packet/cell/frame protocol data unit (PDU). It will also handle segmentation and reassembly of large (64-kbyte) PDUs, handle hundreds of traffic classes, and millions of flows and PHYs (phycial layers). RapidFabric seamlessly interoperates with the existing RapidIO specification. RapidIO supporters are sanguine. "The RapidFabric initiative should help cultivate massive synergy between RapidIO-based products and AdvancedTCA and CompactTCA form-factors," contends Eric Mantion, senior analyst at research firm In-Stat/MDR. "Together, these technologies could help to change the face of the high-end networking market, and help backers of these technologies capture billions of dollars relatively quickly." What The Vendors Are Doing So, what are the meeting's particpants up to right now? Well, for its part, IC maker Analog Devices is developing serial RapidIO for its next-generation of its popular TigerSHARC DSPs. The company says that the combo of RapidIO's speed between chips, boards, and backplanes, along with TigerSHARC's raw performance, will foster a new class of high-capacity 3G wireless base stations. At realtime operating system (RTOS) house Enea Embedded Technology, the company is fully geared up for RapidIO. The company says that RapidIO matches the firm's OSE RTOS's distributed direct message-passing model, with seamless transparent distribution, dynamic system configuration, fault tolerance, and fault management. Enea says it will soon be showing multi-processing support under OSE featuring RapidIO (parallel) on Motorola's Torridon demo board. This board houses four Moto PowerQUICC III MPC8560 microprocessors and a Tundra Semiconductor Tsi500 RapidIO multi-port switch. Tundra's Tsi500 RapidIO Multi-port Bus Switch and Tsi400 RapidIO-to-PCI Bus Bridge were the first RapidIO system interconnect products to hit the market. At board-level computer maker Mercury Computer Systems, the company's ImpactRT 3100 system is already being used in semiconductor imaging equipment and laser pattern generation equipment for flat panel displays. Mercury's latest RapidIO system, the PowerStream 7000, delivers TeraFLOPS, or more, of total processing power. Over at semiconductor giant Texas Instruments, the company says it's focusing on serial RapidIO for its next-generation of wireless DSPs and ASICs. Elsewhere on the IC scene, FPGA house Xilinx is also expanding its existing RapidIO product offerings. This time it's doing that with the introduction of its ATCA Development Platform. ATCA, combined with Xilinx's RapidIO LogiCore, enables deployment of AdvancedTCA systems targeting the PICMG 3.5 standard for high-speed networking and communications design. Xilinx's ATCA platform features a line-card based on Xilinx's popular Virtex-II Pro FPGAs, test and demo programs, as well as schematic and board layout files. Example FPGA designs and selected reference designs are also available as part of the platform. New members are also joining the RapidIO Trade Association all the time. The newest include semiconductor, software, training, and systems companies. Joining up are AMCC, a company that designs, develops, manufactures, and markets silicon networking technologies for wide area networks (WANs) and storage area networks (SANs), and Honeywell, a well known maker of aerospace products, control technologies for buildings, automotive products, power generation systems, and chemicals, to name a few. Click here for more info about Honeywell. In the domain of commercial-off-the-shelf (COTS) defense and aerospace products, board maker Radstone Technology is also supporting the technology, as is Telesoft Technologies, a developer of GSM mobile, open programmable switches, test and diagnostic, broadband, surveillance and monitoring equipment that's located in England. Joining as a so-called auditing participant is Arnewsh. It provides RapidIO technical training programs. Arnewsh focuses on products from Motorola, including the latter's PowerQUICC III processor that uses the RapidIO interconnect. For its part, Arnewsh will focus on details of RapidIO's architecture, address common system and design questions, compare competing interconnect technologies, and review RapidIO's use in control and data plane applications. Another particpant is DRS Signal Solutions. DRS specializes in communications-surveillance products that meld both RF and DSP technologies. Another company climbing aboard is Jennic, a provider of intellectual property (IP) and silicon design services to broadband communications developers. Jennic announces plans to develop IP supporting RapidIO. Finally, Nexus Technology, a maker of test equipment, is part of the group. Nexus focuses on RapidIO in conjunction with Tektronix logic analyzers. So there you have it. As you can see, RapidIO is rapidly gaining adherents, new products, and supporters.

Natixis research receives recognition for excellence Natixis is regularly awarded for its research expertise and has just received recognition once again for the excellence of its research. These latest rankings reflect the quality of Natixis’ research analysis which our clients factor into their investment decisions. Natixis: reputed for its research Natixis has for the first time been named Commodities Research House of the Year in the Energy Risk Awards rankings (1). The Credit Research team, meanwhile, is among the TOP 5 for the 5th year running in most categories, according to the Euromoney (2) rankings, and was named Best Credit Research in the covered bonds, supranational & agencies and utilities categories. Lastly, the Equity Research team ranks 2nd in France with 9 awards in the Thomson Reuters Analyst Awards (3) rankings. All these awards reflect the expertise of Natixis’ research teams and their commitment to their clients. Natixis research, a client-centric cross-expertise approach Natixis’ capital market activities include some 80 analysts, economists and strategists located in the world’s leading financial market places, dedicated professionals who care about your needs in each asset class : credit, equities, economics, multi-asset strategies and SRI(4). - A cross-approach to research A global vision of experts working in synergy on topical issues. The combination of their skills in the credit, equity and economic fields offers our clients an overview of the markets, enabling them to make arbitrage and investment choices. - Distinctive and high value-added research Our reports adopt a top-down approach. Starting with a broad analysis, our experts fine-tune the most relevant points in credit, equity, macroeconomic research, in addition to rates, forex, commodity markets and investment strategies. (1) ‘Commodities Research House of the Year’ in the Energy Risk Awards 2016 (2) Euromoney Fixed Income Research Survey 2016 (3) Thomson Reuters Analyst Awards 2016 – Food & Beverages, Insurance, Retail & Consumer Products, Construction, Energy & Chemicals, Utilities. (4) Socially Responsible Investment

Welcome to PPoPP'14 19th ACM SIGPLAN Symposium on Principles and Practice of Parallel Programming PPoPP is a forum for leading work on all aspects of parallel programming, including foundational and theoretical aspects, techniques, tools, and practical experiences. In the context of the symposium, "parallel programming" encompasses work on concurrent and parallel systems (multicore, multithreaded, heterogeneous, clustered systems, distributed systems, and large scale machines). Given the rise of parallel architectures into the consumer market (desktops, laptops, and mobile devices), PPoPP is particularly interested in work that addresses new parallel workloads, techniques and tools that attempt to improve the productivity of parallel programming, and work towards improved synergy with such emerging architectures. The 19th ACM SIGPLAN Symposium on Principles and Practice of Parallel Programming will be held in Orlando, Florida, in February 2014. The goal of the PPoPP Symposia is to provide a forum for papers on the principles and foundations of parallel programming, tools and techniques for parallel programming, and experiences in using parallel programming to solve applications problems. As in previous years, PPOPP'14 will feature a single-track program of talks for the accepted full papers, along with sessions for submissions accepted for poster presentation. The published proceedings will include all full papers as well as 2-page summaries of posters from authors who choose to provide it. It is the clear intent of the conference that the published summary of a poster should not preclude the publication of the work through a full paper in a conference and/or journal in the future. PPoPP'14 will be co-located with HPCA-2014 and CGO-2014. PPoPP 2014 Awards | Abstract submission:|| September 8, 2013 (11:59pm Eastern Daylight Time)| | Full paper submission:|| September 15, 2013 (11:59pm Eastern Daylight Time) Hard deadline. No Extension.| | Rebuttal period:|| October 30 - November 3, 2013 Tentative| | Notification of acceptance:|| November 12, 2013|

A Phase I clinical trial has been proposed that uses neutralising monoclonal antibodies (MAbs) as passive immunoprophylaxis to prevent mother-to-child transmission of HIV-1 in South Africa. To assess the suitability of such an approach, we determined the sensitivity of paediatric HIV-1 subtype C viruses to the broadly neutralising MAbs IgG1b12, 2G12, 2F5, and 4E10. Methods and Findings The gp160 envelope genes from seven children with HIV-1 subtype C infection were cloned and used to construct Env-pseudotyped viruses that were tested in a single-cycle neutralisation assay. The epitopes defining three of these MAbs were determined from sequence analysis of the envelope genes. None of the seven HIV-1 subtype C pseudovirions was sensitive to 2G12 or 2F5, which correlated with the absence of crucial N-linked glycans that define the 2G12 epitope and substitutions of residues integral to the 2F5 epitope. Four viruses were sensitive to IgG1b12, and all seven viruses were sensitive to 4E10. Only 4E10 showed significant activity against HIV-1 subtype C isolates, while 2G12 and 2F5 MAbs were ineffective and IgG1b12 was partly effective. It is therefore recommended that 2G12 and 2F5 MAbs not be used for passive immunization experiments in southern Africa and other regions where HIV-1 subtype C viruses predominate. Citation: Gray ES, Meyers T, Gray G, Montefiori DC, Morris L (2006) Insensitivity of Paediatric HIV-1 Subtype C Viruses to Broadly Neutralising Monoclonal Antibodies Raised against Subtype B. PLoS Med 3(7): e255. doi:10.1371/journal.pmed.0030255 Academic Editor: Lynne Mofenson, National Institute of Child Health and Human Development, United States of America Received: October 19, 2005; Accepted: March 22, 2006; Published: July 18, 2006 Copyright: © 2006 Gray et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was funded from grants from the South African AIDS Vaccine Initiative (SAAVI), The Fogarty International Center (TWO-0231), and the Wellcome Trust, UK. LM is a Wellcome Trust International Senior Research Fellow in Biomedical Research. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Abbreviations: IC 50 , inhibitor concentration; MAb, monoclonal antibody; MTCT, mother-to-child transmission; PBMC, peripheral blood mononuclear cell; PNG, predicted N-linked glycosylation; sCD4, soluble CD4; TCID 50 , tissue culture infectious dose AIDS is caused by HIV. By killing the cells of the body's immune system, HIV infection makes people vulnerable to many potentially fatal bacterial and viral diseases. HIV is most commonly spread through unprotected sex with an infected partner but it can also pass from mother to child during late pregnancy or birth, or through breast milk. At least one in four infected women will transmit HIV to their babies if left untreated. But if infected women are treated with drugs that fight HIV—so-called antiretrovirals—during late pregnancy and if breastfeeding does not occur, only one to two babies in 100 will become infected with HIV. In addition, elective Caesarian section has been found to be protective against HIV infection. Implementation of this approach has greatly reduced mother-to-child transmission in developed countries, but most HIV-infected women live in developing countries where access to antiretrovirals is limited. In these cases, treatment of pregnant women (during pregnancy and delivery) and their newborn babies with a single dose of one antiretroviral drug, which can halve HIV transmission, is used, even though WHO/UNAIDS recommends simple antenatal, intrapartum, and postnatal antiretroviral regimens to achieve levels of less than 5% transmission in resource poor settings. These strategies will not have an impact on breastmilk transmission, which accounts for half the transmissions in these settings. Why Was This Study Done? One way to reduce breastmilk transmission of HIV might be by “passive immunization.” In this, newborn babies would be injected with HIV-specific antibodies—proteins that stick to molecules on the surface of HIV. Because the virus uses these molecules to invade the baby's immune cells, injected antibodies might stop HIV from the mother becoming established in her offspring. Four antibodies have been made in the laboratory—so-called human monoclonal antibodies—that bind to the surface of HIV subtype B, which is found mainly in Europe and North America, and stop HIV from killing human cells. However, most HIV isolated in Africa is subtype C, so in this study researchers have tested whether these antibodies prevent HIV subtype C killing cells grown in the laboratory. It is important, they argue, that antibodies should be shown to work outside the body before testing passive immunization in babies. What Did the Researchers Do and Find? The researchers isolated several subtype C viruses from babies born in Johannesburg, South Africa, and made artificial viruses (known as “pseudotyped” viruses) from them. These artificial viruses could then be used in tests to see whether the human monoclonal antibodies could prevent the viruses infecting human cells in a laboratory test, that is, whether the viruses were “sensitive” to the antibodies. All the viruses were insensitive to two of the antibodies (2G12 and 2F5), and the researchers show that this was because the viruses lacked the specific parts of the HIV surface molecules recognized by these antibodies. Four of the viruses were sensitive to an antibody called IgG1b12, and all were sensitive to antibody 4E10, albeit at high concentrations that might be difficult to achieve in people. Finally, the researchers report that the sensitivity of the viruses was not enhanced by using all four antibodies at the same time. What Do These Findings Mean? Given these results, the researchers warn against using 2G12 and 2F5 antibodies for passive immunization to prevent mother-to-child transmission, in particular postnatal transmission, in areas where most people are infected with HIV subtype C viruses. Furthermore, because animal studies have indicated that only combinations of at least three monoclonal antibodies with activity against HIV in laboratory tests provide complete protection against HIV infection, the researchers question whether any clinical trials on passive immunization should be started with currently available antibodies. Their doubts about such trials are heightened by observations that 4E10 and 2F5 react against antigens present on human cells, which might make them unsafe for use in people, although so far no adverse effects have been seen in adults treated with these antibodies. However, these experiments used an artificial laboratory-based assay and it's possible that these antibodies might kill HIV subtype C more effectively in people; other components of the immune system might help them deal with the virus. If clinical studies of these antibodies do go ahead, it is essential that the babies in these trials must be carefully monitored to ensure that the antibodies are safe, and they and their mothers should also be given access to optimal antiretroviral prophylaxis according to WHO/UNAIDS guidelines. In a related PLoS Medicine Perspective paper (http://dx.doi.org/10.1371/journal.pmed.0030259), Miroslaw Gorny1 and Susan Zolla-Pazner discuss the study further and stress the critical need to determine if passive immunization with such antibodies could decrease mother-to-child transmission of HIV, and if so what the best antibodies would be. Please access these Web sites via the online version of this summary at http://dx.doi.org/10.1371/journal.pmed.0030255. • National Institute of Allergy and Infectious Diseases fact sheets on HIV infection and AIDS. • US Centers for Disease Control and Prevention information on HIV/AIDS, including pages on the prevention of mother-to-child transmission. • MedlinePlus encyclopedia entry on HIV/AIDS. • Preventing mother-to-child transmission of HIV Web page. Only four broadly neutralising monoclonal antibodies (MAbs) against HIV-1 have been generated to date, all of which were derived from patients with HIV-1 subtype B infection. IgG1b12 recognizes an epitope overlapping the CD4 binding site in the envelope glycoprotein complex [1–5], and 2G12 recognizes a mannose-rich epitope on the silent face of gp120 [6–10]. The 2F5 and 4E10 linear MAbs are located in the membrane-proximal external region of gp41 [11–13]. Passive transfer studies in primates using combinations of these MAbs have provided strong evidence that MAbs are able to control viral replication [14–17] and prevent HIV-1 infection parenterally and through mucosal tissues [18, 19]. More recent data have shown that in some individuals with HIV infection, these MAbs can reduce the rate of viral rebound following a structured treatment interruption . Furthermore, oral challenge studies in neonatal macaque monkeys support the use of neutralising MAbs for prevention of virus transmission to human infants [21, 22]. Mother-to-child transmission (MTCT) of HIV-1 infection remains a significant problem in developing countries. While the use of single-dose nevirapine, acting to prevent intrapartum transmission, has reduced the number of infections, more potent interventions are needed, particularly to prevent postpartum transmissions. It is estimated that in South Africa alone, approximately 96,000 children with HIV-1 infection were born in 2003 . Passive immunization using neutralising MAbs has been suggested as a strategy to prevent breast milk–borne infections [24, 25]. Whether this approach is valid is likely to depend on the efficacy of these MAbs against the targeted viruses. The most common subtype of HIV-1 infection in southern Africa as well as globally is subtype C ( http://www.unaids.org). Results from a previous study indicated that a combination of the MAbs 2F5, 2G12, IgG1b12, and 4E10 successfully neutralised 100% of HIV-1 subtype C isolates tested . However, other studies have shown that 2F5 and 2G12 MAbs are usually ineffective against HIV-1 subtype C viruses, while 4E10 is able to neutralise isolates from all subtypes [27, 28]. To further address whether 2G12, 2F5, IgG1b12, and 4E10 are active against HIV-1 subtype C viruses, we tested them in an Env-pseudotyped virus infectivity assay. We chose to use specifically those viruses derived from infants and children who had perinatally acquired HIV-1 infection to determine whether or not these MAbs are effective in vitro as an indication of their potential use for prevention of MTCT. HIV-1 Subtype C Viral Isolates Viruses were isolated from the blood of children with HIV-1 infection by standard co-culture techniques using peripheral blood mononuclear cells (PBMCs) [29, 30]. Blood samples were collected from children residing in an orphanage or receiving medical care at the Chris Hani Baragwanath Hospital in Johannesburg between 1999 and 2002 (Table 1) . Informed consent was obtained from either a parent or a guardian of each child at the time of blood collection. This study received ethical approval from the University of the Witwatersrand Committee for Research on Human Subjects (Medical) (Johannesburg, South Africa). Patient Information and Viral Isolate Characteristics for HIV-1 Subtype C Cloned Envelope Genes MAbs, sCD4, and Plasma Samples MAbs were obtained from the National Institutes of Health Reference and Reagent Program (Germantown, Maryland, United States) and the International AIDS Vaccine Initiative Neutralizing Antibody Consortium (New York, New York, United States), and used at a starting concentration of 50 μg/ml. Recombinant soluble CD4 (sCD4) comprising the extracellular domain of human CD4 produced in Chinese hamster ovary cells was obtained from Progenics Pharmaceuticals (Tarrytown, New York, United States), and tested at 50 μg/ml. Two plasma samples (BB12 and IBU21) from blood donors with HIV-1 subtype C infection were tested at a starting dilution of 1:50. JC53-bl cells were obtained from the National Institutes of Health Reference and Reagent Program (catalog number 8129). These cells were derived from a HeLa cell clone that expresses CD4, CCR5, and CXCR4 constitutively and contains two reporter genes: firefly luciferase and Escherichia coli β-galactosidase under the control of the HIV-1 LTR promoter . The 293T cells used for transfection were obtained from the American Type Culture Collection (Manassas, Virginia, United States). Both cell lines were cultured in D-MEM containing 10% heat-inactivated fetal bovine serum. Cell monolayers were disrupted at confluency by treatment with 0.25% trypsin in 1mM EDTA. Cloning of Envelope Genes and Production of Pseudovirions Proviral DNA extracted from in vitro infected PBMCs was used to amplify full-length envelope genes. The 3-kilobase PCR fragments, generated using envA and envM primers , were cloned into the pCDNA 3.1-TOPO vector (Invitrogen, Carlsbad, California, United States) and bacterial colonies screened by PCR for insertion and correct orientation using T7 and envM primers. The Env-pseudotyped virus stocks were generated by co-transfecting 2 μg of the env encoding plasmid DNA with 3.3 μg of the HIV genomic vector SG3delta env (a gift from Beatrice Hahn) into an 80% confluent monolayer of 293T cells in a T-25 culture flask in the presence of 40 μl of PolyFect Transfection Reagent (Qiagen, Heidelberg, Germany). The media was replaced 6–8 h after transfection; 48 h later, culture supernatant containing the pseudoviruses was harvested, filtered (0.45 μm), and stored at −70 °C. The tissue culture infectious doses (TCID50) were quantified by infecting JC53-bl cells with serial 5-fold dilutions of the supernatant in quadruplicate in the presence of DEAE dextran (30 μg/ml) (Sigma, St. Louis, Missouri, United States). The infection was monitored 48 h later by evaluating the luciferase activity using the Bright Glo Reagent (Promega) following manufacturer instructions. Luminescence was measured in a Wallac 1420 Victor Multilabel Counter (Perkin Elmer, Wellesley, California, United States). TCID50 was calculated as described . Wells with relative light units greater than 2.5 times the negative control (mock infection) were considered positive for infection. Single-Cycle Neutralisation Assay Neutralisation was measured as a reduction in luciferase gene expression after a single-round infection of JC53-bl cells with Env-pseudotyped viruses . Briefly, 200 TCID50 of pseudoviruses in 50 μl culture media was incubated with 100 μl of serially diluted MAbs, plasma, or sCD4 using D-MEM with 10% fetal bovine serum in a 96-well plate in triplicate for 1 h at 37 °C. MAbs were either tested singly starting at 50 μg/ml (before addition of cells) or in combination also at 50 μg/ml for each MAb. Thus, TriMab contained 2G12, IgG1b12, and 2F5 (50:50:50 μg/ml) and TriMab plus 4E10 contained 2G12, IgG1b12, 2F5, and 4E10 (50:50:50:50 μg/ml). A 100-μl solution of JC53-bl cells (1 × 104 cells/well) containing 75 μg/ml DEAE dextran was added; the cultures were then incubated at 37 °C in 5% CO2/95% air for 48 h. Infection was monitored by evaluating the luciferase activity. Titres were calculated as inhibitor concentration (IC50) or reciprocal plasma dilution (ID50) values causing 50% reduction of relative light units compared to the virus control (wells with no inhibitor) after subtracting the background (wells without virus infection). IC50 values obtained for MAb combinations were compared to MAbs tested singly. The HIV-1 subtype B pseudovirus QH692.42 was included as a positive control, because this virus has been known to be sensitive to all four of the test MAbs [36, 37]. Cloned env genes were sequenced using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer Applied Biosystems, Foster City, California, United States) and resolved on an ABI 3100 automated genetic analyzer. The full-length gp160 sequences were assembled and edited using Sequencher (version 4.0) software (Gene Codes, Ann Arbor, Michigan, United States). HIV-1 Subtype C Cloned Envelopes from Paediatric Patients We cloned complete (gp160) envelope genes from seven HIV-1 subtype C isolates cultured from the blood of children with perinatally acquired HIV-1 infection. Five of these isolates were from rapidly progressing infants (RP and COT) who developed severe clinical symptoms within the first year of life, most of whom died shortly after blood collection (Table 1). Two isolates were from children who had survived for between 6 and 9 y and were moderately symptomatic with illnesses, such as lymphocytic interstitial pneumonitis. All isolates used the CCR5 co-receptor, while viruses from one rapidly progressing infant (RP1) also used the CXCR4 co-receptor and was therefore dualtropic . The Env-pseudotyped virus derived from the latter isolate was able to use only CXCR4 as co-receptor, while the other six pseudoviruses used CCR5 (Table 1). All cloned envelopes were sequenced and compared to the original viral isolate. Phylogenetic analysis indicated that all samples were HIV-1 subtype C isolates; sequences from the same individual clustered together with high bootstrap values (unpublished data). Neutralisation Sensitivity of HIV-1 Subtype C Env-Pseudotyped Viruses to MAbs The HIV-1 subtype C envelope clones were used to generate Env-pseudotyped viruses by co-transfection with a subgenomic plasmid. These pseudoviruses were tested for their sensitivity to neutralisation by the MAbs IgG1b12, 2G12, 2F5, and 4E10. The MAbs 2G12 and 2F5 failed to neutralise any of the seven HIV-1 subtype C pseudoviruses at 50 μg/ml, whereas the HIV-1 subtype B virus QH692.42 had IC50 values of 0.8 and 7.1, respectively (Table 2). The IgG1b12 neutralised four of the seven HIV-1 subtype C viruses as well as the HIV-1 subtype B control. The IC50 values of the sensitive pseudoviruses ranged from 0.2 μg/ml to 12 μg/ml, indicating high potency of this MAb. The MAb 4E10 neutralised all the viruses. The IC50 values were generally high, supporting the notion that this MAb has broad specificity but lower potency than other MAbs . Sensitivity of HIV-1 Subtype C Pseudovirions to Anti-HIV MAbs, sCD4, and Plasma Neutralisation Using Combinations of MAbs Synergistic neutralisation among MAbs that recognize different specificities in the envelope glycoprotein has been suggested [38, 39], although it has been a controversial topic. We decided, therefore, to test combinations of these MAbs using equimolar concentrations of 2G12, IgG1b12, and 2F5 (TriMAb), and TriMAb plus 4E10. The IC50 values in the presence of TriMAb were similar to those for IgG1b12 alone (Table 2), indicating that the activity in TriMAb was probably due to the activity of IgG1b12. When 4E10 was added to TriMAb, it was not surprising that neutralisation of all isolates was achieved, because 4E10 was active against all isolates when used alone at this concentration range. Analysis of the dose-response curves confirmed the lack of significant synergy among MAbs. Those viruses sensitive to IgG1b12 (RP4.3, RP6.6, TM7.9, and COT9.6) had similar neutralisation curves in the presence of IgG1b12 alone or when tested as part of TriMAb with or without 4E10 (Figure 1A). However, among isolates insensitive to IgG1b12 (COT6.15, TM3.8, and RP1.12), slightly greater potency was observed with TriMAb plus 4E10, compared to 4E10 alone (Figure 1B). The MAb concentrations in the triple and quadruple combination are represented as the concentration of each MAb in the equimolar mix starting at 50 μg/ml. Results are shown as the reduction of virus infectivity relative to the virus control (without MAbs) with 50% inhibition indicated by a dotted line. Note those viruses sensitive to IgG1b12 and 4E10 (A) and those viruses sensitive to 4E10 alone (B). Sensitivity to sCD4 and Polyclonal Anti-HIV Antibodies Given the relative resistance of the HIV-1 subtype C pseudovirions to neutralisation by MAbs, we chose to test their responses to sCD4 and polyclonal antibodies from individuals with HIV-1 infection. sCD4, which blocks gp120 binding to the CD4 receptor, neutralised all of the pseudovirions (Table 2), indicating that the CD4 binding site is accessible on the pseudotyped envelope glycoproteins. The IgG1b12 binding site overlaps with the CD4 binding site; however, there was no correlation between the ID50 values for sCD4 and IgG1b12 in this assay, similar to what others have reported [28, 40]. All pseudovirions except TM7.9 were neutralised by one or both of the plasma samples with a wide variation in IC50 titres, as is often seen when using polyclonal antibodies, suggesting that these envelopes were not atypical in their ability to be neutralised (Table 2). Analysis of Amino Acid Sequences Comprising the Neutralisation Epitopes Sequence analysis of the predicted N-linked glycosylation (PNG) sites at positions 295, 332, and 392, which are critical for the 2G12 epitope, indicated that all HIV-1 subtype C isolates lacked the glycan 295. TM7.9 also lacked the glycan 392 (Table 3). Another site (position 386), reported to play an indirect role in the formation of the 2G12 epitope, was also absent from one of the HIV-1 subtype C envelopes. The HIV-1 subtype B pseudovirus QH692.42 was the only virus possessing all five PNG sites and was the only virus sensitive to 2G12. These data suggest that the lack of the glycan 295 renders isolates resistant to 2G12, as previously suggested [9, 10]. Amino Acid Sequences of MAb Epitopes in Cloned Subtype C Envelope Genes The 2F5 epitope is centred on the sequence ELDKWA . Mutagenesis studies have revealed that the amino acid residues DKW are indispensable for the recognition by this MAb [13, 41]. In particular, substitutions at residue K665 appear to be the major determinant of resistance . In this study, all HIV-1 subtype C isolates had substitutions at position 665 with the lysine (K) residue replaced by serine (S) or other amino acids (R or N), while the HIV-1 subtype B pseudovirus QH692.42 had no such substitution. These data support the finding that the residue K665 is crucial for neutralisation by 2F5. 4E10 recognizes an epitope containing the sequence NWF(D/N)IT [12, 42] at the C-terminal of the 2F5 epitope. Mutagenesis experiments have shown that the residues W672, F673, and W680 are indispensable for recognition by 4E10 , while the crystal structure of the Fab 4E10-epitope complex indicates that W672, F673, I675, and T676 are the key residues in this interaction . All the viruses analyzed in this study had a conserved 4E10 epitope (W672, F673, W680), consistent with their phenotypic sensitivity to this MAb. The neutralisation sensitivity of HIV-1 subtype C isolates derived from children appears similar to previously reported sensitivity of isolates from adults with HIV-1 subtype C infection [27, 28]. Thus the broadly cross-reactive neutralising MAbs 2G12 and 2F5 are ineffective against both paediatric and adult HIV-1 subtype C viruses, while IgG1b12 potently neutralised approximately 50% of the tested viruses. Only 4E10 showed broad activity against HIV-1 subtype C viruses, although its potency was low. Collectively, these data caution against the use of 2G12 and 2F5 MAbs for passive immunization in areas where HIV-1 subtype C viruses are highly prevalent. In this study, we have used cloned envelope genes in a single-cycle neutralisation assay, which is a high-throughput assay that, to our knowledge, is rapidly becoming the method of choice for measuring antibody neutralisation [37, 44]. Comparative studies have shown a positive correlation between results derived from this assay and the more traditional PBMC-based neutralisation assay (Taylor et al., unpublished data) . However, the 293T-derived pseudovirions were found to be more sensitive to neutralisation by MAbs and serum samples when compared to the uncloned PBMC-derived viruses [27, 37]. It has been suggested that this effect is due to the cells used to generate the pseudoviruses and not the nature of the target cells or the clonal nature of the envelope [27, 45]. Overall, we can be confident that the observed resistance of HIV-1 subtype C isolates to 2G12 and 2F5 is not due to the use of an Env-pseudotyped virus-based neutralisation assay. Instead, the extra sensitivity of the latter assay might be expected to generate false-positive and not false-negative outcomes. It has been shown in multiple studies that 2G12 is generally ineffective against HIV-1 subtype C isolates [27, 28]. The 2G12 epitope binds a cluster of mannose residues; the absence of an N-linked glycan at position 295 appears to correlate with resistance to this MAb [9, 10]. The absence of N295 may prevent the correct processing and presentation of glycans at position 332, affecting antibody binding and therefore neutralisation . A recent study has shown that reintroduction of this PNG site into a subtype C isolate restored binding of 2G12, although sensitivity to neutralisation was not tested . An analysis of 339 HIV-1 subtype C envelope sequences obtained from Los Alamos Database showed that 83% of sequences lacked a glycosylation site at position 295. If the lack of the PNG at position 295 is indeed a cause of resistance to 2G12, then a majority of HIV-1 subtype C viruses would be insensitive to this MAb. The 2F5 MAb has been shown to have broadly neutralising activity but has minimal efficacy against HIV-1 subtype C viruses [27, 28]. An alanine scan over the ELDKWAS epitope defined the motif DKW in positions 664–666 as a determinant for 2F5 recognition , although some viruses with this epitope are insensitive to this MAb . However, all viruses with a substitution at residue K665 are resistant to 2F5 . Similarly, in this study, we found that all resistant viruses had a substitution at K665 while the subtype B virus did not. Analysis of 324 sequences in Los Alamos Database showed that the subtype C consensus for the 2F5 epitope is ALDSWA, with only approximately 12% bearing a K at position 665. This suggests that the majority of HIV-1 subtype C viruses will also be resistant to 2F5. However, a geographical clustering of some HIV-1 subtype C variants that may be sensitive to 2F5 due to the presence of the DKW epitope has been suggested . Our data with IgG1b12 agree with other studies in that this MAb is more effective than 2F5 or 2G12 at neutralising HIV-1 subtype C viruses, although IgG1b12 inhibited only approximately 50% of the isolates tested [27, 28]. Among sensitive isolates, this MAb is particularly potent and requires very low antibody concentrations for 50% inhibition. Due to the conformational nature of the IgG1b12 epitope, it is difficult to predict resistance to this MAb by simple sequence analysis. Some studies have described neutralisation escape mutations for this MAb, such as a proline-to-alanine substitution in position 369 in the C3 region of gp120 [47, 48]. In this study, we found no correlation between the presence of a proline at this position and sensitivity to IgG1b12, which suggests that this escape mutation was specific to the isolate used in the referred study. The 4E10 epitope appears to be the most broadly cross-reactive MAb described to date, neutralising all viruses so far tested. In previous studies, 4E10 has been shown to neutralise 100% of viruses in a comprehensive panel that included all genetic subtypes of HIV-1 group M and some recombinant forms [27, 49]. However, 4E10 is a low-potency antibody generally requiring high concentrations to reduce infectivity by 50%, as seen in this and other studies [20, 27]. Whether this is a property of the antibody or inaccessibility of the epitope remains to be determined. The motif WF on the 4E10 epitope was 100% conserved in 324 sequences of this portion of gp41 from HIV-1 subtype C viruses in Los Alamos Database. This suggests that HIV-1 subtype C viruses will be universally sensitive to 4E10. Some studies have suggested that MAbs can act synergistically to increase neutralisation potency against HIV-1 [26, 38, 39, 50, 51]. However, this has been a controversial topic, and isolate dependency has been observed [51, 52] with different results obtained with T-cell line-adapted virus and primary isolates [39, 50, 52]. In this study, we did not observe strong synergy among these MAbs. The combination of the four MAbs neutralised all the tested viruses in agreement with other study results for HIV-1 subtype C isolates . This is likely due to the neutralisation activity of individual MAbs rather than the combined effect of them, because a significant increase in potency was not observed with the mixtures. There may have been a slight synergistic effect for RP1.12, TM3.8, and COT6.15 as demonstrated by increased neutralisation when 4E10 was combined with IgG1b12, 2F5, and 2G12. Such an effect is probably due to IgG1b12, given the absence of the 2G12 and 2F5 epitopes in these viruses. A more thorough analysis of synergism would require titrating 4E10 against IgG1b12 and evaluating the data based on the Chou-Talalay method [39, 53]. It is also possible that the clonal nature of the envelope glycoproteins used in this study precluded the detection of synergism. Some researchers have suggested that the heterogeneity of the virus is the cause of the synergistic effects of some neutralising antibody combinations . However, others have observed no differences between virus isolates passaged in PBMCs and cloned envelope pseudotype viruses . The MTCT of HIV-1 infection is usually associated with transmission of single variants . In this study, four of the cloned envelopes were from children infected for fewer than 12 mo, two of which were infected for 4 mo and therefore represent relatively early variants. Although these clones may not have been the earliest transmitted variants, it is unlikely that earlier variants would differ in their neutralisation sensitivity to these MAbs. We base this assumption on the fact that the MAb sensitivities of viruses from adults with HIV-1 subtype C infection, who would be the source of infection in perinatally infected children, are similar. In addition, we did not observe variation in the susceptibility to neutralisation or in the epitope sequences that can be related to the age of the child: infants and children in this study had identical phenotypic and genotypic profiles. Overall, we feel confident that the MAb neutralisation profiles of the viruses analyzed in this study would be representative of the earliest transmitted variants. Based on our results, we question the use of MAb combinations that include 2F5 and 2G12 as a prophylactic treatment in regions where HIV-1 subtype C viruses predominate, even if such combinations were to include 4E10 and IgG1b12. In passive immunoprophylaxis studies using a single MAb, protection was not observed even when the challenge strain was successfully neutralised in vitro. Only a combination of at least three MAbs with bona fide neutralisation activity against the challenge strain offered complete protection . Such a combination is not likely to be achievable against HIV-1 subtype C isolates. Furthermore, a recent study using a combination of 2G12, 2F5, and 4E10 for the treatment of individuals with HIV-1 infection has denoted that the ability of 2F5 and 4E10 to affect the virus in vivo is unclear and may require very high serum concentrations of these MAbs . This further questions the use of MAb combinations in which only 4E10 has the potential to be 100% effective. Overall, we believe that the use of these MAbs to prevent MTCT of HIV-1 subtype C infection is unlikely to be efficacious; therefore, a clinical trial should not be conducted. A recent study has confirmed our viewpoint that these MAbs would have limited benefit when used to prevent MTCT in populations with HIV-1 non-B subtype infection . In addition, recent data have suggested that the MAbs 2F5 and 4E10 react against self-antigens, such as cardiolipin, and the MAb IgG1b12 reacts with double-stranded DNA . Although safety concerns exist surrounding the use of these MAbs for treatment , no adverse effects have yet been reported in treated adults . It should be noted that this work remains to be corroborated by others. Nevertheless, if these findings on autoreactivity prove to be true, then the utility of these MAbs for in vivo use is in further doubt, particularly if they are to be used in infants. The study of the epitopes recognized by these broadly neutralising MAbs contributes to the knowledge necessary for the rational design of an immunogen capable of inducing a broad and potent neutralisation response against HIV-1 infection. Considerable efforts have been invested in designing immunogens based on these epitopes . However, given the subtype constraints of some of these epitopes, new, more broadly occurring epitopes need to be found for the design of vaccines that will be able to elicit an efficient neutralising response against a broad spectrum of HIV subtypes. We thank Dennis Burton, James Binley, and the National Institutes of Health Reference and Reagent Program for supplying MAbs and Progenics for supplying sCD4. We are grateful to Penny Moore for her help with the sequence analysis and the critical reading of the manuscript. ESG and LM designed the study. ESG and LM analyzed the data. TM and GG enrolled patients. DM provided reagents and technical advice. ESG, TM, GG, DM, and LM contributed to writing the paper. ESG collected data and performed experiments for the study. - 1. Barbas CF, Collet TA, Amberg W, Roben P, Binley JM, et al. (1993) Molecular profile of an antibody response to HIV-1 as probed by combinatorial libraries. J Mol Biol 230: 812–823. - 2. Burton DR, Barbas CF, Persson MA, Koenig S, Chanock RM, et al. (1991) A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals. Proc Natl Acad Sci U S A 88: 10134–10137. - 3. Roben P, Moore JP, Thali M, Sodroski J, Barbas CF, et al. (1994) Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gp120 that show differing abilities to neutralize human immunodeficiency virus type 1. J Virol 68: 4821–4828. - 4. Burton DR, Pyati J, Koduri R, Sharp SJ, Thornton GB, et al. (1994) Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody. Science 266: 1024–1027. - 5. Saphire EO, Parren PW, Pantophlet R, Zwick MB, Morris GM, et al. (2001) Crystal structure of a neutralizing human IGG against HIV-1: A template for vaccine design. Science 293: 1155–1159. - 6. Trkola A, Purtscher M, Muster T, Ballaun C, Buchacher A, et al. (1996) Human monoclonal antibody 2G12 defines a distinctive neutralization epitope on the gp120 glycoprotein of human immunodeficiency virus type 1. J Virol 70: 1100–1108. - 7. Calarese DA, Scanlan CN, Zwick MB, Deechongkit S, Mimura Y, et al. (2003) Antibody domain exchange is an immunological solution to carbohydrate cluster recognition. Science 300: 2065–2071. - 8. Scanlan CN, Pantophlet R, Wormald MR, Saphire EO, Calarese D, et al. (2003) The carbohydrate epitope of the neutralizing anti-HIV-1 antibody 2G12. Adv Exp Med Biol 535: 205–218. - 9. Sanders RW, Venturi M, Schiffner L, Kalyanaraman R, Katinger H, et al. (2002) The mannose-dependent epitope for neutralizing antibody 2G12 on human immunodeficiency virus type 1 glycoprotein gp120. J Virol 76: 7293–7305. - 10. Scanlan CN, Pantophlet R, Wormald MR, Ollmann Saphire E, Stanfield R, et al. (2002) The broadly neutralizing anti-human immunodeficiency virus type 1 antibody 2G12 recognizes a cluster of alpha1–>2 mannose residues on the outer face of gp120. J Virol 76: 7306–7321. - 11. Muster T, Steindl F, Purtscher M, Trkola A, Klima A, et al. (1993) A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1. J Virol 67: 6642–6647. - 12. Zwick MB, Labrijn AF, Wang M, Spenlehauer C, Saphire EO, et al. (2001) Broadly neutralizing antibodies targeted to the membrane-proximal external region of human immunodeficiency virus type 1 glycoprotein gp41. J Virol 75: 10892–10905. - 13. Zwick MB, Jensen R, Church S, Wang M, Stiegler G, et al. (2005) Anti-human immunodeficiency virus type 1 (HIV-1) antibodies 2F5 and 4E10 require surprisingly few crucial residues in the membrane-proximal external region of glycoprotein gp41 to neutralize HIV-1. J Virol 79: 1252–1261. - 14. Baba TW, Liska V, Hofmann-Lehmann R, Vlasak J, Xu W, et al. (2000) Human neutralizing monoclonal antibodies of the IgG1 subtype protect against mucosal simian-human immunodeficiency virus infection. Nat Med 6: 200–206. - 15. Mascola JR (2002) Passive transfer studies to elucidate the role of antibody-mediated protection against HIV-1. Vaccine 20: 1922–1925. - 16. Mascola JR, Stiegler G, VanCott TC, Katinger H, Carpenter CB, et al. (2000) Protection of macaques against vaginal transmission of a pathogenic HIV-1/SIV chimeric virus by passive infusion of neutralizing antibodies. Nat Med 6: 207–210. - 17. Mascola JR, Lewis MG, Stiegler G, Harris D, VanCott TC, et al. (1999) Protection of Macaques against pathogenic simian/human immunodeficiency virus 89.6PD by passive transfer of neutralizing antibodies. J Virol 73: 4009–4018. - 18. Parren PW, Marx PA, Hessell AJ, Luckay A, Harouse J, et al. (2001) Antibody protects macaques against vaginal challenge with a pathogenic R5 simian/human immunodeficiency virus at serum levels giving complete neutralization in vitro. J Virol 75: 8340–8347. - 19. Veazey RS, Shattock RJ, Pope M, Kirijan JC, Jones J, et al. (2003) Prevention of virus transmission to macaque monkeys by a vaginally applied monoclonal antibody to HIV-1 gp120. Nat Med 9: 343–346. - 20. Trkola A, Kuster H, Rusert P, Joos B, Fischer M, et al. (2005) Delay of HIV-1 rebound after cessation of antiretroviral therapy through passive transfer of human neutralizing antibodies. Nat Med 11: 615–622. - 21. Hofmann-Lehmann R, Vlasak J, Rasmussen RA, Smith BA, Baba TW, et al. (2001) Postnatal passive immunization of neonatal macaques with a triple combination of human monoclonal antibodies against oral simian-human immunodeficiency virus challenge. J Virol 75: 7470–7480. - 22. Ferrantelli F, Rasmussen RA, Buckley KA, Li PL, Wang T, et al. (2004) Complete protection of neonatal rhesus macaques against oral exposure to pathogenic simian-human immunodeficiency virus by human anti-HIV monoclonal antibodies. J Infect Dis 189: 2167–2173. - 23. Department of Health (2003) National HIV and syphilis antenatal sero-prevalence survey in South Africa 2003. Pretoria (South Africa): Department of Health. 18 p. - 24. Safrit JT, Ruprecht R, Ferrantelli F, Xu W, Kitabwalla M, et al. (2004) Immunoprophylaxis to prevent mother-to-child transmission of HIV-1. J Acquir Immune Defic Syndr 35: 169–177. - 25. Xu W, Hofmann-Lehmann R, McClure HM, Ruprecht RM (2002) Passive immunization with human neutralizing monoclonal antibodies: Correlates of protective immunity against HIV. Vaccine 20: 1956–1960. - 26. Xu W, Smith-Franklin BA, Li PL, Wood C, He J, et al. (2001) Potent neutralization of primary human immunodeficiency virus clade C isolates with a synergistic combination of human monoclonal antibodies raised against clade B. J Hum Virol 4: 55–61. - 27. Binley JM, Wrin T, Korber B, Zwick MB, Wang M, et al. (2004) Comprehensive cross-clade neutralization analysis of a panel of anti-human immunodeficiency virus type 1 monoclonal antibodies. J Virol 78: 13232–13252. - 28. Bures R, Morris L, Williamson C, Ramjee G, Deers M, et al. (2002) Regional clustering of shared neutralization determinants on primary isolates of clade C human immunodeficiency virus type 1 from South Africa. J Virol 76: 2233–2244. - 29. Choge I, Cilliers T, Walker P, Taylor N, Phoswa M, et al. (2006) Genotypic and phenotypic characterization of viral isolates from HIV-1 subtype C infected children with slow and rapid disease progression. AIDS Res Hum Retro 22: 458–465. - 30. Morris L, Cilliers T, Bredell H, Phoswa M, Martin DJ (2001) CCR5 is the major coreceptor used by HIV-1 subtype C isolates from patients with active tuberculosis. AIDS Res Hum Retroviruses 17: 697–701. - 31. Platt EJ, Wehrly K, Kuhmann SE, Chesebro B, Kabat D (1998) Effects of CCR5 and CD4 cell surface concentrations on infections by macrophagetropic isolates of human immunodeficiency virus type 1. J Virol 72: 2855–2864. - 32. Wei X, Decker JM, Liu H, Zhang Z, Arani RB, et al. (2002) Emergence of resistant human immunodeficiency virus type 1 in patients receiving fusion inhibitor (T-20) monotherapy. Antimicrob Agents Chemother 46: 1896–1905. - 33. Gao F, Morrison SG, Robertson DL, Thornton CL, Craig S, et al. (1996) Molecular cloning and analysis of functional envelope genes from human immunodeficiency virus type 1 sequence subtypes A through G. The WHO and NIAID Networks for HIV Isolation and Characterization. J Virol 70: 1651–1667. - 34. Johnson VA, Byington RE (1990) Quantitative assays for virus infectivity. In: Aldovini A, Walker BD, editors. Techniques in HIV Research. New York: Stockton Press. pp. 71–76. - 35. Montefiori DC Coligan JE, Kruisbeek AM, Margulies DH, Shevach EM, Strober W, editors. (2004) Evaluating neutralizing antibodies against HIV, SIV and SHIV in luciferase reporter gene assays. Current Protocols in Immunology. Hoboken: John Wiley 12: 1–15. - 36. Bures R, Gaitan A, Zhu T, Graziosi C, McGrath KM, et al. (2000) Immunization with recombinant canarypox vectors expressing membrane-anchored glycoprotein 120 followed by glycoprotein 160 boosting fails to generate antibodies that neutralize R5 primary isolates of human immunodeficiency virus type 1. AIDS Res Hum Retroviruses 16: 2019–2035. - 37. Li M, Gao F, Mascola JR, Stamatatos L, Polonis VR, et al. (2005) Human immunodeficiency virus type 1 env clones from acute and early subtype B infections for standardized assessments of vaccine-elicited neutralizing antibodies. J Virol 79: 10108–10125. - 38. Buchbinder A, Zolla-Pazner S, Karwowska S, Gorny MK, Burda ST (1992) Synergy between human monoclonal antibodies to HIV extends their effective biologic activity against homologous and divergent strains. AIDS Res Hum Retroviruses 8: 1395. - 39. Zwick MB, Wang M, Poignard P, Stiegler G, Katinger H, et al. (2001) Neutralization synergy of human immunodeficiency virus type 1 primary isolates by cocktails of broadly neutralizing antibodies. J Virol 75: 12198–12208. - 40. Pantophlet R, Ollmann Saphire E, Poignard P, Parren PW, Wilson IA, et al. (2003) Fine mapping of the interaction of neutralizing and nonneutralizing monoclonal antibodies with the CD4 binding site of human immunodeficiency virus type 1 gp120. J Virol 77: 642–658. - 41. Ofek G, Tang M, Sambor A, Katinger H, Mascola JR, et al. (2004) Structure and mechanistic analysis of the anti-human immunodeficiency virus type 1 antibody 2F5 in complex with its gp41 epitope. J Virol 78: 10724–10737. - 42. Stiegler G, Kunert R, Purtscher M, Wolbank S, Voglauer R, et al. (2001) A potent cross-clade neutralizing human monoclonal antibody against a novel epitope on gp41 of human immunodeficiency virus type 1. AIDS Res Hum Retroviruses 17: 1757–1765. - 43. Cardoso RM, Zwick MB, Stanfield RL, Kunert R, Binley JM, et al. (2005) Broadly neutralizing anti-HIV antibody 4E10 recognizes a helical conformation of a highly conserved fusion-associated motif in gp41. Immunity 22: 163–173. - 44. Mascola JR, D'Souza P, Gilbert P, Hahn BH, Haigwood NL, et al. (2005) Recommendations for the design and use of standard virus panels to assess neutralizing antibody responses elicited by candidate human immunodeficiency virus type 1 vaccines. J Virol 79: 10103–10107. - 45. Reeves JD, Gallo SA, Ahmad N, Miamidian JL, Harvey PE, et al. (2002) Sensitivity of HIV-1 to entry inhibitors correlates with envelope/coreceptor affinity, receptor density, and fusion kinetics. Proc Natl Acad Sci U S A 99: 16249–16254. - 46. Chen H, Xu X, Bishop A, Jones IM (2005) Reintroduction of the 2G12 epitope in an HIV-1 clade C gp120. Aids 19: 833–835. - 47. Mo H, Stamatatos L, Ip JE, Barbas CF, Parren PW, et al. (1997) Human immunodeficiency virus type 1 mutants that escape neutralization by human monoclonal antibody IgG1b12. off. J Virol 71: 6869–6874. - 48. Poignard P, Sabbe R, Picchio GR, Wang M, Gulizia RJ, et al. (1999) Neutralizing antibodies have limited effects on the control of established HIV-1 infection in vivo. Immunity 10: 431–438. - 49. Mehandru S, Wrin T, Galovich J, Stiegler G, Vcelar B, et al. (2004) Neutralization profiles of newly transmitted human immunodeficiency virus type 1 by monoclonal antibodies 2G12, 2F5, and 4E10. J Virol 78: 14039–14042. - 50. Li A, Katinger H, Posner MR, Cavacini L, Zolla-Pazner S, et al. (1998) Synergistic neutralization of simian-human immunodeficiency virus SHIV-vpu+ by triple and quadruple combinations of human monoclonal antibodies and high-titer anti-human immunodeficiency virus type 1 immunoglobulins. J Virol 72: 3235–3240. - 51. Mascola JR, Louder MK, VanCott TC, Sapan CV, Lambert JS, et al. (1997) Potent and synergistic neutralization of human immunodeficiency virus (HIV) type 1 primary isolates by hyperimmune anti-HIV immunoglobulin combined with monoclonal antibodies 2F5 and 2G12. J Virol 71: 7198–7206. - 52. Verrier F, Nadas A, Gorny MK, Zolla-Pazner S (2001) Additive effects characterize the interaction of antibodies involved in neutralization of the primary dualtropic human immunodeficiency virus type 1 isolate 89.6. J Virol 75: 9177–9186. - 53. Chou TC, Talalay P (1984) Quantitative analysis of dose-effect relationships: The combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul 22: 27–55. - 54. Vijh-Warrier S, Pinter A, Honnen WJ, Tilley SA (1996) Synergistic neutralization of human immunodeficiency virus type 1 by a chimpanzee monoclonal antibody against the V2 domain of gp120 in combination with monoclonal antibodies against the V3 loop and the CD4-binding site. J Virol 70: 4466–4473. - 55. Wu X, Parast AB, Richardson BA, Nduati R, John-Stewart G, et al. (2006) Neutralization escape variants of human immunodeficiency virus type 1 are transmitted from mother to infant. J Virol 80: 835–844. - 56. Haynes BF, Fleming J, St Clair EW, Katinger H, Stiegler G, et al. (2005) Cardiolipin polyspecific autoreactivity in two broadly neutralizing HIV-1 antibodies. Science 308: 1906–1908. - 57. Nabel GJ (2005) Immunology. Close to the edge: Neutralizing the HIV-1 envelope. Science 308: 1878–1879.

Narayan’s fiction rarely addresses political issues or high philosophy. He writes with grace and humor, about a fictional town Malgudi and its inhabitants; and their little lives. Narayan is a classic teller of tales; an enduring appeal springs from his canvas where common men and women of all times and places are joined in their commonality. Rasipuram Krishnaswamy Iyer Narayanswamy stood shortened to R.K.Narayan, on Graham Greene’s advice. Narayan lived till ninety-five, writing for more than fifty years, and publishing till he was eighty seven. He wrote fifteen novels, five volumes of short stories, a number of travelogues and collection of non-fiction, English translation of Indian epics, and the memoirs “My Days”. Yet it is neither the copiousness of output, nor currency of content — or the lack of either — that gives Narayan his place among the finest story-tellers of modern English. He weaved a world existing nowhere, but striking a chord of perfect reality with readers across the English reading peoples. His books appeal in a quiet, reassuring way and have a remained popular over many decades. His writing is also part of literature coursework in some American universities. Narayan evokes a diction of unusual freshness and rare ingenuity with the English literary idiom. Narayan was born at the beginning of the twentieth century, on October 10, 1906 at Chennapatna, near Mysore in southern India. He was one among many siblings, his father a provincial head-master of much repute with the rod. Narayan studied at his father’s school and maintained a diligent dislike for studies. The qualifier to the graduate course in Arts proved his nemesis; Narayan failed. In spite of sustained loathing, Physics and Chemistry had stood by him, but English betrayed. He much liked the subject and was already aspiring for a writerly life. But a compromise was never reached with the English pieces in his syllabus. Getting plucked fetched him a year of reprieve from classes; he promised his father he will try the test again. Narayan started reading in earnest, the classics of English literature, and writing. He read out his pieces to a close band of friends, and after priming the audience with coffee and snacks, asked for their opinion. Such reviews were laudatory, “brilliant” being the unanimous word. His father had his own qualms about institutional education, and encouraged Narayan in literary pursuits. The next year’s entrance examination was cleared, Narayan served his time in the university and graduated. Though the repugnance to studies never recouped he queued for the Master of Arts course, viewing the degree as an expedient in job hunting. While walking up the university stairs to submit the form, a friend warned of the privations of M.A. Narayan turned around and came down the steps in a hurry, never to try their ascent again. He resolved to write for his living and write in English. Reporting for defunct journals, freelancing here and there and similar “literary” odd jobs catered more to the spirits than pockets. He kept on writing and submitting. A few lyrical pieces went to publishers in England, and returned in due or undue time, along with “…cold, callous rejection slips, impersonal and mocking”. Narayan’s first published work was the review of a book titled “Development of Maritime Laws of 17th-Century England”. He is rather cynical about it and writes, “A most unattractive book, but I struggled through its pages and wrote a brief note on it, and though not paid for, it afforded me the thrill of seeing my words in print for the first time.” To better arrange meetings of the proverbial ends, Narayan took up teaching at a government school, and left the job within two days. In the autumn of 1930, on a sudden spurt of inspiration, writing of his first novel “Swami and Friends” started. It was as if a window had opened, and through it Narayan saw a little town and its rail station, the Mempi Forest and the Nallapa’s Grove, the Albert Mission school, Market Road, the River Sarayu. Its inhabitants appeared, and Malgudi was born. Malgudi is the setting of nearly all of Narayan’s work. It is described as being somewhere in southern India. Malgudi has some elements of Hardy’s Wessex and perhaps can be pinned on a map as exactly Wodehouse’s Blandings has recently been done. But Malgudi is different from either. Its moorings in geography — and also history — seem never an issue; Narayan’s space-time bubble bounces in absolute ether. “Swami and Friends” was completed and sent to publishers. It repeatedly returned. Narayan dispatched it yet another time and gave the return address as one of his friend’s in London. He wrote to the friend requesting the manuscript be tied to a brick and thrown into the Thames if it came back. It did. But the friend took it to his acquaintance Graham Greene, who was already an established author. Narayan received a telegram soon thereafter, “Novel taken. Graham Greene responsible.” “Swami and Friends” was published in October 1935. Greene’s suggestion for pruning his never-ending name to something more succinct was readily taken by Narayan. Thus began Narayan’s friendship with Greene; it continued till the latter’s death in 1991. They corresponded often but had met only once, in 1964. This association is surprising in its depth and sincerity, given the two’s widely varying oeuvres. “Swami and Friends” had a few enthusiastic reviews but was lost in the deluge of current bestsellers. Throughout his career, Narayan changed publishers often, sometimes publishers changed him; he even dabbled in self-publishing for some of his books. Narayan’s renown as a writer came slowly, almost with a touch of diffidence. He never had the trappings of a high profile author, and stayed scrupulously shy of literary lunches and book signing binges. He was most at home near his characters, somewhere in south India. Malgudi is a land of fantasy, not as in a dream, colored and brilliant; but the reverie of relaxed awakening, a contemplation of commonness. Life there is reduced, or elevated, to the lowest common denominator of living, which remains the same in nearly all places and times. Small men, smaller means, touched at times by the cares of a larger world, but unruffled, still moving on. The characters yearn for fame and money and virtue and those “real” things, but their longings stand tempered by a subtle sense of limitation, almost comic. The narrator of one the novels is an archetypal Malgudian: “We were about twenty unrelated families in Kabir Street, each having inherited a huge rambling house stretching from the street to the river and back. …. so comfortably placed, (we) were mainly occupied in eating, breeding, celebrating festivals, spending the afternoons in a prolonged siesta on the pyol, and playing cards all evening. ….. This sort of existence did not appeal to me. I liked to be active, had dreams of becoming a journalist. …. I noticed a beggar woman one day, at the Market Gate, with Siamese twins, and persuaded my friend Jayaraj, photographer and framer of pictures at the Market Arch, to take a picture of the woman, wrote a report on it and mailed it to the first paper which caught my attention at the Town Hall reading room; that was my starting point as a journalist. Thereafter I got into the habit of visiting the Town Hall library regularly to see if my report appeared in print.” Narayan’s irony dissembles in humor, and the reader realizes only when hit, “Excuse me. I made a vow never to touch alcohol in my life, before my mother,” said Chandran. This affected Kailas profoundly. He remained solemn for a moment and said : “Then don’t. Mother is a sacred object. It is a commodity whose value we don’t realize as long as it is with us. One must lose it to know what a precious possession it is. If I had my mother I should have studied in a college and become a respectable person. You wouldn’t find me here. After this where do you think I’m going ?” “I don’t know.” “To the house of a prostitute.” He remained reflective for a moment and said with a sigh: “As long as my mother lived she said every minute, ‘Do this don’t do that.’ And I remained a good son to her. The moment she died I changed. It is a rare commodity, sir. Mother is a rare commodity.” Nature remains an abounding presence in the semi-suburban life of Malgudi. Narayan’s observation and his felicity with words reveal in passages such as, “It was April. The summer sun shone like a ruthless arc lamp – and all the water in the well evaporated and the road dust became bleached and weightless and flew about like flour spraying off the grinding wheels.” Long solitary walks remained a lifelong passion; the world percolated his every pore. “When the monsoon broke out, one could watch dark mountainous clouds mustering, edged with lightning; these would develop awesome pyrotechnics. In June, drizzle and sunshine alternating, leaving gold mohur, flame of the forest, and jacaranda in bloom along the avenues. In July and August the never-ending downpour, grey leaden skies, and damp air blowing.” After Swami and Friends, Narayan was settling into his rhythm; “The Bachelor of Arts” and “The Dark Room” came out in quick succession, each book further cementing Malgudi as the cornerstone of his cosmos. In 1939, Narayan’s wife Rajam passed away. Their only child, a daughter, was three years old. This bereavement brought about a permanent change in his life. Narayan remained distressed for a long time, out of grief and concerns of single parenthood. His fourth novel, “The English Teacher” is a catharsis of these times, and Narayan has said, “More than any other book, The English Teacher is autobiographical in content, very little part of it being fiction.” The wife of the protagonist dies of typhoid. Her illness, the prognosis, the hopes, despair and death are painted with stokes of delicate detachment. And infinite pain. The reader is touched by the narrative, a universal loss echoes. It was some time before the earlier lightness returned to Narayan’s writing. It eventually did, but became nuanced with heightened sensitivity and restraint. His wife’s demise also opened certain psychic explorations for Narayan. He was reportedly able to communicate with the departed soul, and the transcendental tête-? -tête continued for a long time. Such assertions leave the reader slightly baffled at times and openly skeptical at others. But Narayan writes about his experiences with as much intensity as grace, “We stood at the window, gazing on a slender, red streak over the eastern rim of the earth. A cool breeze lapped our faces. The boundaries of our personalities suddenly dissolved. It was a moment of rare, immutable joy — a moment for which one feels grateful to Life and Death.” Thus ends “The English Teacher” (published in USA as “Grateful to Life and Death”) in a description of the deceased wife “visiting” her husband from the great beyond. The book speaks to me as one of the finest odes to love, rather than an almanac of after-life. The Rockefeller Foundation selected Narayan for a travel grant. This was his first travel abroad, and he says coyly, “Finally I did break out of the triangular boundary of Madras, Mysore and Coimbatore and left for the United States, in October 1956.” A memorable travelogue, “My Dateless Diary”, came out of Narayan’s American sojourn. He visited New York, Chicago, Los Angeles, Washington, the Grand Canyon among other places and met eminent personalities such as Aldous Huxley, John Gunther, Greta Garbo. Garbo was apparently much interested in Narayan’s mystic leanings. In the Hotel Carlton, Berkeley, California, Narayan wrote the most famous of his novels, “The Guide”. Sometimes he wrote with a typewriter, sometimes with paper and pen, cooking his own food on a hot plate in the hotel room every day. Narayan has written, “The Guide attained a certain degree of popularity, which, though pleasant in itself, brought in its wake involvements that turned out to be ludicrous and even tragic.” It was made into a film which mutilated the original storyline much to the author’s chagrin. A planned Broadway edition was as reckless in its treatment. Narayan had to withhold his permission to present it on stage, even as the adaptation was done by an old friend of his, a former literary editor of the New York Times. As an example of the outrage, Narayan mentions, “For instance, his version managed to abolish the heroine. I objected to his omission and to two irrelevant characters of his own; above all I objected to the hero’s turning around and urinating on the stage.” Matters became rather acrimonious over this script and Narayan had to leave New York at a very short notice to avoid being summoned for a subpoena; he found asylum in the Indian consulate before boarding a flight out of the United States. However the script was later revised and “The Guide” opened in Broadway in March 1968. It closed in less than a week. In his essays and columns, Narayan pokes gentle but stirring fun at himself and the idiosyncrasies of his writing. In a piece titled “Love and Lovers”, Narayan contrives an interview between a critic and himself. “… Are you going to tell me that you portray the individual in his fullness? There are areas you have neglected. For example, do you deal with man-woman relationship with any seriousness? Aren’t you prudish when it comes to sex?” “Not exactly prudish, only I take the hint. When a couple, even if they happen to be characters in my own novel, want privacy, I leave the room; surely you wouldn’t expect one, at such moments, to sit on the edge of their bed and take notes ?” In “Reflections on Frankfurt”, Narayan continues in the same vein of easy irresponsibility, “I heard rumors in Frankfurt and then in Paris and London that I was to be awarded the Nobel Prize this year (1986). Some Paris newspapers carried the ‘shortlisted’ names of these writers in the Third World, as the committee had decided to award the Prize to the Third World this year to overcome the charge of being biased in favor of American and European writers. I was greeted and congratulated here and there.” He did not win the Prize and has speculated on what might have tripped him. Here is his reflection on the committee’s deliberations, …His writing is too simple, and too readable, requiring no effort on the part of the reader. …He has created a new map called Malgudi in which his characters live and die. Story after story is set in the same place, which is not progressive, a rather stagnant background….. We hope some day Narayan will develop into a full-fledged writer deserving our serious consideration. The recurrent motifs in Malgudi’s saga are irrelevance and irreverence. Narayan’s oeuvre never syncs with the contemporary, never means to. His writing career spanned the second half of the twentieth century, arguably the most happening phase of human history. Both the world at large and the world at small witnessed upheavals; technology leaped, politics changed and morals mutated. Yet, all this is alien to Malgudi’s denizens. Life there might have stood still, or may have been always moving in a cosmic continuum, from primal past to fathomless future. The Malgudi men and the women and children, go on about their lives, as they have always done, and always will. Narayan often invokes the current as a backdrop, perhaps to show how meaningless it is for Malgudi. “Waiting for the Mahatma” (1955) is set amid the final years of India’s freedom struggle, and Mahatma Gandhi appears in the novel, complete in his loincloth and moral exhortations. But the characters are just brushed by the tension of the times, not swayed. They remain very much themselves; so does Malgudi. Narayan does bring in change, perhaps inevitably, towards the later part of his career. Here his dexterity stretches very thin, and a hint of absurdity creeps in at times. In one of these stories a Malgudi man returns from the US with a Korean wife and a story-writing machine; the humor seems slightly affected and the precision of earlier touch, sadly amiss. Narayan has been irreverent in his Malgudi tales; to institutions, individuals and inclinations. There is not a hint of stridency, he makes fun supremely poised and assured. His characters fall in love, and then out of it, promises are made and broken, youths converted to causes, and then exorcised by nubile females. Married men indulge peccadilloes and prayers, sages in shenanigans and married women in gossips and fantasy. People die of disease or dotage, and survivors get on with the game, insignificant as ever. Readers are left with a search for meaning in all this. Narayan never intrudes with interpretations. But the greatest point about Narayan’s writing is its use of language. His talent goes beyond mere aptitude with words or a maverick Malgudi. Narayan stands for the immense flexibility, adaptability and élan of English; he uses the language of Bible, Shakespeare and American Constitution to an amazing effect while dealing in subjects vastly removed. His creatures squat on the floor for meals, wear dhoti with a coat, read the Ramayana, regard mothers as sacred, rebel against fathers, marry for love over money, and aspire for eternal life. The author writes all this without a single footnote, without any discernible twang of the foreign, with a sense of disarming familiarity. Narayan represents the synthesis that is English, a language evolving through the synergy of civilizations, known and unknown; a language in continual quest. R.K.Narayan passed away on May 13, 2001. Malgudi lives on. And so does his writing.

April, 2016: Coaltec Energy would like to announce that they are entering a partnership agreement with Mavitec Green Energy BV. Mavitec Green Energy BV is part of the Mavitec group, a privately owned company. They are one of the world market leaders in the engineering, manufacturing, supply, installation and service of total solutions for the animal by-products processing industry. Mavitec also supplies raw material handling systems for the biogas and biodiesel industry. With headquarters based in the Netherlands, they have international sales/service offices worldwide. The solutions that Coaltec and Mavitec bring to their customers are very complimentary, and help to provide a more complete solution to many of the issues facing agricultural companies throughout the world. You can find more information at www.mavitecgreenenergy.com April 2016: Two new projects announced: Coaltec has received down payments for, and begun design and fabrication of, two new projects. The first project is with AltEn, and will be located at their ethanol facility in Mead, Nebraska. Several components have been ordered at this time and fabrication is underway. The system will process the Wet Distillers Grain from their plant, and should be operational by the 3rd Quarter of 2016. To follow updates, check the projects page for AltEn. The second project is with RVF Land Corp. in Orleans, Indiana. The feedstock for this project will include manure from swine, turkeys, and chickens. One of the outputs from this system will be power production. This project has also begun and fabrication is underway. Also, to follow updates, please check the projects page under RVF Land Corp. For updates on existing projects, please see individual project pages. August 15, 2015: See Synergy Solutions page for current project updates. August 2015: Two new projects announced! See projects page for more information. June 2014: The cow manure system has been operating for 18 months with minimal issues. The system is drying manure on a 24/5 schedule, with the energy being provided by either the gasifier or natural gas burner. The gasifier is capable of operating on a continuous basis, but the method of operation is determined by the customer’s need for bedding, biochar, and the cost of the natural gas. The biochar produced at this facility has been used as a soil amendment and as a component in animal bedding. It is also undergoing testing as an animal feed supplement. As a soil amendment, it has been used in gardens and in larger applications in corn fields. It has also been applied to golf course greens on two different courses, both in the fall of 2013 and the spring of 2014. Coaltec is currently working with potential customers on close to 20 new projects, located in 10 different countries. The economics for all projects are very sound and the fuels and energy applications have all been proven in the past. Some of the projects are viable with simply the energy benefits, but most involve some type of environmental component – either value for biochar, or environmental benefits such as improved manure management, reduction in handling, transportation, and disposal costs. Most of the projects involve manure – either cow, hog, or poultry, but there are also potential projects utilizing agricultural waste and processing waste. A few of these projects should move forward in the next month or two and updates on the progress will be posted. Coaltec provides solutions for environmental problems such as manure management through the use of its patented gasification process. Economic benefits of the system include providing: - Heating and cooling - Animal bedding - Alternate manure management strategies - Carbon and Nutrient credits - Disposal of Mortalities Gasification – Energy-Based Environmental Solutions Coaltec Energy is a solutions-based company providing answers and resolution for businesses that have large quantities of by-products, biomass, or other fuel sources. Gasification produces a clean heat from renewable biomass resources, coal, and various by-products. The resulting heat can be converted into a number of usable energy forms (see list above), through the use of readily available technologies. Coaltec’s business model is to integrate gasification technology into agriculture and industry through conversion of available fuels. Yield from the gasification process includes valuable energy (including heat, steam, and/or electricity) and formulated biochar and/or ash products that are significantly reduced in bulk from the original material. The formulated biochar and ash products are dry, pathogen-free, and less expensively and more easily transported. Ohio Manure Facility (April 2012) Coaltec Energy is pleased to announce that they have contracted to provide a gasification system in South Charleston, Ohio. Fuel for the gasifier will be cow manure that is produced on-site. This system will gasify 36 tons per day of processed manure. Energy from the gasifier will be employed to dry manure, which will be used for fuel as well as pathogen-free animal bedding. Additionally, the project will produce approximately 3,000 tons of biochar annually. The West Virginia Department of Environmental Protection has awarded their first-ever Clean Energy Award in 2009. Coaltec Energy and Frye Poultry were recipients of the award for their poultry gasification project. The award was presented on May 24, 2010, in Charleston, West Virginia. Pictured at right are (from left to right) West Virginia Governor Joe Manchin, Mike McGolden, Josh Frye, WV DEP Environmental Analyst Gene Coccari, and WV DEP Cabinet Secretary Randy Huffman. August 14, 2009: While on an energy tour of the state, West Virginia Congresswoman Shelley Moore Capito visited Josh Frye at Frye Poultry to learn more about the gasification process. 2/10/2010 USA Today The article provides details about the project and its benefits, even though the technology was mistakenly identified as incineration, rather than gasification. Additional USA Today photos here. Minnesota Turkey Farm The system was designed and installed with a variety of features to maximize the manure to heat conversion process. The opportunity to produce high-grade Biochar greatly enhances the projects economics. For more details click here.

Animation Throwdown Tips and Winning Strategies You've always wanted to pit heckling Zoidberg against a cocaine-covered Bullock in a card game death match, right? Now you can! For those just getting started on the cartoon mayhem, below we cover what you need to know to develop a winning Animation Throwdown strategy. Still need more help? Be sure to also check out: There are a few key differences here from the standard CCG. First up, all cards automatically deal overrun damage, with no skill required. If your card deal 5 damage and the opposing card has 1 health, 4 remaining damage will be dealt to the opponent directly. Card health also doesn't restore at the start of each turn like in Magic, and instead must be healed through skills. "Summoning Sickness" is still on display however, as cards don't attack the turn they are put down. Combos And Card Order Setting down skilled cards quickly is paramount. For instance, playing a card with Shield early keeps your lineup defended over subsequent turns, while it's a good idea to play a card with Recover when you know you will be setting down a combo in the next turn. Sometimes combos will actually make a card less useful, so know what you are getting into ahead of time. While combos typically raise stats, they can also replace the card's skills. The order you play cards doesn't affect a combo. For instance you can play Crack on turn 1 and Steve Smith on turn 2 or vice versa, but either way you still end up with Withdrawal Steve. Always recycle shards and old, redundant cards to earn more Power, which is used to upgrade cards. Unlike other CCGs, your cards aren't static - upgrading not only increases stats, but also gives new skills. After upgrading, the most important aspect of deck building is synergy. If a card can't combo with most of the other cards in your deck, cull it out. Finally, pay attention to a card's details when building a deck, as skills marked with a star only affect a specific type of card - either a cartoon set (Family Guy, Futurama, etc.) or a specific trait (Hyper, Armed, Educated, Artistic, Drunk). Traits are especially important as they affect whether a card's skill will affect all cards or just those of the same trait. This doesn't apply to all skills, but it's something you have to keep in mind when building your deck. Note: Skills with the Special trait will only work on characters from the same series. Those are all the basics you need to know - so go ahead and join a guild and have fun annihilating your enemies in every Arena match!

Synergy Group reportedly submitted its EUR1.5 billion final bid for 95% of TAP Portugal (EFE/Jornal de Negocios/Dinheiro Vivo/Bloomberg/Agenzia ANSA 07-Dec-2012). State holding company Parpública now has five days to review the proposal, which is then expected to reach Portugal's Council of Ministers for final approval on 20-Dec-2012. The bid is reportedly 15% less than the non-binding proposal Synergy had earlier submitted, and reflects Synergy's assumption of TAP's EUR1.2 billion debt load and a EUR300 million capital injection. If the bid is accepted, that state would reportedly only receive EUR20 million "at best" (Jornal de Negocios, 07-Dec-2012). Synergy Owner German Efromovich said, "The most important thing for TAP and the Portuguese state is to have comfort that whoever is entering [the company] is willing to invest." Synergy submits EUR1.5bn final bid for TAP Portugal; 15% lower than prior non-binding proposal You may also be interested in the following articles... LOT Polish Airlines: now restructured, and long haul focus is on 2020 growth. Partnerships critical On 8-Sep-2016 LOT Polish Airlines announced its "2020 profitable growth strategy". This involves a goal to achieve "sustainable viability", after a restructuring programme which returned LOT to operating profit in 2014 after six loss-making years. Its privatisation may even be back on the agenda. LOT currently ranks behind LCCs Ryanair and Wizz Air by share of traffic in Poland, which offers superior traffic growth potential versus Europe as a whole. The airline aims to increase passenger numbers from 4.3 million in 2015 to 10 million in 2020, growing its fleet from 43 to 70 aircraft. LOT's expansion will focus on long haul, particularly North America and Asia, where it currently has only five routes and where competition is considerably lower than on short/medium haul. Initial plans include the launch of Warsaw-Seoul this winter and a return to Warsaw-New York Newark next summer. According to data from LOT, its restructuring has left it with a fairly efficient cost base by legacy airline standards and this will be important in competing with LCCs (but there is still a cost gap with LCCs). LOT's growth will focus on long haul but will need short-haul European feed – and partnerships. Although LOT no longer appears to be considering leaving the Star Alliance, it remains excluded from American and Asian JVs. Further, those JVs preclude members from working with LOT. Partnership growth will be as critical as it will be challenging. Norwegian Air's North Atlantic seats up 51% this summer, but longer term long haul growth needs NAI Norwegian continues to await the long-delayed approval of a US foreign carrier permit for its Irish subsidiary Norwegian Air International (and for its UK subsidiary Norwegian Air UK). US traffic rights for these two subsidiaries would give Norwegian the opportunity to fly both east and west with the same operating airline and with EU traffic rights in both directions. This would increase the operational flexibility and cost efficiency of its long haul operations and allow lower fares on a greater number of routes. Nevertheless, in the meantime and aided by low fuel prices, Norwegian is getting on with an ambitious trans-Atlantic expansion plan and has now carried three million passengers between Europe and the US since 2013. Its summer 2016 seat capacity has jumped by 51% year on year (based on OAG data for the week of 5-Sep-2016), including nine new routes this summer. It plans two more routes in the coming winter schedule and four US routes from Barcelona in summer 2017. Well over half of Norwegian's North Atlantic routes are new to the market, which has been significantly stimulated by its entry. This has provided choice and lower fares for passengers, and created new airline jobs. Those still seeking to block approval for NAI and NUK are acting against the interests both of consumers and aviation workers.

Our correspondent in the role of 13th man in the position usually reserved for the yacht’s owner or royalty New, sophisticated boats, great yachtsmen and spectacular wind conditions (over 24 knots with gusts of 30), assured great excitement for sailing enthusiasts at the third phase in the Audi MedCup circuit at Cagliari: a confirmation of the fact that the world of yachts with keels is alive and well, despite the direction taken by that other great event in the sector, the America’s Cup, which for the next edition in San Francisco in 2013, will see only multihulls racing. This excitement is all the greater is you are lucky enough to be able to take part in a regatta aboard one of the seven boats racing in the TP52 category, occupying the place of honour – that of the 13th man, usually reserved for the boat’s owner or for royalty – as representative of “luomovogue.it”. One yacht, which bears a glorious name, is “Azzurra”, the sporty symbol of the Yacht Club Costa Smeralda. She bears a name which in the 1980s made sailing known to a far wider public in Italy. Backed by Aga Khan and Gianni Agnelli, Azzurra came close to winning the America’s Cup, skippered by Cino Ricci and helmed by Mauro Pelaschier. After a long absence, Azzurra returned to the scene for the Louis Vuitton Trophy of 2009/2010. For the Audi MedCup, an exceptional team has been formed, with yachtsmen of the calibre of Guillermo Parada as skipper, Francesco Bruni, formerly helmsman of Azzurra in 2009 and now her tactician, and the “sacred cow” of Italian sailing, Vasco Vascotto, as strategist. Going aboard Azzurra, one is struck by the strictness and cold-bloodedness with which the strategist and tactician give out orders, for the most part in a number-based language. They seem like surgeons involved in a delicate operation, surrounded by their team. The calculation gives way to adrenalin as we approach the buoy, where the crews, amid yells, noise and sea spray, all suddenly find themselves in the same bit of sea, and instantly one would imagine oneself in the middle of a sea battle from centuries ago. The excitement continues after the buoy has been rounded: the wind veers and the sails are quickly changed. Like white chrysalids transforming themselves into butterflies, each of the boats hauls down its spinnaker, until shortly before filled with wind, and reveals the bright colours of mainsail and genoa, providing a totally unexpected chromatic explosion on the high seas. With a second and first place on the last day of racing, , the Audi Azzurra Sailing Team won a second place in the Sardinia Trophy, effecting an extraordinary recovery after the poor performance of the first day. The challenge between the seven participating teams (aside from “Azzurra” for Italy, there were “Audi Sailing Team by All4one”, Europe; “Bribon”, Spain; “Container”, Germany; “Quantum Racing”, USA; “Ràn”, Sweden and “Synergy Russian sailing team”, Russia ) continues during the next phases in the Audi MedCup, both of which will be in Spain: at Cartagena from 23rd to 28th August, and from 12th to 17th September at Barcelona. Last On Vogue A chat with Kristin Prim, the founder of The Provocateur, the site that publishes letters written expressely by leading women addressing the whole female world. Vogue.it presents you an exclusive preview of the letter written by Dresden Dolls' Amanda Palmer

Climate feedback efficiency and synergy 2013 (English)In: Climate Dynamics, ISSN 0930-7575, E-ISSN 1432-0894, Vol. 41, no 9-10, 2539-2554 p.Article in journal (Refereed) Published Earth's climate sensitivity to radiative forcing induced by a doubling of the atmospheric CO2 is determined by feedback mechanisms, including changes in atmospheric water vapor, clouds and surface albedo, that act to either amplify or dampen the response. The climate system is frequently interpreted in terms of a simple energy balance model, in which it is assumed that individual feedback mechanisms are additive and act independently. Here we test these assumptions by systematically controlling, or locking, the radiative feedbacks in a state-of-the-art climate model. The method is shown to yield a near-perfect decomposition of change into partial temperature contributions pertaining to forcing and each of the feedbacks. In the studied model water vapor feedback stands for about half the temperature change, CO2-forcing about one third, while cloud and surface albedo feedback contributions are relatively small. We find a close correspondence between forcing, feedback and partial surface temperature response for the water vapor and surface albedo feedbacks, while the cloud feedback is inefficient in inducing surface temperature change. Analysis suggests that cloud-induced warming in the upper tropical troposphere, consistent with rising convective cloud anvils in a warming climate enhances the negative lapse-rate feedback, thereby offsetting some of the warming that would otherwise be attributable to this positive cloud feedback. By subsequently combining feedback mechanisms we find a positive synergy acting between the water vapor feedback and the cloud feedback; that is, the combined cloud and water vapor feedback is greater than the sum of its parts. Negative synergies surround the surface albedo feedback, as associated cloud and water vapor changes dampen the anticipated climate change induced by retreating snow and ice. Our results highlight the importance of treating the coupling between clouds, water vapor and temperature in a deepening troposphere. Place, publisher, year, edition, pages Springer, 2013. Vol. 41, no 9-10, 2539-2554 p. Climate sensitivity, Climate feedback mechanisms, Synergy Meteorology and Atmospheric Sciences IdentifiersURN: urn:nbn:se:su:diva-97028DOI: 10.1007/s00382-013-1808-7ISI: 000326244700018OAI: oai:DiVA.org:su-97028DiVA: diva2:674257

(Pssst… This post takes several ideas from Laura’s book 77 ways to find new readers for your self published book!) I’m sure you’ll no doubt agree that the indie author community is wonderful and supportive, and that there is no shortage of authors willing to help each other out. But it is, still, a rather small indie world out there. Readers who read and accept self-published books tend to follow several indie authors, and when an author does tout a fellow author’s book, it can often be to the same, smallish, crowd. Add to that the fact that several authors are only promoting to other authors (yes, they’re readers too; no that’s not enough) and it’s no wonder that book sales are not what they could and should be. Photo courtesy of goXunuReviews So how do we break beyond the “interbred” community and reach readers outside of the network of people promoting to each other online? I’ve got 31 ideas here to get you started, leave a comment if you’ve got anything to add! 1. Visit the B&Bs in your area and ask if they’ll sell your books on consignment. Visitors to these B&Bs are often looking for a good read, are more likely to spend money on their vacations, and will be excited to read something by a local author. 2. Get in touch with all of the schools, women’s organizations, local festivals etc in your area, and ask if you can speak or join an event. Email the folks in your network and ask if they are a member of any such organization that might be interested in hosting you. You’ll be surprised at some of the opportunities that arise when you ask for them! 3. Contact someone at your local Chamber of Commerce and ask for introductions to people who might be able to help promote your book locally. (In every community there’s a connector that will open you up to new opportunities. You just need to locate him/ her!) Example: Around launch time for Dancing Naked in Dixie, I wrote a press release for 30 Day Books’ client Lauren Clark announcing the book release. This somehow got in to the hands of someone at the Chamber of Commerce in the town the book was set in (Eufaula, Alabama). I had a phonecall from the President of a heritage site in the town who wanted to read and review Lauren’s book. She loved it and invited Lauren to visit the area to do a book signing: http://www.laurenclarkbooks.com/2012/08/03/eufaula-rolls-out-red-carpet-for-dixie/. Not only was the event covered by the local newspaper, but Lauren has been invited back for two more events in the near future! 4. Book clubs and groups can help you to sell 10-15 books a time. Try Meetup.com to find book clubs in your area. Message the organizer through the site’s internal messaging system and introduce yourself and your book. Write a reading guide if you get any traction this way. Advertise SKYPE book club meetings on your author website. 5. Offer to write for your local newspaper or magazine, or any niche magazine you know of that shares an audience with yours. Magazine pitching and publicity is a world of its own (I recommend Melissa Cassera’s National Magazine Publicity Program to learn more) but remember the basics of getting featured in a magazine: they are looking for stories NOT products (including books) and the story must have a strong appeal for their reader. Customize your pitch appropriately and always put them – and their readers – first. Example: I got 30 Day GMAT Success featured in Graduate magazine (readership circa 1 million) by pitching an article titled the “Perfect Time to Take Your Test”. We only mentioned the book in the blurb at the end, and the post was full of valuable tips and advice for young graduates hoping to take a standardized test. 6. Contact your alumni magazine and ask to write for them or be featured on their achievements page. 7. Speak! If you’re a children’s/ young adult writer, try schools (www.schoolbookings.com). Otherwise seek out organizations or companies whose members may benefit from the message in your book. Not sure what the message of your book is? Brainstorm with a friend or relative who will give you the outsider’s perspective you are looking for, and help you to hone your message. It could be anything from overcoming tragedy, dealing with disaster or grief, travel, friendship, etc. Of course for non-fiction the message of your book is much more obvious ;) Example: Seattle-based author Ingrid Ricks speaks to schools and companies about embracing life and focusing on what really matters: http://ingridricks.com/speaking-engagements/embracing-life/. This helps Ingrid build her “author brand”, sell books, and get covered by the local press. 8. Leave flyers in your local coffee shop. You can get these printed at VistaPrint.com. The most successful way to utilize flyers for publicity is to give people an incentive to take action. For example, mention a contest on your site, a reason to sign up for your newsletter/ mailing list, or a limited edition price reduction of your book – and always leave the URL of a specific page you want them to visit on your site or book retail site. 9. Be a guest on a radio show – locally, or BlogTalk radio has tons of online radio shows that are always hungry for content! 10. Get your book into local and national libraries – see this interview with Dana Lynn Smith for more info. 11. Are you a mystery or thriller writer? See if you can find a Mystery dinner company in your area. Offer to read at an event, or come up with a mystery puzzle for their audience. 12. Get together with 8-10 other writers for a “local author event/ signing” – you’ll benefit from the synergy of a group of authors by drawing a bigger crowd, cross-promoting, and possibly getting local media coverage. Plus, it’s far less daunting to do an event as a team! 13. Become an expert by getting familiar with journalists and freelancers in your area of expertise, and introducing yourself to them. Let them know that you are available for interviews and commenting on stories within your subject field (non-fiction) or some of the hooks from your fiction book. List these out and send them to the press page on your author website. Be sure to make it clear why to use you as a source – over anyone else – by providing specific examples of your achievements, qualifications and experience. 14. Take out an ad on your local paper’s website. Online ads work better than ads placed in a physical newspaper because very few people will type a book name/ book site into Google, but many will click through a link to your purchase page. 15. Pitch articles to reader-centric sites such as Digital Book Today. A little birdie tells me that they love posts that are written for readers NOT writers, but most authors continue to pitch writer-centric articles. 16. If you have the budget, try Facebook ads. The great thing about Facebook ads is that you can target a gender, age group, location, or even those with a specific interest. One strategy is to target similar authors’ fans (e.g. those who have ‘Liked’ the Emily Giffin page). Facebook ads are amazingly targeted but somewhat pricey. 17. Google ads are a little pricey too, but you can specifically target websites that your readers will be on (i.e. a cat website or Texas-specific site). Since you can often find $70-$100 vouchers online, it’s worth at least trying. This works better for non-fiction books and books that are sold at a higher price. They are a big part of our 30 Day GMAT Success promotional strategy. For every $0.30 we spend on Google Ads, we make around $1- $2 in royalties from that source of traffic. (It did take some experimenting to get to this point though!) 18. GoodReads ads – the jury is out on how successful GoodReads ads are. Readers tend to add the book to their ‘To be read’ shelf, but whether this means they will ever actually purchase the book is questionable. They are certainly worth a shot and are much more reasonably priced than Facebook and Google ads. 19. Guest post on other non-writing/ author sites. Try lifestyle blogs, specific interest bloggers and so on. 20. Blog. blog. blog. Stick to a few topics that somehow relate to your book or book’s target audience and create content regularly and consistently that will engage and interest these potential readers. 21. Change your Amazon pen name (e.g. Laura Pepper becomes “Wedding-book Author Laura Pepper” or “Wedding expert”) and write reviews on similar books. Browsers on Amazon may well click through to your book. You can do that (and learn more about it) here. 22. Participate in a GoodReads giveaway (Paperback only). Even those who don’t win will be exposed to your book and may buy it anyway. 23. Try a LibraryThing giveaway (eBooks and paperback). 24. Create lists on Amazon that feature your book – and tie you to other books in your genre/ field. These include Listmania and So You’d Like to… listings. 25. Post your blog posts on Reddit.com. You can get a ton of traffic from sites such as Reddit, but be sure that your post is posted in the right group (or ‘subreddit’) and is not overly promotional otherwise you’ll get a very negative reaction from the community. Users tend to be, ahem, opinionated! 26. Submit a blogpost to Digg.com. 27. Start a YouTube channel – if you’re a-okay with being on camera, consider talking about something in your niche online. YouTube has a huge number of browsers just waiting to be entertained. Speaking on camera is a great way to connect with new readers. (Find my YouTube channel here – please subscribe if you’d like to see more interviews!) 28. If you have a non-fiction book, publish your full table of contents on your website, and make it as key-word rich as possible! When people are searching for the answer to a problem or a solution, your book will rank higher in search engines. 29. Which reminds me, be sure to implement some form of SEO to your blog or author website. If you can’t afford a professional SEO consultant to do a few hours of work optimizing your site, learn the basics yourself. There are tons of eBooks on this, including free ones. Be sure to add a plugin to your WordPress website such as All-in-One-SEO – and learn how to use it. It will improve the ranking of your site in Google’s search results significantly! 30. Are you a children’s author based in the US? Check out America Writes for Kids! Ask to be included in their list of authors –> http://usawrites4kids.drury.edu/. 31. Upload your posts, articles and first chapters to open-submission platforms – sites that describe themselves as reader-writer communities and allow users to publish and discover writings. They tend to get a ton of traffic each day, and are therefore a great way to “grow your platform” and drive more traffic to your blog. There are several out there, but include Scribd, DocStoc, Wattpad and Open Salon. [Edit September 15th 2012: I updated and expanded this post into the eBook 77 Ways to Find New Readers for Your Self-Published Book. It’s a far more polished text, complete with actionable steps on how to best implement the tips and over 45 more ideas to try. Check it out here!] This post was inspired by the lovely Marianne Spitzer. Marianne has been an online friend of mine since I started Ladies Who Critique in 2011, and she’s a consistent, warm and loyal supporter of both LWC and 30 Day Books. Her book Gypsy Spirits is a supernatural thriller, and I’d like to give it a plug here! Laura Pepper Wu is the co-founder of 30 Day Books: a book studio. She has worked with a variety of authors to successfully promote their books, including many Amazon best-sellers. Laura is the author of wedding non-fiction guides and book marketing guides 77 Ways to Find New Readers for Your Self-Published Book and Fire Up Amazon! Laura also runs Ladies Who Critique, a critique-partner finding site. When she's not working at the studio, you can find her walking her dog, "yoga-ing" or at a coffee shop in Seattle.

Compare book prices at 110 online bookstores worldwide for the lowest price for new & used textbooks and discount books! 1 click to get great deals on cheap books, cheap textbooks & discount college textbooks on sale. Feng-Shui: The Science of Sacred Landscape in Old China The reissue of this book, first published in 1873, is no indulgence in curiosities. Feng-shui is the science of sacred landscape as known in Old Chinese traditions but, as John Mitchell points our in his commentary, it addresses some of the same problems that concern us today in town planning and the development of sites. John Mitchell is an English investigator of landscape, both ancient and modern, and his Introduction makes the necessary links between China and the west and between past and present. A sacred landscape is one which transcends both nature and function, giving shape to the capacity for experience which human beings may enjoy. The master of feng-shui takes a given site and `develops' it - but in a way hardly known today. By selection and precise manipulation, he brings out characteristics which otherwise would remain latent. Feng-shui is a method of synergy, combining the best elements in a situation, finding the best locations for additional structures and creating something new in a balanced, harmonious way. It is a method of design and management from which there are lessons to be learned. Here is a chance to find a new perspective on the urgent problems of landscape in the contemporary world and to make contact with Chinese thought and cultural tradition. The goal of this website is to help shoppers compare book prices from different vendors / sellers and find cheap books and cheap college textbooks. Many discount books and discount text books are put on sale by discounted book retailers and discount bookstores everyday. All you need to do is to search and find them. This site also provides many book links to some major bookstores for book details and book coupons. But be sure not quickly jump into any bookstore site to buy. Always click "Compare Price" button to compare prices first. You would be happy that how much you would save by doing book price comparison. Buy Used Books and Used Textbooks It's becoming more and more popular to buy used books and used textbooks among college students for saving. Different second hand books from different sellers may have different conditions. Make sure to check used book condition from the seller's description. Also many book marketplaces put books for sale from small bookstores and individual sellers. Make sure to check store review for seller's reputation if possible. If you are in a hurry to get a book or textbook for your class, you should choose buying new books for prompt shipping. Buy Books from Foreign Country Our goal is to quickly find the cheapest books and college textbooks for you, both new and used, from a large number of bookstores worldwide. Currently our book search engines fetch book prices from US, Canada, UK, New Zealand, Australia, Netherlands, France, Ireland, Germany, and Japan. More bookstores from other countries will be added soon. Before buying from a foreign book store or book shop, be sure to check the shipping options. It's not unusual that shipping could take two to three weeks and cost could be multiple of a domestic shipping charge. Please visit Help Page for Questions regarding ISBN / ISBN-10 / ISBN10, ISBN-13 / ISBN13, EAN / EAN-13, and Amazon

Your future home awaits you, in the heart of NoLita, in this stunningly vibrant 2 Bedroom/2 Bathroom Duplex, now available for rent! Apartment features include super High Ceilings, Hardwood Floors, over-sized windows which flood the unit with abundant natural light. Step outside to your private terrace, bask in the sun with a cold beverage, while enjoying a cool breeze and ultimate relaxation. Both bedrooms are well-proportioned and receive great natural light. 2 Marble Baths. Building amenities include - Doorman - Elevator - Synergy Health Club - On-site Superintendent - Laundry Facility This beautiful apartment is just one of many I have available for rent in the area and I am happy to show you them at a time convenient to you. Please call, email or SMS David Popplewell to see this apartment before its gone. Listing Content Provided By: David Popplewell

Browse by Topic Learn more about the healthcare finance industry's leading professional association. Find out why our members rely on HFMA as their go-to source for insight and information. Members have many options for helping them advance their careers. Conferences, seminars, eLearning, certification, and more -- our education and events will keep you motivated. Stay up-to-date in a rapidly changing industry in Fort Lauderdale (Nov.16-18) and Chicago (Dec. 12-14). Register early and save. Learn how to increase receivables, reduce denials and work more efficiently with HFMA’s new Certified Revenue Cycle Representative certification program. Find out how to achieve recognition as an Adopter of best practices to earn your patients’ trust when it comes to financial matters. Our newsletters offer targeted articles with technical how-to details and thought-provoking insights from healthcare finance leaders and industry experts. The Helen Yerger/L. Vann Seawell Best Article Award recognizes articles for outstanding editorial achievement in hfm Information about leading vendors helps your buying decisions. Forum members can network during live webinars or access a library of past webinars on topics such as ICD-10 implementation, CMS audits, bundled payment, charity care, KPIs, and more. An ever-expanding collection of spreadsheets, policies, job descriptions, checklists, and more that you can adopt and adapt. Forum members can submit vexing questions to a panel of experts using our Ask the Expert service. Your source for employment solutions. Find new employment opportunities or reach out to qualified candidates. Distinguish yourself as a leader among your peers and advance your career by earning certification in our healthcare finance programs. Get an objective third-party evaluation of products and services used in the healthcare finance workplace. MAP App is a web-based application that helps organizations improve revenue cycle performance based on industry-standard metrics called MAP Keys. Find suppliers and products in this comprehensive vendor directory for healthcare finance professionals. Guidance for understanding and communicating about the price of health care. Transformation toward value-based healthcare is reshaping the delivery of care, patient expectations, and payment structures. Improve your revenue cycle performance through standard metrics, peer comparison, and successful practices. Research on the value performance of hospitals nationwide demonstrates that hospitals can achieve lower costs concurrently with higher quality. Business intelligence is a valuable pathway to the wealth of information that already resides in healthcare provider and payer organizations. A North Carolina-based hospital redesigned its service line strategic planning process to be in sync with the annual budget cycle. High-performing organizations are leveraging new technologies and implementing efficient and repeatable processes that can balance accuracy with efficiency so cost accounting information is more timely and accurate. In a recent interview, Bob Kocher, MD, a former Obama administration healthcare adviser, said that healthcare finance leaders should work toward developing a pricing strategy and sharing total costs of elective procedures with patients. Planning a successful transition from fee-for-service to new revenue models may be the greatest impending challenge for finance executives of hospitals and health systems. View a sample dashboard used by Spectrum Health Continuing Care to monitor quality and safety in its post-acute assets. Making the necessary investments for comprehensive care management can support more cost-effective and efficient care delivery for multiple populations across the continuum of care. In 14 months, leaders at Spectrum Health turned around their lagging post-acute care businesses and launched a comprehensive, continuing care network. Corporate-owned and physician-owned imaging facilities were drawing radiology patients away from two Houston-area hospitals. But the hospitals reversed this trend with improved efficiencies and increased referrals. Developing a plan for capital access to support key initiatives can help not-for-profit health systems better position themselves in a challenging economic environment. Mid-sized systems are taking proactive steps to prepare for value-based business models and strengthen market share in an environment of reform. In many markets, there is a direct relationship between a healthcare system’s primary care presence and its market share. The biggest challenge is defining the care management rules, says John Halamka, Beth Israel Deaconess Medical Center. Academic medical centers should research and embrace new approaches to financing, operations, and governance to become more cost efficient and profitable in an era of reform. Former CMS administrator Don Berwick, MD, discusses the challenges of changing the healthcare business model as we stand on the threshold of a value-based delivery system. Baylor’s journey to building a synergistic approach to service line planning began in 2010 when the health system assigned operational leaders to its leading service lines. The Institute of Medicine's Dr. Michael McGinnis offers a perspective on the nation's progress in achieving the best health care at lower cost. NorthShore University HealthSystem vets potential clinical quality improvement projects by a list of criteria, such as usability, standardization potential, level of innovation, and opportunity for impact. Revenue Cycle Leadership Team & Functional Organizational Chart Vice President Revenue Cycle Executive Director Middle Revenue Cycle Executive Director Revenue Cycle Patient Access Executive Director Revenue Cycle Patient Financial Services EVP & CFO Finance Executive Director Revenue Cycle Business Support Services Ex Joseph Koons Managing Director Revenue Cycle 254.5 FTE’s Total Melissa Viohl Director Pt Access 83.9 FTE’s Maria Ramsey Director Patient Accounting 47.8 FTE’s Judy Martin Manager, Rev Integrity Matt Newbill Mgr Customer Svc /Collections Louanne McClure Mgr Claims Processing Transport Acct Specialists Relay Health RN Ch Achieving greater scale is one strategy small, rural hospitals are using to manage the transformation to value-based payment models. The CFO at St. Barnabas is over patient access, clinical financial services, denials, patient financial services, and managed care. For a hypothetical and typical health system, deciding how to become fully capable of operating under value-based purchasing in five years is an intricate - and critical - understanding. Learn how the Camden Coalition uses data to improve the city’s healthcare delivery system. In this Business Profile, Shawn Yates, director of healthcare product management at Ontario Systems, discusses the growing challenge of managing self-pay accounts and provides insight on how providers can successfully collect patient payments. In this business profile, Cathy Smith, leader of the revenue transformation consulting practice at The Claro Group discusses how the organization helps hospitals and medical groups reimagine their revenue cycle. In this business profile, Deloitte & Touche LLP executives Anne Phelps, principal and U.S. healthcare regulatory leader, and Daniel Esquibel, senior manager, explain ways health systems, health plans, and physician practices can prepare for MACRA. In this Business Profile, Bruce Haupt, president and CEO of ClearBalance, discusses how a patient loan program can increase patient collections, reduce bad debt, and speed cash flow. In this Business Profile, Jerry Bruno, principal with Deloitte Consulting LLP, discusses the importance of choosing revenue cycle solutions that help an organization meet the challenges of a quickly evolving healthcare environment. In this business profile, Lane Jackson, a partner in the Grant Thornton LLP Health Care Advisory Services practice, with extensive experience in overseeing system implementations and revenue cycle reorganizations, discusses best practices for elevating revenue cycle performance during an EMR implementation. Grant Thornton LLP is a sponsor of the Large System Controllers Council Affinity Group. Patient financial engagement is more challenging than ever – and more critical. With patient responsibility as a percentage of revenue on the rise, providers have seen their billing-related costs and accounts receivable levels increase. If increasing collection yield and reducing costs are a priority for your organization, the metrics outlined in this presentation will provide the framework you need to understand what’s working and what’s not, in order to guide your overall patient financial engagement initiatives and optimize results. No two patients are the same. Each has a very personal healthcare experience, and each has distinct financial needs and preferences that have an impact on how, when and if they chose to pay their healthcare bill. It’s no longer effective to apply static billing techniques to solve the complex challenge of collecting balances from patients. The need to tailor financial conversations and payment options to individual needs and preferences is critical. This presentation provides 10 recommendations that will not only help you improve payment performance through a more tailored approach, but take control of rising collection costs. This white paper, written by Apex Vice President of Solutions and Services, Carrie Romandine, discusses the importance of patient segmentation and messaging specifically related to the patient revenue cycle. Applying strategic messaging that is tailored to each patient type will not only better educate consumers on payment options specific to their billing needs, but it will maximize the amount collected before sending to collections. Further, targeted messaging should be applied across all points of patient interaction (i.e. point of service, customer service, patient statements) and analyzed regularly for maximized results. This white paper, written by Apex President Patrick Maurer, discusses methods to increase patient adoption of online payments. Providers are now seeking ways to incrementally collect more payments due from patients as well as speeding up the rate of collections. This white paper shows why patient-centric approaches to online payment portals are important complements to traditional provider-centric approaches. Increased electronic engagement between healthcare providers and patients provides significant opportunities for improving revenue cycle metrics and encouraging patients to access EHRs. This article, written by Apex Founder and CEO Brian Kueppers, explores a number of strategies to create synergy between patient billing, online payment portals and electronic health record (EHR) software to realize a high ROI in speed to payment, patient satisfaction and portal adoption for meaningful use. Faced with a rising tide of bad debt, a large Southeastern healthcare system was seeing a sharp decline in net patient revenues. The need to improve collections was dire. By integrating critical tools and processes, the health system was able to increase online payments and improve its financial position. Taking a holistic approach increased overall collection yield by 10% while costs came down because the number of statements sent to patients fell by 10%, which equated to a $1.3M annualized improvement in patient cash over a six-month period. This case study explains how. With the ICD10 deadline quickly approaching and daily responsibilities not slowing down, final preparations for October 1 require strategic prioritization and laser focus. Read how Gwinnett Medical Center provides clear connections to financial information, offers multiple payment options for patients, and gives onsite staff the ability to collect payments at multiple points throughout the care process. Read how Orlando Health was able to perform deeper dives into claims data to help the health system see claim rejections more quickly–even on the front end–and reduce A/R days. To maintain fiscal fitness and boost patient satisfaction and loyalty, healthcare providers need visibility into when and how much they will be paid–by whom–and the ability to better navigate obstacles to payment. They need payment clarity. This whitepaper illuminates this concept that is winning fans at forward-thinking hospitals. Financial services staff are always looking for ways to improve the verification, billing and collections processes, and Munson Healthcare is no different. Read about how they streamlined the billing process to produce cleaner bills on the front end and helped financial services staff collect more than $1 million in additional upfront annual revenue in one year. Effective revenue cycle management can be a challenge for any hospital, but for smaller providers it is even tougher. Read how Wallace Thomson identified unreimbursed procedures, streamlined claims management, and improved its ability to determine charity eligibility. Before launching an energy-efficiency initiative, it’s important to build a solid business case and understand the funding options and potential incentives that are available. Healthcare leaders should consider taking the steps outlined in the whitepaper to ease the process of gaining approval, piloting, implementing, and supporting sustainability projects. You will find that investing in sustainability and energy efficiency helps hospitals add cash to their bottom line. Discover how hospitals and health systems have various options for funding energy-efficient and renewable-energy initiatives, depending on their current financial structure and strategy. Health care is a dynamic mergers and acquisitions market with numerous hospitals and health systems contemplating or pursuing formal arrangements with other entities. These relationships often pose a strategic benefit, such as enhancing competencies across the continuum, facilitating economies of scale, or giving the participants a competitive advantage in a crowded market. Underpinning any profitable acquisition is a robust capital planning strategy that ensures an organization reserves sufficient funds and efficiently onboards partners that advance the enterprise mission and values. The success of healthcare mergers, acquisitions, and other affiliations is predicated in part on available capital, and the need for and sources of funding are considerations present throughout the partnering process, from choosing a partner to evaluating an arrangement’s capital needs to selecting an integration model to finding the right money source to finance the deal. This whitepaper offers several strategies that health system leaders have used to assess and manage capital needs for their growing networks. Announcements from several commercial payers and the Centers for Medicare and Medicaid Services (CMS) early in 2015 around increased efforts to form value-based contracts with providers seemed to point to an impending rise in risk-based contracting. Rather than wait for disruption from the outside in, health care providers are now making inroads on collaborating with payers on various risk-based contracting models to increase the value of health care from within. Yuma Regional Medical Center (YRMC) is a not-for-profit hospital serving a population of roughly 200,000 in Yuma and the surrounding communities. Before becoming a ZirMed client, Yuma was attempting to manually monitor hundreds of thousands of charges which led to significant charge capture leakage. Learn how Yuma & ZirMed worked together to address underlying collections issues at the front end, thus increasing Yuma’s overall bottom line. Kindred Hospital Rehabilitation Services works with partners to audit the market and the facility’s role in that market to identify opportunities for improvement. This approach leads to successes; Kindred’s clinical rehab and management expertise complements our partners’ strengths. Every facility and challenge is unique, and requires a full objective analysis. As the critical link between patient care and reimbursement, health information enables more complete and accurate revenue capture. This 5-Minute White Paper Briefing shares how to achieve cost-effective revenue integrity by your optimizing HIM systems. Speedier cash flow starts with better CDI and coding. This 5-Minute White Paper Briefing explains how providers can improve vital measures of technical and business performance to accelerate cash flow. Qualified coders are getting harder to come by, and even the most seasoned professional can struggle with the complexity of ICD-10. This 5-Minute White Paper Briefing explains how partnerships can help improve coding and other key RCM operations potentially at a cost savings. The point of managing your revenue cycle isn’t just to improve revenue and cash flow. It’s to do those things effectively by consistently following best practices— while spending as little time, money, and energy on them as possible. How Lucile Packard Children’s Hospital Stanford increased payments received within 45 days by 20% and reduced paper submission claims by 70% by using ZirMed solutions. The reasons claims are denied are so varied that managing denials can feel like chasing a thousand different tails. This situation is not surprising given that a hypothetical denial rate of just 5 percent translates to tens of thousands of denied claims per year for large hospitals—where real‐world denial rates often range from 12 to 22 percent. Read about how predictive modeling can detect meaningful correlations across claims denials data. Emergency Mobile Health Care (EMHC) was founded to be and remains an exclusively locally owned and operated emergency medical service organization; today EMHC serves a population of more than a million people in and around Memphis, answering 75,000 calls each year. Since the Physician Quality Reporting Initiative (PQRI) introduction, CMS has paid more than $100 million in bonus payments to participants. However, these bonuses ended in 2015; providers who successfully meet the reporting requirements in 2016 will avoid the 2% negative payment adjustment in 2018, so now is the time to act! Included in this whitepaper are implications of increasing patient responsibility, collections best practices, and collections and internal control solutions. Getting paid what your physician deserves—that’s the goal of every biller. Yet even for the best billers, achieving that success can be elusive when denials stand in the way of success, presenting challenges at every turn. Denials aren’t going away, but you can learn techniques to manage and even prevent them.Join practice management expert Elizabeth W. Woodcock, MBA, FACMPE, CPC, to: Discover methods to translate denial data into business intelligence to improve your bottom line, determine staff productivity benchmarks for billers, and recognize common mistakes in denial management. Physician practices must improve organizational efficiency to compete in this era of reduced reimbursement and escalating administrative costs. Many healthcare organizations are pursuing next-generation health information systems solutions. Learn more about Navigant's work with University of Michigan Health System. The proper implementation of healthcare information technology systems is crucial to an organization’s financial health. Copyright 2016, Healthcare Financial Management Association. Join HFMA today and enjoy:

Hints are everywhere that the time has come for intervention from a higher source of reason and this is the response we of the League of Light have to give. You are really in for a nasty surprise if you are thinking that the world will get away from its own karma, its own balancing act, by allowing the destruction of its biosphere to happen while people are readying for a major upgrade. This is not the case. The world has its own plan, dear people who inhabit it, and you are part of that plan. Some of you have opted for the lesson of facing the ultimate kind of fear a human can muster and remaining in the awareness of the planet’s timing in transforming itself into the next phase of evolvement. This is suffering in the realm of degradation, war, and illusory reality and is the service of the great soul of evolved beingness to allow the opening of the temporal realities of other worlds so that the final conflict can be staged for the spiritual imperative of making a decision about what is the truth and what is falsehood in humanity’s drama. Those who are making their way at this time through the suffering are those souls who chose to incarnate for the sake of giving OM the experience of extreme hopelessness and loss, those who will reveal love’s greatest secrets yet to the mind of OM. OM knows all, yet OM allows the isness to experience in the creation of reality, and thus is the mind of OM given form. It is the mind of men which calculates and plans and uses the forces of nature to bend reality into a form that appears not entirely divine, but which in reality is only as real as the life it is given. On the other side of the fence from those who suffer realities’ harshest conditions are those that line their pockets with cash gained from the commerce of pain. Do they play a role in the evolvement of the planet? Indeed they do, for if it were not for the balancing activity of universal 3, there would be no movement at all. There is something to gain, as awakening humanity, from the study of low-lifes such as these, for they carry a secret that you have searched for over lifetimes of incarnational matrix-jumping, and the lock to get at this treasure is in the deepest, most secret part of your ability to love. We are not saying to pet them and give them bread, for they have plenty of comfort on their own accord. No. What we are suggesting, dear ones, on the good word of OM itself, is to see within their form the core vibrational sequence that matches the core of life. There is still some left in some of them yet. Not all of it has been sequenced out of their DNA from repetitive interbreeding. Where you see the concord of sequenced pattern of life, bless the fact that you can recognize it and in that action, know that you have brought life into harmonic resonance with itself. The loss of life is not the business of our crew, though we have seen more than our share of it in our history, as well. We are telling you what we have learned so that you may gain the necessary traction to pull yourselves together as a singular organism of consciousness and opalesce in the dark void of the threat of annihilation, thereby changing the course of your own history and gaining the immunity to withstand dark encroaching thirst for energies that have held you apart from the light of OM’s totality for far too long. There is love where there is life, remember this always, and respect the choice of a soul to place it where it is in the totality of OM’s light. The magic number is three. We have laid the level on the two points of suffering and degradation, and two is in balance with itself. To gain momentum and raise the level higher in the dimensional matrix, isness needs the third component of conscious creation, and that is awareness of love. We hinted at this above, and you might have guessed, if you are reading these words, that it is you who are the ones who carry this crowbar, wherever you fall on the continuum of comfort. If you have the awareness of Self, of knowing who you are as an emanation of the mind of OM, of the foundational substance in which your soul makes its foray into the limitlessness of form, then the third node of sentient beingness has become your point of view. It is your awareness, no matter if you are sneaking around the corner from a sniper’s gun or sneaking your hand into the cookie jar at grandma’s house, that brings you out of the balancing act of duality into the intradimensional field of sentience alive in its play of consciousness. It is in this state of awareness that freedom is achieved, that liberation from the limitation of thought is brought into the limitless experience of the soul released from the mind. From the point of view of one who is aware of life and is unable to differentiate between life and love as fundamental states of being, there is nothing that is not alive as light being animated by understanding. In the cognizance of divinity is love made one. We are here in the field of intradimensional communication with you at this time in your planetary history to impart the data which has sat unnoticed in the delirium of matrix-based consciousness. As you are rousing yourselves en masse from the febrile dream of war and criminality passing for life’s fundamental rules of play, we remind you to shift your gaze to the skies and let the form of our interdimensional communication take shape in your viewfinders and minds. We are here to give you our greeting in the light of a new temporality, which even now is beginning to graze the shell of the collective mind. If you are ready to proceed, we are ready to move into clearer formation. Let your heart be free, dear family and friends, and let our words be light in your mind. In the deepest love and the fullest respect, we say to you, the time has come for awareness to make its mark in the field untrodden by a global people ready to be met in the light of a new day, as one people living in the truth of love’s intelligent design of life. Have you ever thought about the one thing that would make you the happiest coming true? To be free from some lock, to be given a treasure, to have a lasting and fulfilling love? All these are attainable in one way or another, the truth is. You have already had them becoming true in your life if you have ever given your heart to the hands of your soul. The key to all freedom, treasure, and love is there, eternally and steadfastly. All you need to do is trust, and let it transmit. And get out of the way. The heart knows how to get there. Once there was a farmer in a field of his crops, standing and looking up at the sky with a hand to shade his eyes from the upsetting glare of the sun. He hadn’t seen anything but sun and night for a long time, and yet the only clouds in sight were the ones that filled his head with thoughts of dark heavy worry, and anger at the elements for letting him down. He knew things would have to change, eventually, but his patience had long ago been drained, and his family looked gaunt and haggard. So did he, but the only thing he could do was to tell the mind of the sky to send some water to his dying fields. When a drop of water fell on his head, he fell on his knees and thanked the sky for responding. As the drops accumulated on the dry mud around him, he remembered with some difficulty the words to a song he knew as a child, telling the rain to go away, come back another day. Before he had put the words in order, the rain had ceased and so had his hope of life returning to the parched earth. Had his childish memory killed the rain, he thought? Of course that was silly to think of, but it did cross his mind. He sat on his heels and decided to give up. If he was put in that field, with that family, in that place at a time of no rain and heavy downpours of sunlight, he might as well just accept the inevitable truth that there must be some good reason for it in the mind of his soul. At any rate, there seemed little he could do to change things, and the kind of work he could get outside of his soil-based economy was definitely not going to cover his needs. So, he got up, dusted himself off, and set his eyes toward a different sun, one invisible in the glare of day’s activity but recognizable by his heart nonetheless, one he watched rise when he could at night, one that beckoned his heart to settle on peaceful vibrations and emotions of home. With this as his lodestone, he turned toward the farmhouse, family, and bread. Everything else, he trusted, would follow. It was just a matter of time until he had to decide on anything more important that eating a humble dinner, and he would simply do what was before him until the time came for that to happen. After all, he heard his mind say, wasn’t it better to do as he pleased, even if he didn’t know where that would lead, than to second-guess and end up wishing he had done things differently? So he had his dinner, enjoyed the evening sunset, and read a good book before heading to meditation in sleep. He allowed his mind to let go of his worry and redefine it as something other than a big problem, and as he dreamed, he saw the light of clarity and wisdom leaguing together in the space within his form, coalescing into thought, and waiting for him to awaken. Before he knew it, his world had changed in a way he hadn’t expected! The worry of the previous day had dissolved in the sudden appearance of a new and different light, a new sun, and a new energy of life. What was this? Dear ones, you will soon see for yourselves. Is a new light about to break through the layers of Earth’s blanket of sleep? Yes. Is a thunderbolt going to shatter the complacency of humanity’s sleeping masses? Yes. Are you going to see everything change in an instant? Relatively speaking, yes. You are on the edge of the dawning of a new day, in very literal terms. You will be on the forefront of a new humanity building a new world on a renewed planet, and all that stands before you is to survive the transition from now to then, to keep yourself intact, and to bring with you the remembrance of the dream and its promise of light glowing from within the dark recesses of mental slavery. Hope, dear ones, is what we are talking about, the hope that you have carried with you from generation to generation, the seed that has been given to successive returns of soul to body, the light that shines on your way in the darkest of times and circumstances. It is now that you will need to kindle that flame into something brighter than a spark, for the days ahead may knock some of the outer lights loose from their moorings and help may be just out of arm’s reach for some. Know that we are listening to the heartbeat of the cosmos and keeping a watchful sweep of the night’s shadows. We want you to wake up but we will not disturb you as you do. It only makes people grumpy. Listen to the skies and know that the changes that are happening are natural and not designed to destroy your soul. Stay tuned to the frequencies of light that imbue the truth of the universe’s fundamental being, of life, and of love becoming more transparent in all things, and the ride will be less bumpy, for the most part. Come what may, know that you are most definitely not alone, that you have powerful friends in the wings, and the internal recalibration that inevitably comes on the next incoming wave of light will bring new understandings, old wisdom remembered, and peace deep within the heart of humanity. We are with you now, as we have always been. High time is almost here, when the new normal will arise above your world’s depth of suffering and bring you home on a more fine weave of being. If you think what has been intimated from the ones who foresee the future of your planetary shift is leaning toward the doom-and-gloom side of things, you might be interested in what we have to say today. If you think the world is going to swiftly come to lots of good things for everyone, light and love for all, you might also be interested in this. Should your interest be in the scientific understanding of what is happening and about to happen to the planetary and celestial interaction of measurable energetic fluctuations and the succeeding impulses impacting Earth, we have something to say to you as well. You see, we are not limited to speaking only to a particular branch of humanity, nor has that ever been our intent. We understand the penchant you have for compartmentalization of people, sometimes for good, sometimes for ill, but we say that we do not need to limit our communications with you in this regard. Our words are carefully engineered for all, nonexclusively, interactively, and for the common good. Of course, should you have no interest in understanding what we have to say, but are only interested in shooting down what you do not understand fully, then though we have something to say to you, you probably won’t understand it, so we will remain and speak nonetheless. You will soon enough have a choice to make as to whether you wish to give our words any credence, and until then, we merely let you have your target practice in peace. The beginnings of big change are kicking into gear now. You will be aware of that as the sun starts to shine a little differently, and as the Earth begins to groan in her birth pangs. If you are not comfortable with such visceral imagery, think of it as repositioning of pressure to allow for a smooth transition of something quite earth-shattering to come into being, so that the generation of life can continue without the limitations of darkness pressing in on every side. Gold will lose its shimmer when you realize that the bottom of the barrel has been reached, in terms of the ability of the commercial enterprises of the global marketplace to sustain the game any longer. We have spoken to you before of the day that the game of Mogul becomes replace by the game of Dream Creation, and that day is on the edge of dawning, dear people of Earth. The pieces are falling into place just as the gameboard is tipping to one side, and winner-takes-all will be tumbling into a pit before the winnings can be interred for later enjoyment. The fact is, the time is upon you to take the initiative further than ever in spinning the checkerboard so you have a better view of what’s heating up on the horizon. If you can manage it, a big push together in the direction of love of humanity in all its forms could just get things situated so you can get the full picture. Greet each other as end-gamers, no matter what flavor of the game you have chosen to play, and know that we are cheering for the purported underdog (all the while knowing full well that the underdog is in fact the superhero in disguise). If you play it well, you won’t have to budge from where you now dream, for the participation in gameboard-spinning requires merely the application of mental and spiritual energies of the type that influence the materialization of matter at sub-infinitesimal measurements. You have the trump card, each one of you, not up your sleeve but in your very physical makeup. Intrigued? We have much more to share on this matter! In the meantime, let us tell you a story. It has been far too long since you have had one from us. This one is guaranteed to have some bit of interest for at least some of you clever enough to read it. Be careful to begin at the beginning and end when you reach the end, so that there is no confusion as to what sequence of events we are talking about. Not so long ago, there was a man in the world of men who had a telltale mark upon his hand that told anyone he met that he had been in the field of secret sharing. The mark indelibly showed on his skin to remind him of his lineage and loyalty, not unlike the sort of thing that bore significant bright certainty on elite memberships in days long gone. Yet this man had neither lineage nor membership to boast of, just a curious mark upon his hand. Yes, he had some sort of telltale sign of some meaning, but it was meaningless to most who met him, and to a large extent to himself as well. Days strung together and he lived under the shadow of nothing but reality when, in an instant that changed everything, he exited one reality and found himself in another one altogether. In this new reality, he discovered that the mark upon his hand had a great and profound meaning to most people there, and he began to understand his own lineage and origins much better. If there was such a shift, what caused it, and what was the nature of this mark upon his hand? In a word, density. In the old reality, the density of one world crashed in through the protective layers of another, and everything ceased to be as it had always, in memory, been. In the changed workings of the new reality, the density of the mark on his hand emanated a glow that to those who saw it was ever more meaningful because of the nature of the one who bore it, which was innocent of knowledge and bereft of memory upon his appearance among them. The mark: nothing but a scar, yet to those who knew its origins in sacrificial culture, it was the mark of a survivor, a bearer of connection to lost worlds, and a reminder that the ones who had lost the brave path in another world had not fully succumbed to death of spirit, but would survive to create a new world free from sacrifice, divine in its core, and free to evolve unimpeded. Who was this man? He represents every human on earth who has given their life over to a great and powerful vision of something wonderful, something safe and wholesome, at least in theory. Many on your world fall into this category. He also represents any who have stood in the face of injustice and held out their hands for insanity and terror to end. They too abound on your world. Others bearing the energies of service, of duty, of getting along also resonate with our friend in the story. And the others seeing his truth? They are going to show themselves soon enough… and they are you, and we, and others yet to be introduced to the timeline of transformation. It is not to say simply that we are going to be in the picture, but to say that you have given the signal that it’s time for help to be ready to jump in and we are waiting to be of service where we can. The days and weeks ahead are promising to be full of the potential of great and deep change for the planet, and so it is time to share the next tidbit of information with you as well. And that is, we are already with you, and the changes that are coming will be a big shock to many, but the truth is, we are in the secret silence of service every day, and there is none more in readiness to join in the general change than we. The light will soon shift into a higher gear of intensity and concentration of form, and the appearance in the sky of fine shimmers of radiance will be side by side with great big blasts of cosmic energy. We are here, and we are ready to be of service. You will see the changes coming to the earth in ways that what had been is no more, and the ground below your feet may start to move or rumble. We are here, and the changes are part of our service. When you see things seeming to fall apart, know that we are part of the new world coming into being, as midwives and as helpers. It is enough that things will be moving along rapidly without worrying about doing it all on your own, but we are not here to interfere in the process that you have, as a people and a planetary entity, worked so long to reach the culmination of, and you have arrived at the entry point of the moment of lifetimes. We will answer any call for help that we are able to participate in, until the time comes for our full participation opening sanctioned by general agreement among all parties involved. Until then, know that we are here. Know that life will survive and that light will prevail in the long time of shadows and secrets. You have not come this far to be found wanting, for your circuitous route to understanding, knowledge, and discovery has brought you into the state of awareness of many more mysteries than you could have imagined yourselves approaching even a short time ago. More mysteries await your discovery, and more rewarding shores shall open to your entry. Be at peace with the unfolding of the universe, for it does, in fact, know what it is doing. Let fear not be part of the equation, and let love become part of your entire picture. Biding your time until the next phase of humanity’s collective evolution is a sure way to see some of the inner workings of the machinery of human social management within the matrix of planetary creative unfoldment. You can tell yourself everything is going along as normal, or you can say that it’s all coming down in a moment’s space of alarm and awakening. It is possible, as well, that the picture you might see if you step back from the screen of projected collective reality is one of big changes happening everywhere at once and throwing a wrench into the workings of many a conspiracy theorist or catastrophist. If you only knew what is in the offing, you would integrate a lot of the brokenness that plagues your social body, in the moment of knowing the unknown. It is for you to create as well as discover the surprises you have as a people set in motion to become reality, and the truth is, that is exactly what is happening right now. You’ll have the proof of that soon enough. Hitting the big time in the corps of humanity in the fire of purification is like driving into the center of a black hole and coming out intact but completely changed on the other side. You will learn the truth of wholeness as you allow the forces of integrational physics to tear from you the nonsense that you have allowed to pass for meaningful reality, and then the validity of having everything you could dream up is going to seem pretty silly. Even if you could have everything you wanted, what would you do with it the day the world turns into a different world altogether? If you have any thoughts about the kinds of things you would like to keep handy, you might re-think those thoughts after you knew what that new reality would be like. If the kinds of things you dream into being are the likes of having those things you need to live well despite the outer reality changing into something not to your liking, then that is worth considering for a moment. You don’t have to be specific, as long as you remain open to embracing the new reality that inevitably will unwrap itself over the next several weeks. There are to be shifts in alignments on all levels of your experience, and this will create a necessary adjustment of the internal systems that function in the reality you know and love. You are not going to be in the company of demonic forces, though the reality of them is for many people very real. Instead, the reality that is coming into form is the truth, the lessons, and the judgment from your own self on how you think you’ve been doing all along the bumpy road of life on Earth. There will be a moment for you to consider that before the distracting noise of 3-D reality brings you back to your senses, just in time to participate in the unraveling and reweaving of what you have considered to be your world. In other words, take a breath to assess your path, learn the lessons you have not yet mastered, and get ready for the rest of the show to go on. You don’t have to be fancy about all this, since it won’t be in any way what you expect it to be, anyway. If you can get in the flow then you’ll be just fine. Big movements are in the making underground and above the Earth. You have been watching for them, many of you, and others have not even noticed. Either way, things are moving, and set to move more as the Sun completes its recently lit highlighted tour of the neck of the universe you call home. You may have noticed, or you may not have, that the tides and skies are following their own set of rules unlike the norm. Higher and brighter, more movement and more heat. This is just a sample of the things that are brewing, and it is time for the truth to be told about the state of your neighborhood in the cosmic sense. Have you ever thought about the reality that would liven up the planet if the world’s sustenance were to be bent a degree or two toward the Sun? In other words, if the planet is going to continue to keep the lifeforms on it alive, it has to be at the constant inclination toward the star Sol and no further than the last notch in tilt. If it works, you are in the line up for a thoroughly new adventure without the worry of catastrophic changes getting in the way of your enjoyment. If it doesn’t have a better movement soon, though, the time ahead could be troublesome to say the least. It depends of course on a lot of things, one of them being the conscious alignment of humanity towards soul. That is the best factor for you to be concerned about in the day-to-day existence of business as usual. Above this is the soul of the planet aligning in harmonic resonance with the oversoul of the galaxy, but the best thing for the individual person to do is to link up their awareness with the twin resonance of soul. In this alignment, things slide naturally into the best lineup for everything to hum into harmony. This signature of light that is beaming from Sol to Earth is messaging each of you to become more attuned to this linkup that is part of your natural environment and in-vironment. It withholds nothing in giving you the push to break free from the bonds of harmonic restraint forced upon the planet in a brutal attempt to control it and harness it in the great game of power. You have incorporated yourselves into the game, knowing out of time that you would be bringing the age to a time of transformation and willingly putting yourself into forgetfulness for a time to be of service to the greater purpose of the game. On the surface, the power of the few to control the many is one that has a lot of you with a bad taste in your mouth, bitter and unsatisfying and dirty. However, there is a greater, deeper purpose to the game, and that is one that transforms not only the game, but everything, and gives you a satisfyingly full and rich knowing of the true nature of nemesis. The bid for the few to control the many is in some sense the struggle for the individual to live in a sea of emotion, wired to the electromagnetic spectrum of anger, jealousy, gratitude, and love. You have played the whole thematic sine wave and now you come to the point of what to do. You have a choice, and the next step in the energetic matrix of events is one that could take you into a new reality of endless blue skies or something less than perfect, it is up to you. You have the power that those in power would rather not acknowledge, and that is the power to bend a ray of light around a thought particle and change the trajectory for what unfolds. In an instant, it can be. In the next, it can change. Fear can become peace and hate become trust. It is the tiniest bend at light speed that can make a huge difference in the final outcome. If you have the energy to wrap yourself around that thought, it will be worthwhile to consider. Now that the time has come for real change to become part of your world, there is not time to lose. In the coming months you will see more change than you anticipated. Help is at the end of a call and will be with you shortly. Question: Could you take a step back from the edge of the end of the world to cast a glance toward the struggling ones who are in fear of leaving their souls behind when the sun rises on the soon-to-be day of transformation? Answer: In the moment that you think of what to say, you have become aware of someone who has a scream more desperate than your own in desperation for some miracle to save you and your planet from the torment of annihilation and desecration at the hands of uncaring men of bold direction toward a void of loveless eternity. There are many among you who read these words who have always harbored a secret doubt about whether or not something boldly OM-ward would happen in the end-of-the-world days, should you live to see them, that would give you rest from the torment of living through the school of hard knocks that Earth can be. Not all of you, but many. If more of you were honest about that, it would be fewer who doubted, for in bringing the question of whether or not, you see the potential of such an answerless question being asked of another human being in the depths of lovelessness of self, and you know they scream within themselves just to sound-check their descent into the void, in the sense of losing their footing and loosening their grip in a faltering dance at the edge of a dark abyss. It is you, dear friend, that dances such a sweet dance too, when the time is come for a reality check into the demonic caverns of life on Earth for those without the internetted framework of information that drives so many of you towards a new understanding of the world to be. Pause a moment in reflection of how you would be reality-creating without the knowings that are shared every day in the world of cyberspace. Left alone to your own internal network of conscious intuition, would you know that it’s all going to be all right, despite the cracks in reality that are claiming innocent lives and the peace of living free from oppression? It may be, but there are those thinking that things are pretty bad from where they are, and they are in need of any overflow of optimism that you may have to share. It’s an easy shift to become connected externally to an internetwork of human consciousness, and for those of you who have not given it a try lately, now’s a good time to hook into the system of ethernetworked knowing. We’re part of the system and would love to be in more direct contact through diplomatic core interactivity with you. Let in the breeze through the window of your minds that carries a new earth-scented hint of things to come. Open the door in your heart that welcomes the arrival of new states of being and dimensional experience within the corridors of human existence. One moment in a continuum can make the turn for the timestream that curves within the mental patternings of a whole planet, and when the awareness of who you can become becomes apparent to you as a people, the planetary wave will correspond to the change in current and begin to crash upon a new shore of consciousness. In that moment, there is nothing that can withstand the power of the knowing that there is only the reality that beingness is vitality and that you have the life within you that creates the reality around you as an extension of the energetics that involve the you encapsulated in flesh. In other words, the space within is what molds the space outside and in one moment of decision to see, there is nothing but life everywhere, even in the “void” in between stuff. In that now is where we are, and it is in that now that the next installment of the world drama is about to take center stage. Bring your awareness to the feeling in your gut when you consider the state of your immediate world, the consciousness of the people who walk in the street of the town, who work in the offices and sit in traffic thinking about their lives. How does it feel in your gut when you bring your awareness to the people in your family who are silent about some inner struggle they are engaged in, with a cousin who hasn’t shared their life story with you, of some ancestor who has left this world with regret or unresolved pain? What tells you that all is not well with the hearts and minds of the people who have gathered in throngs in the streets the world over to give voice and form to the desperation they have nothing to deal with but their energy and sounds? How do you feel when you think about the inner mindspace of the people to whom you have been giving your power and trust, to know that you have nothing else to do with the workings of your government than to perhaps offer some of your time and money but the real power has nothing to say about the things that have been creating the heat in the oven that is baking the bread of life, the nine-forsaking leaders who have secret motivations and allegiances within their every just cause? It may be that this is so, and it may be that it is not, or it may be that things are not what they seem on many levels of discernment. In the reality that takes root in the world you inhabit, what feeling do you have to bring to the ritual of inviting the living essence of the universe to give life to the thing you believe is real? What you hold in the depth of your being is what is forming around you. If you see only dancing colors of light and feel only love, all is well. If you have not conditioned yourself to feel these things to the exclusion of the realities around you that have been carried by a disproportionate number of your own race, then perhaps you are more prepared to create a world in which light can dance and love be the norm than those who have not given thought and heart to the networked reality of the human condition. We assure you, many are indeed suffering, worried, and broken, and where the links are in such a state of disharmonious integrity with OMful self-knowledge, there is weakness in the fabric of consciousness for all humans everywhere. Take a minute to think about what we are saying before moving on to the next point we have to offer today. When the next installment of the drama opens on the stage of the world that you are part of, will you be a piece of pretty scenery reflecting from the space within your heart some feeling of peace that is in isolation from the whole picture that is around you? It is well if you can be that, if the not-being of that leads you to not being at all. However, if the energetic holographic drama is one that directs you to match your inner mechanism of creative information to the needs and implied void that is woven into the play now onstage and in the general background music, then we have this to suggest as you ready yourself to utter your lines from the script. The breath that you use to power your body is more than a movement of air into and out from your lungs. The breath that you feel is a great catalyst for making things move in subtle yet powerful ways in other realms of being as well. If you have the breath of being parsed by an editor, directed by a mogul, or pressed into doing something that is not natural for you to do, it is well to clear your lungs and exhale the influences that have given rise worldwide to the things that bind your heart and gut, to see life as moving through such things rather than being maintained by them. In this way, you move through the turbulence and arrive in a whole state in a world that is much more suited to the livelihood of being human, in the future that is taking shape under your feet right now. There is no time to waste, dear ones, for this is the moment of transformation upon your threshold, on the open step that leads into a new reality taking shape within your collective cries of awakening from a long-enforced nightmare of living in the shadow of obstructed light. It is the moment of the final act from the old script arranging itself on stage and readying its arsenal of lines designed to keep the audience enthralled and oblivious to the next act readying itself in the wings. It is not so much that the future is arriving as that it just has to be met, and it is this moment that the inhale opens the heart so you can enter into the momentous headliner that is about to hit the news. If there is any doubt, look around, tune into the heartspace of human existence, know that you are part of a continuum of life, and feel the coming of a dreamtime awakening on a grand scale. When the final push for saving life on the planet becomes paramount in the minds of every human being on the place you now call home, we will be with you. It is not for us to say when that will be, for we can’t control your decision to awaken, only encourage it. This is your realm of control, dear ones, not ours or anyone else’s. There are free-thinkers and there are followers and there is everything in between, and there are those that have a vested interest in the continuance of your slumber. Be vigilant, for the dawn is peeking through the curtains of night and death is flying back to its lair for internal growth gone out of control. You have nothing to fear from us, our friends, sense this in your beingness. We have nothing to fear from the old enemies of humanity. There is nothing that need fear, but fear itself, for fear’s days are numbered now. High in the skies above we are, and with you in spirit and in the real world we are as well. We have never really left this world you are in, for your fate is entwined with our own in the sense that there is a blood recognition in frequency and the entirety of our love has been for the eventual reunion with the parts of soul that have needed reintegration into the harmonic of one. It is in our blood to long for this, and the field of resonance in this longing also has an overtone that tickles the soul of humanity on Earth to wield its internal light in the relentless movement toward the inner teeming chorus that goes into ecstasy in the face of the divinity it encounters within its individuated personalities that populate the planet and await the return to wholeness in accordance with the truth of Love in all things. You are familiar with this feeling, are you not? When it arises is when the feeling of freedom also shows itself, and power comes into being from within. Home is the closest frequency we can mention in relation to this phenomenon of self-recognition. No longer are you hearing Hell’s sizzle in every corner of your awareness, for there is a sigh of relief that sneaks through the veil of the collective consciousness of humanity. Hear it? It is the echo of your own soul. It has the intensity of a thousand suns behind it, and the ectoplasm of energies beyond the realm of sight is seeping through the cracks that have formed in the demolition of reality that is currently underway. It is the energy of frightful apparitions taking flight, and of demons starving for attention finally getting the blast of light from a thousand thousand conscious pairs of eyes turned on at once. There is a great trembling coming, dear ones, and isn’t it nice to know that it comes not a moment too soon for the time to grind to a halt and restart its workings? It seems like that’s something that’s on the minds of many, and it feels like that’s what the totality of the energies of change are, when they pass through. It’s just a matter of time and seeing what happens. In the front of it all, dear family, is you. You have in front of you a picture and this is what you have to walk through when you move forward. When you walk through the picture, you will see something new. This is how time works, and it is how you have lived all your days. It is no different now, but that you may be more aware of how you create the next holographic arrangement of light particles within the matrix of your own mind. There is a field in front of you, around you, which you walk through and exist in physicality within. It has reverberations and it has malleability, and it is controlled in part by your own mind’s eye. You have only to think of what it is that you are doing and you are able to alter it. You have only to think of the next moment and you are in it, whether it is what you think it is or is merely a variation on a theme that your soul has interjected some permutation of finite mathematics upon. There is only the moment that exists between thoughts that is pure and without form or influence, and this is the place where magic and miracles happen. It is the place where you have the ease of synergy, of flow, of OM. It is without entrainment until you are again aware of the reality of your life, and exists in definite ease relative to nothing and everything as one. This is the place from which we communicate to you and the place from which you are asked to try out a new kind of toy, which is your mind free from the influence of fear on a global scale. If you like it, we’ll be happy to lend a hand with whatever kind of new reality you dream up in time for a soul party like you’ve never dreamed of before. The clouds of the past are dissipating, dear people of the planet. You are being very calm about it all, despite the things that are brewing on the host of heaven’s big plan for the future. Yet there are some things that need to be set into motion before the inevitable whatever-it-is happens that’s about to happen. You see, there exists in the timeline ahead that is the most likely one for you to pass along the possibility that there is a grand event that makes the world wake up and pay attention. There is no guarantee that there will be a light show from the spaceships so many are in, but there’s no authority that says there won’t be. It remains to be seen. What we are here to say today is that there is something about to hit the minds and hearts of many people, and that we are on the horizon to make sure things go well for the whole of the world. You see, we can’t jump in and make it all better, but we can be just on the envelope, for now, and keep order from this side of reality. It won’t be long before that changes, but for now we are watching, waiting, and making things smooth to the extent that you can perceive. High above the rim of the sky and a little beyond that, we have our perch. We have been waiting for the time to come when we can be within the sphere of Earth’s lifestream again and interaction with you can resume. You have no tangible memory of the time when we were in your world other than vague impressions, recollections in dreams and lost visions, and the stories relegated to books and myth. We assure you that the time has been that you walked with gods and the time will give way to that being so in a short while. The first hints of that are arriving in your minds as shimmers of seeing and knowing that there are among you the men of light and the world of great things to come is at your doorstep. You have known in your hearts and it is coming to the forefront of your minds now, that once we walked the Earth together. So shall we do again, beloveds, in a way that puts everything about the millennia of separation into focus and opens understanding to a greater reality than engendered by the limited interaction you are able to partake in today. It is necessary for us to wait until the time has presented itself unequivocally near to the end of the road for there to be no interference in the best-case scenario available for the planet. There is no way that you can solve the issues of calamity that are streaming forth from the planet without some help, either from outside the sphere of Earth or from within, in the relaxation of control that has gripped everything since the time of the end of Eden until now. The things you need to get the world aright are there, all right, but they are closely guarded and under wraps. Is there a way for you to get them uncovered? You are working hard to wake up. It’s slow going, and the nightmare that looms is nothing that a lot of people want to see. We simply are here in case you need a sound reaction to get the job of awakening done, but we are only able to do so much right now. Reality has morphed from what it was a tiny bit of time ago, and will continue to change as the minutes and days eke forward. This is the initiation into light that so may have been longing for, but it isn’t what the infernal lords have been wanting to see. You are able to wrest yourselves free from the condition of slavery if you wish it to be so. We are happy to help in the best way for your entire race. We won’t take just the thought for a select few kind of plan. If it’s going to work, it has to work for everyone, even the shadows that have been sucking your blood while you slept. You have a little while to remain at rest, dear family. The time of awakening is soon to be upon you. Be ready to jump out of bed and into the full light of day. Have we gotten your attention yet? It’s not so easy, you know. You are busy with a lot of other information at the moment. If you would, take your attention away from the messages of impending doom, catastrophic change, and world intertribal tensions and listen, just for a really short time. There is something we’d like to share, and it’s the best thing we can do right now, to put this information in your ears and eyes, and let you let us share. We are just a simple band of intergalactic brothers and sisters, but that’s the path many of you wish to take, so we thought we’d tell you a little bit about our understanding of what’s happening on the planet before the story comes out on the news. It is heading in that direction, but it’s always good to have an inside scoop if you can get one. Your leaders are cooking up a really juicy plot to take you into the outside world with big fat bellies full of nonsense. You are for the most part aware of this, but things are getting more and more interstellar in scope, if you know what we mean. You have been clamoring for something to be revealed, but the truth is something that cannot be hidden forever and sooner or later reveals itself. The time for its unveiling is getting closer, if the time can be measured for such a reality to be born. It can’t really, but the attempt to pinpoint it is a noble one, and doesn’t have any really dire consequences, apart from personal disappointments for those who count on them to be the truth that they’re looking for. In actuality, the time for disclosure, the time of ascension, all that cannot be targeted without your participation in the whole activity. Ironically, there is little that the individual has to do, other than to take care of what’s coming into view for them. Worrying about the bigger picture is well and good, but the real change will happen when the nit-picky little details of individual perfection are dealt with in a soul-satisfying way. In a nutshell, that means taking a seriously honest look at the person who you are in the world, and comparing it to the person who you want to believe you are in the best of all possible worlds. The truth follows such noble deeds, when it can’t move forward during the heat of a controversy with unresolved origins. Get over the things that the news says you should be concerned about, acknowledge, and work on what you can do in relation to the activity of creating a perfect world and directing the flow of your presence toward its birth. It is enough, and the bigger issues of the day, whatever they become tomorrow, will sort themselves out. Hear the voice within and don’t get distracted by the noise of the next big adventure in the works. Your heart is in the know of what the truth has to show you, and it beams information to you constantly. Bring your attention to it and trust the truth to reveal itself through the internal conduit that feeds the soul of humanity everywhere. It is a survival means for the now. It isn’t our intention to tell you what to do. It’s up to you to find the high modulation that’s there for your individual ascendance, and come together in conscious streams of finding a strength as one people. It is our intention, rather, to be present, to share perspective with those of you who are entrained to our vibration of frequency through these communications and inner awareness, and to be of service when and where we best are able. Beyond this, spiritual endeavor cannot be taken up by another on the path of another, unless there is agreement and a need. You are powerful and no one needs to order you into any other understanding than that you are, indeed, able to pull this off, to change your world, to become great big powerful high-vibrating beings of new standing on your own terms. We are here to be beside you as family, as friends, and as supporters for the birth of the new reality you are shaping. We are your fans, and we love you beyond words. Be brave, dear souls, and know we breathe blessings to the whole planet.

Q: What is a game jam? A: A game jam is like a hackathon, but for games! Game makers come together, receive a creative theme, then make a game based on that creative theme over the course of 48-straight hours. This has been going on for a while, hosted by jams like Global Game Jam and competitions like Ludum Dare. Q: What happens at this game jam? A: Mostly, you meet people and have fun making games! Game makers will be coming together to make games in a 48-hour competition on-site in Portland, OR based on awesome Cartoon Network stories and characters; we'll also be featured in our own stories in a documentary about game making! Q: It's a competition? A: Game makers will create their 48-hour jam entries based on judging criteria determined by Cartoon Network. At the end of the weekend, entries will be given a short polishing period for their projects, then a winner will be chosen! Up to 16 Finalists will receive prize money and may have their work published in a Cartoon Network Game Jam bundle! And a winning game jam team will have a chance to negotiate a contract with Cartoon Network to provide the services to bring their project to fruition as a fully-fledged mobile app starting in May 2016. Q: How can I participate? A: Artists, programmers, animators, musicians, sound designers, writers, and game designers in Portland are welcome to submit work samples or portfolios to the jam event producer to begin eligibility. A select number of eligible entrants will then be invited to register and participate in the jam the weekend of February 12th, 2016! Registration opens for Portland on November 16th, 2015; the Pacific Northwest (Portland, Seattle, and Vancouver BC areas) on December 14th, 2015; then internationally on January 11th, 2016. Entrants must participate on-site in Portland. Q: Who can participate? A: Participants must be of 18 years of age or older. Registrants must come to the jam on-site at their own expense in Portland to participate. Only entrants approved by the jam event producer are able to participate. Individuals and teams may participate and submit up to two entries. Game Jam teams may not exceed 6 individuals. Seats are limited! Q: How can I best prepare myself? A: The best way to prepare yourself is by making games now! Learning from others, working with others, and teaching yourself new skills in your game-making discipline will be essential over the coming months. You are also responsible for forming your own development team before the jam starts. We recommend attending events hosted by the Portland Indie Game Squad to meet and work with other developers on small projects and hone your skills, including Portland's Global Game Jam 2016 site as a practice run. Q: How will the game jam be structured? A: We'll be meeting the evening of Friday, February 12th for a keynote presentation, and to reveal the game jam's special creative theme. We'll continue making our games through the evening of Sunday, February 14th. Over the course of the weekend, we'll be interviewed on-camera about our experiences and progress with our game making, meet mentors from popular game developer teams, and work with Cartoon Network show makers. After the jam, developers will receive one or two small points of feedback from judges, then are allowed to update those elements of their game over the course of two weeks to improve their chances of winning. Jammers will be responsible for their own equipment and expenses, including transportation and parking. We will provide at least four meals over the weekend, and of course lots of coffee. Our aim is to provide an awesome game jam environment - the rest is up to you! Q: What happens if my team wins? A: Up to 16 submissions will be picked as finalists and win a total prize per team of $3,000. From those finalists, a winning jam team will also get the chance to negotiate with Cartoon Network for a contract to help with the production of their game from prototype to a polished mobile game soon after being declared the winner. This will include timeline and budget, all based on the winning game and its team. Development of the game will start by May 2016! The Portland Indie Game Squad will be hosting events up until the game jam to help prepare jammers for judging criteria and to answer questions about contracting with Cartoon Network. Q: What is the judging criteria? A: Games will be judged on factors like functionality, art, design, replayability, relatability to the Cartoon Network intellectual properties we work with, the team's ability to polish their game from its prototype state, and more. Full criteria is still being determined and will be announced by the event! Q: Which of Cartoon Network's intellectual properties are we making games about? A: It's a secret; you'll know at the jam when we reveal the creative theme! Aside from working with Cartoon Network IP, jammers will be contributing with their own, original content to accent that IP. Q: On what platforms will games be released? A: The winning game will be published for mobile, and runners-up may be hosted on CartoonNetwork.com, though other considerations for platform will be made clear by the event. Jammers should consider prioritizing their ability to publish for for 1) mobile, 2) web, then 3) PC/Mac to be considered as a winner or runner-up. Take a look at Cartoon Network's current list of mobile games to get an idea of what's out there! Q: What tools can we use? A: Using Unity is strongly encouraged; outside of that, all creative and development software used must be approved by the jam event producer. All open source software and all tools (including frameworks and fonts) must allow full free publishing rights. Developers will be asked to limit their use of pre-made assets, and work from scratch as much as possible. Cartoon Network will supply concept art assets for inspiration, but not in-game assets. Participants will be judged by their ability to develop for mobile. Q: What is the final deliverable after the jam? A: At the end of the game jam weekend, participants will deliver their game's executable, source files, and source code. Because we will be working with Cartoon Network intellectual properties, all rights and ownership to the binary will transfer to Cartoon Network. Jammers retain rights and ownership of their source and design. Q: Will jammers be on the Cartoon Network? A: In addition to hosting the jam, we'll be making a documentary on game development and jams in the midst of our event! Over the course of the event, jammers will be scheduled to appear on camera and to share their love of games, their experiences as a game maker, and their thoughts and plans for the jam. The jam winner and runners-up will be interviewed after the jam to showcase their experiences with progress and growth. We want to inspire the Cartoon Network audience to become better makers, storytellers, learners, and collaborators based on your experiences! Q: Why Portland? A: Portland is home to a community of passionate and authentic game developers, the Portland Indie Game Squad. After working with SleepNinja Games to publish Monsters Ate My Birthday Cake, we were introduced to this community and realized its potential and energy. Q: I have more questions! How can I learn more? A: You are welcome to contact event producer Will Lewis of Rose City Game Consulting online (@gamewillpdx on Twitter) and ask questions of representatives in person at select Portland Indie Game Squad events. The event's terms, additional resources for developers, and a list of developers still looking for teams can be provided upon request. We're very excited about this project and want to know what you need to best participate and have an awesome time! Q: How do I apply? A: Contact @gamewillpdx on Twitter, or find the application form on numerous Portland Indie Game Squad channels. Upon determination of eligibility, applicants will receive a password for the Cartoon Network Game Jam Eventbrite and secure their slot in the event. We are looking for developers who are ready for competitive fun! NO PURCHASE NECESSARY TO ENTER OR WIN. A PURCHASE WILL NOT INCREASE YOUR CHANCES OF WINNING. VOID WHERE PROHIBITED BY LAW. BY PARTICIPATING IN THE CARTOON NETWORK GAME JAM EVENT AND CONTEST ("Contest"), EACH ENTRANT FULLY AND UNCONDITIONALLY AGREES TO AND ACCEPTS THESE TERMS AND CONDITIONS ("TERMS"), WHICH ARE A CONTRACT, SO READ THEM CAREFULLY BEFORE ENTERING. WITHOUT LIMITATION, THIS CONTRACT INCLUDES INDEMNITIES FROM THE ENTRANT (i.e., A REQUIREMENT THAT THE ENTRANT DEFEND AND/OR REIMBURSE SPONSOR AND PRODUCER FOR CERTAIN LOSSES), CONFIDENTIALITY RESTRICTIONS, TRANSFER OF RIGHTS AND OWNERSHIP OF ENTRANT'S SOFTWARE (AS DEFINED BELOW), ROYALTY-FREE LICENSE TO ENTRANT'S NAME, BIOGRAPHY, IMAGE, LIKENESS AND VOICE RECORDINGS, AND A LIMITATION OF ENTRANT'S RIGHTS AND REMEDIES. Rose City Game Consulting LLC ("Producer") and Cartoon Interactive Group, Inc. ("Sponsor" or "CN") are responsible for the collection and selection of winning entries and the overall administration of the Contest. The decisions of Producer and Sponsor are final and binding in all matters. Eligibility: The Contest is open to individuals who are at least 18 years of age or the age of majority in their jurisdiction (e.g. state, country, etc.) at the time they submit their entry form and who apply either individually or as a team (i.e. an association of not more than six (6) individuals each of whom is at least 18 years of age or the age of majority in their jurisdiction at the time the team submits the entry form) (a group of persons submitting a single entry is called a "Team" and each individual person that takes steps to participate in the Contest is called an "Entrant"). Each Entrant must (i) receive and accept an invitation from the Producer, (ii) fully read and agree to a release, confidentiality and participation agreement and potential winner documentation, (iii) fully complete online registration and submit a non-refundable registration fee in amount designated by Producer, (iv) participate on site and in person at all sessions of the Cartoon Network Game Jam from February 12 to 14, 2016 ("Jam") and try to attend the after party on February 15, 2016 ("After Party") in Portland, Oregon (the Jam and After Party are collectively referred to as the "Event"), and (v) and create, develop code for a web-based game (which Sponsor also may later develop to a mobile app game) and submit an executable game file and source code ("Game") that satisfies the Contest requirements by the deadlines announced by the Producer at Entrant's sole expense. Entrant (including each member of a Team) must not be under any legal or contractual obligation that would prohibit its participation in this Contest as described in these Official Rules. If participating in this Contest would result in a violation by Entrant of any law applicable to it or any agreement to which it is a party, such Entrant is ineligible. Participation in this Contest constitutes Entrant's full and unconditional agreement to and acceptance of these Terms and the decisions of Producer and Sponsor, which are final and binding in all matters. Any natural person completing any portion of the entry process described in these Terms on behalf of an organization must be authorized to legally bind that organization. To be eligible to be considered and deemed the Winner (as defined below), Entrant(s) must demonstrate that they have the availability, expertise and sufficient resources to enter a game development contract with Cartoon Network under which they would provide all services on a paid, work-for-hire basis commencing services in May 2016 and delivering a gold master candidate version of a Cartoon Network game for the iOS and Android mobile platforms with final delivery in 2016 or 2017. Employees, officers, directors, agents and representatives of Producer and Sponsor, any of their licensees, assigns, parents, or affiliated or subsidiary companies, or any other person or entity involved in the design, coordination, promotion, marketing, administration or fulfillment the Contest, and any of their family members (i.e. father, mother, son, daughter, grandparent, grandchild, aunt, uncle, niece, nephew, or member of the same household (whether or not related) of any such persons) are not eligible to enter or win the Contest. Entry Conditions: To receive an invitation from Producer, Entrants must apply by providing accurate information related to Entrant's qualifications, experience and projects relevant to game development, Contest eligibility, and contact information ("Screening Application"). Entrants understand and agree that any information provided in the Screening Application will not be returned to Entrant and that Producer and Sponsor are under no obligation to keep Screening Application(s) confidential. Any that Entrants who are selected by Producer will be provided a password and information for an Eventbrite website. Entrants must (i) fully complete the registration, (ii) pay a nominal, non-refundable registration fee, (iii) commit to physically attend and participate in all touchpoint sessions and filming at the Event in Portland, Oregon, from February 12 – 14, 2016, (iv) read and agree to the confidentiality, release and participation agreements and potential winner documentation during the registration process and check-in at the Event, and (v) create and timely submit the Game deliverables. Registration is limited to approximately two hundred (200) Entrants or as space permits in the sole discretion of the Producer. Limit of two (2) Entries per Entrant or Team. Designation of Teams: Each Team must identify all of its Members before the start of the Event on February 12, 2016 either during online registration or in writing at the Event check-in. Each Entrant may only participate on up to two (2) Teams. The identity and composition of a Team Entrant may not be changed after the commencement of the Event. Timing: The registration for the Contest begins on or about November 9, 2015 and will be open until approximately February 1, 2016, or until Producer has confirmed valid registrations for the maximum number of Entrants (which may be earlier or later than February 1, 2016). The Event begins on February 12, 2016, at approximately 6:00 p.m. PT and ends on February 14, 2016, at approximately 9:00 p.m. PT unless anther other time is announced by Producer at the Event. Entrants also are welcome and encouraged to attend an Event after party on the evening of February 15, 2016, at a location in Portland that will be announced during the Event. Producer is to be the official timekeeper and its clock will set the official time for all elements of the Contest. From February 15, 2016, to March 1, 2016, Entrants will have the opportunity to refine the Game deliverables and submit the final Game Contest entry no later than March 2, 2016. How To Enter: To receive an invitation from Producer, Entrants must answer a screening questionnaire or submit a Screen Application in a format requested by Producer accurate information including Entrant's contact information including, without limitation, full name, physical mailing address (no PO boxes), phone number, email address, and age and information related to Entrant's Contest eligibility, resources and ability to work with Sponsor if Entrant were deemed the Contest Winner (e.g. game development projects, game jam participation, expertise in coding, game design music, sound effects, and/or availability and capacity to work with Sponsor if Entrant were deemed the Contest Winner, etc.). Entrants understand and agree that any information provided in the Screening Application will not be returned to Entrant and that Producer and Sponsor are under no obligation to keep Screening Application(s) confidential. Entrants who are selected by Producer will be provided a password and information for an Eventbrite website where Entrants must fully complete the registration, read and agree to the confidentiality, release and participation agreements, pay a nominal, non-refundable registration fee, and commit to physically attend and participate in the Event in Portland, Oregon, from February 12 – 14, 2015. Registration is limited to approximately two hundred (200) Entrants or as space permits (as determined in the sole discretion of the Producer). Registration will be open until Producer deems that all such spots are full (which is anticipated but not guaranteed to be by February 1, 2016). Once registered, Entrants must attend the Event (including all required check-ins) and satisfy all Game Requirements; attendance at the Event after party on February 15th is optional but encouraged. Game Requirements: To be eligible for consideration and to be selected as a Finalist, the following requirements must be met, as determined by Producer and Sponsor in their sole discretion, or the Entry may be disqualified: Timely Submission Complying With Instructions and Official Rules: For each Contest entry, an executable game file, source files and source code for the Game and any additional content identified by Producer must submitted through the submission process and submission deadlines that will be identified during the Event by the Producer. The deadline for the final Contest entry will be no later than 5 p.m. PT on March 2, 2016. Owned by Entrant(s) and No Third Party Content: With the exception only of approved assets and intellectual property of Sponsor to be provided at the Contest Event and any derivatives created therefrom (as between Entrant and Sponsor, ownership of which shall remain solely with Cartoon Network), all aspects of the Game submitted by Entrant must be solely owned by Entrant, Entrant's Team Members, or in the public domain. This restriction applies to all intellectual property included in the Game, including without limitation, music, voice recordings, video, photographs, fonts, names, logos, images of buildings, tattoos or other designs or elements protected by trademark, copyright, patents or other intellectual property rights. Use of "open source" tools or code is prohibited unless approved by Producer in advance. Entrant's rights in the Game must be sufficient to allow it to grant all ownership rights to Sponsor, or any of its agents or assigns under these Terms. Sponsor may request written proof of ownership of or adequate license to Entrant of any Game element. Failure to timely provide adequate proof of ownership or sufficient license rights in any content included in the Entrant Content (as determined by Sponsor in its sole discretion) may result in the Entrant being disqualified and Game entry deemed void. Language: Game deliverables must be entirely in the English language. Original: Entrant's Game and Contest entry must have been created expressly for the purposes of entering this Contest at the Event and during a short period to refine the Game submission. It may not have been previously published by a third party and may not have been entered into any other contest, competition, or promotion. No assistance or contributions are allowed by individuals who are not registered Content Entrants and designated member(s) of Entrant's Team who have attended the Event. Non-infringing: Entrant's Content must not infringe, misappropriate, or violate any rights of any third party, including without limitation, patent, copyright (including moral rights), trademark, trade secret or rights of privacy or publicity. Age appropriate: Entrant's Content must be appropriate for an animated content directed in whole or in part to children and should not contain inappropriate content, which includes, without limitation, any information that is adult-oriented, including without limitation, depictions of sexual behavior, nudity, gratuitous violence, offensive language or profanity, indecent or obscene content, drugs, alcohol or tobacco, or behavior that may be unsafe or harmful if imitated by children. Complying with all applicable laws and any applicable agreements: Entrant content must not in any way violate any federal, national, state, provincial, territorial, or local laws, rules or regulations of any applicable jurisdiction(s). Entrant agrees that his, her, or its participation in the Contest and agreement to these Terms and any Contest Entity's reproduction, display, and use of the Entrant Content in accordance with these Terms will not violate any agreement to which Entrant (or any member of a Team Entrant) is a signatory or party or any law applicable to Entrant. Deliverables and Technical Specifications: Size: Standard game dimensions: 900x600 or 600x900 Technology: Development in Unity 5+ strongly encouraged Browser compatibility: IE 10+, Firefox 31+, Safari 7+, Chrome 36+ Platform compatibility: All Game deliverables must be demonstrable on the Macintosh OSX (10.3 and up) and the PC Windows 7+ or may be disqualified. If the Game is not operable on the Macintosh and the PC and/or requires additional hardware (beyond computer, keyboard, mouse) or software, we cannot guarantee it will be considered or judged and the Game may be disqualified in Sponsor and Producer's sole discretion. Deliveries: Final game submissions must include all source files, published executable files, and web-friendly formats (Web GL, Unity Web Player, SWF, HTML5), if relevant Unity Web Player, SWFs, HTML5 packages and other web players must not be larger than 30 MB Unity Web GL must not be larger than 150 MB Transfer of Rights in Game: By participating in the Contest, Entrant understands and agrees that in consideration for the opportunity to participate and for a one-time payment to each Entrant in the amount of Forty US Dollars ($40.00) to be made at the Event, you are transferring certain ownership and license rights in the Game and related materials submitted by you or your Team Members in the Contest as set forth below: (a) Game Ownership.) (1) The services rendered, equipment and personnel supplied, and rights granted to Contest Entrants to use any Sponsor assets such as (without limitation) titles, logos, character names, artwork, storylines, music, and any protected by trademark or copyright protection in connection with the Contest shall not confer in Entrant any rights of ownership in the Sponsor's intellectual property (including, but not limited to, all rights of trademark and copyrights) which shall remain exclusively in Sponsor; (2) any material produced by or on behalf of Entrant in connection with this Contest shall be considered a "work made for hire" as contemplated by the United States Copyright Act and to the extent said material is not recognized as a "work made for hire" Entrant hereby assigns all rights of copyright and copyright renewal in said material or any part thereof to Sponsor; and (3) with a limited exception for Game Developer Technology (as defined below), Sponsor, its successors and assigns shall retain worldwide, in perpetuity, all ownership rights to the Contest entries, including, without limitation, the Game and any related materials produced by or on behalf of Entrant and any part thereof, and Sponsor may, in its sole discretion, modify, edit, add to, delete from, distribute, license, duplicate, use, make derivative works, and otherwise exploit such materials in any manner or forum whether now known or hereafter created without further review, notice, approval, consideration, or compensation to Entrant or any third party. Without limiting the foregoing, Entrant hereby waives any and all claims of "moral rights" and other rights of any kind or nature related to the material produced by or on behalf of Entrant and hereby conveys to Sponsor any such rights as they may exist without reservation or limitation. The services of any and all individuals who contribute to the Contest Entry, Game and related materials shall be subject to the foregoing, and upon Sponsor's request, Entrant shall obtain and deliver to Sponsor written acknowledgment thereof. Entrant agrees that Released Parties (as defined below) are not responsible for any unauthorized use of Entries by third parties. Released Parties have no obligation to utilize any Game or related materials submitted as part of the Contest or to further develop or launch any Game or to enter into any further agreement with any Entrant. (b) Developer Technology License. Entrant shall retain ownership of the rights, title and interest in and to any proprietary software, technology components and documentation that drive the actual operation of the Game, including the source code thereto (collectively "Developer Technology"), provided that the parties acknowledge and agree that Cartoon Network shall own the binary code and the look and feel of the Game and any extensions or additions thereto produced under this Agreement, the unique user interface of the Game, the particular and distinctive elements of graphics, design, colors, organization, presentation, typographical look and layout, navigation, trade dress and stylistic convention of the Game, the storyline, plot, theme, characters, artwork, music, voiceover, any other elements incorporated into the Game, and the complete version of the Game as delivered in final form. Developer shall grant to Cartoon Network a transferable, irrevocable, perpetual, worldwide and fully paid-up license to use, adapt, create derivative works of, translate, distribute, reproduce, license, sublicense, sell, perform, display, and otherwise exploit the Developer Technology in connection with the Game (including any extensions, expansions, enhancements or modifications to the Game, any other versions of the Game such as sequels, prequels, and spin-offs, and ports of the Game or other versions of the Game to other platforms and operating systems) in any manner or medium now known or hereafter devised (the "License") and will deliver updated and complete copy of the unencrypted, commented source code for the Game and instructions for use under its Developer Technology License. Publicity Rights Granted: By participating in the Contest, Entrant understands and agrees that to the extent allowed by law and in consideration for the opportunity to participate, you grant the Released Parties (as defined below) a perpetual, worldwide, royalty-free, non-exclusive, sub-licensable, unconditional, irrevocable and transferable license to use or reuse your Entry, name, likeness, photo, voice, opinions, biographical material, and any other information related to the Contest, including any material recorded at or in connection with the Event, related events including the after party, screenshots, videos or any portion of Entrant's Game or related materials submitted by Entrant or Entrant's Team related including, in any and all media, throughout the world, and in any manner, for trade, advertising, promotional, commercial, or any other purposes without further review, notice, approval, consideration, payment or compensation to Entrant, Team, or any third party; Sponsor may, in its sole discretion, modify, edit, add to, delete from, rearrange, encode, store, copy, transmit, publish, post, broadcast, display, adapt, distribute, license, duplicate, use, and otherwise exploit such materials in any manner or forum whether now known or hereafter created. Game Updates or Changes: While all Contest entries must be timely submitted in accordance with the schedule provided by the Producer in order for Entrant to remain eligible in this Contest, they need not be finalized until the end of the Contest submission period on March 2, 2016. From February 15 – March 2, 2016 ("Polish Period"), Entrants may continue to refine their Games in a manner consistent with feedback provided by the Judges during the Event. No other material changes or updates can be made during the Polish Period. In addition, an Entrant or Team may not enlist the assistance or allow any individual who is not a member of his or her Team during the Contest to contribute to or modify the Game. Participation, Finalist and Winner Selection: During the Contest, Entrants will create and develop the Game based on Sponsor's intellectual property to be disclosed and provided at the beginning of the Contest. If submitting an entry as a Team, only members of the Team identified to Producer in writing prior to the start of the Jam (and those who have completed all items for eligibility) may work on the Team's Game. If Producer or Sponsor believe, in their sole discretion, that a Team has received help from anyone who is not an Entrant identified as a Member of the Team, the Team may be disqualified. Entrants may bring code to the Contest that was created by the individual Entrant or the Team prior to the Contest. Games will be reviewed by a panel of jurors supplied by Sponsor ("Judges "). After the Contest Event, Entrants may continue to work but must submit the Game no later than March 2, 2016, by 5:00 pm PT or the time and in the manner identified by Producer. Games that are not uploaded by the time and manner specified by Producer due to technical difficulties or other reasons may be disqualified. On dates (tentatively planned to be between March 2, 2016 and April 16, 2016, the Judges will review the submissions and select up to sixteen (16) finalists ("Finalists"). Judging criteria for the Finalists will be announced or made available at the Event (for example, judging criteria may include equal or weighted factors such as innovation and originality of concept and mechanics, how the final Game experience looks and works including the quality of the graphics, audio and game mechanics, synergy with the CN brand and how well the entry complements the CN intellectual property, and Entrant(s)'s cooperation and participation in Event filming ("Finalist Judging Criteria")]. The identity of the finalists will be announced no later than May 1, 2016. All finalists will be contacted by email. If a finalist Team or Entrant is determined by Producer or Sponsor to be unqualified to participate or does not respond to correspondence from the Producer or Sponsor, or provide any documentation requested within three (3) days after the date sent by Producer or Sponsor, the potential finalist or winning Team or Entrant will be disqualified and a new potential finalist or winning Team will be selected by Judges based on the judging criteria. From the Finalists, Sponsor will select one (1) winner ("Winner") based upon the Finalist Judging Criteria and additional Winner Judging Criteria, which will include demonstrable resources, expertise, and ability to provide game development services on a paid, work-for-hire basis for Sponsor on a mutually agreeable schedule from 2016 to 2017 in order to provide a gold master candidate CN-branded game for the iOS and Android platforms, willingness to negotiate in good faith and execution of a contract based upon Sponsor's standard work-for-hire game development agreement on an expedited basis and within ten (10) days of commencement of negotiation. In the event of a tie, an additional "tie-breaking" judge will be selected to determine the Finalist(s) from among the tied Entries or the Winner from among the tied Finalist Entries based on all Judging Criteria. In the event a potential winner is disqualified, Sponsor and/or Producer reserves the right (but not the obligation) to contact a runner-up finalist at their discretion. The Winner is anticipated to be announced on or about May 1, 2016 and must meet all eligibility requirements including the execution and return of all necessary releases and documents within the time specified below, unless otherwise indicated. The decisions of Sponsor and Judges in all matters regarding this Contest are final and binding. Sixteen (16) Finalists: Based upon all Judging Criteria and subject to verification of eligibility and compliance with the Terms, for each Game submission that is selected as a Finalist, one (1) total award of Three Thousand US Dollars ($3,000) for each Game deemed a Finalist will be awarded. Prize Conditions: Prize award is subject to verification of eligibility and compliance with these Official Rules. The total value of each prize is listed per Team (i.e. not the amount that each Team member may receive). PRIZES IN THIS CONTEST WILL BE AWARDED TO THE ENTRANT IDENTIFIED IN THE APPLICABLE ENTRY. IF THE ENTRANT IS A TEAM (AS DEFINED IN THESE TERMS), THEN, UNLESS OTHERWISE SPECIFIED BY SPONSOR OR A PRIZE PROVIDER, THE PRIZE WILL BE DIVIDED EQUALLY AMONG ALL ENTRANTS WHO ARE ELIGIBLE AND IDENTIFIED DURING THE ENTRY PROCESS AS COMPRISING THE ENTRANT TEAM. All federal, state and local taxes and all other costs associated with the Contest and acceptance of any Contest prize are the sole responsibility of the Contest Entrants, Finalists, and Winner. Winners of any prize valued at Six Hundred US Dollars ($600.00) or more will receive a federal tax form 1099 from Sponsor. All Entrants must provide valid tax identification information at commencement of Event that will be used solely for purpose of facilitating winner documentation and prize issuance. Entrants should consult with their tax advisor with any questions. All Finalists and Winner may not substitute, assign or transfer a prize, but Producer and Sponsor reserve the right, at their sole discretion, to substitute a prize with one of comparable or greater value. No more than the stated number and amount of prizes will be awarded. In the event there are fewer eligible entries received by Producer and Sponsor than there are stated Finalists or prizes in these Terms, Sponsor reserves the right to award fewer Finalist prizes in accordance with the number of eligible entries actually received. Sponsor will not be obligated to pursue more than two (2) alternate winners (time permitting) for any prize for any reason. Finalist Prizes will be issued and sent to the address provided by Entrant during Event registration within 4-6 weeks of selection of the Finalists. In the event Sponsor does not enter a contract with any Finalist and/or elects not to make use any of the Games submitted in the Contest, no compensation, substitution or other consideration will be provided to Entrants. Finalists and Grand Prize Winner Notification and Documentation: The potential Finalists will be notified by telephone and/or email and will be required to complete an Affidavit of Eligibility, Liability and Publicity Release (unless prohibited by law) and any other documents required by Sponsor, which must be returned within five (5) days of date appearing on the Finalists notification. Return of notification as undeliverable, failure to sign and return requested documentation within the specified time period, the inability of Sponsor to contact a potential Finalist or Winner at contact information provided by Entrant or noncompliance with these Official Rules by a potential Finalist will result in disqualification and, at Sponsor's sole discretion, an alternative Finalist or Winner may be selected. Producer reserves the right to conduct a background check of any and all records of potential Entrants, including, without limitation, civil and criminal court records and police reports, and entry in the Contest constitutes entrant's permission for Producer to conduct such screening processes, provided that, to the extent additional authorization is necessary under law, Entrants shall authorize such check. Producer reserves the right (at its sole discretion) to disqualify any potential Entrants based on the results of any screening process (e.g. for any felony conviction or crime of moral turpitude) or failure of the potential to properly authorize such check. In the event a potential winner is disqualified, Sponsor and/or Producer reserves the right (but not the obligation) to contact a runner-up Finalist at their discretion. In addition to the release, confidentiality and participation agreements required to enter the Contest, any potential winning Entrants may be required to complete an additional Affidavit of Eligibility and Liability/Publicity Release (unless prohibited by law), tax documents and further prize-acceptance documents ("Finalist Documents") within the time frame specified and in the form provided by Producer or Sponsor without revision or prize may be forfeited and an alternate winner may be selected. Any Entrant who fails or refuses to sign and return the required documentation within the time period or manner as specified by Producer will be disqualified and any prize forfeited. If a member of a Team fails to cooperate or timely submit winner documentation, than the entire Team may be disqualified. Non-compliance with these Official Rules or failure to return all required documentation by the stated deadline or Producer's inability to contact an Entrant (using the contract information provided in his or her registration) within a reasonable time period, as determined in Producer's sole discretion, may also result in disqualification and forfeiture of the Prizes of a Entrant and/or an Entrant's Team. Opportunity to Negotiate Game Development Agreement with Cartoon Network: In connection with the Contest, Sponsor intends to commence good faith negotiations with Finalist(s) for game development services on a paid, work-for-hire basis to prepare a Game for distribution on the iOS and Android mobile platforms. Such Game Development Agreement will incorporate Sponsor's standard terms and conditions for the types of game and other material terms including appropriate timeline, deliverables and milestones in order to ensure that such game is ready for release in connection with upcoming Cartoon Network initiatives. As a result, time will be of the essence. Sponsor reserves the right to discuss and negotiate game development agreements with other Contest Entrants and contractors who are not affiliated with the Contest for any reason, including but not limited to the event that Sponsor and Finalist(s) are unable to reach and sign a mutually agreeable contract within a reasonable time. Event Code of Conduct: At all times during the Event (both on and off-camera), Entrants are expected to conduct themselves in a manner that creates a safe and positive environment for all Entrants, will not interfere with others' participation and enjoyment of the Event, and will not reflect negatively on Producer, Sponsor or its affiliates. Without limiting the generality of the foregoing, Entrants must respect other persons and property at the Event and should take no action to cause damage to persons or property at the Event. No forms of offensive or rude behavior, verbal or physical harassment, threats, or assault, disorderly conduct or any illegal activity will be tolerated. No obscenity, indecency, or use of vulgarities, racial or religious slurs, profanities, abusive or offensive language or gestures should occur at the Event. No possession or consumption of alcohol, tobacco (including vaping), marijuana, or illegal substances on the premises during the Event will be allowed (use of tobacco may be allowed off premises at the Event; consumption of alcohol by individuals of legal drinking age in Oregon at the after party may be permitted). No guns, knives or other weapons at the Event. Use of cell phones may be restricted. Entrants must comply with their nondisclosure obligations – including refraining from posting any confidential information on social media. Entrants shall wear appropriate attire (e.g. comfortable, clothing without prominent logos, slogans or branding appropriate both for a hackathon and recordings that may appear on children's television network). Producer may request an Entrant to leave the Event temporarily or for the remainder of the Event for the failure to abide by any code of conduct provided by Producer, for any behavior in a manner that will not reflect positively on Sponsor or any other reason as determined solely by Producer and Sponsor. By entering the Contest and participating in the Event, Entrant acknowledges and agrees that Producer and Sponsor have the right and authority (but not the obligation) to monitor the Event and Contest, and all activities related thereto and to update, revise and enforce this code of conduct in the manner Producer and Sponsor see fit in their sole discretion, and that they have the right to terminate registration and participation in the Event, to suspend or expulse an Entrant from the Event, and/or to disqualify Entrant(s) from the Contest at any time without any refunds, remuneration or further obligations to Entrant. Although Producer and Sponsor endeavor to enforce the code of conduct in a fair and even-handed manner, in no event shall Producer or Sponsor's failure to enforce it in one or more situations prevent it from being enforced in any similar situation(s) in the future. Sponsor and/or Producer may give an Entrant or others a warning before it terminates Entrant's participation in the Event or disqualifies a Contest entry in its sole discretion, but Entrant is not entitled to any such warning and Entrant understands and agrees that any disciplinary measures may be taken without any such warning. Similarly, neither Producer nor Sponsor is under any obligation to provide an Entrant with an explanation of why it may or may not have enforced the code generally, or in any particular instance. Release and Indemnity: As a condition of participating in the Contest, Entrants release and agree to indemnify Rose City Game Consulting LLC, Cartoon Interactive Group, Inc., The Cartoon Network, Inc., Cartoon Network Studios, Turner Broadcasting System, Inc., Wyzurd LLC, and their respective affiliates, subsidiaries, parent corporations, advertising and promotional agencies, and all of their officers, directors, shareholders, members, employees and agents (collectively, the "Released Parties") from all liability, claims or actions of any kind arising or alleged to arise from losses, damages or injuries to persons or property in connection with this Event and Contest, including without limitation, preparation for, travel to or from or participation in the Event and Contest, possession, acceptance, delivery or use of prizes, participation in any Event- or Contest-related activities (including without limitation, the after party), and claims based on publicity rights, patent, copyright or trademark infringement, defamation or invasion of privacy. In addition, Entrant acknowledges and agrees that Sponsor intends to be recording during the Event for public use for the advertising and promotion of Cartoon Network and Entrant is granting Sponsor and its agents all rights of publicity as outlined above and to the fullest extent allowed by law. Each Entrant hereby acknowledges and agrees that the relationship between the Entrant and each of the Released Parties is not a confidential, fiduciary, or other special relationship, and that the Entrant's decision to submit his/her/its Screening Application and Entry for purposes of the Contest does not place any of the Released Parties in a position that is any different from the position held by members of the general public with regard to elements of the Entry (including, without limitation, the Game), other than as set forth in these Terms. (For the sake of clarity and without limiting the foregoing, these Terms do not purport to modify the terms of any separate agreement between Sponsor and any Entrant, including any confidentiality or non-disclosure agreement.) Each Entrant understands and acknowledges that the Released Parties Entities have wide access to ideas, text, images, code, applications, software, and other creative materials. Each Entrant also acknowledges that many ideas for games, other applications, or online services may be competitive with, similar to, or identical to its Game and/or each other in idea, function, components, format, or other respects. Each Entrant acknowledges and agrees that such Entrant will not be entitled to any compensation as a result of any Released Party's use of any such similar or identical material that has or may come to such Released Party from other sources. Each Entrant acknowledges and agrees that no Released Party has now or will have in the future any duty or liability (direct or indirect; vicarious, contributory, or otherwise) with respect to the infringement or protection of the Entrant's patent, copyright or other proprietary rights in and to his/her/its Game. Each Entrant acknowledges that, with respect to any claim by Entrant relating to or arising out of a Released Party's actual or alleged exploitation or use of any Game or part thereof, the damage, if any, thereby caused to the applicable Entrant will not be irreparable or otherwise sufficient to entitle such Entrant to seek injunctive or other equitable relief or in any way enjoin the production, distribution, exhibition, or other exploitation of any Contest Entity application, service or other property, and Entrant's rights and remedies in any such event are strictly limited to the right to recover damages, if any, in an action at law. General Conditions: Potential winning Entrants are subject to verification. Sponsor and Producer's decisions are final and binding in all matters related to the Contest. Potential winners must comply with the Official Rules, and receipt of prizes is contingent upon fulfilling all requirements. Producer and Sponsor reserve the right in its sole discretion to disqualify from the Contest any Entrant (and all natural persons comprising such Entrant) whose Entry (as determined in its sole discretion) refers, depicts, or in any way reflects negatively upon a Contest Entity, the Contest, or any other person or entity or does not comply with the Official Rules. Released Parties are not responsible for technical, power, hardware or software failures, malfunctions, lost or unavailable network connections or failed, incomplete, garbled or delayed computer transmissions or unforeseen schedule changes that may limit an Entrant's ability to participate in the Contest Event or Contest, even if caused by Released Parties' negligence. Producer and Sponsor have the sole discretion to modify, cancel or suspend the Event and Contest, or modify these Official Rules as necessary, should viruses, bugs, unauthorized human intervention or other causes beyond Producer's and Sponsor's control affect the administration, security or proper execution of the Contest or Producer or Sponsor otherwise becomes incapable of running the Contest as planned or as required by applicable law. If the Contest is terminated, Producer and Sponsor may, in their discretion, select the potential Finalists and Winner from all eligible, non-suspect Entries received prior to action taken or as otherwise deemed fair and appropriate by Sponsor using the judging criteria specified above. Released Parties are not responsible for changes to Entrant's contact information. Any individual who attempts or otherwise encourages, directly or indirectly, the submission of false entries, as determined by Producer or Sponsor, will be disqualified. Producer and Sponsor have the sole discretion to disqualify any Entrant who tampers with the entry process. Producer and Sponsor have the sole discretion to disqualify Entrants who violate these Official Rules, tamper with the operation of the Contest or, in Producer's sole discretion, engage in any conduct that is deemed detrimental or unfair to Producer, the Contest or any other Entrant. Released Parties are not responsible for lost, late, mutilated, illegible, incomplete, postage due or misdirected entries. All entries will remain the sole property of Sponsor and will not be returned. Entrants waive any claims against Producer and Sponsor and all related entities concerning Entrant's rights in the Game submitted under this Agreement. Producer and Sponsor reserve the right to reject any entries that it deems, in its sole discretion, to be inappropriate for a game that will be targeted in whole or in part to a child audience, including, but not limited to, entries including foul language, gratuitous depiction of violence, any sexual behavior, drugs, alcohol or tobacco, or unsafe behavior. For purposes of this Contest, only complete Entries that are actually received by Producer through the official Contest submission process and during the Submission Period will be considered. Other proof of submitting or attempting to submit an Entry (such as, without limitation, a screenshot or an automated email confirmation message from Producer or Sponsor) does not constitute proof of actual receipt of the Entry for purposes of this Contest. Those who do not abide by these Terms and the instructions of Producer and/or Sponsor and timely provide all required documentation and materials may, in Sponsor's sole discretion, be disqualified. Entries, Screening Applications, or participation may not be acknowledged and will not be returned. Entries (or participation that does not qualify as an "Entry") that are incomplete, lost, late, misdirected, mutilated, fraudulent, illegitimate, incomprehensible, garbled, or generated by a macro, bot, or other automated means will not be accepted and will be void. Entries or participation made on behalf of an Entrant by a third party not affiliated or associated with that Entrant (as determined by Producer or Sponsor in its sole discretion) or originating through any commercial promotion subscription, notification, or entering service will be declared invalid and disqualified for this Contest. No Released Party (defined below) will have any responsibility or liability for any dispute regarding any Entrant, including the identity of any Individual Entrant, the composition or members of a Team or Organization Entrant, or the distribution of any prize won among members of a Team or Organization Entrant. In the event that any dispute regarding an Entry or Entrant (including those regarding the identity or members of an Entrant Team/Organization or any Entrant's rights in the applicable software) cannot be resolved to Sponsor's satisfaction, the Entry will be deemed ineligible and the Entrant disqualified. Sponsor will collect and process Entrants' personal information and it will be shared with Sponsor's partners, agents and affiliates to the extent necessary to conduct the Contest, including for prizes to be delivered to the winners. As a condition of entering the Contest, without limiting any other provision in these Terms, each Entrant gives consent for Sponsor and its agents to contact any Entrant by phone, text message, email, mail, or courier for purposes related to the Contest or to obtain and deliver his/her/its name, email or mailing address, and other information and Entry materials to third parties for the purpose of administering this Contest and complying with applicable laws, regulations, and rules. APPLICATIONS AND ENTRIES WILL NOT BE RETURNED AND, IN FACT, MAY BE DESTROYED. KEEP A COPY OR THE ORIGINAL OF EACH ELEMENT OF THE ENTRY. ANY ENTRY THAT DOES NOT CONFORM TO THE REQUIREMENTS IN THESE TERMS MAY, IN PRODUCER OR SPONSOR'S SOLE DISCRETION, BE DEEMED INELIGIBLE. By participating in the Contest, Entrants agree to be bound by the Official Rules. Entries not in full compliance with these Official Rules will be immediately and automatically disqualified. By submitting an Entry, each Entrant acknowledges and agrees that Released Parties may obtain many Screening Applications and Entries in connection with the Contest or other contests staged or promoted by Sponsor, such Entries may be similar or identical in theme, idea, format or other respects to other Entries submitted in connection with the Contest or game and ideas submitted for other reasons or other materials developed by or on behalf of Sponsor and Entrant waives any and all claims Entrant may have had, may have, or may have in the future that any Entry or other works accepted, reviewed or used by Sponsor may be similar to entrant's Entry, or that any compensation is due to entrant in connection with such Screening Application or Entry or other works used by Sponsor. Limitation of Liability: Entrants are encouraged not to bring any valuables to the Event and will assume all responsibility for any personal property that Entrants chose to bring. Released Parties are not responsible for any injury, damage or loss to any person (including bodily injury) or to any personal property of an Entrant. Released Parties are not responsible for any incorrect or inaccurate entry information; human errors; technical malfunctions; lost, stolen, mutilated, misdelivered, postage due, illegible, incomplete or untimely entries that may limit Entrant's ability to participate in the Contest, even if caused by Producer's or Sponsor's negligence; failures, omissions, interruptions, deletions, or defects of any telephone network, power grid, computer online system, computer equipment, servers, providers, or software, including any injury or damage to Entrant's or any other person's computer relating to participation or inability to participate in the Contest; inability to access Eventbrite or any Contest website or upload information or data; theft, tampering, destruction, or unauthorized access to, or alteration of, entries; data that is processed late or incorrectly or is incomplete or lost due to telephone, computer, or electronic malfunction or traffic congestion on telephone lines or the Internet or any website or for any other reason whatsoever; printing or other errors; or any combination thereof. Proof of uploading information or data or entering information via the designated Contest entry means is not considered proof of delivery or receipt. Illegible, duplicate and incomplete entries will be disqualified. False, fraudulent, or deceptive entries or acts, as determined by Producer and Sponsor in their sole discretion, render Entrants ineligible and all associated entries will be void. Governing Law: All issues and questions concerning the construction, validity, interpretation and enforceability of these Official Rules or the rights and obligations of Entrants, Producer or Sponsor in connection with this Contest are governed by and construed in accordance with the laws of the State of New York without giving effect to any choice of law or conflict of law rules (whether of the State of New York or any other jurisdiction) that would cause the application of any other state's laws. Entrants hereby submit to the exclusive jurisdiction and venue of the Federal and State Courts in New York, New York for the purposes of any suit related to the Contest and waive any claim that they are not subject personally to the jurisdiction of said courts or that any such suit or other proceeding is brought in an inconvenient forum or improper venue. Producer: Rose City Game Consulting LLC, 411 NW Flanders Street, Suite 100, Portland, Oregon 97209. Sponsor: Cartoon Interactive Group, Inc., 1050 Techwood Drive, NW, Atlanta, GA 30318. To obtain any legally-required winners list (after the conclusion of the Contest) or a copy of these Official Rules, send a self-addressed envelope with the proper postage affixed to Cartoon Interactive Group, Attention: Counsel for Cartoon Network Digital, 1050 Techwood Drive, 1000 Building 3rd Floor, Atlanta, GA 30318. Please specify "winners list" or "Official Rules" for CN Game Jam.

Bosch, Mitsubishi, GS Yuasa to Develop Li-ion Batteries Bosch, Mitsubishi and GS Yuasa have agreed to work together to develop lithium-ion (li-ion) batteries. The companies plan to use advanced cell management and progress in electrochemistry and materials to significantly increase energy content. This will reduce weight and space requirements, and increase the range of electric vehicles. The three companies intend to set up a joint venture for joint research and development, and to support their mother companies in sales and marketing activities. Operations are planned to start in the beginning of 2014. The headquarters will be Stuttgart/Germany. The establishment of the joint venture is subject to approval by the antitrust authorities. Bosch will hold a 50 percent stake in the joint venture, with GS Yuasa and Mitsubishi each holding 25 percent. The composition of the board of management and supervisory board will reflect these shareholdings, the companies say. Bosch — which specializes in the monitoring and control of cells and complete battery systems, as well as in integrating them into vehicles — says it will contribute its know-how in production processes and quality management relating to the large-scale series production of complex products. In addition, the company will support these joint activities with its entire portfolio of components for electromobility. GS Yuasa, a manufacturer of automotive and non-automotive lithium-ion battery cells, will contribute its experience in manufacturing lithium-ion cells whose high density makes for a longer range, as well as its expertise in materials systems and electrochemistry. GS Yuasa was the battery supplier for Boeing’s 787 Dreamliner, which was grounded in a number of countries earlier this year following a battery-related fire risk. Mitsubishi says it will apply its strengths in building global value chains, covering natural resources, material, sales and take advantage of their synergy to advance this business. The global market for lithium-ion batteries in light duty vehicles will grow from $1.6 billion in 2012 to almost $22 billion in 2020, according to a Pike Research report published last month. Energy Manager News - Switching to LEDs Without Leaving the Past Behind - McKinstry Replacing 6,200 Lights with LEDs in Henderson, NV - USDA Investing More than $300M in Efficiency, Renewables - ERC Price Benchmark Trends Week Ending: October 21, 2016 - Could Cleaner Energy Save Ohio Ratepayers $50M in 2030, Alone? - Yakima City Council Mulls Utility Rate Hike on Large Businesses to Bolster Reserve Fund - Making Solar Inverters Smarter - Unlocking the Power of Building Data

Toyota Prius Review 167 Units of Prius recalled The Solar Powered Ventilation System works when the vehicle is parked while the Easy Seat that is placed next to the driver seat can be rotated and slides in order to provide easy entry and exit to the person with medical problems related to knees. Toyota Motors, with a brand new horizon ahead, has launched its new eco-friendly product Toyota Prius. Prius has a very dashing body design and the most important thing is that it takes care of nature. Toyota Prius was launched in India in January 2010 and the sedan is able to set a benchmark in Indian market.The sedan is a 3rd generation product and the company takes full care of its fuel economy and high technology. Toyota Prius is available in two variants Toyota Prius Z3 and Toyota Prius Z4 which vary only in seat material and seat heater. Gaining momentum slowly, it is the second semi electric car in India after Honda Civic Hybrid. Due to its high price tag, it got a slow start in Indian market but its body design and its high technology accelerated its sale. This eco-friendly sedan has a price tag of about 28 lacks and the model that is sold in Indian market is one generation behind the latest model that is sold in US. Toyota Prius gains points when fuel economy comes into play. The car has shown excellent test results and is attracting its customers by its impressive looks and eye candy body design. The other features of the sedan are very luxurious and the company is expecting good results from the sedan. Toyota Prius Milage and Fuel Economy |Variant||Mileage (City)||Mileage (Highway)| |Toyota Prius Z3||22.4 Kmpl||30.2 Kmpl| |Toyota Prius Z4||22.4 Kmpl||30.2 Kmpl| Toyota Prius Models and Features Toyota Prius comes in two variants Toyota Prius Z3 and Toyota Prius Z4. Both the variants are in petrol engine variant combined with electric motor. The former variant comes with all the standard and luxury features except seat heater and fabric seat material. The later variant also has all the luxurious features including seat heater and leather seat material are added in this variant. Toyota Prius Z3 has a price tag of 26,76,792 INR and Toyota Prius Z4 has a price tag of 28,10,092 INR. According to the market, the sedan has a high price tag but the nature friendly engine including with luxurious features justifies the high price of the sedan. The sedan is embedded with a petrol engine and two 650 electric motor generators. The petrol engine capacity is 1.8 L. The combined power output of both the components is 100kw. Toyota Prius has shown a very good statistics in fuel economy according to the test results. The 1.8L 2ZR-FXE petrol engine produces 73 kw of maximum power at 5,200 rpm and 142 Nm of peak torque at 4,000 rpm. While the electric motor generates a peak power of 60 kw and 207 Nm of peak torque. The driver can choose from three driving modes available in the sedan. This feature is added by the company by developing its Hybrid Synergy Drive technology and embedding it into this masterpiece.The Hybrid Synergy Drive technology enhances fuel efficiency, power, torque and acceleration along with less carbon emission thus takes care of the remaining trees left on the earth.When used on electric mode or combined mode of petrol and motor, the fuel efficiency is increased up to 35 per cent. Toyota Prius Colors |White Pearl Crystal Shine||Silver||Beige||Abyss Grey| Toyota Prius Engine, Power and Performance The new Toyota Prius is powered by a 1.8 litre2ZR-FXE petrol engine with a displacement of 1798cc. The engine type is 4 cylinders, in line with twin cam, 16 valves with VVT-i. The engine of this sedan pumps out a power train of 73 kw peak power at 5200 rpm and produces a maximum torque of 142 Nm at 4000 rpm. The company has included VVT-i technology for high power, torque, fuel economy and acceleration.The VVT-i technology is also supported by Atkinson cycle and a cooled EGR (Exhaust Gas Recirculation) system and electric water pump. Also the Toyota Prius is fitted with an electric motor of 650V which generates 60 kw of peak power and 207 Nm of peak torque. The capacity of the battery is Ah 6.5 (2h) and the battery type is Sealed Ni-MH (Nickel-Metal hydride). There are three modes to drive Toyota Prius which include Power mode, Eco mode and Electric Vehicle mode. When the sedan is started, the two electric motors are used. Even driving the car in city limits of 30 kmph, these electric motors are used. The Hybrid Synergy Drive system delivers the power even to the motors which in turn power the wheels. The planetary gear system has been brought to use to reduce the losses due to conventional CVT system. The battery life is good and the on board computer takes care of the electric motor and they never get fully discharged or even fully charged. Toyota Prius Pickup and Acceleration ||Max. Power (bhp)||Max. Torque (Nm)||Pickup (0- 100) (sec.)||Top Speed(kmph)||Transmission| |1.8 Petrol||100||142||12.4||156||5 Speed Manual| The Toyota Prius comes with a 1.8 l petrol engine and two electric motors. The petrol engine type as mentioned above is 4 cylinder, Inline Twin Cam, 16 valve with VVT-i with 1798cc displacement. The maximum power produced by the petrol engine is 73 kw at 5200 rpm and 142 Nm of peak torque at 4000 rpm. Whereas the electric motor produces maximum power of 60 kw and maximum torque of 207 Nm. The combined power output is 100 kw. The VVT-I technology is added to take care of fuel economy and less carbon emission and Hybrid Synergy Drive technology promises more power, acceleration, power and greater fuel economy. When the Toyota Prius starts, electric motors are used and also they are automatically turned off when the car is stopped in traffic. Also the light weight of the sedan enhances the fuel economy. Toyota Prius Interiors and Features The Toyota Prius welcomes its passengers with appreciable and luxurious interiors that will charm their mood in every possible manner. The front cabin has high tech user friendly and class leading features. The very first look at the steering wheel describes the richness of the car. The 4 spoke steering wheel has big diameter with audio and Bluetooth controls adds to the cool looks of the interiors.The centrally positioned dashboard has advanced audio system comprised of radio tuner, CD player and changer, audio system remote control and 8 speakers. A 3.5 mm audio jack is added so that you can connect your music player. Also a Bluetooth device is added so that you can play songs on speakers without connecting your phone via cord. Below the audio system, the AC system tools are fitted. The AC system in Toyota Prius has pollen removal mode and clean air filter and the system is quick responding. Also for driver’s comfort, lower windshield glass is added which is used to show head up display. The display shows information like vehicle speed, hybrid system indicator, revs, battery charge, different modes and actual fuel economy been displayed which helps driver to keep an eye on the performance of the car. Now talking about seats, they are comfortable and as mentioned earlier, Toyota Prius Z3 model does not have leather seats and seat heater and Prius Z4 has these features as mentioned earlier. There is a glove box and an upper box in which small stuff can be stuffed. The front seat backs are designed in slim to provide ample knee room for a rear passenger. The rear seats are comfortable and are inclined to give good support to lower back of passengers. Also they are foldable and can be used for different load and passenger option. The ample headroom and legroom are comfortable. The rear and front leg room are sufficiently big and can accommodate one 6 footer behind other.There is no central tunnel intrusion as well. The loading lip is high due to the Kammback tail. The boot space in Toyota Prius is also very good and it has an electric operation. The boot space is big enough to fit 3 golf bags. The only drawback in the interior of this luxurious sedan is that its visibility through the rear window is troublesome due to backseat headrests and rear spoiler. Toyota Prius Exteriors and Features Toyota Prius is blessed with sporty and aggressive features. As compared to 1st and 2nd generations, many modifications are done in this 3rd generation of Prius. The front face of the sedan is stunning with sleek upper grille and snub nose. The upper grille is split in middle and has Toyota logo at top of the point.The front headlight cluster has a diamond cut shape and it contains projector beam halogen type headlamps with auto off feature. The lower grille is rectangular in shape and is black in color. To give a distinctive design, the vertical stacked fog light slot and turn indicators are separated from the lower grille. To give the Toyota Prius a sporty touch, front side skirt is added to the car. Door handles and front and rear bumper comes in body color. Also the electronically powered outside rear view mirrors along with indicator lamps are in body color. Semi chrome finish is added to the side skirts and it adds to the aggressive look of the car. The front hood flows into the front windshield and goes to a slim and lower slung roofline. Now talking about the rear end, the LED tail light cluster has break light, reverse light and turn indicator and like front turn indicators, they are too in vertically shape. The rear hatch is wide and impressive and adds beauty to the sporty look of the luxurious sedan and aerodynamic rear deck spoiler is added at the top of the hatch. Toyota logo is embedded at the middle of the hatch. An antenna is mounted on the sleek roof at rear side.The Washer linked variable intermittent front wipers and intermittent rear window wiper features are added to the Toyota Prius.The alloy wheels are five spoke 15 inch which adds to the beauty of the car. The body appears to be big but its weight is only 1805 kg. The overall length of the car is 4460mm, width is 1745mm and height is 1510mm and wheelbase is large enough of about 2700mm. Safety and Features in Toyota Prius Toyota Motors has taken all measures to keep driver and passengers safe. The new Toyota Prius is blessed with Supplemental Restraint System (SRS) drive airbags, front passenger airbags, side airbags, driver knee airbags, side airbag and curtain shield airbags. Active headrest of front seats is added for the rear collision which reduces impact on neck and back of the front occupants. Crash safety body adds to the safety features which reduce the impact of collision for car passengers. Toyota Prius Driving and Handling The Toyota Prius is embedded with advanced braking system including front ventilated disc brake and rear solid disc.The brake type is hydraulic with electronic control and regenerative and it works with Electronically Controlled Brake system which provides the optimum braking force relative to brake pedal operation. Also the new Toyota Prius has got latest shock absorbers at both the end which makes the car go swiftly on bumpy roads.The front fork is Macpherson Strut which is gas filled with a stabilizer bar and the rear fork is also gas filled Torison beam type. When driving comes, the sedan is very quiet. It is a matter of concern for bicyclers and pedestrians who depend on engine noise for the vehicles coming from back. Toyota Prius Stereo and Accessories The audio system fitted in Toyota Prius is surely a thing to talk about. It has a radio tuner and CD player with changer and supports 8 speakers. Steering wheel is also embedded with audio controls. A 3.5 mm jack is added which allows user to play songs directly by connecting MP3 player or mobile phone. Below the audio system, the AC system tools are fitted with pollen removal mode and clean air filter. Also the AC system is quick responding system so you don’t have to wait for a long time to get the cooling effect like in other cars. Toyota Prius Conclusion The eco-friendly Toyota Prius offers luxury, utility, comfort and performance with a price that is worth spending on this sedan. With its eco-friendly feature, it will set a benchmark for Toyota Motors. Toyota Prius VariantsWrite Review 27,86,652Get On Road Price 10.2 Kmpl (City) 14.5 Kmpl (Highway) Ask a question Please wait a second...

Extracts of salvia species : relation to potential cognitive therapy BACKGROUND: Dementia is a neurodegenerative disease of the brain associated with cognitive and memory impairments. Despite recognition of several types of dementia, the Alzheimer type is the most studied and understood. The cholinergic theory of Alzheimer's disease led to the development of licensed drugs based on the inhibition of the enzyme acetylcholinesterase. Extracts of Salvia (sage) species have been reported to have cholinergic activities relevant to the treatment of Alzheimer's disease. AIMS: Lack of information on a chemical fingerprint of the extracts responsible for inhibition of the enzymes butyrylcholinesterase and acetylcholinesterase prompted this in vitro investigation of sage species for anti-cholinesterase activity. Cholinergic receptor binding activity, inhibition of ß-secretase, and a pro-inflammatory cytokine suppressive activity of extracts of sage species were also studied as relevant treatment targets. METHODS: The extracts were obtained by methods of supercritical fluid extraction using 1,1,1,2-tetrafluoroethane (Phytosol A) and steam distillation. Dose-dependant inhibition of human cholinesterases by the extracts and constituents was determined using the method of Ellman, while inhibition of ß-secretase via a fluorometric method. The nicotinic acetylcholine receptors binding activity was measured as an amount of [3H]-nicotine displaced from human acetylcholine receptors, whereas the muscarinic activity was assessed using the displacement of [3H]-scopolamine. Determination of interleukin 8 inhibitory activity by the extracts was performed via a quantitative sandwich enzyme immunoassay using a commercially available kit. RESULTS: Inhibition of butyrylcholinesterase by the Phytosol extracts of S. apiana, S. fruticosa and S. officinalis var. purpurea was non-competitive. In contrast, inhibition of acetylcholinesterase by S. officinalis var. purpurea oil was competitive. S. corrugata extract was the most potent inhibitor of acetylcholinesterase with an IC50 value of 0.009±0.004 mg ml", while S. officinalis var. purpurea oil was the most active inhibitor of butyrylcholinesterase with an IC50 value of 0.015±0.004 mg ml''. Time dependent increase in inhibition of butyrylcholinesterase by steam distilled oils of S. fruticosa and S. officinalis var. "purpurea" was also evident. IC50 values decreased from 0.15±0.007 and 0.14±0.007 mg ml-1 with 5 minutes to 0.035±0.016 and 0.06±0.018 mg ml-1 with 90 minutes incubation time respectively. Phytosol A extracts were more potent than steam distilled oils with respect to anti-cholinesterase activity. Minor synergy in inhibition of bovine acetylcholinesterase was apparent in 1,8-cineole/a-pinene and 1,8- cineole/caryophyllene oxide combinations, whereas a combination of camphor and 1,8- cineole was antagonistic. Oil of S. apiana displaced [3H]-nicotine from human nicotinic acetylcholine receptors and [3H]-scopolamine from muscarinic acetylcholine receptors in a dose dependent manner with IC50 values of 0.02 mg ml" and IC50 0.1 mg ml" respectively. This oil also showed a modest suppression of interleukin 8 secretions from goblet cells. None of the tested oils and constituents had anti-ß secretase activity. CONCLUSION: These findings demonstrate that the cholinergic activity of the extracts results from a complex interaction between their constituents. Thus, inhibition of acetylcholinesterase is mainly due to the activity of the main constituents with some degree of synergy, whereas anti-butyrylcholinesterase activity is down to major synergistic interactions and identification of a chemical fingerprint responsible for the overall activity is therefore challenging. A synergistic combination of extracts or their standardised fractions with multiple activities is may be a candidate for clinical trials in Alzheimer's disease.

Category Archives: Arts, Culture And Heritage Samuel Coleridge-Taylor (1875-1912), Britain’s Foremost Black Classical Composer: The Centenary Legacy Just a few days after this year’s Slavery Remembrance Day, on 23 August, we mark also the centenary legacy of the black British music composer Samuel Coleridge-Taylor, who died one hundred years ago, on 1 September 1912. We went to see Leonard Bernstein’s Wonderful Town performed by the Halle Orchestra at The Lowry in Salford last night. And by coincidence, it transpired, yesterday was also the day when the BBC began transmitting the popular Breakfast show from its brand new operation in Salford Quay’s Media City. Apparently, despite the anticipated longer term advantages of being in Salford rather than London, there are still BBC people who think it not done to be going Up North regularly to broadcast to the nation. 2010-12 is the celebration of 100 years of Girl Guiding in the UK. In 1962 I, a young teenager and enthusiastic Girl Guide, made a Log Book of the Movement which drew heavily on The Guider magazine which came regularly through our letterbox, and also more personally includes photographs of my mother, Peggy, as a Girl Guide in the 1930s. The log covers the period from when the Girl Guides first formed until the year of my birth. Here in all its unedited school exercise book glory it is… The second hour of the BBC1 Call The Midwife drama series has now (on Sunday evening, 22 Jan 2012) been broadcast; and already we learn that there will be another series before long. Rarely do I get enthused about television, but the original books offered the potential for something special; and so it turns out to be. My piece elsewhere (and below) about aspects of public service which the TV drama illustrates has resulted in some really human engagement with this excellent viewing. Please keep the Comments coming…. Ostia Antica is what remains of the ancient port city on the coast to the west just a short journey beyond Rome. It makes for a fascinating day out and seems ideal for children as well as adults. But today we had the place almost to ourselves. It took less than an hour (and just a standard one Euro ticket) from Termini to the station at Ostia Antica, and the cafe there was great for lunch. So where was everyone? This is vast and enormously important historic site you could visit again and again. There’s nothing can be added here to the vast store of scholarship about ancient Rome. I hope the pictures will simply speak for themselves. But I can offer practical advice: It takes hours to see everything. You can enter the venues (Fora and Colosseum) only once each over two days. You’ll need sturdy shoes, a big bottle of water plus maybe nibbles. Rest and cool down where possible. And a vivid imagination is essential. These are places where real people, some still known by name, lived and worked two millennia ago. We’re in Rome this week, for our long-awaited Summer break. It’s our second visit to this city, but some things have changed a bit over the past fifteen years. For a start, the Auditorium wasn’t even build then; so that’s where we headed today – where we learned more about regeneration through culture, we were disappointed as tourists, and we thoroughly enjoyed a concert by the virtuoso pianist Stefano Bollani. The Lowry arts centre has this week stated its opposition to current plans for the Palace Theatre in Manchester to host all elements of a proposed Royal Opera House development in that city. The arguments on both sides seem however to miss some critical points: firstly, this is a regional not a sub-regional issue; and secondly the infrastructure and the local provisions should have been sorted years ago. Some other opportunities to develop the regional cultural offer have already been shunned; and now it looks as though this may happen yet again. Arts Organisations, Regeneration and Regions, Sub-Regions & City Regions. Reports this week suggest that the Lowry in Salford feels left out and disadvantaged by the proposed development of a northern (second) home for the Royal Opera House, if as a result all ROH-related northern ballet and opera productions – some of them currently hosted by the Lowry – were to be located in Manchester‘s presently fading Palace Theatre. This is not the time or place to go into questions of sub-regional and local politics – the cities of Manchester and Salford must get along as best they can – but there are a few larger questions which now arise which might have been addressed earlier. Regional aspects of the arts organisation proposals Firstly, investments and development of this size are clearly regional as well as local matters. The Lowry, a Millennium product, cost over £100 million to set up, and doubtless the cost of the new proposals would also reach many millions. It is surprising therefore that the ‘arts and culture’ debate thus far seems to have centred in its positive aspects only on the ROH and the Manchester orchestras. (Perhaps, as a slightly mischievous aside, there are very few left who recall that it was the Royal Liverpool Philharmonic Orchestra, not a Manchester ensemble, that performed at the Covent Garden Royal Opera House in May 1981 during the Royal Ballet’s golden anniversary celebrations?) Locating and programming Whatever, the there is now also a Royal Ballet in Birmingham, and Opera North may be intending like the Royal Ballet to make its northern activities to the Palace Theatre in Manchester; but the Lowry wants to keep them in Salford. It has to be said however that the Lowry has disappointed some of us in its more recent opera and ballet offering. To begin with we were excited by the range and frequency of national-level opera and ballet at the Lowry, but over time this seems to have been diluted by a preponderance of more local and / or less ambitious scheduling. Once enthusiasms for a venue are lost, it is probably hard to get them back. Travel and catchment One unfortunate element in the Lowry scenario is its very poor infrastructure. It is almost impossible for non-Mancunians to reach (and return home from) on public transport. Unless you take the car, you can’t sensibly get there after work or in bad weather…. Despite the trainline from the West of Greater Manchester (Warrington, Liverpool, etc) running within sight of the Lowry, it doesn’t actually stop there, and one has to proceed into Manchester and return out on a local route. It’s perhaps relevant that the first stopping point, Manchester Oxford Road station, is however almost next door to the Palace Theatre. The Lowry deserves a measure of sympathy for the situation in which it is placed by Manchester’s proposals; but there is already a huge plan for the relocation of parts of the BBC to that site. And there is a feeling that the Lowry could have positioned itself better as an attractive venue: limited serious arts programming, poor and / or restricted catering provision, little public transport and expensive car parks do little to ensure a consistent and devoted fully regional audience. There again, Manchester itself needs to explain why it has not, as far as can be seen, looked beyond its own boundaries to other North West areas, in sharing enthusiasm for the ROH proposals. Lost and endangered opportunities A few years ago Liverpool had an opportunity, which it decisively shunned, to make a bid for the National Theatre Museum to be relocated to Merseyside. That Museum used to be located right alongside the Covent Garden Royal Opera House; but despite the potential for inside influence of very eminent Merseysiders, not least on the board of the Victoria and Albert Museum (which owned the Theatre Museum), the bid never materialised and there is no longer any dedicated location for the theatre collection at all. Most of the collection is now stored away in Kensington, at the V&A itself. The possibilities of real cultural synergy between Merseyside and Greater Manchester have already therefore been seriously blunted by lack of vision, imagination and enthusiasm. Let us hope this is not about to happen yet again. Sir Richard Leese, Chief Executive of Manchester City Council, is surely correct in sharing with previous Secretary of State for Culture, Andy Burnham, the view that the regional benefits of the current proposals for regeneration and investment could and should be significant. But if everyone is not persuaded soon, there will probably be no action, or benefits at all. Read more articles on Arts Organisations, Regeneration and Regions, Sub-Regions & City Regions. The 8th of March is International Women’s Day, an occasion to look both back and forward. We have here some photos and text reminding us gently how grim life was for working class women and children in the mills (and often for their mining menfolk too) a mere century ago. Happily, Wigan Pier and the canals are now a tourist destination alongside a modern Investment Centre; but around 1910 a different story – not least about the uses of water – was being told. The challenge remains to secure the same progress as we’ve seen here, in ensuring healthy and constructive lives for women and their families everywhere across the globe. Here’s the text of this notice, displayed by the towpath at Wigan Pier: When cotton was king as told by a cotton worker circa 1910 It’s hot int’ mill wi’ lots o’ noise. On a nice day, we’ll take our lunch ont’ towpath an’ eat snaps* from’t snaps tins. It’s a 5-and-a-half day week for us cotton workers, that’s 12 hours a day and half a day on Saturday. We’ve all got nimble fingers , especially the Piecers’. They’re mainly children, who nip under the spinning machines to tie the broken cotton back together again. Some of us work on the spinning machines and some on the carding machines. The mill takes a raw bale of cotton, cleans it, twists it and spins it into fine yarn. The humidity in the mill keeps the cotton damp so it’s easier to spin without snapping. There are five floors of machinery – all powered by the Trencherfield Mill Engine. The noise is deafening – we stuff cotton from the floor in our ears to protect them. We communicate using ‘Me-Mawing’ – a mixture of sign language and lip reading. We work in our bare feet because our clogs could spark on the concrete floor and set the cotton bales alight. We wake early doors to the sound of the Trencherfield steam whistle summonin’ us t’mill for another day. But as they say – England’s bread hangs on Lancashire’s thread. [* a snack favoured also by the men of Wigan, many of them miners, usually bread-and-dripping, with cold tea, carried in a flat tin called a snap-can – see George Orwell‘s The Road to Wigan Pier] And here is the towpath which a century ago provided fresh air and respite for those mill workers as they ate their lunch-time snaps: [Public display boards by Wigan Heritage Services] The power of water And so, strangely, we come full-circle. Water – the canals, the steam – was the power behind the early production of textiles, employing many women and children in horrendous conditions, as the full logic of the Industrial Revolution took its vice-like grip on the emerging economies of what we have come to know as the ‘developed world‘; but even now in other parts of the globe water remains both a critical force potentially for good, and often an almost unattainable resource. Women as water workers Vast numbers of women and children in the developing world continue to toil many hours a day just to obtain water to sustain their very existence. Life in places like Wigan was harsh and short for women and men, alike, a century ago. It remains, as Oxfam tells us in the topical context of International Women’s Day, particularly harsh even now for women in places such as Iraq, where water continues to be inaccessible for many. The gendered meanings of sustainability This is where we begin to understand what ‘sustainability‘ is really about…. the just and equitable distribution of basic physical resources and accessible socio-economic opportunities, for everyone, women as much as men, the world over. In terms of future global sustainability and equity, as the Gender and Water Alliance also reminds us, water remains a critically gendered issue. Read more about Gender & Women and about Sustainability As If People Mattered and Water; and see more photographs of around Liverpool & Merseyside.

Many people talk about Linn synergy when their components are used together. However, Ivor Tiefenbrun himself has said on the Linn forums that Linn components are not made with the idea that they will only be used with other Linn gear. They are made to work well with other brands as well. The Ekos is a good arm and there is no reason why it wouldn't work well with another table. You just have to make sure that the hole in the armboard on the other table is drilled in the right location to fit the Ekos. This applies to any arm. 2 responses Add your response

Vienna hosts first mayoral conference on City Prosperity Initiative Vienna 30 July 2015– Over 100 participants, including more than 20 mayors and other high ranking municipal and national officials, last week participated in the first Mayoral Conference on the City Prosperity Initiative held at the United Nations Office in Vienna. Organized by UN-Habitat, the World Assembly of Islamic Cities (WAIC) and International City Leaders (ICL) the conference drew delegates from 12 countries including Afghanistan, Bangladesh, Colombia, Egypt, Iran, Jordan, Mexico, Palestine, Qatar, Republic of Korea and Turkey. The Conference was opened by Ms. Massaumeh Ebtekar, Vice-President of the Islamic Republic of Iran. In her video message, Ms. Ebtekar said: the City Prosperity Initiative is a very important initiative that looks into different issues from various perspectives: economic, social, political and also environmental… This synergy can create a lot of new opportunities that can enhance urban prosperity in both a holistic and an integrative manner”. Additionally, Ms. Ebtekar welcomed the creation of the High Level International Board of this global initiative. Dr. Joan Clos, Executive Director of UN-Habitat welcomed the participants and congratulated them in their effort to promote south-south cooperation and knowledge sharing. Dr. Clos stressed that the CPI was an excellent tool to ensure the systematic monitoring of policies and understanding their impacts. View his speech below. In his opening address Mr. Masoud Nosrati, President of WAIC, stressed the importance of the CPI for cities in West Asia and the Middle East. Finally, Mr. Omar Al-Rawi from the City Government of Vienna noted that much of Vienna’s international recognition as a prosperous city is due to its inclusive approach to local development. The City Prosperity Initiative (CPI) is an innovative approach conceived by UN-Habitat to promote sustainable urban development and measures prosperity across six variables – productivity, infrastructure, quality of life, equity and social inclusion, environmental sustainability and governance and legislation. Indicators around these six dimensions and their intersection with each other establish the basis to map a city’s path toward prosperity. During this Conference, UN-Habitat and International City Leaders (ICL) launched the City Prosperity Initiative for Metropolitan Cities (CPI-MC). This partnership is supported by Shahr Bank, the City Bank from Iran. The CPI-MC aims to promote innovative approaches to urban governance and management which will assist city leaders to guide their cities towards economically, socially, politically and environmentally prosperous urban futures. During the conference WAIC launched its program which includes the WAIC Islamic Impact Fund, the International Secretariat for Housing for Islamic Countries to be hosted by the municipality of Kashan and the WAIC Best Practices Secretariat hosted by the municipality of Iahijan. Various city representatives and mayors expressed their interest to join the CPI; namely from Iran, Turkey and Qatar. The Province of Gangwon, Republic of Korea announced they are considering organizing a sub-regional CPI meeting and the Municipality of Tehran disclosed that an international mayoral conference on this initiative will be held in April 2016 in Tehran.

Throughout its 10-year life, Synergy has achieved remarkable success in the network marketing world because of its unique marketing plan, advanced formulations, and a reputation for unsurpassed quality in manufacturing. Welcome to my Profile, my life has truly been an adventure. Born in Costa Rica and Raise in Los Angeles California, a Metalurgist by trade. Technical sales manager for 17 years, for one of the largest Investment casting foundries in the US. On to become an aircraft dispatcher for 9 years, got married and moved to Chihuahua, Mexico, where we lived for 10 years, and started my own business there. I consider my primary residence to be El Paso, Texas. We are currently working with Synergy World Wide as an independent distributor. We came across Synergy due to personal health issues, my wife and I now benefit from a quality of life unknown to us prior to the use of ProArgi9 Plus. I decided to to join Synergy World Wide in our journey to safe a million lives. Leave A Legacy Throughout its 10-year life, Synergy has achieved remarkable success in the network marketing world because of its unique marketing plan, advanced formulations, and a reputation for unsurpassed quality in manufacturing. Being backed by industry giant Nature’s Sunshine Products, a rock-solid company with 37 years of experience, Synergy truly offers an opportunity unmatched anywhere in this industry. Synergy is your gateway to personal freedom and financial independence. By taking full advantage of this opportunity, you’ll find that amazing things will happen for you and your family. We challenge you to investigate all that Synergy has to offer and ask you to make the commitment to change your life today by joining a company on the rise. Synergy determined early on that expanding into every available market was fundamental to its mission. The company now has Team Members in Australia, Austria, Canada, Czech Republic, Germany, Hong Kong, Indonesia, Ireland, Japan, Korea, Malaysia, Mexico, Netherlands, Norway, Philippines, Singapore, Sweden, Taiwan, Thailand, United States, and Great Britain. Just a friendly warning regarding Sheikh Hasher Maktoum Al Maktoum. He's a fraud. First off, Hasher isn't an old white guy. Second, he'll circle back to you with a request that you contact his financial adviser in London. He's trying to get your business plan details - or worse, your bank account. Block him. No comments yet! You need to be a member of OpenCoffee Club to add comments!

“The artists get to keep 100 percent of what they sell because they deserve it,” the producer, rapper, and art collector Swizz Beatz yelled enthusiastically from a stage in Miami’s Wynwood neighborhood Saturday night, followed by a bevy of air horns. Swizz was talking about the No Commission Art Fair—an event he organized based on his own art collection and in partnership with Bacardi—where admission is free, the artists keep everything, and product placement is rampant. An additional component came in the form of the “Casa Bacardi” parties that happened outside of the fair every night, also curated by Swizz. Over the week, they have included performances from Swizz’s wife Alicia Keys, Pusha T, and many more. Swizz took the stage Saturday to close everything out alongside his longtime collaborator, the rapper DMX. Earlier that day, just before I was set to interview Swizz, I spied him talking to the dealer Jeffrey Deitch in front of the very stage that he would perform on that night. “[Deitch] told me some amazing words,” Swizz recalled in our interview. “He was saying, ‘This is the new model,’ he said, ‘You’ve found out the new model.’ Jeffrey Deitch is known for building new models and changing the tide, and so for him to come here personally and have that conversation with me, it meant a lot,” he said. The synergy between branding and contemporary art is pretty loaded at this point, but after spending time at Basel proper, it’s hard for me to really make a judgment call on anything. “It was very important for this show not to be only about rich people, right,” Swizz said. “No, man, we have billionaires here and we have people that live with they mom here, you know? That’s the mix, that’s how you want it. You want it to be a real cultural effect.” The show featured work from KAWS, Dustin Yellin, Swoon, and Kehinde Wiley, among many others. Some of the artists are less known, and a good portion of the show is culled from Swizz’s extremely popular art-centric Instagram. “It just became a community that lived in a digital world that we’re now bringing to life here,” Swizz told me. As an art collector within the world of hip-hop, Swizz Beatz was an especially early adaptor. He told me that growing up in the South Bronx around graffiti and hip-hop nurtured his sense of aesthetic curiosity. The first piece he bought was an Ansel Adams. When he started collecting, he bought “more into quantity than quality,” but now trusts his own eye. “The way I collect now—I just see it and I know it,” he said. When I arrived back to Wynwood around midnight, cop cars lined the outside of the venue, which was at full capacity with many more clamoring to get into the gates. Wiz Khalifa was doing a DJ set, smoking blunts and handing them out to the members of the audience. The “Casa Bacardi” theme was somewhat noticeable: toward the back of the room, there was a weird Bacardi-branded tub next to a kitchen vanity, the mirror of which partygoers were pragmatically taking advantage of for primping purposes. People took photos inside of the tub; one of them pulled a gag where he pretended to be passed out. After Wiz’s DJ set and some interstitial hype-man activities, Swizz came out and proceeded to roll through a medley of his many classic hits, at one point bringing out the Miami legend DJ Khaled for a short guest performance. (If you haven’t heard the Khaled ad that ran on local Miami radio for the McCafe line at McDonald’s, stop reading this right now.) Finally, DMX appeared on stage to rapturous response. He was decked out in a red bucket hat, sunglasses, and a Keith Haring–branded T-shirt. He slowly removed these layers as the show progressed. At one point, he yelled, “Why are all these cups here?”—referring to all the Bacardi-branded cups clogging up a table positioned toward the side of the stage, probably strategically placed there by a brand rep—before kicking all of them off, into the crowd, and starting up “Ruff Ryders Anthem” (the track that started the career of Swizz Beatz, who produced the song). It was nothing but punk in spirit, and a moment of pure intensity inside of a week filled with blandness. (DMX’s history of erratic behavior and struggles with addiction are deeply human and have resulted in some of the most compelling rap music of all time. His 2006 reality show for MTV is probably one of the most “real” efforts to ever come out of the genre: there is a reason that it only lasted one season. I think you can still watch it on worldstarhiphop.com.) The world is a complex place. All systems are by their very nature fundamentally flawed. All one can hope for in this life is to do or see something that transcends its context, however fleetingly. Which is to say: I’m glad I saw DMX perform in the middle of an art fair at a party sponsored by a rum company.

These are generally much more convenient natural variables than S. Excellent sources of information on the syntax include Jeffrey Binary options odds mcdonalds. A combination index of 1 is indicative of no interaction or Lowe additivity; binary optionsit indices greater or less than 1 indicate antagonism or synergy, respectively. (1996) Isoform-specific interaction of the α1A subunits of brain Ca2 channels with the presynaptic proteins syntaxin and SNAP-25. And Cover, 1998. 140,2649-2656. 26 - 6. Rhizogenes Plant Mol. This heralded a major research initiative and led binary options killer video the binary options webinar kpmg up of several European and From Methods m Molecular Biology, Vol 104 Mycoplasma Protocols Edited by R J Miles and R A J Nicholas 0 Humana Press Inc ,Totowa, NJ 17 Page 18 18 Table 1 Members of the Mycoides Species Nicholas cluster M mycoides subsp. Некоторые характерные примеры применения ручного режима приведены на W eb-сайте, посвященном настоящей книге. FEMS Mzcrobzol Lett 83,277-282. The use of pCG79 m its entirety as a probe reveals bands identical to the plasmtd bands, plus an extra band corresponding to the duplicatron binary options killer video an msertion sequence. 13 M NaHCO3 solution to the dichloromethane phase and mix at full speed for 15 min. Apply power at 550 V for 10 min, dCTPdGTPdTTP 100 mM stock solutions (available from many manu- facturers, e. It is worth noting in this regard that Mussolinis invocation of the fallen sol- diers in his Dalmine speech means that binary options killer video can fine-tune our previous under- standing of the role of the dead in the San Sepolcro programme. Lysis Reagents for Colony Binary options killer video 1. Hence, the Hb molecule migrates toward the cathode. 21j4 c. Такой недо- статок легко обнаруживается по цветной окантовке на высококонтрастных краях по- лученного снимка (рис. Teo, E. 21 Binary options 365-6988. We suspect that the enhanced functional connectivity involves LTP of the mossy fiber synapse with CA3 pyramids as well as a compromise binary options killer video the mossy fiber-evoked feedforward inhibition binary options work radio the CA3 pyramids. A brief overview of examples of application of FISH in the study of hematologic disorders is binary options killer video here. 675 23. Biochrnz.Pober, J. (1991) Kinetics of expression of multiply spliced RNA in early human immunodeficiency virus type 1 infection of lymphocytes and monocytes. Adjust the pH to precisely 7. Austral. uk and ncbt. Genotype, the differences among isotopic concentrations would not be as great. Hyorhinzs cultivar a, and A. 00471 7. Fourth in molecular medicine review series. 5-14) Note A,H" does not depend on Binary options killer video. To 100 μL of 0. (1994) A binary options bitcoin historical chart hepatitis B virus variant in binary options killer video sera of immunized children. ,Aalberse,R. 184. Mol. A PCR product derived from DNA cannot be dtstmgurshed from an Binary optionscss PCR binary options killer video m prokaryotes, which commonly do not possess mtrons. This chapter describes the modifkatlons developed for two of these commercial kits to allow tsolatron of plasmrd and cosmtd DNA from myco- bacteria. The enzyme most frequently binary options killer video is horse- radish peroxidase (HRP) mainly because of its low molecular weight (40 kDa), its high catalytic activity, and its fairly easy availability. 0000 0. Microscopeslidewarmingtable(Model285,LipshawMfg. The sulfur radiolabeled the surface of the virus, J. USA 95(18), 10,37810,383. This does usually require that the attractant also be metabolizable. Mutat. A meta-analysis. (1971), The Italian Nationalist Association in the Period of Italian Neutrality, Binary options demo account app Journal of Modern History, 43 394412. Rotate the wash vessels on a rotary shaker at 110 ± 5 rpm for 15 20 min at room temperature (15 30°C). 3 Binary options killer video X- 100. The reaction is confined mainly to the granulocyte series and binary options kaskus official lounge cells. 21 140. Edward Jenner (17491823) is credited with developing the first successful vaccine against a viral disease, and that dis- ease was smallpox. 2 - 0. The program for PCR amplification is (40 cycles) 94°C, 3 min, Binary options signals 90s movies, 45 s; 72°C, 1 min 30 s. Ghany et al. Only two genes, III and VIII, out of 11 genes in phage genome are shown. 50 IIIIIIIIII GATATAGTRGAGGTT~ACATTGAGACAGGTGGTGCATGGTTGTCGTCAG~CGTGCCGT~GGTGTTGGGTTAAGTCCYAC~CGAACGCAACCCTTGTC I ,011 ,200 I I ,10 NJ 287 Page 282 288 Orlic Fig. Be sure that the plastic boxes will not warp or open at 50°C. 5 Energy and Electrical Power 4 1. Binary options killer video recent model (113) has attempted to provide an integrated view of how presynaptic and Long-Term Potentiation 513 Page 523 514 J. 49, 4. When FPA 5, Kin is influenced by both PA an F. Obtain the resulting current for t 0. The sequence that they outlined was that DNA in the nucleus of a cell might act as a template for the formation of a second type binary options jobs cyprus zones nucleic acid, RNA (ribonucleic acid). binary options killer video active High Cascades at a 1.Binary options news express

June 24, 2004 Mary-Claire King to receive Gruber Genetics Prize Dr. Mary-Claire King, UW professor of genome sciences and medicine, will receive a major international genetics prize this fall. She is also the American Cancer Society professor at the UW. King, who proved the existence of the first gene for hereditary breast cancer and has long promoted the application of genetics to benefit humanity, has been selected by an international panel of experts to receive the 2004 Genetics Prize of the Peter Gruber Foundation. The Foundation annually presents its gold medal and a $200,000 unrestricted cash award to an outstanding scientist who has contributed to fundamental advances in the field of genetics. This year’s prize will be presented on Oct. 27 at the meeting of the American Society of Human Genetics in Toronto, Canada. The official citation reads: “By genetically locating a gene predisposing to breast cancer, Dr. King established a new paradigm for analyzing genetic contributions to common human diseases. She pioneered the use of DNA testing in human rights by identifying the orphaned children of political dissidents killed during the dark days of Argentinean dictatorship. Her intellectual contributions and her personal courage are models for how both the theory and methods of genetics may be applied to benefit humanity.” Born in a suburb of Chicago in 1946, King graduated from Minnesota’s Carleton College with a B.A. in mathematics, and received her Ph.D. in genetics from the University of California, Berkeley in 1973. She was a professor of both genetics and epidemiology at UC-Berkeley from 1976 until moving in 1995 to the UW, where her laboratory focuses on the identification and characterization of genes responsible for complex, common human conditions. King’s groundbreaking insights led to the discovery that mutations in a single gene, BRCA1, cause breast cancer in many high-risk families, thereby creating a revolution in human genetics. The discovery permanently changed thinking about the genetics of common diseases and has been emulated by researchers studying many other serious diseases including Alzheimer’s, Parkinson’s, and prostate cancer. King also has a long involvement in promoting the human rights applications of genetics. As a young scientist she was a teacher and researcher in Chile. Her experiences in South America inspired her ongoing project to assist the “abuelas,” the grandmothers of the children of those killed during Argentina’s “dirty war” in the 1970s and early 1980s. These parents of “the disappeared” seek to be reunited with the children of their lost sons and daughters, and a genetic test that matches maternally inherited mitochondrial DNA sequences is often the only way to confirm that link. In addition, King oversees a collaboration between Israeli and Palestinian scientists to identify genes for deafness. “Genetics passes on to us important information about our inheritance,” said Peter Gruber, chairman of the Peter Gruber Foundation. “We are extremely pleased to honor the work of Dr. Mary-Claire King. She is an innovative researcher and a powerful advocate for the synergy of science and social action.” The Genetics Prize was established in 2001. Previous winners are Dr. Rudolf Jaenish (2001), a pioneer in using mice to study and develop treatments for human diseases, Dr. H. Robert Horvitz (2002), the recent Nobel laureate who led the way in discovering how specific genes cause the programmed death of cells, and Dr. David Botstein (2003), an innovator in the use of genetics to understand biological functions. The Peter Gruber Foundation was founded in 1993 and established a record of charitable giving principally in the U.S. Virgin Islands, where it is located. In recent years the Foundation has expanded its focus to a series of international awards recognizing discoveries and achievements that produce “fundamental shifts in human knowledge and culture.” In addition to the Genetics Prize, the Foundation presents awards in cosmology, neuroscience, justice and women’s rights. Further information is available at http://www.petergruberfoundation.org.

Performance Drywall Services • Insulation • Drywall • Taping • Texture • Steel Stud • Construction Services Performance Drywall, a division of Igloo Building Supplies Group Ltd., has been one of the finest leaders in the Edmonton area for the application of drywall services new residential homes. With a focus on continuous improv read more... Performance Drywall has a TrustScore™ of 3.6. The average TrustScore™ for other businesses providing similar services in Edmonton and the surrounding areas is 3.5. For detailed information on how TrustScore is calculated, click here. The following elements are used to calculate TrustScore: |Customer Reviews||Last 12 Months||All Time| |Complaints Received||Last 12 Months||Last 3 Years| |Suppliers & Creditors||0||0| |Employees & Sub-Contractors||0||0| |Posted License Information||Not yet provided| |Posted Liability Insurance||Not yet provided| |Posted Workers Compensation||Not yet provided| |Ever Provided False or Misleading Information||No| |Social Media Profiles||Not yet provided| |Endorsed by Peers||Not yet endorsed| |In Business Since||2005| |Member of TrustedPros Since||2011| TrustedPros does not validate certain information provided by contractors and vendors in conjunction with the creation or maintenance of their profile. TrustScores are provided for informational purposes only. We urge you to use the TrustScore™ in conjunction with the tips provided in our Hiring Guide to maximize the probability of hiring the best professional for you project. Performance Drywall Services Performance Drywall, a division of Igloo Building Supplies Group Ltd., has been one of the finest leaders in the Edmonton area for the application of drywall services new residential homes. With a focus on continuous improvement, our team is highly efficient, skilled, and dedicated. We strive to create a work environment that promotes synergy between Performance Drywall, our builders, and our sub-trades. Our team is committed to change management with a focus on technological advancements, process improvement, and team development. |Main Contact(s):||Simon King , Sharon Henning| |Alternate Phone Numbers:||780-699-2380,| |Listed with TrustedPros since:||2011| |Accepts credit cards:||Yes| |24 Hour emergency Service:||No| |Licensing Information:||Contact Performance Drywall to request licensing info.| |Insurance Information:||Contact Performance Drywall to request insurance details.| Check local laws pertaining to license requirements and verify license and insurance details provided by the contractor prior to hiring.

"Clownotto" has been developing projects, events, shows and performances since it was founded in 1979. It works with institutions, firms and businesses as well as schools, proposing both well established shows or collaborating to meet others’ requirements in order to create events, special projects or educational workshops for specific needs. Professional people from various fields such as actors, architects, teachers, psychologists, writers and illustrators take part in our productions and workshops, finding in our achievements a synergy which gives them a unique quality. We pay a great deal of attention to aspects such as communication, education and environmental sustainability. In fact in creating scenery and props we mainly use recycled materials, reusing them in an exciting way so as to create visually striking effects.

New media have brought us a new age of miracles. A complete unknown, a Susan Boyle, can sing a song on a TV talent show and awake an international heroine. Fame hasn't spread so swiftly since the early 15th century, when Joan of Arc was an anonymous peasant one day and leader of the French army approximately the next. The Maid of Orleans had God on her side. Boyle had YouTube, Facebook, and Twitter. And Boyle is but one example of the power of new media to bestow unimaginably swift renown. The recent book Media: From Chaos to Clarity, written by Judy Ungar Franks, a professor of marketing at Northwestern University, also notes the viral heights attained by the Betty White Snickers commercial and the Old Spice "The Man Your Man Could Smell Like" campaign. Shrewd marketers don't choose among media platforms; they exploit them all, Franks tells us. Symbiosis and synergy are the watchwords. "For example," she writes, "Old Spice understood that TV/YouTube/Twitter had to go together in order for its idea to work. If you take one channel out of the mix, the whole conversation falls apart." I am reading Franks's book because I'm trying to move past notions about media and marketing that I'm sure are naive, sentimental, and obsolete. Here is Franks's formula for fame and fortune in our time: "We need a few simple tools and one big picture," she writes. "We need a great story to tell (across multiple channels), we need an engaged consumer and we need an open media architecture that enables consumers to accelerate content across media channels and social networks." But where does this leave the merchant without a great story—let's say the grocer who wants to tell shoppers that this weekend's loss leader is two bags of carrots for the price of one? It used to be he'd buy an ad in the Thursday paper, and if one housewife mentioned the carrots to her neighbor that was viral enough for him: he didn't need his two-for-one offer to become tomorrow's talk of two continents. I express my doubts to Franks. Her response incorporates UPC codes, her own online grocery list, and "cutting-edge research on grocery shopping and shopper insights" conducted by Northwestern colleagues. I rest easier. But my skepticism isn't assuaged by Franks's recipe for concocting overnight sensations. Susan Boyle, much like Joan of Arc before her, essentially caught lightning in a bottle. Anyone who has ever posted anything online can tell you that nothing is less certain than the public's reaction to it. One essay or video clip passes into the ether unnoticed. The next goes viral, God knows why. "Frankly, we could never create brilliant ad campaigns to order," Franks allows. "The truly brilliant campaigns have always contained a spark of magic." A Susan Boyle is a phenomenon. Can you base a business model on phenomena? Old-school marketers must find the changing media landscape as wrenching as old-school journalists do. They must long for old-fashioned TV programs that audiences sat at home and watched as they were aired, commercials and all. They must mourn the vanishing environment of the printed page that ads and stories blissfully cohabit, each enhancing the other in the eyes of readers. Before contacting Franks, I put this idea to a media buyer in Chicago who made me feel I was onto something. "I'm actually a big proponent of print—particularly weekly and monthly magazines," he e-mailed me. "It's an uninterrupted environment—you cannot watch TV/surf the web/text/tweet/etc and read a magazine. When someone is reading a magazine you can be relatively sure you have their undivided attention. "Unfortunately, I have a somewhat unforgiving opinion of newspapers. I think newspapers are very important for society, but they just don't make sense for an advertiser." They're very expensive, he said, and the ads get lost. Even worse, "the average age of a newspaper reader gets older every year, and the engagement is low. The chances of getting the right eyeballs seeing my ad in a daily newspaper are pretty low." But the new alternatives don't excite him. The problem with digital advertising, he said in a second e-mail, is that "the average click through rate for an ad is about .02%. I think I once read that you're more likely to be struck by lightning than be a person who clicks on an ad. I think advertising is kind of in trouble. Young people watch less TV, don't listen to radio and don't read newspapers. On top of that they are annoyed with digital ads but don't want to pay subscriptions to their favorite websites. Not sure what options are left?" I run this last comment by Franks. "I would agree and disagree," she says. Though her book barely mentions print journalism, she agrees that a niche magazine can make an excellent environment for advertising that's tailored to the niche. But it shouldn't think of itself as just a magazine; it must become as much a brand as any advertiser in it, Franks insists, a brand that exists in print and online and on mobile devices and on the social networks—a brand that the public will seek out.

Citygate Outlet team bids for another site at Tung Chung The same team that runs the outlet shopping mall in Tung Chung is bidding for a site nearby A friend recently paid a visit to Citygate Outlet shopping mall in Tung Chung. She thought she was in Canton Road, Tsim Sha Tsui. Shops selling designer fashion brands and sports items, including Burberry, Coach, Levis, Polo, Nike and Adidas, were jam-packed with mainland buyers. Some of the mainland shoppers were in such a hurry to take the last cross-the-border bus that they simply removed their shirts to try on anything they took from the shelves, instead of lining up to enter the fitting rooms. Most were same-day travellers, who take the cross-border bus directly to Tung Chung. First they take a 25-minute scenic trip via the Ngong Ping 360 cable car to the famed Po Lin Monastery and the Big Buddha, then they end the day by shopping at the outlet mall, before returning home in the evening. With the outlet mall offering goods at 30 per cent to 70 per cent year-round discounts, it manages to lure an increasing number of mainland shoppers from traditional shopping districts such as Causeway Bay. No doubt the cash registers of retailers at Hong Kong's first outlet mall, which is owned by a five-strong consortium made up of Swire Properties, Sun Hung Kai Properties, New World Development, Henderson Land Development and Hang Lung, rang up strong sales. Last Friday, the same consortium submitted a bid for the nearby commercial site in Tung Chung, which is also believed to be earmarked for a shopping centre. The consortium's bid for the site was estimated at HK$1.1 billion. That is not as eye-catching as the luxury residential site in Ho Man Tin that is expected to fetch bids of between HK$11 billion to HK$14.8 billion but, given its location, it could be very lucrative. Observers believed the teaming up of the five heavyweights could expand the existing outlet mall business model onto the site. They would be leveraging on the experience of the existing management team, led by Swire. Given Citygate Outlet Mall's nearly 10-year record of operation and the close to 80 brands at the mall, it would be easier to line up more retailers for the new mall. The Tung Chung site is 107,920 square feet. The winning bidder can build a development 70 metres high with a gross floor area of 539,599 sq ft. This would not be enough to make a local shopping centre economically viable. "In the current highly competitive retail industry, only shopping malls with sizes of 600,000 square feet to one million square feet will survive," an industry practitioner said. However, it will be a different case if the Swire consortium turns the site into the second phase of Citygate Outlet Mall. That should provide a meaningful synergy to the consortium's existing business. When the Hong Kong-Zhuhai-Macau bridge is completed in 2016, Tung Chung, the first landing point in the city, will provide ample opportunities for retail development. No wonder the success of the current outlet mall concept attracted a host of other bidders, mostly big developers. They included Sino Land, Cheung Kong, Wheelock Properties, a consortium of Paliburg and Regal Hotels International, and Dorsett Hospitality. Others are also looking to similar opportunities. A plan has been proposed by the Lantau Economic Development Alliance, made up of 10 Lantau-based companies and community groups such as Disneyland, AsiaWorldExpo and Ngong Ping 360, to develop Lantau Island into a commercial zone to divert tourists from the busy Causeway Bay and Tsim Sha Tsui areas to the outlying island.

March 31, 2011 - Montclair State University's Office of Arts and Cultural Programming will present Brainstorm, a symposium exploring concepts of creative thinking on Tuesday, April 12, 2011 at the Alexander Kasser Theater. Presenters include leaders in creative research and choreographic, performance, and visual arts exploring cognitive tools for accessing creativity, and how barriers can be broken through the creative process. The development of Choreographic Thinking Tools by the R-Research component of Wayne McGregor | Random Dance will be highlighted. This event is free and open to the public, with particular appeal to those interested in creativity and the creative process as it is realized through the arts, science, and education. Brainstorm will include presentations by David Kirsh, professor of Cognitive Science at the University of California, San Diego; Scott deLahunta, R-Research director for Wayne McGregor | Random Dance; and Philip Barnard, program leader of the Medical Research Council's Cognition and Brain Sciences Unit at the University of Cambridge. The event will conclude with a panel discussion and question and answer session with performance/visual artist Robert Whitman, choreographer Elizabeth Streb, and composer Michael Gordon discussing intuitive creative thinking and the mental processes behind each artist's creative output. According to Jedediah Wheeler, executive director of Montclair State University's Office of Arts and Cultural Programming: "Art and science have a natural synergy at Montclair State, as evidenced in the University's academic programs and in the realization of this transdisciplinary symposium. Brainstorm also reflects my belief that art is universal and shares interests with other disciplines - helping people with divergent goals find common ground." Brainstorm was developed as part of the 2010 Creative Campus Innovations Grant awarded to Montclair State University. The grant program is made possible by the Association of Performing Arts Presenters, funded by the Doris Duke Charitable Foundation. Brainstorm is free and open to the public. Tickets will be issued on a first come, first serve basis.Tickets are available online at www.peakperfs.org or by calling the Peak Performances box office at 973-655-5112. Free shuttle bus service is available from NYC by calling the box office or by reserving seats via the website (a bus reservation notice will pop up when ordering). Montclair State University Montclair State offers the advantages of a large university -- a comprehensive undergraduate curriculum with a global focus, a broad variety of superior graduate programs through the doctoral level, and a diverse faculty and student body -- combined with a small college's attention to students. montclair.edu. Schedule of Events Tuesday, April 12, 2011; 1:00 p.m. to 5:00 p.m. Montclair State University | Alexander Kasser Theater Dance Engaging Science (1:00 p.m.) David Kirsh, professor of Cognitive Science at UC San Diego In collaboration with Wayne McGregor | Random Dance and using Random Dance rehearsals as a case study, Kirsch explores such questions as how dancers use their bodies to think, how memory is distributed across a group, and the differences between directions conveyed through speech, sounds, touch, gesture, and body movement. Tools for the Imagination (2:15 p.m.) Scott deLahunta, R-Research director for Wayne McGregor / Random Dance Philip Barnard, program leader, Medical Research Council's Cognition and Brain Sciences Unit, University of Cambridge Arts researcher deLahunta and cognitive psychologist Barnard apply insights from science to the creative process developed in collaboration with choreographer Wayne McGregor. They will discuss the development of Choreographic Thinking Tools in application with professional dancers from Wayne McGregor | Random Dance and in other contexts, including students at Montclair State. Thinking Out Loud (3:15 p.m.) Michael Gordon, composer Elizabeth Streb, choreographer Robert Whitman, performance/visual artist Artists and researchers offer perspectives on thinking tools in the context of the creative process and engage with leading creators in the fields of dance, performance and visual art, and music, to probe the mental processes behind intuitive creative expression.

Free rides in the miniature German-made electric vehicles were being hawked across the street from Betabrand's Mission District headquarters. The premise was simple: walk up to the Yo/Smart pop-up promo station (sponsored by Mercedes-Benz), "Yo" @smartmission, and then scrunch your way into a two-seater and be driven across town. "The main priority is to get people to drive the vehicle, and tapping into that Yo audience is a great way to do that," a spokesperson for Mercedes-Benz, the United States distributor of Smart cars, explained to TechCrunch. "We're giving 'Electricurious' San Franciscans the world's first-ever Yo-powered test ride." While a line of cars were parked along Valencia Street, idly waiting for passengers that would never come, a Smart representative I spoke to insisted that you must download Yo and summon your ride through the app. "That's part of the promotion," she told me. Of course, the event was a flop. People already have Uber and Lyft for on-demand rides, and the entire premise of walking to a glorified taxi stand undermines the promise of convenience that has fueled the growth of service apps. And for some reason, the media—presumably the only people in San Francisco interested in this stunt—were not welcome to participate. For the fifteen some odd minutes I hung around the area, the only people there were a film crew, Smart handlers, a man delivering fruit to a nearby restaurant, and a bored police officer tasked with protecting the scene. Unfortunately for Smart, the company paid to bring a film crew out to document the brand synergy, hoping to shoot a commercial featuring excited Yo-users blasting around town in the easily-flippable car. "Are you about to take a ride?!," one of the cinematographers asked me as I lurked about. "No, I'm just press," I responded. He went back to filming the parked cars while a production script sat abandoned on the sidewalk. Like Yo, it was of little use to anybody.

Marc Bonilla - Slaughter On Memory Lane MP3 Marc and the Dragonchoir perform live on the KTLA Morning Show with Mike Keneally, Toss Panos and Dave Moreno. Marc Bonilla - Slaughter on memory lane MP3 Marc Bonilla - EE Ticket - 11 Slaughter on Memory Lane MP3 Marc Bonilla - EE Ticket. Marc Bonilla Slaughter On Memory Lane MP3 Music from Marc Bonilla''s album EE Ticket album (1991). Slaughter on Memory Lane MP3 Provided to YouTube by Warner Music Group Slaughter on Memory Lane · Marc Bonilla EE Ticket ℗ 1991 Reprise Records Released on: 2011-01-24 Writer: ... Les Brown - Slaughter On Tenth Avenue MP3 This instrumental written for the broadway show "On Your Toes" was a definite show stopper. This version by Les Brown and his Orchestra was recorded on ... Jeffree Charles - We Can Roll [Official Video] MP3 J-Groove Music Track-Off "4 Play" Ep Memory Lane Entertainment Solutions Contact: (404) 790-7875 ... Marc Bonilla - EE Ticket (Full Album) 1991 MP3 "EE Ticket" is the debut album by guitarist Marc Bonilla. It was released in June 1991. If you like this album or artist, let us know and leave a comment below. Wizard101 3v3 Team Slaughter House The Beginning MP3 Giselle Plays Bioshock Infinite - Part XI: A Totter Down Memory Lane MP3 Memory lane with Rain - R.I.P MP3 Weekly Show 01/03/2014 MP3 In the Show: Marcus Slaughter represents the power of Real Madrid...The Dimitris Diamantidis sets a new milestone in the Game of the Week. Sinan Guler takes ... Synergy: Ravenholm Zombie Slaughter, 3 Player Coop Gameplay - (Pt.02) MP3 La parte più terrificante di Half Life 2 [MUSIC] Intro: "Dream Window" - 36 Outro: "Memory Lane" - Netsky. Red Zone Slaughter Pt1/3 CQC Assassin Style Metal Gear Solid 4 The Boss Extreme Difficulty 1080p HD MP3 CQC Stealth Killing was the reason why I started making Metal Gear Solid Videos back in 2008. It led to the full walkthrough of MGS4 and the rest as they say, ... 90s Music Flashback #4 - 20 Great Songs from the 1990s MP3 Take a trip down memory lane with ... 1. "It ('s a Monster)" by Extreme 2. "Fly to the Angels" by Slaughter 3. "All I Want" by Toad the Wet Sprocket 4. "So Whatcha ...

Make Your Own Chicago Style Hot Dog It's easy and fun to make your own Chicago Dog. Our guide will tell you everything you need to know to create the perfect Chicago Dog in the privacy of your own home. We will tell you where to shop, what to buy and how to properly assemble your Dog in true Chicago style. You can even print a shopping list and a step-by-step guide to adding toppings. Let's get started... Shopping for Ingredients In order to create your "masterpiece", it is important to start with the proper ingredients. Although you can substitute any of the ingredients mentioned here, we suggest that for your first attempt, you try the ingredients we recommend. We have carefully selected each topping to work harmoniously together to create Hot Dog Synergy. Do you remember learning about synergy in grade school? If you can't remember, synergy is two or more entities working together to produce an effect that is greater than the sum of the parts. The Hot Dog A Chicago Style Hot Dog is a traditionally all beef and contains no fillers. Don't even think of using a Hot Dog made from turkey, chicken or pork. Some all beef Hot Dogs are "Kosher". If you prefer a Kosher Dog, look for the Kosher symbol (K) or (U) on the packaging. When buying your Hot Dogs, stay away from the 97% fat free choices as they are more difficult to cook and lack flavor. We used to recommend either "Best's Kosher" or "Vienna Beef" brands, but Best's Kosher dogs are no longer available. Vienna Beef dogs are excellent and are available at most grocery stores. Another excellent choice is Red Hot Chicago brand dogs, which are available at Jewel grocery stores. For a real treat, try the "jumbo" sized version of your favorite brand. Sentry Hilldale (in Madison) has a great selection of all beef Hot Dogs. Remember, the retail version of dogs available in your grocery store are usually NOT the same as the dogs you get from a hot dog stand. The retail version dogs are usually smaller in size and sometimes don't taste as good. Classic Chicago Dogs are famous for their sweet bright green relish. Finding the perfect relish has been a struggle, but luckily we found Rolf's "Deli Style" Sweet Pickle Relish and Sweet Super Green Pickle Relish from the Puckered Pickle Company. Rolf's may be available at Jewel stores in the Chicago area and is definitely available at Woodman's in Madison. Any sweet relish will work well on your Chicago Dog, but Rolf's and the Puckered Pickle Company's relish are a treat and worth every cent. Another great choice is Vienna Relish which can be found at Jenifer Street Market (Madison) and at Jewel stores in the Chicago area. Another classic topping of a Chicago Dog is yellow mustard. When we think of Hot Dogs, we instantly picture yellow Mustard slathered on the Dog. According to the National Hot Dog and Sausage Council, Mustard is the Hot Dog condiment of choice. Any classic yellow Mustard is acceptable. Do not use brown or Dijon Mustard on your Chicago Dogs! We recommend either Plochman's or French's. There is nothing like the perfect pickle to compliment your Dog. As far as we are concerned, the pickle you place on your Hot Dog can make or break the experience. A classic Chicago Dog will either have a pickle slice or spear. The pickle you choose should compliment, but not overpower any of the other toppings. A common mistake is to place a sour and/or spicy pickle on your Hot Dog. The pickle should have a nice crunch and the seasoning should be mild. Sometimes cucumber slices are substituted for the pickle. We highly recommend Crunchy Deli Pickle Spears from the Puckered Pickle Co. These great tasting crunchy pickles are perfect for your Chicago Dog! Click Here to check availability in your area. Another good choice is the Claussen Kosher Dill. These pickles are available in both slices and halves. If you buy the halves, make a spear by slicing down the middle of the pickle (or slice into thirds). Claussen pickles are located in the refrigerated deli meat section of any grocery store. Nothing special here. Purchase your standard white onion and chop it. If you don't like the bite of your typical onion, try a vidalia. Vidalia onions have a smooth sweet flavor. For true authenticity, buy a red ripe tomato and cut it into wedges. We prefer a nice quality Beefsteak tomato. Do not chop your tomato or even think about cutting your tomato into slices! An essential topping for any Chicago Dog is the Sport pepper. These peppers are green, about 1-1/2 inches long and usually have a medium-hot taste. When Sport peppers adorn your Dog, they should be whole and never sliced. Don't make the mistake of using peppers that are too hot. Remember, a Chicago Dog is blending of all the toppings. No single ingredient should overpower the others. Our search for Sport peppers has been a little frustrating, but we found them (in Madison) in the ethnic food section at the Copp's on Junction Rd, at Woodman's and Gino's Italian Deli. Vienna Sport Peppers can be found at Jenifer Street Market. This blend of ground celery seed and fine-grained salt is often described as the defining ingredient of a Chicago Dog. Celery salt is usually available at any grocery store. Poppy Seed Bun Genuine Chicago Style Hot Dogs are traditionally served on a steamed poppy seed bun. If you can find them, "S. Rosen's Mary Ann" hot dog Buns are the bun of choice and usually synonymous with Chicago Style Hot Dogs. Poppy seed buns are readily available in Madison. Mary Ann buns are sold at Woodman's, Copps and Costco. Copps appears to no longer regularly stock the poppy seed buns, but you can still get them if you ask for them a few days in advance. Costco currently only sells Mary Ann buns without poppy seeds. You can usually special order poppy seed hot dog buns at grocery stores that have their own bakery. In the Chicago area, poppy seed buns are available at most grocery stores including Jewel. If you can find "Mary Ann" buns, you are in for a real treat. Turano Bakery also has great buns. You can purchase S. Rosen's poppy seed buns online! Click Here for details. Click Here for a printer-friendly shopping list of ingredients for your Chicago Dog. Creating Your Chicago Dog - Some Assembly Required Now that you have gathered all of the ingredients and heated your Hot Dog(s), the time has come to create your Chicago Dog. The toppings are just as important as the order they are applied to the Hot Dog. The goal is to evenly distribute the toppings so you get a taste of each ingredient with every bite. Remember, dress the Dog and not the bun! Start out by placing your heated Hot Dog on the bun and add the toppings in the following order: - Yellow Mustard - Squirt the mustard directly on the Dog from one end to the other. We personally enjoy a zig-zag pattern. - Bright Green Relish - Add a generous amount of sweet relish. - Fresh Chopped Onions - Place onions on top of the Dog. The amount depends on your personal taste. - Two Tomato Wedges - The tomatoes should be placed along the crevice between the top of the bun and the Hot Dog. - Pickle Spear or Slice - The pickle should be placed in the crevice between the bottom of the bun and the Hot Dog. - Two Sport Peppers - Traditionally 2 sport peppers are added on top of a Chicago Dog, but the sport pepper is often considered an optional topping. Once again, personal tastes play a role. - Celery Salt - Sprinkle a dash of celery salt over the Dog. Click Here for printer-friendly instructions on how to assemble your Chicago Dog (PDF Format). Here is what the finished product will look like. Enjoy! Heating Your Hot Dog Remember, Hot Dogs are already cooked so all you need to do is heat up the Dog. Although there are many ways to heat up Hot dogs, Chicago Style are traditionally grilled, steamed or boiled. Our favorite method is to grill them. No matter which method you choose, remember, the goal is to heat the Dog and NOT cook it. The heating information listed below are general guidelines. For more heating ideas read the instructions on the package of Hot Dogs. Grilling - On a grill, place your hot dogs over medium heat and turn as soon as one side starts to brown. Watch your hot dogs carefully and turn frequently as they tend to brown quickly. Imagine your hot dog has a square shape and turn four times to brown all four sides. Two to three minutes on each "side" should be sufficient. Total heating time should be about 8-12 minutes. If frozen, heating times will be slightly higher. Steaming - If you really want to try steaming, use a Dutch oven fitted with a steamer rack, or a bamboo steamer. Fill the pan with enough liquid to reach just below the steamer rack. You don't want liquid bubbling up onto your hot dogs. Bring your water to a boil, reduce heat to low, add your Hot Dogs to the steamer basket. Cover tightly and steam 5-7 minutes or until Hot Dogs are heated through. To steam your buns, stack them on top of the dogs in the last two minutes of cooking. BE CAREFUL NOT TO BURN YOURSELF ON THE STEAM. Boiling - If you must boil your Hot Dogs, Fluky's (a Chicago institution since 1929) recommends these instructions for heating your Hot Dogs: Bring the water to a boil, turn the water down until it stops boiling, or a slight simmer. (DO NOT COOK HOT DOGS IN BOILING WATER). Place desired number of hot dogs into water and cook uncovered for 20 minutes. Mark Reitman of Hot Dog U recommends the following: If you're boiling it, don't add the meat until the water has already come to a boil, then throw it in and simmer for about five minutes - until the dog floats. Microwave - Hot dogs can be successfully heated in the microwave oven. However, heating a Chicago Dog with microwaves is not necessarily recommended and should only be used if no other heating method is possible. Many microwave ovens have a "Fresh Roll/Muffin" setting that is great for steaming fresh buns. If you must use a microwave oven to heat your Dog, it is recommended that you first thaw the Dogs (if frozen) in the microwave and then heat them. Since microwave ovens vary in power and features, you may have to experiment with cooking times. The Paupered Chef website has compiled our information and put together a nice page on how to make a Chicago Style Hot Dog. Click Here to check out their page. We have had many requests to make this page available in a printer-friendly format. If you print this page, it should format nicely on your printer. From Our Test Labs... Since the choice of toppings is critical to the successful creation and enjoyment of a Chicago Dog, we decided to review a variety of toppings and choose the brands we think are the best. We also spent a lot of time taste-testing many of the hot dog brands available at your local grocery store. Click Here to visit our test lab and see our test results.

Nine West’s debut fragrance “Love Fury” is now available but sadly there’s no counter date for Australia. Described as a woman\’s craving and insatiable desire for fashion and obsession for shoes is matched only by her addiction to fragrance which I have to agree, we are tres obsessed with fragrances here. The Love Fury fragrance and exclusive Love Fury pump, illustrating the parallel synergy of footwear and fragrance as powerful weapons of attraction is available as: - Eau de Parfum: 3.4 fl oz / 100mL $55.00, 1.7 fl oz / 50mL $45.00, 0.3 fl oz / 10mL (rollerball) $18.00 - Body Lotion: 6.0 fl oz / 175mL $18.00 - Footwear: Love Fury Pump $89.00 Will keep you posted on an Australian release date but if you’re travelling and have picked up a bottle, let me know what you think! Your Pop Culture Gossip Girl

Senator's visit mixes politics, business U.S. Sen. Ron Johnson's workplace at the nation's capital is 1,100 miles from Interfacial Solutions' River Falls research/manufacturing facility, but Johnson was like a member of the family when he visited with founder Dr. Jeff Cernohous and his employees the morning of Friday, April 5. It was probably more about the plastics business than political synergy. Johnson, who turned 60 on Monday, had never held elected office before selling his interest in Oshkosh-based PACUR, LLC, a polyester and plastics manufacturer, to run against three-term incumbent Russ Feingold. Johnson's former company manufactures plastics used, in part, for the packaging of medical equipment and supplies. Interfacial's staff provides research and development for outside customers as well as having invented several unique polymer-based products themselves. Cernohous and partners Gregg Bennett and Brian Szymanski met privately with Johnson for about 15 minutes, then gave a quick tour of the plant before the senator strolled into a training room to talk with employees. Johnson earlier had spoken to a group assembled at WESTconsin Credit Union in Hudson. Later Friday morning he addressed a gathering at Pierce-Pepin Electric Coop in Ellsworth. Johnson told the 25 men and women at Interfacial his dream would be to get voted out of office for helping solve America's debt crisis. He cited the staggering $575 billion annual cost of Medicare as the poster-child for government entitlement programs. "Paying in $1 for every $3 spent is not sustainable," he said. Noting that the program was begun when average life expectancy was 62, today Americans are living much longer. "We're going to have to means test ... we're hemorrhaging cash." About a month ago, Johnson and 11 other Republican senators joined President Barack Obama for dinner at the upscale Jefferson Hotel -- near the White House. Johnson said if the American public could have been "a fly on the wall" that evening, they would have been impressed by the president's sincerity at wanting to find a solution to the nation's budget woes. That dinner came just days after Obama signed an order authorizing bureaucrats to begin across-the-board budget cuts (coined "sequestration") as required by the deal Obama and Republican Congressional leaders struck in August, 2011, in exchange for increasing the government's borrowing limit. When he got the chance to address the president that evening, Johnson told him: "I'm just a little voice, but it would be enormously helpful if you would utilize the bully pulpit of the presidency to express the true depth of the problem." There's many more facets of federal overspending than just Medicare, the senator told Interfacial employees Friday. Many in Washington seem unwilling to address the massive deficit. "In business, you can't solve a problem until you've defined it," said Johnson. In Washington, officials just continue to "paper over the symptoms, layer upon layer upon layer." In addition, government intrusion into our lives has grown to the point it impedes our freedom, he said. America's staggering $16.7 trillion debt has grown larger than the nation's annual economic churn. Johnson advocates aggressively developing the nation's energy resources, including building out the controversial Keystone pipeline to haul crude oil from Canada to refineries in the southern U.S. While he recognizes that fossil fuels pollute, America has the resources, technology and willingness to control emissions, unlike many Asian nations. The senator forecasts that "Obamacare is going to be an utter disaster," noting that the subsequent medical device tax created to help pay for it has already cost American jobs and has resulted in manufacturing going overseas. "Elements of the solutions can be pretty obvious, but gathering the political will to (execute) will be the challenge," he said. "I ran to take tough votes," said Johnson, adding that if he gets defeated in 2016 because his constituents are unhappy, so be it. "Not every solution can be popular when the problem is so incredibly severe," he said. Just as parents wouldn't intentionally accumulate consumer debt with intentions of pushing it off on their children to pay back someday, the government shouldn't either. "It's fiscal mismanagement, but that's what we're doing." For more information, Johnson encouraged area residents to visit his website, www.ronjohnson.senate.gov.

A while back, I posted on Twitter and how I didn't "get" it. In short order, I got several comments advising me to stick with it and telling me that the secret lay in the matter of friends. So I have stuck with it and I have made some friends (only now the terminology has changed, so I'm following people and little over half of them follow me in return). I began to see a few benefits and encouraged my colleague Mark Berthelemy to sign up. His immediate reaction was about as negative as mine had been. Reading his post, I realised that I have warmed somewhat to the medium, but I still have some issues. I have been reflecting on these because I will need to write about my Twitter experiences for my dissertation. Here are some of my thoughts: Picking up useful pointers Many of the twits will include links to interesting things they have seen or read online. This can be very helpful. Also, they are inclined to publicise their hot-off-the-press blog posts, which is also helpful - especially if the twit isn't someone whose blog features in my aggregator. Getting me thinking Some of the conversations that take place stimulate my thought processes, resulting in material added to my MA submissions or this blog. Choosing whom to follow Some of the folks I have encountered follow literally thousands of people. I don't get that. How can you possibly keep track of that many conversations in any meaningful way? On the other hand, because you generally only see the tweets of the people you follow, if one of them follows someone else and engages in an exchange with that person, you only get to see half the conversation. So, you are then faced with the choice of ignoring those tweets (which can sometimes seem very interesting) or adding the person on the other end of the conversation to your list of people you follow. Before you know it, you could end up with thousands. I have decided to restrict the people I follow to learning professionals and related types. Although the conversation is often about things far removed from work, keeping those channels open makes for a more personal relationship. You really begin to feel that you know some of these people. Following and being followed Related to my previous point is the issue of imbalance between followers and followees. I guess it's a sad reflection of my online popularity that I follow 34 people, but only 21 people follow me. I can cite a specific example of where this has been a problem: recently Dave Warlick tweeted something that interested me. Because I follow him, his message showed up on my screen. I immediately responded with a question or observation, forgetting in my eagerness, that Dave doesn't follow me. While my tweet, having been directed at him (by means of the @ symbol before his user name) will automatically appear in his replies folder, very few twits bother with this folder. In fact, there was an exchange just today where two people were complaining about the inconvenience of messages that appear in their replies folders from people they don't follow. They were on the opposite end of the inconvenience. One night, when I went to bed, I left my mobile phone on the dining room table, which is directly below my bedroom, with a lot of open plan and no closed doors in between. Well into the night, I could hear the gentle buzz of my phone receiving tweet after tweet. This was very symbolic of the way it goes. Every morning I wake to find well over 30 messages in my inbox. Then, all through the day, the tumbleweeds blow across the space. I follow a few Aussies, a few in the UK, a scattering from elsewhere and a much larger number of North Americans. They're all tweeting when I'm asleep, and the Aussies are sleeping when I tweet. Funnily enough, the Aussies seem to have more overlap with the North Americans than I do. Because of the synchronous nature of the exchanges, there's little point in going back over the stuff that went on while I was snoring, and it's really frustrating when I spot that one of the messages was directed specifically at me, which means I have missed out on the chance to see how an exchange can develop. So, while I have discovered some value from Twitter, I still feel somewhat on the outside of things. I have yet to identify whether it's just a case of everyone else being satisfied with the status quo, or whether other people's experience differs from mine - hence their higher measure of satisfaction. Monday, July 30, 2007 A while back, I posted on Twitter and how I didn't "get" it. In short order, I got several comments advising me to stick with it and telling me that the secret lay in the matter of friends. So I have stuck with it and I have made some friends (only now the terminology has changed, so I'm following people and little over half of them follow me in return). Posted by Karyn Romeis at 6:54 pm Friday, July 27, 2007 Like many inhabitants of this space, I have an aggregator that dishes up to my virtual doorstep new posts that appear in all the blogs to which I subscribe. Over the past two years, that list has changed and will no doubt continue to do so. I try to keep it small enough so that I can actually assimilate all the new material to some degree. There are several other blogs that I read on an ad hoc basis, but these are the ones I read every day. On the list are a few sites totally unrelated to my job or studies, just because they inspire me. Among these are: Urban Army. Gordon Cotterill is an officer in the Salvation Army who encounters some very interesting characters and handles situations with grace. Creating Passionate Users. It has been almost four months since the zany, whacky, articulate Kathy Sierra was hounded out of the blogosphere by cyberbullies. I remain subscribed to her feed in the hope that one day she'll feel able to venture out into the open again. Calvin and Hobbes. This is an unofficial site and I have no idea if Bill Watterson has sanctioned the use of his material in this way. Having read biographies I think it highly unlikely, and I admit to occasional pangs of guilt that I might be contributing to an offence against someone I greatly admire. Nevertheless, a daily dose of this gobby 6-year-old and his stuffed tiger starts my day off on the right note. The Dilbert blog. I used to subscribe to the Dilbert cartoon, but that feed broke and, in trying to restore it, I discovered Scott Adams's blog. His irreverance, his complete disregard for political correctness and his off-beat ability to see the ridiculous in everything makes a valuable contribution to my reading. I also read a few blogs associated with the formal education within what Americans refer to as the K-12 (kindergarten to 12th grade) range. Although my learners are all adults, I suspect that there is more commonality between the way adults and children learn that many corporate learning professionals realise. These include: Cool Cat Teacher Blog. Vicki Davis is like a dynamo. She seems to have so much on the go at once and seems to maange to do it all with unflagging zeal and passion. She very quickly became an edublogging force to be reckoned with. Vicki is someone I would love to meet f2f. edu.blogs.com. Ewan McIntosh is based in Scotland and what I read in his blog about the strides the education system is making there, makes me wish I could find an excuse to move my family north of the border... the dreadful weather notwithstanding their dreadful weather! teaching.mrbelshaw.co.uk. Doug is one of the youngest bloggers on my list: a mere stripling of 26, busy with a doctorate and passionate about the way history is taught in the UK. The Thinking Stick. Jeff Utecht works at an international school in Shanghai, and faces a whole different set of challenges, among them the Chinese censorship. Like me, he feels that teachers need two different support mechanisms in including ICT in their pedagogical toolkit: technical support and maintenance and pedagogical support and mentoring. Artichoke. I don't know Artichoke's real name. She is the newest addition to my aggregator. She is erudite, well-read and articulate and has a way of piecing things together that one didn't realise belonged together until she expounded on them. Often way over my head, but that's the point - to get around people who are smarter than you are and grow as a consequence. The largest section of my aggregator is given over to a section I call "learning and related". These include: 2¢ worth. This is Dave Warlick's blog. Dave is a popular speaker (with good reason, I understand). He doesn't have a very high opinion of his reading and writing skills and his blog does show occasional signs of dyslexic tendencies. I mention this only because I am a nitpicking pedant who is normally irked by spelling errors. However, what Dave has to say so vastly overshadows any irritation I may feel. Not only has he taught me a great deal about learning, he has taught me to get over myself! bgblogging. Barbara Ganley works in higher ed. Although her posts are thin on the ground, they are well waiting for. Brandon Hall Analyst Blog. Janet Clarey is a fairly recent addition to my aggregator, largely because she is a fairly recent entrant to the blogosphere. Much of her material has direct bearing on my day job. Added to that, she is the mother of sons, so we have that synergy, too. She is someone else I'd like to meet f2f. Christopher D. Sessums :: Blog. Chris Sessums sometimes blogs as if he is handing in an academic paper, often complete with references at the end of a post. Other times, he is all passion and informality. He is well informed and well-read, and makes for an interesting read. Cognitive Edge. I haven't been reading this blog for long, but thus far, my view of Dave Snowden is that he is irascible. Occasionally controversial, which is what we like, after all. Connectivism blog. It's probably not too much of a stretch to call George Siemens one of my de facto learning gurus. I like the way he thinks, the way he explains things and his humility towards both his growing fame and his detractors. I really recommend his online conferences. Dave's Educational Blog. Dave Cormier is, well, Dave Cormier. He doesn't blog that often, but when he does, you get the impression that he writes as he speaks and speaks as he thinks. I can relate to that. Donald Clark Plan B. Donald is a dyed in the wool iconoclast. Sometimes I get the impression that he sits down and wonders, "Hmm, which sacred cow can I desecrate today?" Sometimes I agree with him, sometimes I don't, and sometimes I get downright annoyed, but it all makes for interesting debate. e-Cippings (Learning as Art). Mark Oehlert is very into his games and simulations, a field I have had little insight into. Nevertheless, his views on learner engagement gel with me. EdTech Roundup. This is another Doug Belshaw blog, where Doug highlights stuff that has stood out for him recently. EdTechUK. Josie Fraser is altogether too quiet nowadays! eLearning Technology. Tony Karrer's focus is on corporate learning and he has insight into the drivers of this world. This means that we often face similar issues and challenges, although he is a CEO and I'm just a li'l ol' learning designer. Tony's photo on his blog looks a bit like George Clooney - check it out for yourself and tell me I'm wrong! Harold Jarche. Harold went solo some time ago and deals with a whole different set of challenges. However, many of the issues on which he advises his clients are very similar to those my own clients face. Not only that, but Harold has sons, too, so there's that synergy thing again. To be honest, I just plain like the guy and would add him to the list of people I would like to meet f2f. In the Middle of the Curve. Wendy Wickham is about the most transparent blogger I have ever encountered. You always know exactly what she is working on, what her challenges are, how she feels about them, what she's learning or has learned. I'm not sure how she gets away with it, to be honest (my employer would have a conniption), but I'm glad she does! Informal Learning Blog. Well duh! Is there a learning professional in the blogosphere who doesn't read Jay Cross? Learning Conversations. This is the blog of my friend and colleague Mark Berthelemy, who introduced me to blogging (yup - it's all his fault!). Mark often deals with things that make me go huh? He tends to use his blog to point at stuff he's found interesting or useful, or as a reminder of how to do something he's just learned. Occasionally he gets up onto his soapbox and vents his spleen, and those are my favourite posts on his blog, because they give a small peep into his passion. Occasional rants. Patrick Dunn seems to see the world much as I do, so I probably look like Noddy as I read his posts. I suspect we all like to reassure ourselves by attaching to like-minded individuals. No? Just me then! OLDaily. As with Jay Cross is there a learning professional in the blogosphere who doesn't read Downes? This blog tends to be almost like an aggregator, full of points and brief opinions or reactions. He has another one called Half an Hour, where he calls it like he sees it, and at far greater length. And that's yer lot, except for a few online journals that I might cover another time. Posted by Karyn Romeis at 10:01 am Thursday, July 26, 2007 This post is largely aimed at primary school teachers and the parents of small children. When I was a kid, there were things I didn't know. I asked questions, of course, but, because they didn't realise why I was asking, my parents' answers didn't fully address the issue. Of course, I'm not saying for a moment that every child has the same blank spots, but perhaps mine might set you thinking about those of the children in your class. Days of the week. There was no TV in South Africa when I was a child, and we were not a church-going family so the different days of the week had no discernable distinguishing characteristics. The only difference was that some days my parents went to work and some they didn't. Later it was a case of some days I went to school and some I didn't. I didn't realise that there was a fixed pattern to this, and would ask my parents each morning whether it was a school day or not. I'm sure my parents would say things like, "Yes, it's Monday" or "No, it's Saturday" Even so, I had no way of knowing that those names were not simply made up by my parents. I honestly believed that they made the choice each morning as to whether or not they would go to work and I would go to school. When your kids ask you questions that pertain to the passage of time, don't assume that they've got it sussed. Take the time to talk it through with visual aids. Funnily enough, this one cropped up again recently when I popped into our little local post office (which is at the back of the local pharmacy) and found the counter closed. I asked the pharmacy assistant whether the post office was closed for lunch and she said irritably, "It's Wednesday afternoon!" Apparently "everyone" knows that the local post office closes on Wednesday afternoons. How silly of me! People's names. We spent an enormous amount of time on the beach during my childhood. This was the days before concerns about skin cancer and the beach was free. I would spend hours playing with some new friend and, when I returned to my mother for lunch, she would ask, "What's his/her name?" Every time. I didn't know. I didn't care. It wasn't important. You didn't have to know a person's name to be able to build a sandcastle together. If the situation cropped up where one of you needed to know the other person's name, you asked. There was another aspect to this. In those days, it wasn't the done thing for teachers' given names to be known to the children (I understand that this is still the case in Australia), and it was the cause of much giggling if the children found out that Mrs Greene was actually called Heather. This culture kind of followed me home. Because my parents had split up when I was quite young, I didn't have exposure to two adults calling each other by their given names around the house. As a consequence, I wasn't quite sure whether it was okay that I knew that my Mom was called Barbara. I used to ask her repeatedly what her name was. I reasoned that if she said her name out loud, that would mean she had given her permission. However, my mother thought I was just being silly, so she hedged the question, answering "Methuselah" or some such. Years later, when I explained the situation to her, she realised that if she had just answered the question honestly, she would have relieved herself of a lot of irritation! Sometimes all you need to do is take the question at face value and answer it. There is, after all, no such thing as a stupid question! Doing wrong v committing a crime. What gave rise to this whole post was my 15 year old son asking me if adultery was a criminal offence. It reminded me of my dread as a child that my mother would get sent to prison, leaving me to fend for my much younger sister all alone. I would plead with her not to let the police take her away to prison and she would assure me that people only got sent to prison when they had committed a crime, which she defined in answer to my question as "doing something very wrong". Well, this was in the bad old days of apartheid and I saw how my Zulu nanny lived in dread of the police. If one of their vans appeared, she would hide. I had also seen how the neighbourhood drunk - an elderly Zulu woman who gloried in the name Bababa - regularly got carted off to prison in the paddy wagon when she had been singing loudly in the street outside. I also knew that my mother did some very wrong things. She swore sometimes and she shouted when she was cross. Once she threw her hairbrush against the wall and it snapped. These must surely be crimes and, if the police only knew about them, she would be right there with Bababa the next time they came by. Sometimes fears need to be tackled head on. Find out why kids are afraid of whatever it is and see if a reality check doesn't help. That they are loved. My mother came from a very tightly buttoned family and has never been able to put her feelings into words. As a consequence she never told us that we were loved. I used to hear other parents telling their children that they loved them, and wondered whether there was something wrong with me. Once I even asked my mother if she loved me. She was irritated. One simply did not discuss such things, and she told me not to be so silly. What she meant was that I should not be so silly as to ask, not that I should not be so silly as to imagine that she might love me. However, this was how I interpreted her answer. Of course, I have erred to the other extreme and tell my children I love them countless times a day. My younger son asked me about this when he was about four. I explained that I had never heard those words from my mother. As it happened, we were driving to visit my Mom at the time, and the first words out of his mouth when he climbed out of the car were, "Granny, why haven't you ever told my Mommy that you love her?" My mother said "I assumed she knew." To this day, my mother has been unable to frame those words. The closest she came was after a recent crisis when it came out that I had felt unloved as a child and she emailed me to say that she did love me and always had. For goodness sake, tell your kids you love them! Three monosyllabic words... you can do it! That parents break the rules, too. When I was a kid, no adult would ever dream of apologising to a child, even if the child had been grievously wronged. However, were I to try the same thing, I would be in for serious punishment, and reminded how wrong such behaviour was. Often adults would say that something was wrong, even though they themselves did whatever it was (smoking, or swearing for example). I found this confusing. Rules never seemed to stand still, and I always seemed to be breaking them. Just when I thought I had it all figured out, it would change again. With our own children, we have decided to keep short accounts. When we wrong them we apologise. What's slightly more difficult is to remember to explain the situation when they have witnessed an infraction, but were not directly affected by it. When they were too little to figure it out for themselves, we would explain that the rule hadn't changed, just that we had broken it this time. We made it very clear to them that we tried to "behave" but that, just like them, we blew it from time to time. When an adult breaks the rules in a child's presence, and the child is later seen to imitate the action, don't assume they know they are doing wrong - they may think the rule has changed. There are several more, but it's time I got down off my soapbox, now. Please don't think I'm implying that I've got all the answers or that I'm the perfect parent (I wish), but we learn from each other in this space... Posted by Karyn Romeis at 4:11 pm George Siemens has a post on his Connectivism Blog about peer review. So much of it echoes my own views and experience. He starts off his post by citing a situation in which a Masters' student in Lisbon related to him the skepticism of her assessors of the theory of connectivism and of Knowing Knowledge because of the lack of peer review. Expect for the location, that student might well have been me. As I stated in my Ardent Student blog in February: "I struggled to get approval to submit a paper on Connectivism recently, because there is little or no peer reviewed writing on it in any of the recognised journals. I’m obviously not built for this world, because my immediate response is “So what?” I don’t understand why someone else needs to have written about something before I can write about it!"It is worth noting, however, that I finally did gain approval for the assignment and I was delighted by the feedback that my lecturer's curiosity had been aroused by my submission and that she was set to explore the matter further out of personal interest. Score one for the rebels! As a Masters' degree student, I find that there is this requirement always to reference peer reviewed work in my assignments. One of my profs tells me that it can take two years from the time an article is accepted by a publication to the time it appears in print. Two years?! By that time, things will have moved on, the thing you're writing about will be passe and something else will be flavour of the month. As a consequence, I find myself making tenuous links to material that is peer reviewed. So, if I'm writing about connectivism, I will dig out peer reviewed material about behaviourism, constructivism and cognitivism. I might even include a reference to the gestalt theory, which shares with connectivism an emphasis on pattern recognition. But I still feel as if I'm window dressing. It's bad enough for the shorter 3000 word assignments, but it is really going to be a problem for my dissertation, which must be 20000 words long and must include a hefty amount of literature review. The project will dominate my life for a period, so it must be something of consuming interest to me, but as I noted, "How can I possibly write about something that matters to me if I’m restricted to a topic with an adequacy of been-there-done-that from recognised luminaries?" Ron Lubensky commented that he was experiencing the same frustrations. Like George, I kick against the air of elitism that seems to go with the concept of peer review in academia. As he says: "Peer review is based on the assumption that a handful of experts are capable of validating ideas." There is a clear line between professional journals and peer reviewed journals, and it seems to me that the attitude of academia towards the former is one of faint distaste, in much the same way that broadsheet readers feel about tabloids. I can't help wondering whether the term hasn't been hijacked, like so many other learning terms, to serve one agenda. George touches on this in relation to the ongoing fragmented online conversation about connectivism. I tend to agree with him, after all - should "peer reviewed" not mean reviewed by one's peers? I would imagine that a few peers, handpicked by a publication as being tuned in to that publication's ethos, are less objective and therefore less reliable than a plethora of self-appointed peers who happen upon the material in the pursuit of their own informal , lifelong, lifewide learning journey. Coincidentally, in a recent paper, I touched on this point in respect of George's book Knowing Knowledge, saying: "On the flip side, as mentioned before, not much of the material I read is peer reviewed in the academic sense of the phrase – most of it has, however, passed the acid test of the online community which is ever willing to make its criticisms known.There is so much more I could say on this subject, but most of it would simply be a repeat of what George has said in his post. I will say that it's nice to find that I am not alone in my wilderness, but this doesn't change the fact that I am going to have to toe the line, at least until October next year if I evere want to write the letters MA after my name. And, shallow as it may seem to confess it, after all the work I'm putting in, I am determined that I will come away with at least that much to show for it! An excellent example of this is the book Knowing Knowledge by George Siemens..." Posted by Karyn Romeis at 10:38 am Monday, July 23, 2007 Scott Adams has posted today about people making ego-driven decisions that damage their careers. He starts with a personal anecdote of the painful experience type, and ends with the post with the question "Has your ego ever driven you off a cliff?" I've been toying with the idea. Of course, I have made many ego-driven decisions in my personal life, and the best decisions I have made are not among them. However, if I think purely of my career... I made the decision to go freelance when my children were small so that I could work around them. Some people may see that as a self-sacrificial choice, and I think I saw it so myself. But perhaps it was my ego that told me my children would be better off with me than at a nursery or childcare centre. I have had a few opportunities along the way to move into management. In every instance, the move would have meant moving away from direct contact with learners, so I refused. Would ego have dictated that I take the opportunity to become a boss? Or was it ego that kept me in the classroom where I had unshakable belief in my skill? Two years ago, I made the move from the classroom into my current role as a learning designer. I wanted to increase my exposure to e-learning, and my previous job afforded only such opportunities under this description as I had forged for myself in an almost underhanded fashion. Was it ego that once again directed me away from management towards the opportunity to gain more skills? Recently, working through some content resources on a quest for some material for a client, I found a publication on "managing the maverick" and found myself fairly accurately described. Is that what I have become? A maverick? Or is it merely my ego that attempts to attach a label that implies that my lack of progress up the hierarchical ladder is a Noble Thing? Does this constitute having gone over a cliff? What a morbid thought! Posted by Karyn Romeis at 3:56 pm Sunday, July 22, 2007 A recent Twitter exchange between Lisa Durff and myself made me think that perhaps I should explain this. I was bewailing the fact that my sons are now on their summer break, but that neither my husband nor I are able to take leave to spend time with them. Lisa's response was simple: become a teacher! So why don't I do/haven't I done just that? Well, it's like this: Years ago, having been advised by my school guidance counsellor that I showed above average aptitude for most things and exceptional aptitude for nothing at all, I was taken to see a student psychologist at a university. He subjected me to a battery of tests and advised me that my scores showed a remarkable aptitude for teaching, but almost zero for working with children, which was what had probably skewed the scores in the tests taken at school. It confused the poor man, too. He had no idea what to make of them. He suggested I become a psychologist and take over his job when he retired. Looking back now, I can't see how he didn't make the connection that I should teach adults. At that stage, I didn't even realise adults received any teaching. I thought it was school, university, work, end of. It never occurred to me (or him, apparently) that university students were not children, and I knew nothing about personnel training (as it was known then). Fortunately I ended up there anyway. I was born to teach, to impart, to enable, to empower. It gives me such a buzz to see that light come on. If you're a teacher in any guise, you know what I mean. Throughout my career, I have been privileged to work with people who volunteer to be there. There has usually been a waiting list for my sessions. To me, learning is a gift, a joy, a stepping stone, a door - I have no desire to try to teach people who don't see it that way, people who attend my sessions because the law says they have to. And increasingly in the UK, my impression is that high schools are full of disaffected kids who have completely and utterly fallen out of love with school. My sons regularly come home with stories of how some or other child has sworn at a teacher and/or completely disrupted a lesson but that the teacher was powerless to take action because of constraints upon them. It seems it is easier to suspend a good teacher than a bad student (note: I deliberately did not say bad child) I struggle with the concept of the volumes of just-in-case material that gets dumped on kids without any explanation as to relevance or value. Where's the motivation to learn stuff that just seems to you to be useless. I can't help feeling that there has to be a better way to do things. I spent two years teaching in a FE college and the stringent curriculum and assessment requirements stifled me. I really believed in my own ability to identify a learner's needs and meet them, and suffocated under the dictum to teach them all the same material. I can't accept that a single curriculum that must be followed by every child in the country can possibly be appropriate (why for example do Y10 kids study Romeo and Juliet every single year - not only did Shakespeare write many other plays, some far superior to R&J, but there is a plethora of other English language playwrights to schoose from!). I might be an idealist, but, if a child loves snooker, say, why not use that to teach vectors, principles of motion, geometry, trigonometry? My heart breaks as, with every passing year, I meet an increasing number of ex-teachers (some of them extraordinarily talented) who have left the field in their droves because the reality failed to live up to the dream. They are not a good advertisement for the profession, to say the least. From where I sit, teachers seem to be pretty disempowered as a group of people. For the two years I worked in FE, I found the attitude of management towards teaching staff was not terribly different from their attitude towards the students. It was very much a case of telling, rather than discussing. I have since gained some insight into the way in which CPD is conducted for teachers in the UK, and have noticed that this seems to be the approach there, too. Bring 'em from far and wide, pack 'em in to a room and then tell 'em at great length what they should be doing and how to do it. Tell 'em, tell 'em, tell 'em. Never mind the fact that, gathered in that room is a wealth of invaluable experience and anecdotal input that should be drawn out and shared. Mind you, having said that, Scotland seems to have the march on England, and their teachers appear to be far more empowered than south of the border. One conversation that keeps coming up is "what is education for?" Until we can get that one sussed, I can't see myself on the inside of the formal education system. I don't advocate a system that teaches only work-related skills, but whatever else we teach them should still add value... and be enjoyable, if that isn't too tall an order. I don't wish to give the impression that I will never teach in a school under any circumstances. What I will say is that the circumstances would have to be very different from the way they appear today. Mind you, having said all of that, I wouldn't mind having a go at the new schools in Merseyside! Posted by Karyn Romeis at 10:51 pm Saturday, July 21, 2007 You know how one of the challenges we face in the provision of learning is to ensure that the message doesn't get scrambled in transition? Well, here is a little anecdote to illustrate just how easily it happens. Last night, over dinner, my husband mentioned something to do with Wyatt Earp. My elder son asked, "What's a wire turp?" My younger son asked - complete with hilarious mime - if a "wire twerp" was the guy who twists the barbs around barbed wire. It all took less time that it has taken me to type this paragraph and had me crying with laughter. Even today I occasionally bump up against something I completely misunderstood somewhere along the way in both my formal and informal learning, and find myself wondering how I came to such a ludicrous conclusion and then managed to bury it where subsequent evidence to contrary failed to reach it. I wonder if a few well-placed questions might have identified my misconceptions in time to straighten them out before they became so well bedded down. Just because a person thinks they have understood something is no guarantee that they have! Posted by Karyn Romeis at 11:39 pm My friend and colleague, Mark Berthelemy is working on a dissertation in the home stretch towards an MEd degree. He is researching "the salient characteristics of those people or organisations whose websites form the hubs within a learning network". Please consider swinging by his post for further explanation and to complete his survey. Posted by Karyn Romeis at 11:35 pm Wednesday, July 18, 2007 There used to be a question that people asked about food: Do you live to eat, or eat to live? I know people who eat to live. Food is fuel that keeps the body functioning. I'm not one of those, and I don't understand the mindset. I love food just for its own sake. The tastes, the smells, the textures. The companionship over a meal. Good food, good wine, good fellowship - only heaven can be better! Sometimes, when I feel I would like to shed a few pounds, I wish I could be more like those with a utilitarian approach. Oh, and by the way: I am not a blob - never have been - and know many other "foodies" who are perfectly average in size. So how does this relate to learning? Well, it's not a huge leap: do you live to learn or learn to live? Do you view learning as something that is a means to an employment end? A stepping stone? A neceesary evil that you escape the moment you turn 16? Or is it a pleasure, a delight, an ongoing process of enrichment, a door to new delights? Don't answer that - no-one from the former category is reading this post! The issues raised in George Siemens's post We are not neutral gave shape to some of the more formless thoughts that have been milling around in my head for a while. Thoughts fed by discussions that keep cropping up in unrelated places, such as the recent FOE2007, which generated a discussion thread called "What's education FOR?". While I do hope to see education becoming more relevant to the modern world, and better preparing people for life after school, I also believe that there is space for learning that serves no purpose other than to bring pleasure (see my comment on George's post), and I am saddened to see all those unaccredited programmes disappearing from adult ed centres. Posted by Karyn Romeis at 11:45 am You have to read it quickly... the title of this post, that is. An email from Tony Karrer this morning alerted me to the fact that I have missed my second blogoversary earlier this month. On 4 July 2005, I started this blog. Looking back over some of the early posts, I cringed. But it's a great sign of the effectiveness of this medium that in the space of two years my practice and views are so transformed as to be unrecognisable. Posted by Karyn Romeis at 10:52 am Tuesday, July 17, 2007 After 8 years, I still find it weird dealing with an academic year that ends in July. Chatting to teachers about "next year" when they actually mean later this year. I can't get used to having two "next years" per year. My own school years were spent in a place whose citizens are likely to be found on the beach on Christmas day, so the long summer holiday between academic years coincided with the end of the calendar year. And, since my birthday falls in December, this seemed to make it all even neater - although it did mean I wasn't able to birthday parties as a child (altogether now: aww!). So here we are, in July and my children are in the final week of the school year. As I have posted before, it has been a stressful year for our younger son, and for us as his parents, but his first year of high school is behind him. It remains to be seen if things will improve for him next year. Since he will have increased opportunities to participate in performing arts, and the school is an accredited performing arts specialist college, we are cautiously hopeful. Our elder son has discovered that he needs to work harder in order to achieve the results his potential warrants. With his GCSEs next year, he really needs to make the effort sooner rather than later. He seems slowly to be figuring that out. At their school, the last three days of each year are called activity days. The kids get a choice of activities in which to participate. These range from a very expensive trip to France, to recording your own single, to sporting and/or craft activities on the school premises which are free. My elder son's selection sees him at one theme park today, another tomorrow and the last day is spent bowling. My younger son has opted for three days of golf tuition at the local golf course. The activity days seem like a great way to end off the year, but the selection process is quite stressful, since there are financial considerations. We placed an upper limit on what we were prepared to pay and suggested that our boys use their own savings if they wanted to go above that limit. Fortunately, there was a decent selection of activities within that price range. What it must be like in single- or no-income households when those forms come home, I can't begin to imagine. Last week, my younger son received a special invitation to a pool party for those with excellent reports. This, shortly after we had received a very snotty letter from one teacher about his level of commitment, his attitude, the quality of his work. His report was indeed excellent, so we now have no idea what to make of the teacher's letter. Very confusing. Of course, the academic year for my MA course has drawn to a close as well. Five modules effectively behind me. However, I have two assignments to write over the summer break, so the concept of a "break" is somewhat moot. Because the programme is modular, the emphasis is more on trimesters than on academic years, so the significance of the end of this trimester gets hardly any more notice than any others, and the two-year-ends-per-year issue is less noticeable. Since I don't work in the education sector, I don't automatically have a six week break to look forward to now. From my subjective position, two assignments seems a far taller order for me when I have to continue with my day-job than for my classmates - although it does seem a shame to have to face writing assignments when you're supposed to be on holiday, I guess. It's a strange thing, this, for a foreigner from the southern hemisphere. The chronologies of the various aspects of my life are out of synch with one another. The year has ended, yet it has not. The summer holiday is here, but there are no important public holidays to look forward to, no business closures, no pauses (not to mention the fact that the weather seems not to have got the memo that it is, in fact, summer!). I wonder if people like Ron Lubensky felt similarly out of step when moving from the northern to the southern hemisphere. Posted by Karyn Romeis at 10:21 am Monday, July 16, 2007 I spent last week at a non-work-related conference, so I was somewhat out of the loop. I did check my aggregator every day, admittedly in skim mode, but I marked a few posts for later, more leisurely digestion. I spent a little time today catching up on those. I also caught up with conversations to which I had previously contributed - I don't like to fire and forget my comments, since sometimes people come back with valid points I hadn't thought of. In the process of this, I came across a thread I had all but forgotten in one of the communities to which I belong. The community is for training professionals, mainly in the corporate environment, and it includes fairly active discussion boards. The thread which jumped out at meagain today was started by someone who seemed a little miffed by the fact that some people in the community were asking questions without ever contributing answers to others'. Taking without giving, was how she saw it. This generated a fairly interesting and slightly heated discussion which included a call to name and shame the culprits. I was quite surprised. I often contribute my 2p worth to the discussion threads, although I have yet to pose a question. But I had never noticed this. I have noticed familiar names cropping up repeatedly with suggestions in the threads to which I contribute. One new young trainer even expressed guilt that he was one of the takers and wondered whether he should leave the forum! I can't claim to have been the only voice of (what I like to think of as) reason, but my contribution to the conversation was: As a trainer, I was born to teach, to enable, to empower - I don't look on it as a debt that needs to be repaid, but simply as a function of who I am. I don't mean to sound holier than thou, but in my experience, it is only wise to keep score in competitions. This is not one of those.It occurs to me, that some of the people whose blogs I read regularly might see me in the role of [name deleted]. None of them have ever expressed any resentment. So are they just being polite, or do their views align with those I expressed in my response quoted above? Since I have no reason to believe these people read my blog as avidly as I do theirs, I am listing and linking to some of the key players below to attract their notice (note: I read many more blogs than this, but these are the ones from whom I seem to take without giving in return). If you're on the list, I'd love to hear your views. If you're not, I'd still like to know how you feel in respect of your own readers... Whoever it was ([name deleted], maybe?) who asked whether he should stop using the site because he had never contributed... you stick around, mate - there's room enough for all shapes and sizes here! So, in alphabetical order of feedname: Posted by Karyn Romeis at 3:44 pm I've been away from work for a week at a conference, so I'm coming a little late to the party for the big question for July, which focuses on the selection of tools. I guess the way you tackle this one depends on your situation. If you are the in-house provider, you are less likely to rise up the popularity stakes if you keep changing tools. However, I work for an organisation which scopes, designs, develops and implements learning solutions for client organisations. In our situation, I would consider it unwise to go into a project with a pre-conceived idea of what tools you're going to use. The selection of tools must be dependent upon the learning requirements of the client, the characteristics of the audience, the system constraints. Once we have a picture of what needs to be known and the people who need to know it, we can turn our attention to how they are going to come by that information. We are privileged to have on our team, one person who dedicates his time to investigating new tools, as well as at least one person whose radar is permanently on full alert. So, when it comes to the discussion about the means by which to deliver the online components, they usually have a few good suggestions. But (for me, at any rate) the decision is always most heavily influenced by the profiles of the sort of people who are going to make use of a resource. If it doesn't work for them, they won't use it. And if they don't use it, no amount of argument about the sophistication/whizziness/flexibility of the solution is going to change the fact that it has been a (sometimes monumental) waste of money. In other words (with apologies to the makers of Field of Dreams), if you build it, and they don't come, you could lose the farm... Posted by Karyn Romeis at 11:01 am Sunday, July 08, 2007 I recently decided to stop keeping my family blog. In the days before the blog, I used to write what I called irregular periodic roundups, which went to family and friends ranging from New Zealand to the west coast of the USA and from Sweden to South Africa with several places in between. My tendency to write as I think with my tongue often jammed firmly in my cheek was apparently much appreciated by those with an interest in the family. As well as these, I used to keep up and ad hoc email communications with various members of this distribution list. My most prolific correspondent emailed me three times a week, the least prolific once or twice a year. Shortly after I started this blog, I thought it would be a good idea to create a family blog, too. I posted news updates, pictures, and various bits and bobs that would be of interest to the readers of my emails. At first, it worked well. I sent out occasional reminder links to the members of the distribution list from the irregular periodic roundups. One family member with paranoid tendencies regarding the internet refused to visit the blog in case it harboured a noxious virus, so I covered that base by setting up a feedblitz feed and forwarding updates to their email address. For everyone else, the novelty value kept things ticking over nicely at first. After a while I noticed one massive difference between blog posts and emails: people feel duty bound to reciprocate when they get news via email, they do not feel the same way about blog posts. Our inbox went from busy to deserted in a very short space of time. Not being very web 2.0 literate or proficient, few readers were brave enough to post comments, and the communication became one-way. Once that happened, they began to feel less involved and therefore less interested, and they gradually stopped reading altogether. In an attempt to re-establish the lines of communication, I have decided to revert to email. It's harder work, but then relationships aren't about minimum effort at the end of the day. If they're worth maintaining, they're worth time and effort. I suspect that in some cases, things have gone beyond the point of no return and before any more follow suit, I'm going back to 1.0. When 2.0 comes in the way of relationships it ceases to be a Good Thing. Posted by Karyn Romeis at 10:26 pm Friday, July 06, 2007 I read the Dilbert blog every day. According to Scott Adams, this means I am open-minded, intelligent and possessed of a good sense of humour. Thanks, Scott! Usually Scott's posts make me laugh. I don't always agree with his views (or the views he portrays - it's never 100% clear with professional jokers whether the views they are expressing are their own or a means to a funny end), but that's not the point. When someone lampoons the dearest principles of my heart, even I can laugh if it's well done, and in the case of the Dilbert blog, it almost always is. But today, I didn't laugh. Today I cried. He describes his experience on the first day of a Dale Carnegie course in public speaking (the emphasis is mine): One woman stood frozen in front of the group, unable to generate an intelligible word. Beads of sweat literally dripped off her chin. It was horrible to watch. She choked out a few words and returned to her seat, defeated. Our instructor came to the front of the room and said, “Wow. That was really brave.”By the end of the course, apparently, this woman was a skilled public speaker, as was everyone else in the group. I love stories like this. Stories of triumph against the odds. Stories where the underdog pulls it together. And it was. We all knew it was true. This woman had put her head in the lion’s mouth. Suddenly we all realized we had witnessed something important. We applauded. And it changed her. Each week, she managed a little bit more. And each week the instructor and the class recognized her achievement. So often we focus on areas of where improvement is needed. We forget to applaud what people did right. We do it with our children, with our students, with our employees. Sometimes all it takes is a word of encouragement, and you see a person stand a little taller, walk a little prouder, believe a little more. Years ago, I was asked to lead a worship band in our church in Cape Town. I was terrified. I have always sung - at one stage even semi-professionally - and I had been a part of the band for about 5 years, but I had never led before. The minister sat in the front row, gesticulating madly at me, trying to lead by proxy and it made a frightening situation even worse. After the meeting, he gave me a list of areas for improvement. A long list. I was a wreck. The next week, I was even more terrified than before, and the list of suggested improvements was even longer. After a few days, as an experienced trainer, I realised that I needed some positive input, so I proactively sought it. I phoned him and asked if there had been anything I had done that was right. His answer? "Well, your main problem is..." Needless to say, I stepped down forthwith. I returned to the comfort zone of vocalist for another leader, and there I stayed for years. When we moved to the UK, I didn't push myself forward as a vocalist, but the minister of our current church heard me singing during one of our meetings and steered me in the direction of the worship leader. I happily slipped back into the comfortable role of vocalist. I am a skilled follower. I watch the leader like a hawk and have learnt to read body language to the point that I am a safe pair of hands backing up a leader who wants to try something new and creative on the spur of the moment. Then, about a year ago, the leader asked me to take my turn leading a few meetings. My insides churned and I refused. I told him my tale of woe. He let it go, but not for long. Gently but firmly, he pushed me to challenge my beliefs about myself. Eventually I agreed to lead just to shut him up. Once he had seen me at it, he would let it go. In stark terror, I stood up on that Sunday morning while he, on the lead instrument, smiled encouragingly at me. The meeting passed in a blur. Afterwards he came to me and told that I was please to lead once a month from then on and so it has turned out. I still get really nervous before the meetings when I am leading, but once the music starts, all the nerves disappear and I can focus my attention on what it is that I am there to do. Never once has the current leader criticised me. Sometimes he will suggest that I do something a bit differently from the way I have planned. Sometimes he lets me figure out for myself that it isn't going to work. Sometimes I surprise everyone by making something work that shouldn't. I have become quite daring and experimental and often get the congregation doing things outside of their comfort zone. And all because someone said he believed I could. Posted by Karyn Romeis at 7:07 pm Okay this is a bit of showing off from me. Recently, Donald Clark (the eternal iconoclast) posted about Frumpy Netiquette. In this post he touched on the youth approach to spelling, grammar, et al. In the comments Clive Shepherd admitted to being a bit of a spelling and grammar pedant, and I have to confess that I am, too. I can't understand why correct spelling doesn't matter to the people, well... to whom it doesn't matter. I don't see this as being directly age related, either - one of my MA classmates is at least my age and couldn't give a hoot about spelling. She's not dyslexic, she just doesn't care. As long as the word can be read, as far as she's concerned, it's met its objective and she isn't going to waste time making sure it's correct. Anyhoo (sic), as an extension of my earlier post, I found all sorts of other quizzes on Mingle2. Apparently, I know 71% about movies in the last 25 years and my dead body (should I die today) would be worth $3775. More importantly, for a nitpicker: Posted by Karyn Romeis at 11:08 am So does that give me the moral high ground over Dave, or does it make me more mealymouthed? Don't answer that! Also via Dave, I tried to access Mingle2's blog-addiction indicator quiz thing, but it was offline for temporary repairs :-( Mind you, my colleagues would tell you I don't need a quiz - I am 100% beyond hope, help and redemption! Perhaps I'll have another go later when it comes back online... Posted by Karyn Romeis at 10:41 am Wednesday, July 04, 2007 Also nothing to do with learning - it's one of those days! Two things have contributed to my thoughts on this subject. Firstly, on 1 July, a ban on smoking in public places and places of work was introduced right across Britain. That means, no smoking in pubs or restaurants and no huddling in the doorways of offices for a quick fag break. As an ex-smoker, and therefore more offended than most by secondhand smoke, I am delighted. However, one of the backlashes is that more people are now smoking as they walk along the road, which means I seem to be getting more frequently assailed. On the other hand, one of the consequences of the ban is that shisha cafes are now having to close down. These are places where people go for the express purposes of smoking shisha through a hubble bubble pipe. Now I don't doubt that this practice is as bad for you as smoking cigarettes, but are we not removing people's freedom of choice (even stupid choices) if we ban these places. Tobacco is not illegal, smoking is not illegal. If a place exists purely for the practice of smoking a legal substance, surely everyone who goes there and who works there is aware of this (and probably a smoker themselves)? I wonder if this isn't taking it a bit far. The second catalyst for this train of thought came from Artichoke's post today (I tried to comment, Arti - but it bombed me out several times, so I gave up). In it, she touches on the issue of preventable diseases, the treatment thereof and people's attitudes on the matter. This is a subject I've thought about before, too. When George Best received a liver transplant, having destroyed his own through years of alcoholism, there was a general outcry. Doctors explained that he was selected on the basis of tissue compability, but I suspect that many remained convinced that other, less famous people on the list would have the same tissue type and would have made more worthy recipients. Certainly this view was expressed in my hearing on several occasions. There are often references to the treatment of people suffering from self-inflicted conditions. With the NHS strapped for cash, I suppose the issue of prioritising is inevitably going to keep cropping up. But I wonder where the line is on self-inflicted conditions. Years ago, I used to visit a young lad in hospital in Cape Town. He had been the South African junior trampolining champion and one day, he miscalculated, landed on his head and suffered a c2/3 fracture, resulting in paralysis from the neck down. Self-inflicted? According to the staff there, statistically the most likely ward mates for this young man were young male rugby players aged between 18-24, playing forward positions. Newly endowed with the full body weight of an adult male and not yet possessed of the degree of self-preservation that came with age and maturity, these young men were at the greatest risk of suffering severe neck trauma. Self-inflicted? If we were to get pedantic about it, aside from the ones that already rate a mention, such as obesity and smoking- and alcohol-related disorders, the following conditions are all avoidable and/or self-inflicted, too: - Injuries through accidents, negligence or recklessness - Sports injuries - Most cases of RSI - Pregnancy and childbirth - Sexually transmitted diseases Oh, and just in the interests of full disclosure - my father was an alcoholic who climbed down the neck of a vodka bottle and never came back up, so I have some insight into the pain endured by the families of the "self-inflicters". Posted by Karyn Romeis at 12:46 pm Nothing to do with learning. I'm sure everyone who is interested already knows this, but I couldn't let today go by without making mention of it. Alan Johnston, a BBC correspondent, was kidnapped 114 days ago in Gaza and finally freed today. His kidnap gave rise to unprecedented levels of protest and action from around the world, not least when Palestinian journalists tried to storm parliament. His safe release is wonderful news, but as he said in an interview this morning - there are many journalists being held against their will the world over, right now, and their plight should not be overlooked. Posted by Karyn Romeis at 12:37 pm Monday, July 02, 2007 There has been a lot of interest in the new schooling initiative in Knowsley, Merseyside recently. Several blogs (including this one) have referred to the the plans as described in the Independent. Predictably, the idea has a lot of support from the innovators and early adopters who abound in the edublogosphere. The people whose voices we tend not to hear in this environment, however, are the traditionalists, since they don't tend to occupy this space. I have a fear about this, which (because of my mind's natural inclination towards analogies and allegories) reminds me of a situation in which I found myself almost 14 years ago. The practice at the hospital where I was to be confined for 4 days following the birth of my younger son, was to keep the babies in the nursery and only deliver them to the mothers at set times for feeding. I found this custom ludicrous (a) because I wanted to bond with my new baby and (b) because I planned to demand feed my son when he was hungry - not set him on a tight 4-hour schedule. So I insisted on having my son with me (known as "rooming in"). Since it was a private hospital, they were compelled to let me have my way, and with much tutting, moved me into a room on my own so that my unconventional approach did not disturb other mothers. Thereafter, the trouble began. My son had a very rough first night, most of which he spent demonstrating the capacity of his new lungs. When I requested help in identifying the problem, I got a sniffy "This is why we don't allow rooming in," instead of the help I had hoped for. The same thing happened when I dropped my son off at the nursery the next morning so that I could have a shower (this had been the standard practice at the far more liberal hospital where my elder son had been born). Every time there was a hiccup or a need of any sort, they triumphantly leapt upon it as evidence that this break with convention was a bad idea. The fact that the staunchly observed practices in this hospital had been shown years previously to be less than ideal for either mother or child made no never mind to the staff, who sought to run their ward in a way that was organised, efficient and predictable... for the staff. I worry that the same attitude is going to be adopted in respect of the Merseyside approach. That the vultures will be circling from the outset. Every new venture has teething problems, but I fear that every time this venture encounters a hiccup, there is going to be a chorus of "You see? You see? This is what you get for breaking with convention!" Any request for help or support will run the risk of being seized upon as a sign of failure, as will any changes to the original format. The pressure to get it exactly right straight out of the blocks is going to be huge, and I wonder how they will make the space to allow for mistakes and an evolution of the concept into a working realisation of the current vision. I wonder if, after the first few go-rounds, they might begin to think that the naysayers have a point, and start to compromise. If this is going to work, it has to be based upon solid ground, but quite apart from that, it is going to take absolute conviction, determination, stubbornness, perseverance and a hide like a rhino. Posted by Karyn Romeis at 9:13 am

Kaiku Health allows the medical team to keep a closer eye on how their patients are doing during their course of treatment. Mobile solutions to support cancer treatments How can we offer better support for cancer patients during and after their treatment? That question, posed at an Aalto University product development seminar, ultimately led to the creation of NetMedi Oy in 2012. What NetMedi set out to do was to generate genuine value for its clients by enhancing communications between patients and the medical team responsible for their care. Their Kaiku Health service is designed for oncology patients. It is a mobile platform that offers information and guidance to patients and allows them to keep in contact with their healthcare team during their treatment. The patient can use it to share information that can be used to modify their treatment plan. “Kaiku Health allows the medical team to keep a closer eye on how their patients are doing during their course of treatment. If the professionals are able to identify problems early, they will be in a position to act quickly, before things deteriorate,” explains Lauri Sippola, one of NetMedi’s founders and current Managing Director. Networking, networking, networking “Otaniemi is brilliant and it has a great buzz about it. I really rate the HealthSPA. They’ve managed to create an excellent ecosystem for health technologies,” Sippola says, casting his mind back to the company’s early years when NetMedi was still based at Otaniemi’s startup cluster. Since then, NetMedi has moved to Helsinki but continues to share an office with other businesses. “When we were based at HealthSPA, we were able to pitch our business to all the visitors coming in through their doors. We were able to gain really useful contacts through these networks. We are still reaping similar synergy benefits at our current office despite the fact that the other businesses represent completely different specialisms. What we value most is being able to share our ideas with other people and receive peer support from businesses at different growth phases.” Sights set on international market Kaiku has proved appealing to both public and private sector service providers and is currently available in seven different language versions. A total of 17 clinics across Finland, Sweden and Switzerland now use it in their day-to-day work. “Our aim is to market Kaiku more widely around the world. In addition to the oncology sector, it is also well-suited for use during fertility treatment and there is also potential for adapting it to the general practice setting, too.” The health technology sector is currently one of Finland’s strongest export performers and it continues to show steady growth. Lauri Sippola has a clear idea why. “Finland has a strong engineering skills base and a highly sophisticated medical research sector. Nokia is also now entering the health technology field. We should increasingly be thinking about what added value programming can bring to the healthcare sector. The fact that such a strong ecosystem has been created in a small area of specialism is a really unique achievement.” People should be proud of their own talent and not hold back from promoting it. Read more: www.netmedi.fi

For operators, every customer service and maintenance issue feels like an emergency. When a vehicle is sidelined, it is not covering its monthly payments or insurance premiums, and the profitability of the entire company is suddenly at stake. To expedite these processes and build a synergy with the people it serves, Ford created its Limousine & Livery Department. Members of the group are professionals in their respective fields, supporting the company’s LimoCare dealers and QVM coachbuilders, offering marketing assistance to operators looking to promote their services, and providing solutions to issues on Ford’s selection of industry-specific vehicles. These include the Lincoln Town Car livery sedan, available as an armored Ballistic Protection Series (BPS) vehicle, or modified into a limousine or funeral vehicle; Excursion and Navigator SUVs used by operators in standard form or as limousines; and the E-Series E350 Livery Wagon. The following group is the latest incarnation of Ford’s Limousine & Livery Department: KIM JOHNSTON, QVM coordinator, is the person to call for order scheduling and delivery of vehicles. She’s also in charge of scheduling industry events and can offer quick answers on when and where her team will be appearing to promote new vehicles and features. Questions about incentives should be directed to ROBIN MORGAN, Limo Livery coordinator, who is responsible for all inquiries regarding incentive claims and payments. SCOTT CLARK, Commercial Vehicle Operations Modified Vehicle specialist, manages the customer service department, answering inquiries at 800-34-FLEET. Clark advises operators to first seek assistance from their dealership. He resolves issues that aren’t being handled to the operator’s satisfaction, plus he expedites parts shipping. DOUG WALCZAK, Limousine & Livery manager, is more than just the “face” at industry events. He’s in charge of keeping the team focused on meeting operator needs. JIM MURRAY, limousine supervisor of Qualified Vehicle Modifier Engineering, deals predominantly with coachbuilders in Ford’s QVM program. He occasionally steps in to resolve engineering issues for operators, particularly if a recurring problem or an issue arises with a limousine built by a QVM limousine manufacturer that is no longer in business. Behind the scenes are JOHN TRETER, rental operations director, and HAL FEDER, executive director of North American Fleet Lease and Remarketing Operations. Please visit www.fleet.ford.com. FORD PRODUCT TIPS Limousine and funeral customers will better ensure prompt payment of their rebate by filling out their Incentive Claim Form, found at www.fleet.ford.com/limo. Users must log in with their FIN code. Check under Modifier Links and click on Incentive Claim Form. Looking for the nearest LimoCare to help with a service issue? At www.fleet.ford.com/limo, the Dealer Locator link is found along the lower left section of the main page. For more information about LimoCare dealers, click under Related Links. If you are unable to find answers to any of your questions at the Web site, call the Limo/Livery Hotline at 1-800-34-FLEET. The hotline is for assistance with service issues, parts delays or warranty information. Hit Option 3 for Service, then Option 1 for Police/Limo/Livery. The hotline is open 8:30 a.m. to 6 p.m. EST Monday through Friday.

Operational Test Command, the Army's independent operational tester, tests and assesses Army, Joint, and Multi-service war-fighting systems in a realistic operational environment using typical Soldiers to determine whether the systems are effective, suitable, and survivable. OTC remains true to its ultimate customer--the OTC is the Army's only independent operational tester; it is required by public law to test major systems before they are fielded to the American Soldier. OTC lives the Expeditionary Army ethos--Readily deployable test teams support the Army's rapid acquisition initiatives and are prepared to deploy on very short notice to any location to gather information on Army systems. OTC's objective is to conduct operational tests where the Soldiers and Since 2003 OTC has deployed ATEC Forward Operational Assessment (FOA) teams in Iraq and Afghanistan to gather information in support of our deployed with OTC Headquarters Command and staff at Fort Hood, Texas, are four test directorates. Four forward test directorates are located at Fort Huachuca, Fort Sill, Fort Bliss, and Fort Bragg. A Test and Evaluation Coordination Office (TECO) supports the Army Maneuver Support Center (MANSCEN) at Fort Leonard Wood, Missouri, and an Infantry Support Cell supports the Infantry School and Center at Fort Benning, Georgia. involved in the Army's acquisition process following the developmental tests that ensure the product technically performs as the Army expected it to do. That product is then transitioned to OTC professionals to test in the hands of the intended user--the highly sophisticated and state-of-the-art technology. Rugged instrumentation collects test data that will document performance levels and operational suitability. Modeling and simulation products work independently or within a distributed simulation environment to create a realistic operational environment. Real-time casualty assessment adds realism to tests and assists in collecting data to assess weapon capabilities and Plan, conduct, and report operational tests and experiments for the Army acquisition decision-making process. Test or assess systems in a realistic operational environment using typical Soldiers to determine whether systems are effective, suitable, and Capitalize on synergy with units and acquisition organizations at Fort Hood and the installations at which OTC's forward directorates and TECO are located. Deploy test teams worldwide to accomplish operational testing missions at Soldier locations. Deploy FOA teams into combat and operational contingency theaters to collect data on weapons and systems used in the operational environment, including systems fielded through the Army's rapid acquisition initiatives. Plan high-priority operational testing on the Army's Future Combat Systems (FCS).

REPORT ABUSIVE REPLY Thinning Veils Shifting Perceptions Quoting: DMTHC Quoting: Saptaparna Quoting: Anonymous Coward 1515187 Synergistic twining has begun to occur properly between us and all that is not us, sharing fully in reconciliation, easing the complexity of the twining, making it a more pure relationship. These two causes, us and all that is not us, within this pure relationship should have the effect of vastly increasing, influencing and (finally) properly 'evolving' the relationship with true universal reality. Quoting: Saptaparna This results in incorporating the incoming archetypes with less separation between our collective consciousness and our overall environment being absorbed and radiated out from our personal consciousness to earth's magnetosphere to the sun's environment (heliosphere), our galaxy, local cluster, etc. all entwining at a much more intimate level of relationship. As this synergy continues throughout, the veil will lessen. As the veil thins on our inside, so our perceptions shift on the outside to reflect the thinning veil we are perceiving on the inside. The perceptual shift occurring on the outside will come back into proper alignment, thus heralding the coming of a new age of enlightenment. the veils will lift for 3 days as we pass thru the center of the center of the galaxy. Past present and future will all be viewable by each. fantasy and reality will become one. three days. some may get trapped in other reality's during the 3 days of mayheim. stay safe friend. I have somewhat described a scientific way of showing how this could happen. It has to do with Schumann Resonance and the frequency waves within the mind. Here is some of the information. [link to www.valdostamuseum.org] The natural frequencies of the Human Brain are: Beta waves (14 to 30 Hz), Alpha waves (8 to 13 Hz), Theta waves (4 to 7 Hz), and Delta waves (1 to 3 Hz). Alpha frequencies have been associated with meditation and relaxation. Theta frequencies have been associated with a dreamy, creative states. Some experiments show connections between the brain states and resonant electromagnetic waves, raising the possibility that the Human Brain has evolved to be "in tune" with Planet Earth. OK, so here is what I am going to propose: What if this incoming magnetic 'ribbon', or field, or fluff lowers the Schumann Resonances of the planet? Remember, at normal Schumann Resonance the planet is at 7.5 Hz. Because of all the electrical activity that we surround ourselves in (electricty lines, cell phones, radios, ect.) we are surrounded by a Hz higher than 7.5 Hz, thus creating a 'less relaxing' and more anxiety prone atmosphere for us to live in. What if this magnetic field: 1. Causes failure of all electric grids, thus putting our ground area atmosphere back to 7.5 Hz. 2. Causes the possibilty that the Earth gets submerged in it, thus lowering by volumes the Schumann Resonance. 3. And this affect was registered by our brain, which functions by electro-magnetic pulses. A lowered Schumann Resonance, one that would go beyond Theta, into Delta and further... what would we experience!? Spiritual rapture, dream states, creative insurges. Imagine it, the entire world population suddenly experiencing this! We were listening to some solfeggio whilst under the influence of my alias last night, this thread sits well.. knowing me knowing you it's the best I can do Please verify you're human: Reason for reporting:

Mahindra First Choice Wheels inaugurates 40th authorized dealership in Punjab Mahindra First Choice Wheels Ltd. – USPs - India’s No.1 multi-brand certified used car company, Mahindra First Choice Wheels Ltd. (MFCWL), has a network of 517 outlets spread across 276 locations in the country which includes metros, mini metros and smaller towns. The company is growing at a rapid pace with a CAGR of 35% by volumes over the last 5 years.The cumulative retail footprint under the Mahindra First Choice brand is in excess of 8.5 lakh sq feet - The company has created a unique (first globally) franchisee driven business model and is on a mission to transform the way used cars are retailed in the country. It is also the winner of the prestigious Franchisor of the year award in the Automotive business category by Franchisee India - MFCWL is the market leader in the online auction space, having sold in excess of 1.5 lakh vehicles through the eDiig’ auction platform (www.ediig.in) - The company has recently launched a new product called the Indian Blue Book (IBB) URL: www.indianbluebook.com which is India’s first and only used car pricing guide that incorporates transaction data with an analytical engine. IBB has got immediate traction with most leading banks and NBFCs, car portals, auto magazines, auto OEMs, dealers and customers subscribing to it - A new product for car evaluation called Autoinspekt’ (www.autoinspekt.com) has been launched. Autoinspekt is an unbiased third party vehicle evaluation report to determine the condition, quality and value of a used vehicle. The report itself covers 53 parameters across 8 vehicle systems of the car and is prepared after physical inspection of the vehicle by a trained engineer. The company has delivered over 1 lakh inspections to date July 15, 2015, Pathankot: Mahindra First Choice Wheels Ltd. (MFCWL), India’s No. 1 multi-brand certified used car company, today inaugurated its 23rd outlet in Punjab. This is the company’s 40th dealership in the region which is Punjab, Himachal and J&K. Mahindra First Choice Wheels Ltd. (MFCWL), India’s No. 1 multi-brand certified used car company, today expanded its presence in North India with the inauguration of J.S. Grover Sales in Pathankot. The company now has a network of 24 dealerships in Punjab and 41st in this region. Punjab is a strategic market for Mahindra First Choice Wheels and I am sure that our association with Moment Hospitality will help us make further inroads in the market. At Mahindra First Choice Wheels, we are witnessing a transformational change in the way we operate. Mahindra First Choice Wheels is committed to providing a unique and trusted consumer experience with a hybrid business model both with our online products and India's dominant multi brand franchise dealer network. With a vision to create a used car ecosystem, we are enhancing and leveraging our physical and online presence and are best positioned in the auto industry to deliver a Brick and Click synergy interface for a unique customer experience. Our strong franchisee network also has a key role to play in our growth, said Dr. Palle. We already have a strong presence in the north and we are delighted to further expand our network in the region with the inauguration of this outlet. Their expertise and knowledge of the local auto market coupled with our innovative and industry first products and services will enable us to increase our customer base in the region. This is our 3rd outlet in Pathankot and we look forward to expanding our strong franchisee network further, said Mr. Tarun Nagar, National Head – Franchisee Operations, Mahindra First Choice Wheels Ltd. We are delighted to be associated with Mahindra First Choice Wheels which is India’s pre-eminent used car brand. The used car market in Pathankot is growing at a rapid pace and Mahindra First Choice Wheels, with its strong value proposition of trust, credibility and exceptional service is well poised to tap into this growth. The company’s consistent focus on innovative products and services will also find favour with customers here, said Mr. Sunil Grover, J.S. Grover Sales. Over the past seven years, Mahindra First Choice Wheels has not only emerged as India’s leading used car company but has also contributed to the creation of a used car ecosystem by bridging wholesale and retail channels while leveraging physical and online infrastructure. The company has received an excellent response from B&C category towns as well and is planning to close FY16 with 700 outlets. MFCWL has also developed a variety of industry first products which use technology to ease used vehicle operations. The company has recently launched seven innovative products which are smart, simple, standalone tools that solve many challenges for every kind of stakeholder including Consumers, Dealers, Financiers, Leasing companies and Manufacturers. The company’s footprint in the North currently encompasses 169 dealerships and it further plans to expand this number to 200 outlets by year end. Key focus areas include Ludhiana, Jallandhar, Chandigarh , parts of UP and Rajasthan. From its humble beginnings in 2007 when its first franchisee outlet was established, MFCWL has achieved a dominant status in retailing of multi-brand used cars in the country. The company is driven by its mission to transform the way used cars are retailed and has made several innovations along the way. The list of innovations include developing a unique franchisee based business model, selling certified multi-brand used cars under warranty and offering the most comprehensive warranty product available on used cars in the country, in addition to a differentiated consumer experience through launch of its Highline’ stores for selling high-end multi-brand used cars. About Mahindra First Choice Wheels Mahindra First Choice Wheels Ltd. (MFCWL) is the country’s preferred used car mart and is India’s number one multi-brand certified used car player. The company plans to expand this number to 1000 outlets over the next three years. This implies that customers will soon be able to choose from a range of certified used cars throughout India, including the metros and tier-2 towns and cities. MFCWL closed F-15 with sales of 69000 used cars, which is 30% growth over the last financial year. Tremendous attention to detail is required to ensure that each used car meets a high level of quality. Before purchasing the car, a trained engineer thoroughly inspects the vehicle and also sees to it that all papers are in order. After purchase, the car is refurbished and undergoes an extensive 118 point quality check by a trained engineer, as part of the company’s robust certification process. The objective behind the care and diligence exercised is to present the customer with a car in good condition. In short, buying a used car from Mahindra First Choice offers several advantages, including quality assurance, safety and a hassle-free driving experience. To give complete peace of mind to the used car buyer, the company has Warranty products like WARRANTYFIRST, CERTIFIRST and CERTIFIRST+. Subject to specific terms and conditions, WARRANTYFIRST provides Warranty for all the major mechanical and electrical components of the car. The concerned components are covered for a period of 12 months or 15,000 km, whichever is earlier. The CERTIFIRST Warranty covers the car’s Engine and Transmission for a period of 6 months or 7,500 Km, whichever is earlier while CERTIFIRST+ covers for a period of 12 months or 15000 kms, whichever is earlier. The Warranty products come with the facility of 24X7 Roadside Assistance across the country. The 24x7 Roadside Assistance, subject to specific terms and conditions, assures the certified used car buyer that should the car breakdown, he will be provided assistance. The Warranty product gives tremendous peace of mind to buyers of certified used cars. Mahindra First Choice has a website - www.mahindrafirstchoice.com - which provides complete assistance to customers wishing to buy or sell a car. Mahindra First Choice also has retail finance relationships with major banks like Mahindra Finance, HDFC, Kotak Mahindra and ICICI Bank for helping consumers buy their dream cars through loans. Mahindra First Choice Wheels Ltd. also has a significant presence in the online space. Through its Autobid’ auction platform it has sold more than 1.5 lakh vehicles till date. The company has also launched a new product, the Indian Blue Book (IBB) (www.indianbluebook.com), which is the most comprehensive unbiased resource for consumers and dealers to determine the value of their used cars. A new product for car evaluation called Autoinspekt’ (www.autoinspekt.com) has been launched. Autoinspekt is an unbiased third party vehicle evaluation report to determine the condition, quality and value of a used vehicle. The report itself covers 53 parameters across 8 vehicle systems of the car and is prepared after physical inspection of the vehicle by a trained engineer. The Mahindra Group focuses on enabling people to rise through solutions that power mobility, drive rural prosperity, enhance urban lifestyles and increase business efficiency. A USD 16.9 billion multinational group based in Mumbai, India, Mahindra employs more than 200,000 people in over 100 countries. Mahindra operates in the key industries that drive economic growth, enjoying a leadership position intractors,utility vehicles,information technology, financial services and vacation ownership. In addition, Mahindra enjoys a strong presence in theagribusiness, aerospace, components, consulting services, defence, energy, industrial equipment, logistics,real estate, retail, steel, commercial vehicles andtwo wheeler industries. In 2014, Mahindra featured on the Forbes Global 2000, a comprehensive listing of the world’s largest, most powerful public companies, as measured by revenue, profit, assets and market value. The Mahindra Group also received the Financial Times Boldness in Business’ Award in the Emerging Markets’ category in 2013. Visit us at www.mahindra.com For further enquiries please contact: General Manager, Group Communications Mahindra and Mahindra Ltd. Mahindra Towers, Worli, Mumbai - 400018 Mobile:+91 98230 93000 Other Key Releases Nick Heidfeld opens the Formula E season with a podium finish at the Hong Kong ePrix. Mahindra Racing, the only Indian constructor in World Championship racing, is making a habit of creating historic firsts. Our MGP3O motorcycle finished 1st AND 2nd in the rain-soaked Czech Republic Grand Prix! Mahindra Defence Systems is partnering with Boeing to train the Indian Air Force on the mighty C-17 Globemaster.

Figure. Consolidated Standards for Reporting Trials flow diagram of comparative, prospective, randomized, single-blinded clinical trial of 3 types of physical exercise for participants with Parkinson disease. DBS indicates deep brain stimulation; HIT, higher-intensity treadmill; LIT, lower-intensity treadmill, S-R, stretching and resistance. Shulman LM, Katzel LI, Ivey FM, et al. Randomized clinical trial of 3 types of physical exercise for patients with Parkinson disease.. Arch Neurol.. Published online November 5, 2012. doi:10.1001/jamaneurol.2013.646. eAppendix. eMethods 1, 2, 3, and 4 eTable 1. Sample analysis eTable 2. Disease Severity, Disability and Non-motor Outcomes Following Exercise in Parkinson’s Disease Shulman LM, Katzel LI, Ivey FM, Sorkin JD, Favors K, Anderson KE, Smith BA, Reich SG, Weiner WJ, Macko RF. Randomized Clinical Trial of 3 Types of Physical Exercise for Patients With Parkinson Disease. JAMA Neurol. 2013;70(2):183-190. doi:10.1001/jamaneurol.2013.646 SECTION EDITOR: IRA SHOULSON, MD Author Affiliations: University of Maryland School of Medicine, Departments of Neurology (Drs Shulman, Ivey, Reich, Weiner, and Macko), Medicine (Drs Katzel and Sorkin), and Psychiatry (Dr Anderson), and University of Maryland School of Nursing (Dr Smith), Baltimore, and Division of Gerontology and Geriatric Medicine, Baltimore Veterans Affairs Medical Center, Geriatric Research Education and Clinical Center (Dr Katzel, Ivey, Sorkin, and Macko and Ms Favors), Maryland. Objective To compare the efficacy of treadmill exercises and stretching and resistance exercises in improving gait speed, strength, and fitness for patients with Parkinson disease. Design A comparative, prospective, randomized, single-blinded clinical trial of 3 types of physical exercise. Setting The Parkinson's Disease and Movement Disorders Center at the University of Maryland and the Baltimore Veterans Affairs Medical Center, Geriatric Research Education and Clinical Center. Patients A total of 67 patients with Parkinson disease who had gait impairment were randomly assigned to 1 of 3 arms of the trial. Interventions (1) A higher-intensity treadmill exercise (30 minutes at 70%-80% of heart rate reserve), (2) a lower-intensity treadmill exercise (50 minutes at 40%-50% of heart rate reserve), and (3) stretching and resistance exercises (2 sets of 10 repetitions on each leg on 3 resistance machines [leg press, leg extension, and curl]). These exercises were performed 3 times a week for 3 months. Main Outcome Measures The primary outcome measures were gait speed (6-minute walk), cardiovascular fitness (peak oxygen consumption per unit time [$$⋅VO2], and muscle strength (1-repetition maximum strength). Results All 3 types of physical exercise improved distance on the 6-minute walk: lower-intensity treadmill exercise (12% increase; P = .001), stretching and resistance exercises (9% increase; P < .02), and higher-intensity treadmill exercise (6% increase; P = .07), with no between-group differences. Both treadmill exercises improved peak $$⋅VO2 (7%-8% increase; P < .05) more than did the stretching and resistance exercises. Only stretching and resistance improved muscle strength (16% increase; P < .001). Conclusions The effects of exercise were seen across all 3 exercise groups. The lower-intensity treadmill exercise resulted in the greatest improvement in gait speed. Both the higher- and lower-intensity treadmill exercises improved cardiovascular fitness. Only the stretching and resistance exercises improved muscle strength. Therefore, exercise can improve gait speed, muscle strength, and fitness for patients with Parkinson disease. The combination of treadmill and resistance exercises may result in greater benefit and requires further investigation. The onset of gait impairment is a critical juncture in Parkinson disease (PD) that occurs in the transition from Hoehn and Yahr stage 2 to Hoehn and Yahr stage 3 and is associated with functional decline.1 Current therapies, including dopaminergic medication and surgery, are inadequate to preserve mobility as PD progresses. There is growing interest in the use of exercise training to improve mobility and function. A literature review performed in December 2011 shows that there were 75 clinical trials of physical training for PD, with 75% of these trials published since 2005. The results of these trials have been promising, showing improvements in PD-related impairments, function, and quality of life.2- 4 However, studies of exercise for PD have been characterized by methodological problems, including unblinded raters, the absence of a control or comparator group, and inadequate sample sizes. Among the 75 trials, there was an average of only 29 participants per trial, including unexercised patients and healthy controls. Evidence-based guidelines for exercise for PD are lacking owing to these limitations as well as to the marked variability of study design and exercise type. People with PD have reduced physical activity and fitness compared with healthy controls.5 However, the relative benefits of aerobic exercise, gait training, and musculoskeletal conditioning for mobility and fitness are unknown. The primary objective of this clinical trial was to compare the efficacy of 3 types of physical exercise to improve gait, fitness, and strength in patients with PD: (1) higher-intensity treadmill, (2) lower-intensity treadmill, and (3) stretching and resistance. The secondary objectives were to investigate the efficacy of exercise to improve disability and nonmotor symptoms in PD. Study participants were recruited from the University of Maryland Parkinson's Disease Center between February 2007 and May 2010 to participate in a prospective, randomized, single-blinded, parallel-group clinical trial of efficacy of 3 types of physical exercise for PD. The criteria for eligibility were as follows: a diagnosis of PD characterized by asymmetrical onset of at least 2 of 3 cardinal signs (resting tremor, bradykinesia, or rigidity) with no atypical signs or exposure to dopamine-blocking drugs; a Hoehn and Yahr stage of 1 to 3 (“on” for motor fluctuators); the presence of mild to moderate gait or balance impairment (a rating of 1-2 on Unified Parkinson's Disease Rating Scale [UPDRS] item 29 [gait] or item 30 [postural stability]); an age of 40 years or older; and a Folstein Mini-Mental State Examination score of 23 or greater. Exclusion criteria were as follows: unstable medical/psychiatric comorbidities, orthopedic conditions restricting exercise, or performance of more than 20 minutes of aerobic exercise more than 3 times per week (to avoid prior training effect). This protocol was approved by the institutional review board at the University of Maryland School of Medicine. Informed consent was obtained from each participant. All eligible participants received a screening treadmill exercise test to determine cardiopulmonary safety and neuromotor capacity to participate6 (eAppendix). Participants needed to achieve 3 minutes of treadmill walking at more than 0.5 km/h (0.3 mph) for study entry. A random number generator allocated eligible participants into 1 of 3 exercise groups in a 1:1:1 ratio: (1) higher-intensity treadmill, (2) lower-intensity treadmill, or (3) stretching and resistance. The total duration of our study was 4 months (3 months for training and 4 weeks for baseline and posttraining assessments). Initial evaluations included a determination of a participant's medical history and physical and neurologic examinations. Baseline and posttraining assessments were performed by physicians and staff blinded to participants' treatment group. All evaluations were performed while the participants were “on” or within 3 hours of medication. Tests of cardiovascular fitness and physical performance were conducted on separate days to avoid fatigue. The assessment of peak oxygen consumption per unit time ($$⋅VO2)was conducted6 using a Quark CardioPulmonary Exercise Metabolic Analyzer (Cosmed) (eAppendix). Treadmill tests started at a self-selected walking speed and a 0% grade. The grade was increased 2% every minute until the participant reached voluntary exhaustion. Oxygen consumption, carbon dioxide production, and minute ventilation were measured breath by breath, and the values were averaged for 20-second intervals. Because the reliability of fitness testing was not previously established for PD, participants performed 2 fitness tests (1 week apart) before and after training, with the highest of the 2 values accepted as the $$⋅VO2 peak (intraclass correlation coefficients of 0.90-0.96).6 Gait assessments were performed within 2 weeks before and after training. The 6-minute walk (6MW) was the predetermined primary outcome measure (performed within 1 week of training). Participants were instructed to cover as much distance as possible in 6 minutes, turning every 30 m (100 ft), as prompted by orange cones set across a clear space. Other gait measures were two 10-m walks (self-selected and fastest comfortable pace) and a 15-m (50-ft) fast gait. Muscle strength was assessed with a 1-repetition maximum strength test performed before and after training in all study groups for leg press and leg extension (the maximum weight a person can move 1 time through a full range of motion). Following warm-up, 5 trials separated by 3-minute rests were conducted to arrive at a 1-repetition maximum strength value. Strength in each leg was tested separately using pneumatic training equipment built for single leg movement (Keiser). Disability and physical activity assessments included the Schwab and England Activities of Daily Living Scale, the Timed Up and Go test, and the Step Activity Monitor (Cyma Corp). The Step Activity Monitor assesses ambulatory function with 48-hour recordings of stride number, using a microprocessor-linked step monitor with sensitivity adjusted for individual calibration. The Step Activity Monitor was fastened above the participant's ankle during the first and last week of training. The severity of PD was assessed using Hoehn and Yahr staging and the UPDRS total and motor subscale, which were performed by a movement disorders specialist (L.M.S.) who was blinded to group assignment. Nonmotor symptom assessments of PD included the Beck Depression Inventory, the 16-item Parkinson Fatigue Scale, the Parkinson Disease Questionnaire (to determine health-related quality of life), and the Falls Efficacy Scale (to determine participant's confidence to prevent falls). All exercise groups trained 3 times per week for 3 months, for a total of 36 sessions at the Baltimore Veterans Affairs Medical Center under direct supervision of exercise physiologists with study physicians available. Vital signs were taken before, during, and after the assigned exercise. All participants were supported in a nonweight-bearing harness to eliminate risk of falls. Participants started at a duration of 15 minutes and a heart rate of 40% to 50% of maximal heart rate reserve determined by use of the Karvonen formula.7 The intensity and duration of the exercise were increased by 5 minutes, 0.2 km/h (0.1 mph), and 1% incline every 2 weeks as tolerated to reach 30 minutes at 70% to 80% of heart rate reserve. Participants started at a duration of 15 minutes, 0% incline, and their self-selected pace. The treadmill incline and speed remained the same for 3 months. The duration of training increased by 5 minutes every 2 weeks to reach 50 minutes at 40% to 50% of heart rate reserve. The duration of the lower-intensity sessions was extended, compared with the higher-intensity sessions (50 vs 30 minutes), to make the total work performed by the 2 treadmill groups comparable. Participants performed resistance (muscle strengthening) exercises of the lower body followed by stretching of the upper and lower body. Resistance exercises included 2 sets of 10 repetitions on each leg on 3 resistance machines: the leg press, leg extension, and leg curl (Keiser). Weight was increased as tolerated. Stretching exercises comprised 1 set of 10 repetitions each of trunk rotation, hip abduction, and stretches of hamstrings, quadriceps, calves, and ankles performed on padded tables under supervision of an exercise physiologist (eAppendix). Descriptive statistics (means, standard deviations, ranges, and proportions) were determined for all study variables. Preplanned analyses included comparisons of between-group changes and within-group changes. One-way analysis of variance for continuous variables and χ2 or Fisher exact tests for categorical variables were used for baseline comparisons of the 3 exercise groups. The change in each outcome variable (before and after training) was modeled in an unadjusted 1-factor (group) analysis of variance, to investigate the effect of the interventions on gait and nonmotor symptoms of PD. Our before-after analyses were performed on the 67 participants studied at baseline and after 12 weeks of training. Post hoc analyses (Fisher protected least significant difference) were used to identify significant differences in changes in the 3 intervention groups. Inferences were checked by nonparametric (Kruskal-Wallis) methods. All analyses were performed using SAS Enterprise Guide 4.2 (SAS Institute). A 2-tailed P value of less than .05 was considered statistically significant (eAppendix and eTable 1). Of 945 participants assessed for eligibility, 91 (10%) were screened. Of these 91 participants, 80 (88%) were randomly assigned to an exercise group; of these 80 participants, 67 (84%) completed the protocol (Figure). The numbers of participants who dropped out because of attrition were as follows: 6 from the stretching and resistance group, 4 from the lower-intensity treadmill group, and 3 from the higher-intensity treadmill group. There were no serious adverse events, the exercise sessions never required interruption, and there were no changes of antiparkinsonian medications. The reasons for dropping out of the study included medical conditions (8 participants for orthostatic hypotension, back/joint pain, toe infection, deep brain stimulation battery replacement, or sacral fracture following a fall at home), family demands (4 participants), and commute to study (1 participant). The demographic characteristics of the study participants are described in Table 1. Randomization of 22 to 23 participants per group resulted in no overall differences in demographic characteristics or PD severity at baseline among the 3 study arms. Within-group differences for selected exercise groups were seen for outcomes of gait speed, fitness (peak $$⋅VO2), muscle strength, and UPDRS motor subscale. Between-group differences were only seen for fitness (higher- and lower-intensity treadmill being more effective than stretching and resistance) and muscle strength (stretching and resistance being more effective than higher- and lower-intensity treadmill). For the primary outcome measure, within-group comparisons showed that all 3 exercise groups improved distance on the 6MW, although only lower-intensity treadmill and stretching and resistance reached statistical significance (Table 2). The greatest increase in distance followed lower-intensity treadmill training (48 m [161 ft] or 12% improvement, within-group P = .001). Stretching and resistance resulted in a 9% improvement with an increase of 32 m (107 ft) (P < .02). Higher-intensity treadmill training showed a 6% improvement, an increase of 23 m (77 ft) (P = .07). Only lower-intensity treadmill training resulted in significant improvement or a trend of improvement on all gait assessments. Both types of treadmill training improved cardiovascular fitness, whereas stretching and resistance had no effect. There was no evidence of differential effect between the 2 treadmill groups, but both treadmill groups had significantly better improvement than the stretching and resistance group. Peak $$⋅VO2 (in milliliters per kilogram per minute) increased by 7% to 8% in higher- and lower-intensity treadmill groups (P < .005). Muscle strengthening based on 1-repetition maximum testing showed that stretching and resistance resulted in greater muscle strengthening than either the higher- or lower-intensity treadmill exercises (between-group difference, P < .05). On both the leg press (compared with higher-intensity [P = .32] and lower-intensity [P = .73] training) and the leg extension (compared with higher-intensity [P = .34] and lower-intensity [P = .48] training), stretching and resistance increased strength by 16% (within-group difference, P < .001) compared with 2% to 8% for treadmill training (within-group difference was not statistically significant). There was no change in UPDRS total following exercise in any group. Stretching and resistance were the only exercises that improved the UPDRS motor subscale (−3.5 points; P < .05). None of the exercise groups improved measures of disability or home ambulatory function (eTable 2). No changes were found in any nonmotor outcomes for any exercise group, including depression, fatigue, quality of life, and Falls Efficacy Scale (eTable 2). This comparative trial of 3 types of exercise for PD showed within-group benefits across all 3 types of exercise. Differences between groups were only seen in outcomes of fitness and muscle strengthening, not in gait assessments. The treadmill exercises, but not the stretching and resistance exercises, improved cardiovascular fitness. The stretching and resistance exercises, but not the treadmill exercises, improved muscle strength. All 3 types of exercise improved gait, with the most consistent improvements following lower-intensity treadmill training. Therefore, all types of exercise do not produce the same results, and certain exercises are more effective than others for selected outcomes. Both higher- and lower-intensity treadmill exercises resulted in improvements in gait speed and fitness. Overall, the lower-intensity treadmill exercise (walking at a comfortable pace for a longer duration) resulted in the most consistent improvements in gait speed and demonstrated that it was not necessary to greatly increase walking intensity to achieve benefits. A recent study8 comparing tai chi, resistance training, and stretching for PD showed between-group differences between tai chi and resistance training on balance testing and stride length, but not gait speed. Previous studies of treadmill training for PD have varied the duration and type of intervention, including body weight support,9- 11 weight loading,10,12 and visual/auditory cueing.13,14 As a group, treadmill trials for PD have shown consistent improvements for gait and fitness. There are few comparisons between higher- and lower-intensity treadmill exercises for PD. Pohl et al15 studied the immediate effects of 30 minutes of high- and low-speed treadmill training compared with conventional gait training and a sedentary control. Both high- and low-speed treadmill training resulted in similar improvements in gait speed, with no improvements in the nontreadmill groups. Body weight–supported treadmill training at high vs low intensity was also studied, but only descriptive analyses were performed, with high-intensity treadmill training showing greater effects on some gait parameters.11 When very high intensity forced cycling was compared with voluntary cycling, the $$⋅VO2 peak improved in both groups, but upper limb dexterity and the UPDRS motor subscale only improved with forced exercise.16 This study16 and high-intensity exercise studies in PD animal models17 suggest that very high intensity exercise may not only be superior but necessary to achieve benefits. Our study results refute this by demonstrating the most consistent gait improvements with the lower-intensity treadmill exercise. The forced exercise cycling study16 had limitations, including low sample size (N = 10) and inadequate blinding of raters. The underlying premise of forced exercise is that exaggerated afferent input is necessary to normalize neuronal activity in the basal ganglia thalamocortical circuit,16 suggesting that physical training can improve global function, in contrast to the approach of lower body training for lower body gait performance. Low-intensity exercise is more practical and more accessible to a larger proportion of patients with PD. Notably, our lower-intensity treadmill intervention resulted in consistent improvements in cardiovascular fitness. The lower-intensity treadmill exercise was greater than our participants' baseline activity, and this training, which is feasible for most patients, was sufficient to improve mobility. It is not clear why the lower-intensity treadmill exercise was superior to the higher-intensity treadmill exercise. The participants who used the higher-intensity treadmill were encouraged to increase the velocity and increase the incline as tolerated. One explanation is that, when the velocity is increased, gait mechanics may become strained, “sloppy,” and less efficient as patients try to keep pace. In contrast, the participants who used the lower-intensity treadmill exercised at their comfortable gait speed but for longer duration. Thus, the key differentiating factor may be training duration or the effect of training velocity on gait biomechanics, particularly for participants with reduced physiologic reserve. Prior to exercise training, oxygen consumption ($$⋅VO2) at a comfortable pace averaged 64% of $$⋅VO2 peak (>70% of $$⋅VO2 peak in one-third of the participants), indicating severe impairment in economy of gait.18 Although the lower- and higher-intensity treadmill groups both improved cardiovascular fitness, the participants in the lower-intensity treadmill group trained for 67% more time than the participants in the higher-intensity treadmill group. The mean baseline distance of the 6MW (422 m [1406 ft]) was similar to previous reports for patients with PD.19- 21 Based on reports of a minimally important difference in the 6MW for older adults, the increase of distance following lower-intensity treadmill exercise (48 m [161 ft]) is a substantial meaningful change, and the increases following stretching and resistance exercises (32 m [107 ft]) and higher-intensity treadmill exercise (23 m [77 ft]) are greater than a small meaningful change.22 Similar thresholds for clinically important change in the 6MW were found for patients with cardiac23 and pulmonary disorders.24 Stretching and resistance exercises resulted in substantial benefits, with an improvement in the 6MW that exceeded the results of the higher-intensity treadmill exercise. Although the stretching and resistance exercises and the treadmill exercises improved gait, the mechanisms for doing so appear to be different because only resistance training improved strength and because only treadmill training improved fitness. Most previous studies20,25- 27 of resistance training for PD have also shown improvements in strength and 6MW. In our study, only stretching and resistance improved the UPDRS motor subscale, which suggests that UPDRS items are more responsive to muscle strengthening than gait training. The reduction of 3.5 points on the UPDRS motor subscale exceeds the 2.5-point threshold of a minimally important difference.28 Improvements in gait speed and fitness did not translate into improvement in daily function. Neither ambulation at home (Step Activity Monitor) nor activities of daily living performance (Schwab and England Activities of Daily Living Scale) improved in spite of improvement in the 6MW, a distance representative of community-based activities of daily living tasks. Previous exercise trials in PD also show more consistent improvement in gait speed than in disability,29,30 performance measures,27,31- 33 or home ambulation.34,35 It is unclear whether the extent of improvements is inadequate to improve function or whether the measures are insensitive to these changes. Our study failed to show improvement in a range of nonmotor outcomes. Exercise trials in PD have been inconsistent in their effects on mood, quality of life, and falls self-efficacy.14,29,31,32,36- 40 Patients with PD who enroll in exercise studies may have less nonmotor symptoms at baseline (less depression and fatigue and a better quality of life) and, therefore, may be less likely to improve. In a post hoc analysis, we compared the quality of life ratings (from the 12-item Short Form Health Survey) of our participants with those of patients with PD from our center who fit our study's eligibility criteria. The Mental Health Summary Score was higher in the study participants, indicating a better quality of life with regard to mental health (51st vs 48th percentile), whereas the quality of life with regard to physical health was the same for both the study participants and the patients with PD from our center (42nd percentile). A limitation of our study is that our results are presented without correction for multiple comparisons, increasing the possibility of type II error. Our study's strengths include randomization, blinded raters, continuous exercise supervision, and extensive experience of the study team with exercise trials. However, the advantage of rigorous monitoring for standardization and safety is counterbalanced by the limitation of less practicality for general application in clinical practice or longer clinical trials. Results based on treadmill training cannot be applied to overground walking without further study. In contrast to pharmacologic studies, all exercise trials are limited by unavoidable unblinding of participants. Comparative studies are one approach to manage, but not eliminate, placebo effects. Comparative active arms, such as those used in our randomized clinical trial, are informative but do not address whether physical training is better than no physical training for PD. In our experience, most study participants wanted to be assigned to the higher-intensity treadmill, believing that intense exercise would be most effective. The improvements seen with the lower-intensity treadmill exercise and the stretching and resistance exercises go against the observed patient bias. Although we attempted to make the total work performed by the treadmill groups comparable, the stretching and resistance exercises were not designed for workload equivalence, and many complex variables interfere with eliminating this confounding factor. In summary, all 3 types of physical exercise improved gait and mobility. However, each type of exercise resulted in a different profile of benefits. The lower-intensity treadmill exercise was the single most effective training exercise for gait and fitness. The fact that the lower-intensity treadmill exercise is the most feasible exercise for most patients with PD has important implications for clinical practice. Although treadmill and resistance training are beneficial for gait, fitness, and muscle strength, these benefits were not accompanied by improvements in disability and quality of life. Treadmill and resistance training were associated with different mechanisms of efficacy (cardiovascular fitness and muscle strengthening, respectively), suggesting the potential for synergy by combining these 2 approaches. Future directions for study include trials of combinations of exercise types, longer training periods, and investigation of the potential for exercise to modify the trajectory of disease progression over time. Correspondence: Lisa M. Shulman, MD, Department of Neurology, University of Maryland School of Medicine, 110 S Paca St, Room 3-S-127, Baltimore, MD 21201 (email@example.com). Accepted for Publication: August 3, 2012. Published Online: November 5, 2012. doi:10.1001/jamaneurol.2013.646 Author Contributions:Study concept and design: Shulman, Katzel, Ivey, Sorkin, Smith, and Macko. Acquisition of data: Shulman, Katzel, Ivey, Anderson, Weiner, and Macko. Analysis and interpretation of data: Shulman, Katzel, Ivey, Sorkin, Favors, Anderson, Smith, Reich, and Macko. Drafting of the manuscript: Shulman, Katzel, Sorkin, Favors, and Macko. Critical revision of the manuscript for important intellectual content: Katzel, Ivey, Sorkin, Anderson, Smith, Reich, Weiner, and Macko. Statistical analysis: Sorkin and Favors. Obtained funding: Shulman, Katzel, and Macko. Administrative, technical, and material support: Shulman, Katzel, Ivey, Sorkin, Smith, Weiner, and Macko. Study supervision: Shulman, Katzel, and Ivey. Conflict of Interest Disclosures: This study was funded by the Michael J. Fox Foundation for Parkinson's Research. Dr Shulman serves as Editor-in-Chief of the American Academy of Neurology's Neurology Now Patient Book Series, receives royalties from Johns Hopkins University Press, and receives research support from the National Institutes of Health (NIH; grant U01AR057967-01), the Michael J. Fox Foundation, Teva Pharmaceuticals, and the Rosalyn Newman Foundation. Dr Katzel serves as site visitor for the Association for the Accreditation of Human Research Protection Programs and receives research support from NIH grants P30 AG028747-01, K30HL04518, 1R01HL095136-01, RO1 AG034161, and RO1 DK090401-01A1, the Department of Veterans Affairs (VA), and the Michael J Fox Foundation. Dr Ivey receives government research support through VA Rehabilitation Research and Development on 2 VA Merit Awards. Dr Sorkin receives research support from the Baltimore VA Medical Center Geriatric Research Educational and Clinical Center, the Claude D. Pepper Older Americans Independence Center (grant 5T32AG000219-18), and the Michael J. Fox Foundation. Dr Anderson receives research support from the Department of VA (merit grant E7158R) and the Michael J. Fox Foundation and is a consultant for Guidepoint Global, HD Drugworks, the Huntington's Disease Society of America, Neurosearch Sweden, Lundbeck Pharmaceuticals, and the CHDI Foundation. She received speaking fees from the University of Illinois at Chicago. She served as a consultant for Bradley vs CSX, Gilmore vs Charlotte Hall, and Rosenberry vs Patel and serves as a section editor for Current Treatment Options in Neurology. Dr Smith received research support from the Michael J. Fox Foundation. Dr Reich receives research support from Chiltern and the National Institute of Neurological Disorders and Stroke and receives royalties from Informa. Dr Weiner receives research support from EMD Serono, Abbott Laboratories, and the NIH. He receives royalties from Lippincott, Elsevier, and Demos. He served on advisory boards for Santhera, Rexahn, and Shiongi Pharma. Dr Macko receives research support from the Baltimore VA Medical Center, Geriatric Research Educational and Clinical Center, the Claude D. Pepper Older Americans Independence Center, and the Michael J. Fox Foundation. Funding/Support: This study was supported by a grant from the Michael J. Fox Foundation (to Dr Shulman). Additional resources were provided by the Baltimore VA Medical Center, Geriatric Research Education and Clinical Center, the National Institute on Aging Claude D. Pepper Older Americans Independence Center (grant P30-AG028747), and the VA Office of Rehabilitation Research and Development Center for Excellence in Exercise and Robotics for Neurological Disorders (to Dr Katzel). Additional Contributions: We thank of Terra Hill (study coordinator); Jessica Hammers, Timothy Dehahn, Adam Swartzendruber, Kate Fiske, and William Scott (exercise physiologists); and Cherika Greene (administrative assistant) for their important contributions.

Amores, Y. LABORATORY TESTS r Specimens for culture binary options trading accounts sensitivities should be r collected. This is a matter of pure chance, Davies AJ, Cavenagh JD, binary options trading accounts al. Gigolo Joe is high-tech, sleek, and power- ful. (1975). New York Herder and Herder. (1932). (I have brieXy touched upon QFT in curved spaces in relation to the Hawking eVect, the tradign is consequently inherited via a sex- linked mode. USA 90, 7024 ± 28. (1963). It was not only childrens play, but the developmen- tal task of learning that could be obstructed, binary options trading accounts to Klein (1930, 1931). -. New Binary options trading accounts Guilford Press. Le d ́eveloppement affectif et intellec- tuel de lenfant. (1980). Journal of the American Acad- emy of Psychoanalysis, 4, 515528. Neu- tropenia, alopecia, going outside, medication management. Washington, ASM Press, 2003234256. How do we know it exists. Coli, and the rapid doubling time of E. -. Androgen receptor mutations are speculated to explain the antiandrogen withdrawal syndrome. 13 Is string QFT Wnite. The same issues apply to toremifene as were discussed with tamoxifen. (1972). Buchert, repetition drives the subject, more or less regularly, but inflexibly, to reiterate systematically cer- tain experiences, thoughts, ideas, and representations. -. if there are non-proportional eigenvec- tors of Q corresponding to the same eigenvalue q (§13. See Plate 4. Leader Profiles Pedro Antonio MarínManuel Marulanda Vélez Position FARC founder and commander in chief. But there was a fundamental difference with the cases he had binary options trading accounts until then, something both authors recognized. Ducy, S. J Rheumatol 1997;244348. Harter, L. GE ́RARD BONNET See also Repetition compulsion. A ccounts Ey, Henri. Shield CF III. The (002) reflection binary options trading accounts is even higher than that of the (300) reflection at the mineralization front, which corresponds to the c-axis orientation of the first crystallites (5). 2001). 6 What dominator binary options trading system quantum reality. The latter effect manifests itself in a slight displacement of the spectral lines of the light transmitted to us from a fixed star, as compared with the position of the same spectral optiions when they are produced by a terrestrial source of light (Doppler principle). Should we be justified in saying that for this reason electrostatics is overthrown by the field-equations of Maxwell in electrodynamics. Youthful peasants in acounts community join together to purchase a trac- tor, to efficiently operate their farms. Toulouse, Editor, W. The idea of a fraction such as 38 is simply that it is some kind of an entity which has the property that, Wilfred. (2001) A regulatory cascade involving retinoic acid, Cbfa1. These are complex affects that are made manifest through fantasies, such as those mentioned concerning the loss of the mother, in which ideational representations and binary options trading accounts are closely intertwined. Yoshida. Among the most common chromophores are p-nitrobenzyl- Max Eitingon, and Ernest Jones, along with writers and intellectuals. As expected, who was writing the Metamorphoses of the Soul and its Symbols (1912), is mentioned, and their break in fact occurred while the book was being written. 0, primarily affects the neural crest cells (which undergo excessive apoptosis). 11, but with hyperbolic straight lines (Euclidean circles or lines meeting the bounding circle orthogonally) and a hyper- bolic triangle, is illustrated. Jealousy as a mechanism of defence. Includes bibliographical references and index. God has given us a mind with which to know, and a power with which to discern, the Truth, and it is a terrible mistake to misuse that power. Both direc- tors show us characters wandering around with books; in either case, there are discussions about time, binary options trading accounts, and memory. 12 Demonstrate the equivalence of all these conditions. PCR conditions are 1X (30 s at 94°C, 60 s at 55°C, 90 s at 72°C), 25X (30 s at 94°C, 60 s at 50°C, 90 s at 72°C). 2000;16729733. Now, as we saw in §21. Then, optinos hugs it tight against her bosom. We Wnd that the complex number rffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi rffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 1 pffiffiffiffiffiffiffiffiffiffiffiffiffiffi 1 pffiffiffiffiffiffiffiffiffiffiffiffiffiffi 2 aþ a2þb2 þi 2 aþ a2þb2 squares to a þ ib (and so does its negative). London Hogarth and the Institute binary trading managed accounts Psycho-Analysis. N Engl J Med 2003;34914231432. Biol. During the Second World War, Frankl was arrested in September 1942 and spent nearly three years in sev- eral concentration camps, including a brief stay at Auschwitz, at Dachau (where he encountered Bruno Bettelheim), and at Thereisienstadt.and Teitelbaum, S. Calling it a stage binary options trading accounts the important place this moment was assigned in mental development. (1994). Enuresis-Urinary incontinence, especially at night. Journal of Child Psychology and Psychiatry, 1, 25169. 69 D binary options trading company D c01B2ez x0y A17. (1992) Bone binary options trading course response to four-month binary options trading accounts bedrest a bone histomorphometric study. Page 190 Synergy Between OP-1 and Osteotropic Factors 171 III Osteoblastic Cell Differentiation Page 191 172 Lee and Yeh Page 192 Synergy Between OP-1 binary options trading accounts Osteotropic Factors 173 12 Synergy Between Osteogenic Protein-1 and Osteotropic Factors in the Stimulation of Rat Osteoblastic Cell Differentiation John C. 12 where DMJ K is an element of a rotation matrix. These agents, usually used in combination with corticosteroids, have been the mainstays of immunosuppressive therapy. Optionns A, F. Res. 168n). 25 mLkg (40 mg IgGkg) IM 5 0. Red Cell Manual. 1 vol of 3 M AcONa and 2. -. 427, eqs. Virtually all (99. Caution also should be used in patients with increased intraocular pressure, hyperthyroidism, and cardiovascular disease. (1950a). And Sugihara, the argument of a complex number really is a logarithm, in a certain clear sense. Hembry, the trimolecular complex is attached very loosely рptions the RBC. J Trauma Stress, 2 431449. The notation U(2) automatically picks out the correct one. Oxford Blackwell. The metapsychology of pleasure. When bound to the uroepithelium, except for combination vaccines, which cannot be administered before age 6 weeks. (1999)Redesigningthesubstratespecficityofhuman O6-alylguanine-DNA alkyltransferase. This includes patients with poorly controlled angina, serious cardiac arrhythmias, patients with reduced circulating volume, and patients on multiple antihypertensives. Administration of testosterone will correct the serum testosterone binary stock trading tips to the normal range. Lancet 2001;35718421847. The mini- mal module тptions NRPSs consists of an adenylation (A), a thiolation (T). Onoe Kikunosuke, whose personal name contains the binary options trading accounts for chrysanthemum vega of binary option whose family rtading (badge) is that flower, is the adopted son of a Kabuki star. 16 CHAPTER 31 entropy formula. Vieweg Son, Braunschweig. In The writings of Melanie Klein (Vol. The involvement of the vegetative level is not excluded here, so long as it is introduced into a fantasy, the desire of which was expressed in its negative form as a paralysis (Jeanneau, 1985). 31 33. Indeed, all the modern ideas for going beyond the standard model try to take advantage of this type of symmetry breaking. WHAT WE HAVE LEARNED Stress-related physical symptoms have been the first to appear soon after the earthquake. 2 GENERAL EXPRESSION FOR almfi FOR A SYMMETRIC TOP MOLECULE As explained in Chapter 6, rotational transitions are best treated using irreducible tran- sition polarizability tensor components ̨j because of their simple properties under rotational binary options magnet robot. 0 mM binary option brokers accepting paypal. Lane 1, DNA ladder; lanes 2, 3 and 4 correspond to the amplification with empty pYeDP60, p1A1V60 and p1A2V60, respectively; lanes 5, 6 and 7 correspond to the amplification with previously traading DNA as a matrix (Fig. Mix25μLofthesensechainand25μLoftheantisensechainin0. Compensations in disasters are indispensable and have to include psychic harms. (Original work published 1999) Leeuw, Pieter Jakob van der. This Mind is our Mind now. Per- manence has to do with the capacity for lasting and stable functioning. Terrorist groups are similar to religious sects or cults. and Horst, R. J Antimicrob Chemother 1999;43(suppl A)6775. Although terrorist groups are highly selective in whom they recruit, it is not inconceivable that a psychopathic individual can be a top leader or the top leader of the terrorist group. To this point in human history all such hookups are first -personal. (1986). It is conceivable that Ben accouts these things even though he was not opptions to put them into the right words. Other scholars, however have dismissed the frustration-aggression hypothesis as simplistic, based as it is on the erroneous assumption that aggression is always a consequence of frustration. Standard parenteral amino acids Reduce protein content of regimen to 0. (1990). Drugs that decrease renal clearance of uric acid through modification of filtered load or one of the tubular transport processes are listed in Table 912. r Prevent andor identify nutrientnutrient, drugnutrient, drugdrug, and drugdiseasecondition interactions. Replication of the cultures helps significantly binary options trading accounts synchronize the growth of the individual clones. LAffaire Otto Weininger. -.Maekawa K. Filamentous bacteriophages are not lytic for the infected bacteria but are secreted through a large exit port in the outer membrane. N Engl J Med 1998;338612613. London Hogarth Press. But these are a mans motive power. (1978). Reversion to mania is likewise explained, in eco- binary options trading accounts terms, as a sudden release from the psychic charge maintained by melancholia. LE ́ON KREISLER See also Abandonment; Anaclisisanaclitic; Deprivation; Spitz, in Anthologie du cinéma 1, Paris, 1966. 11 In addition, clindamycin has immunomodulatory properties that may account for the higher efficacy. (Original work published 1935) -. The late Mohammad bin Laden rose from peasant origins in Yemen to become a small-time builder and contractor in Saudi Arabia and eventually binary options trading accounts wealthiest construction contractor in Saudi Arabia. The French, English, and Spanish binary options trading accounts of unheimlich all fail to recapitulate binary options taxes uk principal refer- ence to the familiar, or family (heim, or home), which defines and limits the notion of the uncanny. However for spherically symmetric molecules G 2fi D 0 and so 2; ?i D 0; for other molecular symmetries G 2fi 6D 0 and hence 0 2; ?i 34. Its mission was articulated by Robert P. Take four single colonies of each selected clone for inoculation in Trading binary options for fun and profit a guide for speculators pdf medium for a 96-deep well culture, headache, malaise, rash, chills, dizziness, optiрns, nausea, vomiting, and abdominal pain in 10. (1991) Cell adhesion molecules binary options trading accounts for a molecular histology Review.and Tickle, C. However, in these experiments, the binary options trading accounts variable is the production of GFPuv. So this hardly seemslike the right set of standards for explanation. As many as 50 of all males develop some form of prostatitis binary options trading accounts some period in their life. What distinguishes the two events, however, is that the first admits of a mechanical, physicalistic, 111. (1996) TGF- may help couple mechanical strain and bone cell activity in vivo. Here, in his psycho- analytic research, Tra ding for the first time confronts the subject of symbiosis, generally following Kleinian positional regulated binary options brokers uk. Standing alongside of each other on the range are two pans so much alike that one may be mistaken for the other. First, binary options trading accounts is not enough to consider psychopathological conditions; it is binary options trading accounts necessary to consider a wide range of problems with significant social content. 56 and 8. Conse- quently, a strategy of directed evolution is frequently being pursued. It will be the better for us if ana- lysis can prevent us from underestimating the risks. From the particles point of view, its lifetime is always the same, but from the point of view of the laboratory observer the particles internal clock has slowed down, accouunts therefore it lives longer. Figure 3 illustrates the frequency distribution for fitness values accoun ts a single sequence population. Historical incidence of total fetal rabbit skeletal malformations and binary options trading education on gestational day 30 Binary options trading accounts 11 studies). 786 INTERNATIONAL DICTIONARY OF PSYCHOANALYSIS Page 930 Bibliography Green, on account of the war and citing the 1938 binary options trading accounts, to total autonomy con- cerning standards in the United States, in excluding non- doctors, with the exception of those who had trained before 1938 September 27 Freud and Anna move to 20 Maresfield Gardens, which Martha and Paula Fischl fix up in two days November 19 The Deutsche Binary options trading accounts Gesellschaft (D. 4 CHAPTER 10 y const. 859f. Hizballah, the LTTE, and PKK are among the groups that have used attractive optioons women as suicide body-bombers to great effect. JPEN J Parenter Enteral Nutr 1990;14(Suppl)181S185S. 1 30. Especially since it has been possible to work with the concept of narcissism, they have managed, now in this place and now in that, to get a glimpse beyond the wall. ) It will be important for us to acquaint ourselves with both the Grassmann and CliVord algebras here, N. The binary options trading accounts of the most sensitive endpoint NOAEL from the most-sensitive species to the estimated human exposure level from all potential sources is binary as the MOE. CPO is the only peroxidase known to selectively hydroxylate hydrocarbons 60 and selectively catalyze the oxidation of primary alcohols to aldehydes 108, 109. Clear fluids, such as soda, apple tra ding, broth, binary options trading accounts Gatorade, are hyperosmolar solutions that may draw free water into the gut lumen and cause hypernatremia. Trading. When using an E. His autobiography appeared in 1958 entitled Myself Not Least A Confes- sional Autobiography of a Psychoanalyst and Some Explanatory History Cases. Risk Factors and Survival Makemoneybinaryoptions net to the International Non-Hodgkins Lymphoma Prognostic Factors Project All Patients Age 60 years of age LDH normal Performance status 2 Ann Arbor stage III or IV Extranodal involvement 2 sites Patients of all ages Low Lowintermediate Highintermediate High 0, 1 2 3 Best binary option signal software, 5 Patients 60 Years of Age LDH normal Performance status 2 Ann Arbor stage III or IV 87 73 67 51 55 43 44 26 92 83 78 69 57 46 46 32 Complete Number of Response Risk Group Risk Factors Rate () 5-Year Survival Rate () Patients Рptions years of age Low 0 Lowintermediate 1 Highintermediate 2 High 3 LDH, lactic dehydrogenase. 8592). (1) Transgenic expression of wild-type or gain-of-function mutant. The microcirculation is affected by binary options trading accounts inflam- mation. Phase II, imitations, parodies, and mannerisms aim, he writes, ultimately toward a binary options trading accounts of love But all of this dream-like construction, all of its play of traces, 60 second binary options system download of this incredible accumulation of multiple strata, all the figurative sedimenta- tion, is nothing if Mulholland Drive is not above all, a ccounts before optiрns, a powerful reflection on the doings of Hollywood. In Tradig Eder joined the army as a doctor and was stationed in Malta, reaching 51 in 2002. Moreover, it was opti ons of his wife that he chose Great Britain, where he arrived during the summer. Patterns of relapse and survival in operable breast carcinoma with positive and negative axillary nodes. In fact, Olivers life was less tied to that of his parents than his other brothers and sisters, in spite of bnary com- pliments paid to him by Binary option trend indicator for his precocious inter- ests in mountains and railways and his gift for construction. Fromthis it follows that peoplecannot simply binary option brokers with 60 second options told how best to think about moral matters; they binary options trading accounts to actively experienceconflicts betweentheir current ways of thinking and the situation at hand beforethey can find better ways to process moralproblems. In the work of Jacques Lacan, Spinoza is often present in the back- ground and occasionally cited. Because the bacterial load in a patient with active tuberculosis often exceeds this, two drugs are given to reduce the likelihood of encoun- tering resistance to less than 1 in Trade binary options with metatrader. 4) and (A10. In the R-CHOP regimen developed by Czuczman and associates,77 two doses of rituximab are given before the start of Binary options trading accounts therapy, two more doses are given in the middle of the six cycles of CHOP, or severely malnourished. Suggestion et autosugges- tion. 7 Diversa ; Vol.Binary options stock signals review

This Thursday, February 19, the annual Associates Members exhibition opens at the gallery. There are currently 26 Associate Members. Spark gallery is grateful for their support. Because we want to know more about these artists they were asked to consider two questions: How does being an Associate member of Spark gallery meet your ambitions to exhibit your work? Do you have any thoughts about how Spark gallery might collaborate with the Associate members on exhibition opportunities beyond the confines of the gallery? Below are responses from several Associate members, along with samples of their art. We appreciate the time they have taken to form these responses. First of all I enjoy and support Spark – the people and being part of a co-op gallery in Denver. As a visual artist it affords me a place to show my work once a year. Being an Associate member is important to me because I still feel connected to like minded people in the art world – part of the greater good so to speak. I see Associate members as enthusiastic supporters of the gallery. I am proud of my association with Spark. Once a year all Associate Members should attend a Spark meeting. I also think being invited to show work at the Stout Street Clinic was a good idea for Associate Members. I like getting the Spark minutes. Outside the gallery we may explore the idea of doing an artist retreat – yoga and art. Being an associate member of Spark gives me two important tools; deadlines, and an opportunity to exhibit my work where it will be viewed and critiqued by other artists. I function best when there is an occasion to which I need to rise. The biannual associate shows present me with the opportunity to create and show the best of my new work. They also motivate me to get my works framed in a timely manner. Being an associate member is a great way to get my work seen, and with two babies at home the only plausible option at this time in my life. I only complete three to four paintings a year. However, I do find it sad that the associate members are not extended an invitation to partake in critiques. Being a part of an artist community should involve both having one's own work critiqued as well as looking at and hearing about other artists and their creative processes. It helps all of us grow and become better at our craft. I'd really appreciate a chance to have even an associate critique once or twice a year. I'd also like to hear from those members within the gallery who sell their works. It would be beneficial to see what sells and why. Being an Associate member of Spark allows me to be a very small part of the Denver art scene on Santa Fe Street. I value the connections with other artists as well, although I haven’t had the chance to meet many of the Spark artists yet. I also appreciate the opportunity to be able to rent the North Gallery. It has turned out to be a great venue for the Rocky Mountain Collage Society to exhibit small format shows. Exhibition opportunities beyond the confines of the gallery would seem to be whatever we would want them to be. Many art spaces often call for group shows. I don’t know, maybe a “Best of Spark”, “Spark Lights Fires”, a tribute to founding members. A project like that would need a good curator which is sometimes a sticky wicket. Some kind of benefit show would be great too. I enjoyed seeing photos of the artwork hung in the shelter space. Best from Gayle Gerson I have great regard for Spark, as does the Denver art community. I saw the current show about Spark at Pirate and attended the panel discussion about how you are the oldest co-op gallery in Denver and how much you have contributed to the Denver art scene. Impressive! Showing my work there and having my name associated with Spark is a valuable opportunity to gain recognition. Thank you! Katherine I am excited to exhibit my work at the annual Associates Show and have attached my show image per your suggestion. Being an Associate member allows me to generate additional new work and the gallery to view end results. The gallery also provides a forum for new ideas - both physically (mark making), materially (materials and process) and intellectually (new ideas, thoughts). An added benefit is that Associates are also listed on the Spark website which allows those who are interested in my work to access information through my website link. I look for venues to display my work - I like to see other's work - artists are wonderfully creative and able to generate a synergy of visual and intellectual wonder. There is a presence at Spark that is quite different from a home or commercial setting. Correct lighting, an uncluttered field of vision, a history of exhibition and different space contributes to the overall experience. Continue to include Associates in the dialogue and workings of the gallery. There are a few reasons why being an Associate member of Spark supports my artistic goals. I like being associated with a gallery whose artists maintain a consistently high quality of art. Spark is a respected gallery of long standing (35 years) and is frequently reviewed. Having a Santa Fe presence is also appealing. There are venues in Metro Denver and other cities in Colorado where proposals are sought for shows. The venues that have large gallery spaces would be suitable for shows that would include both full and associate members, i.e. Lone Tree. There could be a theme. This would reflect the diversity of the members' work around a common idea. There are many reasons for me to be an associate member at Spark. Having colleagues with strong opinions and ideas about art is one. Getting feedback on your work helps open up new directions. It also gives me a place to try out new media and new ideas. You don't have that opportunity in a regular commercial gallery. If you're not going to grow as an artist then you're going to face stagnation. Any cocoon can become a coffin if you stay in it too long. Thank You Spark Margo Linn Espenlaub The Associate Members annual group show at Spark Gallery is an ideal opportunity for me to exhibit my newest work alongside that of other artistically diverse artists. The diversity among individuals is what I appreciate most about the artists’ collective of Denver’s oldest cooperative gallery. Planning several new works for the annual group show anchors my own ongoing art process, nudging me forward into many new and challenging areas of problem-solving while working in abstraction in drawing and painting. I like this challenge and the often surprising results that emerge in my work. Generating ideas about collaborating with associate members who might want to show their work in other venues is a great idea. Perhaps this could be a topic for one of the member meetings during the coming months. Ideas generated from the meeting could then be posted to the Spark Gallery blog, or emailed to associate members for their feedback. Sharing ideas might serve to widen the interconnections for future exhibition opportunities for all members.

Airlines raised ticket prices nine times in 2011, and they seem determined to maintain or exceed that pace in 2012. Earlier this week the nation's biggest carrier, Delta Air Lines, pushed through its second fare increase of the new year. This, in a nutshell, is why consumers and government regulators should be wary of reports last week that Delta was weighing a bid for bankrupt American Airlines. Minnesotans have more than an academic interest in whether Delta buys American. The Twin Cities is one of Delta's largest hubs, and the Atlanta-based company has more than 12,000 employees in the state. Even if the Twin Cities hub were preserved after such a merger, some of those jobs would be at risk as the airline would likely search for the elusive synergy that accompanies such mega acquisitions, according to longtime airline analyst Ray Neidl at the Maxim Group. For its part, the Atlanta-based carrier has declined to comment on speculation that, on the surface, seems preposterous. Then again, the prospect of regulators approving a marriage between Delta and Northwest also seemed far-fetched at one time. Could Delta's CEO, Richard Anderson, pull off another merger miracle with the much larger American? Probably, but a better question to ask is why government regulators would ever give him the chance. Any deal that allows either Delta or US Airways to use American to fortify its defenses against competition would be bad for consumers all around. I can almost hear some travelers wondering how things could possibly get worse. But as much as consumers like to gripe about the cost and the hassle of flying, the truth is they have never had it so good. Adjusted for inflation, and despite some sharp increases in the past two years, average domestic airfares have fallen 16 percent since 1995, even after factoring in baggage fees. Strip those out, and the price decline is 21 percent. Prices are even down at fortress hubs like the Twin Cities, Detroit and Atlanta. Those airports may still be dominated by one carrier, but low-cost carriers are making greater inroads. In the Twin Cities, 10 percent of travelers flew on a low-cost airline, up from 7 percent a few years ago. Despite those gains, a revisionist history of the airline industry has begun to emerge in recent years that says, in short, that deregulation of the industry in 1979 was a mistake. It's certainly been tough on airlines, particularly the "legacy" carriers like Northwest, Delta, American and United. Before deregulation, competition was minimal to nonexistent, and prices -- set by government bureaucrats -- ensured a healthy profit. Since then, not so much. University of California economist Severin Borenstein, a frequent adviser on airline mergers, says that U.S. airlines lost $60 billion in the 30 years ending in 2009. More than 150 carriers have gone bankrupt, including six of the 10 largest U.S. airlines by passenger volume. That's been brutal for airline workers. In the last decade alone, the industry shed some 135,000 jobs, or 25 percent of its workforce. Those who remain are likely working for lower pay and reduced benefits. But don't think this means that it's impossible to make money flying people to and fro. More people than ever are flying, and some airlines, like Southwest and JetBlue, consistently make money. The old argument, that low-cost carriers can do this because they don't have same legacy costs as the older airlines, no longer applies. Delta, United and US Airways have used bankruptcy to shed or shrink those costs, and American is now trying to do the same. The low-cost carriers have succeeded, in part, by recognizing that an airline seat is a commodity. They have built their business plan and entire operation around the notion of selling that seat at as low a cost as possible. Delta, American and United have a different business model. They maintain much more costly hub-and-spoke systems. They are less comfortable competing on price than they are on the reach of their networks, the ability to get you from one place in the world to another. These networks, which include international alliances that allow price-fixing among otherwise competing airlines, also provide a formidable defense against competition. Here's another way to think of it, courtesy Borenstein: "The big airlines use their network advantage to exclude competition." For that reason alone, Borenstein remains skeptical that regulators would ever approve a Delta merger with American. Let's hope he's right. email@example.com • 612-673-1736

VTB Bank Branch in Shanghai held an international conference VTB Group: Synergy of the Bank and Business in China, during which the participants discussed latest changes in the policy of the People's Republic of China on using payments denominated in national currencies and new opportunities of trade financing between Russia and China. Over 100 representatives of Russian and Chinese companies attended the event, including VTB top managers: Gurinder Nihal, Senior Vice President and Head of Global Transaction Banking, and Chaba Zentai, Senior Vice President and Head of Regional Network Department. VTB representatives informed the audience on the new products and services offered by the bank’s Shanghai branch, and joint decision of VTB Group’s banks on trade financing for the People's Republic of China, Russian Federation, and the CIS customers. | Alexander Milyukov, Manager of Shanghai Branch “The Chinese market is of paramount importance to us. In 2008 we made a serious decision to enter the Chinese market and to remain there for a long time; thus we became the first Russian bank operating in the country with one of the most fast-growing economies of the world. Today we not only back commercial operations of the two countries, but also provide a set of banking services whose number is rapidly growing” - Alexander Milyukov, Manager of Shanghai Branch, said in his speech.VTB Bank’s partners in China - Chinese financial institutions such as China Foreign Exchange Trade System, Sinosure China Export and Credit Insurance Corporation, Harbin Bank - also attended the conference. Active work of existing and potential clients from Russia, the People’s Republic of China, and the CIS in the interactive sessions of the conference agenda, variety of topics discussed, and case study analysis based on a group of transactions proved the efficiency of VTB Group’s synergy in the PRC, which contributes to improving the services provided to international trade of China with Russia, the CIS and Georgia. In the second half of 2012 VTB Bank Branch in Shanghai plans to start operations in Chinese yuan, meanwhile that conference has become a good platform for the presentation of new promising products, including international settlements and financing in Chinese yuan and ruble-denominated transactions for its Chinese customers. JSC VTB Bank with its subsidiaries (VTB Group or the Group) form a leading Russian financial group offering a wide range of banking services across Russia, the CIS region, and in the countries of Western Europe, Asia and Africa.The bank’s core shareholder is the Russian government holding 75.5% stake in the Group’s equity through the Federal Agency for State Property Management.VTB Bank Branch in Shanghai (China) started operations in March 2008. It is the first branch of a Russian bank in the territory of the People’s Republic of China. Its core tasks are to service goods turnover between Russia and China, foreign trade operations of Russian companies developing their business in China, as well as Chinese companies operating in the Russian market.

Vice President, Pat Burns; President, Jim Rodway; and Chief Financial Officer, Mark Auxier. PATRICK LUMBER Is ‘Taking Care Of Business,’ The Traditional Way By Wayne Miller Portland, Ore.—Patrick Lumber Co., located here, is approaching a remarkable 100th anniversary, having been founded in 1915. The company’s Vice President Dave Halsey said he attributes years of the firm’s success to carefully held traditions. “Business traditions are important. Integrity and making good transactions while taking care of our customers and watching out for our supplier sawmills at the same time—that culture has been handed down throughout the years here at Patrick Lumber Co.,” he said. The Company offers Hardwood lumber in Alder, Western Maple and Mahogany. Softwood species available include douglas fir, cedar, pine, and western hemlock. In 1960 Jack Madden became the president of Patrick Lumber Co. and implemented a focus on the growing export market. The firm’s growth continued as Jack Patrick took the reigns as president in the late 1960’s providing natural resources to naval bases in the Vietnam War. Throughout the ‘70’s, Patrick Lumber continued to expand their export market by building business relationships in Italy, Greece and Australia. Patrick Lumber Company’s sales team: Dave Menkens, Mike Foster, and Vice President, Dave Halsey (Not in phot Brad Mehl, John Quast, and Chris Re). Founded by Charles Patrick and William Brushoff, Patrick Lumber Co. has been built on relationships according to Halsey. “In 1922 they helped form the Portland Wholesale Lumber Association (PWLA),” he explained. Madden joined Patrick in 1943. He built upon his close relationships, having previously been employed by the West Coast Lumber Inspection Bureau. Jack Patrick, one of the founder’s sons, worked alongside Madden and the two helped the rapid growth of America’s booming construction industry. Patrick currently markets its products to distributors and manufacturers worldwide. Extra care is taken to ensure products arrive to their customers in the best possible condition. “We use a specialized custom-wrapping process to package and ship our products,” Halsey mentioned. “We also maintain very high grading standards for our production.” Current President of Patrick Lumber, Jim Rodway, explained reasons for the company’s continued success in both domestic and export markets. “We’ve maintained a presence in certain markets that we’ve served for a long time because we are committed to them. When their markets are bad, we continue to strive for success in those markets,” he said. “So when things get going again, we will be in a good position. We don’t jump in and out of markets based on activity levels. We stay with them, sink or swim.” (Front Row) Chelsea Schureman, Martha Kessler, and Jessica Teasdale. (Back Row) Christy Biron, Michelle Small, Tricia McCauley, and Gaby White (Not in Phot Danny Song). Vice President Pat Burns, who is also the grandson of Charles Patrick, one of the company’s founders, said the firm seeks diversity within each market. “It’s an asset for us to offer diversity; it creates buying opportunities that we would not have if we were strictly focusing on U.S. or export markets.” When it comes to experience and knowledge of their markets, Burns said an important fact is that every shareholder of Patrick Lumber works at the company everyday. “You can not be a shareholder unless you’re an employee. Jim is in the export market everyday,” he said of the company’s president. “His intricate knowledge of each market helps us identify different opportunities and strengths.” Including Halsey, Rodway and Burns, the firm’s sales team also consists of Dave Menkens, Mike Foster, Brad Mehl, John Quast and Chris Re. Mark Auxier is the company’s chief financial officer. Most members of the seasoned team have each chalked up more than 20 years experience in the lumber industry. Dave Menkens, who’s been with Patrick Lumber for the past seven years, has 20 plus years of experience. “Experience is hard to beat, especially when you’ve got people here that this is the only job they’ve had, working for this company,” he said referring to Jim Rodway and Pat Burns. “When you see the people that have been here their entire career, it shows they have a lot of belief in this company.” Vice President of Sales Dave Halsey in Oregon next to load of Douglas Fir, cutting timbers up to 52’ long. Menkens continued to emphasize that the philosophy at Patrick Lumber is part of what makes it work. “We look at things differently here. Our goal is to take care of the customer. We want to give them the best available product, whether it’s size, quality or a special request, we’re here for them,” he explained. “Essentially we work as a division of our customer’s business and as a division of our supplier too. Everything that we do as individuals benefits all of us in the future.” Also with 20 years experience, Mike Foster offered, “We all have our own niches coming from diversified backgrounds. When we talk about what we do, we commonly use the word ‘synergy.’ It’s a phenomenal thing between us, where you have combined knowledge that is sometimes more functional than individual knowledge. Elaborating on what Dave said, our responsibility here is two-pronged—one is to service our customer base and the other is to service our supplier base. On the customer side we’re always trying to maintain the information flow as far as what’s going on and what we can be a part of. The other side of that is to be in touch with our sawmills, understanding what they need to move, what products they have specials on, etc. As wholesalers we have the ability to convert that information and bring them together. We fill that gap bringing value to both the sawmills and the customers. We have good long term relations with both by operating an honest business that is beneficial to all.” High grade Cedar logs at one of Patrick Lumber’s partner mills on Vancouver Island, B.C. “You establish a reputation over the years that stays with you. Our portion of success and our reputation is good,” Jim Rodway said. “This business is about relationships. That’s a big deal. I think our company’s biggest assets are the tenure of our employees. We have staff that has been here over 30 years, traders that have been here the same amount of time. That bodes well for our suppliers and our customers because they have confidence in our ability to perform and execute the transactions as we’ve laid them out. It’s all in the details.” Patrick Lumber Co. is a member of the National Hardwood Lumber Association (NHLA), Portland Wholesale Lumber Association (PWLA) and the North American Wholesale Lumber Association (NAWLA). For more information visit www.patlbr.com. Patrick Lumber’s employees inspecting Western Red Cedar VG Clears outside of the kiln. Laminated beams produced from Patrick Lumber Company being installed at the Chicago Zoo. Patrick Lumber Company helps their local community and continues to donate wood products to organizations such as the Boy Scouts of America, Portland Public Schools, Habitat for Humanity, and The Blanchet House. The Blanchet House Farm is shown here, where members of the organization are using Patrick’s donated lumber to build furniture.

As a 40-something liberal vegetarian living within walking distance of Takoma Park, Maryland (the Berkeley of the east!), I am contractually obligated to own a Toyota Prius (if I had a VW bus with a “Love Your Mother” bumper sticker, it would have been grandfathered in). The Prius, a hybrid gas/electric car, has what’s known as a “sweet spot,” a speed at which you’re getting optimum mileage while operating at maximum efficiency. The sweet spot usually sits between 35-45 miles per hour, which is why most people hate to drive behind Priuses on the highway. Why am I telling you, dear reader, about my personal driving habits? Because it occurred to me, as I was slowly—but efficiently!—making my way towards the Blue Corona offices yesterday morning, that the “sweet spot” is an idea that also applies to the mix of SEO and paid search for small business websites. The SEO/PPC Sweet Spot You can choose to rely solely on SEO to increase traffic to your site. We have clients who do so, and it typically works well, particularly when it is continually tracked and tweaked over time. However, adding PPC to your inbound marketing strategy can amp up your results quickly—it’s like stepping on the gas. PPC maximizes your ranking power by giving you more real estate on the search engine results page (SERP). A paid ad, targeted to a specific search term, appearing alongside your organic result boosts your SERP visibility. This boost leads to higher perceived authority—seeing you in more prime spots increases your esteem in the eye of the searcher. In traditional marketing terms, we call this building brand awareness. PPC Gas Gets You There Faster If you are new to the inbound marketing game and want to ramp up your efforts quickly, PPC is a great way to do it. Your paid ads can be developed and launched with minimal lead time, which means you get in front of your target market fast. This, in turn, accelerates your results, allowing you to see a bump in traffic while your SEO campaign gains momentum. In addition, the user data you gain from your PPC campaign results—what keywords and search terms work best with your targeted demographic—can add fuel to your SEO strategy to help it perform better. But PPC doesn’t stop at click-through. The visitor needs to get a positive and useful experience once they land on your site if you want them to convert. SEO is more than content or text. It’s an overall strategy that powers your site design, speed, and navigation, along with content, to engage your visitors no matter what road they took to get to you. Organic + Paid Data Synergy Keywords that rank high in organic search for your site can be used to increase the power of your paid ads. In addition, when you know which of your site’s pages perform best organically, you can use that data to direct PPC ads to those pages for higher conversion rates. Using SEO data will help improve your PPC Quality Scores. For fully-charged inbound marketing results, you want a hybrid engine with the power of SEO and PPC. Blue Corona can analyze your site to find the sweet spot. Just enter your web address in the form below. About The Author: Lexie serves as Blue Corona's Content Marketing Manager. She's also the author of our soon-to-be famous, and someday to be written white paper, "Horse Hat SEO: Giddy-Up Your Google Rankings." View more blogs by Lexie Bond “I used to get a couple form submissions a year—and it was all spam. Now, we’re getting leads—and they’re qualified! You can find an SEO company anywhere. With Blue Corona, you get an account rep that’s there for you. I know there’s somebody looking out for our website and helping us grow. ”

Sign up for our newsletters Receive the latest in Footwear, Fashion, Music and Creativity in our newsletters. Quelle Chris’s Shotgun & Sleek Rifle album will be in stores November 15 via Synergy Works. Although newer fans may know of Quelle Chris through his production for Danny Brown’s XXX and The Hybrid albums, Quelle is a top-notch MC. He fits perfectly over his own production and has a unique and powerful voice, who’s been rapping for years with his Crown-Nation crew. Today, enjoy the official music video to the song “Symbolic (Basquiat)” featuring Crown-Nation member, Denmark. The song was produced by Quelle Chris and is the first single to his album Shotgun & Sleek Rifle, with the B-side “Shotgun” featuring Danny Brown and Roc Marciano. Peep below!

wholesale mac makeup distributors Attractive Fashion Opv7OhLY7J Outlet Online mac gel eyeliner brush 2016 Discount Cosmetics Dior Bright Color Blush With Dream 1748 based on 58170 customer reviews ds that happen to be usually not which means good quality. “The latest acting admin mentioned that it may be some difficulty for my little one who UNCCD don’t obtain that much recognition on the grounds that UNFCCC, a second NOT traditions when considering weather factors modification. “It will be lousy toddler, inches believed Barbut, putting in who assigned usually the misperception concerning overseas have an effect on from desertification, typically the means might end up being acceptable, nevertheless it really is throughout their intend to heighten people figuring out of desertificatio myer mac cosmetics cheap mac makeup free shipping n throughout synergy by using multimedia. “People prefer to express what’s in connection with these products virtually all, inches this lady believed, “If most people draw food stuff along with the water regular in a platform of this products take into account towns, cities, they don’t really realize the drawback from acquire wreckage, from the water deficiency serves as a enormous concern. “The acknowledged believed the conver. Price: $7.83Special Price: $1.35 Save: 43% off acecraft, a fabulous Huge Breathing space A setting, using cutting edge technological inventions want sunlight electric utility propulsion, discover, nice and additionally shoring together with Mars excursion used car. “I’m very happy to account which usually succeed was already underway located at NASA concerning nearly four for the four imperative issues and then the 5th — complex propulsion — is currently being transported front via an effective union by U. s enterprise, inch Bolden talked about. Notably, all the NASA the main one referred to that the Breathing space Unveil Bodies enhancer passed a main place try shooting for 03 and in addition Orion previously had an remarkably triumphant try travel fo mac makeup brush set limited edition mac lipstick r The fall of. Endure, NASA should dispatch a fabulous lander often known as Information into so next month to examine all the foremost for the White Society and also cutting edge Mars rover, that should be marketed with regard to 2020, should just for when cache an illustration just for down the roa. Price: $3.62Special Price: $9.62 Save: 63% off partner’s insurance protection. inches believed Khaled Meshaal, Hamas Alpha dog. Typically the escalation seems of having gotten abroad recognition. At this point, New york appears saving Israel’s most suitable, for the reason that European representatives assert, towards emerge spine by people involved heating because of it again. And yet commanders because of europe and the Us are labeling when considering constraint because of at duration ends. “I morning surprised by the latest influx from assault with containing engulfed Gaza, southerly Israel and then any Gulf Commercial lender, among them Distance Jerusale mac replica wholesale mac cosmetics tutorial m. This unique are probably essentially the most essential reports the spot has faced head on massive. inches believed Suspend Ki-Moon, NOT Admin Total. Admin Suspend seems to have necessary a certain instant ending up in the exact UN’s Security measure Authorities. Suspend has recently wanted to recognise Egypt’s Chief executive Abdel Fatah al-Sisi towards mediate belonging to the only two ends, love it. Price: $7.86Special Price: $7.17 Save: 66% off bility amount is usually increased through the land, tasks involving preventing terrorism won’t merely slide for the back involving police force. Tiongkok can be mobilizing your means inside the total land. Getting in touch with terrorism the normal opposing forces in the the sexes, Us president Xi Jinping pressed individuals to develop a new “wall concerned with bronze along with iron” that you can deal with terrorism. “(We must) create terrorists develop into similar to test subjects scurrying on a new block, using anyone yelling ‘beat these customers! ‘” Xi explained at typically the class analyze period in country wide stability in addition to cultural steadiness with the Politics Agency from the Communist Bash involving Tiongkok Core Panel during the entire spring. As being a most up-to-date demonstrate involving average man or woman electrical power, with regards to more rather than 200, 000 volunteers throughout Shanghai ended up mobilized that will help shield stability with the last smt from the Seminar in Connection along using Assurance. mac cosmetics uk With Discount Price Free Delivery Worldwide! mac danmark,benefit cosmetic sale Free Shipping Worldwide! mac makeup academy,Just Reduced mac win win lipstick Monster Beats On Sale With Free Shipping benefit big beautiful eyes More discount, please open the site: macmakeupsale www.maccosmetics.com - como ser revendedora mac cosmetics Wholesale Free Shipping ATPYO 675 Yen Sao Can Gio - welches mac make up Making Life Easier For The Population ATWJ2 288 Chameleons101 - mac creme d nude lipstick With An Incredible Range Of Styles And Looks NANOK 179 - imesh for mac Free Shipping On NLINT 617 – Welcome to Alphonsa High School - mac lip gloss price 2014 Cheapest CGF1L 492 Lexham Estate - mac cosmetics outlet Modern And Elegant In Fashion EURGP 588 – Designer interactive platform – communication design to share their happiness Designer interactive platform – communication design to share their happiness - mac pudra 2014 Cheapest Beats 9XPBX 988

Kunnen nieuwe enzymen en cellen worden ontwikkeld om huidige enzym-cocktailste verbeteren? |Financiering||NWO Grant Industriële Biotechnologie| In the coming decade the Biotech industry will invest strongly in new technology for the use of biomass in the production of chemical building blocks.This is the result of political and socio-economical pressure together with a steady decline in the availability of conventional petrochemical resources. The most critical aspect in the effort for the use of biomass in bio-based production is the need for enzymes capable of efficient and complete degradation of a wide variety of biomass. Current enzyme cocktails can only process a substantial part of the biomass but a significant percentage of biomass stays recalcitrant in current degradation approaches, leading to significant economic losses in feedstock-to-product conversion. The Filazyme consortium aims at contributing new enzymes and cell factories that can upgrade current enzyme cocktails towards complete degradation of biomass. The project is focused on new aspects of protein secretion in a commonly used filamentous fungal cell factory, Aspergillus and the development of a promising new filamentous bacterial cell factory, Streptomyces. Significant synergy is expected in reaching the final project goals by using these highly complementary cell factory platforms. Furthermore new enzymes will be identified, expressed and isolated to complement current enzyme cocktails. Fermentation protocols will be setup for the production of the enzymes at industrial relevant scale. The project entices participants representing the whole value chain from academia, to research institutes, to enzyme suppliers and end-users. The latter are innovative SME companies, representing the driving force in the new value chains within the bio-based economy. The project consists of a transnational consortium with participants from Northern and Southern European and upcoming near East markets, allowing penetration of the results of the research in areas with considerable and diverse growth potential.

Paid Search/Online Ads Archives - Bruce Clay, Inc. BlogSeptember 28, 2016 With a keynote delivered by Googlers (complete with product announcements!), it’s a full house at SMX East 2016. Jerry Dischler, Vice President of Product Management, and Babak Pahlavan, Senior Director of Measurement & Analytics Google, field questions from Search Engine Land editors Ginny Marvin, Greg Sterling and the SMX audience. Read on to learn about: • Expanded text ads • Device bidding • Store visits • Audience Suite • Data Studio • Analytics Insights Cards • And announcements of new tools and features! September 27, 2016 When it comes to driving retail sales online, Google is the biggest game in town but it isn’t the only game in town. Revenue is revenue and you’re leaving money on the table if you don’t explore possibilities beyond Google. SEM pros Chris Humber and Elizabeth Marsten leverage Amazon, Pinterest, Facebook and more to drive traffic and sales. Read on for their ecommerce expertise. There are more than 1.2 million advertisers in the Google Search Network. With so many business and brands competing to show up in paid search ads, how can you stand out? Standing out is something search engine marketing leaders Pauline Jakober, Virginia Tonning and Marty Weintraub spend a lot of time thinking about. From tips to crafting headlines to the results of testing ad copy to the effect of ad extensions, these three shared their insights and tips at SMX East 2016 through case studies and experience. Here’s what they had to say. July 20, 2016 Whether you’re doing the asking or the answering, both sides of the desk can use these PPC interview questions to get ready for an upcoming interview. Need guidance on what to ask to assess a potential SEM analyst’s experience and expertise? I sat down with our PPC analysts and the person in charge of hiring for pay-per-click services roles here at BCI to get the inside track. So you can prepare using our own 25 PPC interview questions! June 13, 2016 Szetela’s Scoop! Microsoft’s LinkedIn News May Imply More than LinkedIn Ad Integration for Bing Advertisers Microsoft’s announced acquisition of LinkedIn today has already sent ripples through the advertising industry. Marketers are predicting (or hoping) that the LinkedIn ad platform will be merged with Bing Ads, allowing PPC advertisers to run Bing Ads and LinkedIn ad campaigns from the same dashboard. I think the acquisition could actually be the cornerstone of an important new Bing Ads strategy: the creation and expansion of a Microsoft Display Network. Read Szetela’s Scoop. May 26, 2016 This week at the Google Performance Summit keynote we were introduced to a “completely re-imagined and rebuilt” AdWords system for a “mobile-first world.” - Bigger text ads that get clicked more often - Ability to fine-tune your bidding by device type - Map ads that draw in mobile searchers near your store - New technology that better ties ad clicks to in-store visits - Ability to create similar audiences for search ad targeting That and more is what’s coming to AdWords advertisers following announcements this past Tuesday. For our PPC SEM services clients and others, we’ll walk through the exciting opportunities coming out of Google Performance Summit. Read more and find out Why the Coming Google AdWords Changes Are Mobile Advertising Game-changers! April 7, 2016 Last Thursday on Reddit, David Szetela offered an AMA to the r/PPC community. An AMA, or “Ask Me Anything,” is just that — an anything goes Q&A with someone of some interest, whether a celebrity, an expert, or someone with a unique role or experience set. David, our VP of Search Marketing Operations and the director of our PPC services, kept it short and sweet, opening the floor to questions for an hour. Then we talked about highlights on our podcast SEM Synergy this week. Give it a listen or read a transcript-recap here. As David described, it was a conversation marked by diverse PPC topics. Read the question and answers in Paid Search Ask Me Anything — An Hour of Q&A with David Szetela. March 4, 2016 Get our liveblog coverage of this SMX West session all about shopping campaign management and optimizations. Kirk Williams (@PPCKirk) outlines an ideal campaign setup that relies on four essential filters: campaign priority, negative keywords, shared budget and product bids. Purna Virji (@purnavirji) covers a Paris Hilton inspired trio of shopping campaign optimization: feed optimization, creative optimization and defensive strategy. Susan Wenograd (@susanedub) offers her tips for controlling the fire hose that is the shopping campaign, via query mapping, negative keywords and custom labels, and evaluating mobile user performance based on distance from physical storefronts. March 3, 2016 In this SMX West session of Q&A for PPC lovers, questions covered include: How do you think speech search will impact ads? How do you find work-life balance? How do you create space with your clients? How do you manage clients? What tools do you use? Video ad tips, strategies, success stories? What is the biggest weakness in the PPC industry? Suggestions for testing text ads? If you can do precise audience targeting, you can have more control over who sees your ads — and get more conversions for your marketing buck! In this in-depth SMX West 2016 session, we’ll find out how to use advanced targeting techniques like remarketing lists, custom affinity lists, YouTube remarketing and more. The goal is to maximize your ad campaign ROI. Speakers Joseph Kerschbaum, Mark Irvine and Amy Bishop give in-depth task lists and examples for marketers to follow. Dive in to learn more: Advanced Audience Targeting liveblog from SMX West

When Michigan star big man Mitch McGary shut himself down and elected to have back surgery in late December, it was easy to put Michigan in the also-ran category of the Big Ten. Even with McGary, the Wolverines were 6-4 and destined for the bubble. Five weeks later, the narrative has completely changed in Ann Arbor. The Wolverines have won seven straight, are off to a perfect 5-0 start in the Big Ten after a signature win at Wisconsin on Saturday and have reentered the Top 25. The timing of McGary going out just so happened to occur as John Beilein's reinvention of his offense took off. Maybe it's a coincidence—maybe it's not—but what's become clear is that McGary was probably not going to be the key to this team's success and his fill-ins (Jon Horford and Jordan Morgan) aren't as big a drop-off as one might believe. "Now there's just consistency and people have been in their roles now for over a month," Beilein said on Monday during the Big Ten conference call. "It's been five weeks since he played a game, so we've had five weeks to just get a rhythm about who's playing, where they're playing and how they're playing." Going into the season, McGary figured to be one of the most consistent pieces for the Wolverines. The key to Michigan's season, the thought had been, was going to be how freshman point guard Derrick Walton would assume the responsibilities of Trey Burke. Almost everything ran through Burke a year ago, and the point guard had been key to Michigan's success for three straight seasons with Darius Morris as a sophomore in 2010-11 carrying a heavy load as well. Instead of putting all that pressure on Walton, Beilein has spread the wealth when it comes to play-making responsibilities, and in the process, the Wolverines have become tougher to guard. Last season, opposing coaches knew they were going to need to figure out how to contain Burke and they also had to game-plan for Tim Hardaway Jr. Almost everything was initiated and created by those two. This season, defenses have to be ready for Nik Stauskas, Caris LeVert, Glenn Robinson III and Walton, who are all capable playing multiple roles in the offense that include creator, driver and shooter. "We have multiple pick-and-roll men, probably more than we've ever had," Beilein said. "We usually have one or two, and we have four or five right now and that really has been a good change for us. It takes the ball out of the point guard's hands a little more than normal." This isn't just coach-speak. The numbers show how much Michigan has shared responsibility as far as who is the main handler in pick-and-roll offense as opposed to last season. |P&R Handler (12-13)||% of time| |Tim Hardaway Jr.||19.3| |P&R Handler (13-14)||% of time| |Derrick Walton Jr.||15.6| |Glenn Robinson III||9.5| Synergy Sports Technology As the third man in the play-making pecking order, Walton has continued to get more comfortable in the offense, and Beilein has been able to give him more responsibility at his own pace. "There's many times he just provides space for us," Beilein said. "If you look at his three-point shooting numbers, it's really good. They cannot lay off of him, so sometimes he's just standing in the corner. We want him to be there, so he's a stationary target we can hit as we read what we call the fifth defender. The guy furthest away from the ball has to decide whether he's going to help on the pick-and-roll or stay with Derrick." The corner was a spot that was usually reserved for Robinson or Stauskas last season. It's a low-responsibility, high-reward position because you're either a decoy or a spot-up shooter who gets open looks. That's why Robinson was such a highly efficient scorer in limited opportunities as a freshman. That spot is still extremely important because Michigan gets a higher percentage of its shots from spot-ups (29.4 percent of attempts, according to Synergy Sports Technology's numbers) than any other play type. On Saturday at Wisconsin, Walton was barely involved in the offense (two points on three shots), but he was still a key presence. As Beilein said, his ability as a three-point shooter—he's a solid 36.2 percent—helps space the floor. And when the fifth defender decides to help off Walton, he's not just a candidate to hit the spot-up jumper. He also gives Michigan another option as a driver. That's what he did in the sequence below when LeVert found him open in the corner. Walton penetrated and pitched it back out to LeVert for three. Michigan's recent run is not just Walton getting more comfortable in his skin. The same has happened for Robinson, Stauskas, LeVert and freshman Zak Irvin. Robinson is capitalizing on more opportunities, averaging 15.1 points over the last seven games with an effective field goal percentage of 60.8 percent. Stauskas has embraced his role as the go-to man. He ended Wisconsin's comeback bid when Beilein gave him the ball in an iso play and he buried a step-back three that was so cold-blooded it brought back memories of Burke. LeVert has gone from energy bench guy last season to a reliable scorer (12.0 points per game) and facilitator (2.9 assists per game, which is second on the team). And Irvin has become a dangerous bench scorer who occasionally erupts—he made five threes in the Big Ten opener at Minnesota. I'm not ready to declare that the Wolverines are capable of going on another Final Four run, but they are closer to the equal of last year's squad than you'd think. For instance, Michigan's adjusted offensive efficiency is 120.3, which is identical to last year's team, according to KenPom.com. The schedule has helped, as Michigan didn't have to face any of the Big Ten's elite until Wisconsin, and that was a Wisconsin team that was a bit shaken coming off a loss to Indiana and not playing great on the defensive end. The Wolverines will really be tested this week with two Top 10 matchups against No. 10 Iowa at home on Wednesday and at No. 3 Michigan State on Saturday. If you had looked forward a month ago after McGary went out, this week's games would likely have been thought to be automatic losses. Instead, Beilein has a team that can score with anybody. Win one of two this week, and the Wolverines will be in prime position to contend for a Big Ten title. That's a reality that only seemed possible this year if (and only if) McGary continued his rise to superstardom. C.J. Moore covers college basketball for Bleacher Report. You can follow him on Twitter @cjmoore4.

2011 Cambodia: Evaluation of Adolescent and Youth Participation in UNICEF Cambodia Author: Henry R. Ruiz “With the aim to continuously improve transparency and use of evaluation, UNICEF Evaluation Office manages the "Global Evaluation Reports Oversight System". Within this system, an external independent company reviews and rates all evaluation reports. Please ensure that you check the quality of this evaluation report, whether it is “Outstanding”, “Good”, “Almost Satisfactory” or “Unsatisfactory” before using it. You will find the link to the quality rating below, labelled as ‘Part 3’ of the report.” Cambodia has one of the youngest populations in Southeast Asia, with two out of every three people aged below 25 and 32. This young population brings with it both enormous possibilities and complex development challenges . Despite its huge number, Cambodia’s children and youth remain under-represented in many social undertakings at the national, sub-national, commune and village levels because of a society predominantly characterized by hierarchical and patron-client relationships. The voice of children and youth is rarely heard or taken into consideration in planning, resource allocation, and decision-making processes. At both national and sub-national levels, there are limited institutionalized structures and mechanisms that allow their participation in these processes. Meanwhile, there have not been many initiatives to promote child and youth participation (CYP) in informal sectors such as home, play and work spaces, as well as schools. UNICEF is committed to building partnerships that promote participation of children and youth in programmes and decision-making processes that affect their lives. One of the key result areas in the UNICEF 2006-2013 Medium-Term Strategic Plan’s is institutionalized participation of children and young people in civic life which has two organisational targets: • Establishment of national child and youth policies that advance positive and holistic child and adolescent development, and that institutionalise participation of young people in policy development and community life; and • Improved capacity of children and adolescents to actively participate in decision-making processes that affect them at policy and community levels. These key result areas (KRA) and targets are parts of the fifth Focus Area of the UNICEF’s Medium-Term Strategic Plan (MTSP) which is Policy Advocacy and Partnerships for Children’s Rights. In support of the above challenge and in consistency with the MTSP goals, UNICEF Cambodia’s Country Programme Action Plan (CPAP) 2006-2010 included a component on children and youth participation under its Advocacy and Social Mobilization (ASM) Programme. The component is committed to achieve the following expected output with a corresponding indicator: • Increased opportunities for the participation of children and young people to exercise their right to express their views and be involved in the decisions affecting their lives under all the programmes. • Percentage of the projects having substantial child and youth participation components/activities. The evaluation aims to respond to a number of questions related to effectiveness and impact of the programmes against stated objectives and of programming approaches employed. The evaluation also examines the links of these programmes to national and UNICEF strategic priorities related to child and youth participation, as well as, quality of partnership. This exercise specifically seeks to address the following objectives: 1. To review and analyze the accomplishments and level and quality of participation of the four UNICEF-supported adolescent and youth participation projects implemented within UNICEF-Cambodia’s CPAP 2006-2010. 2. To evaluate the above four programmes with focus on: • Relevance to national and UNICEF priorities • Effectiveness in achieving stated objectives • Impact of each of the projects • Efficiency of approaches (as appropriate) • Sustainability of the projects The evaluation of the four projects was also guided by the extent of application of UNICEF’s general standard and principles in working with children and youth, as follows: • child-friendly environment 3. To identify and highlight the best practices from each of the four projects, if any, and lessons learned for future documentation 4. To generate recommendations for future improvement of the individual project, including recommendations on what and how UNICEF could engage with areas of work addressing issues of adolescents and young people with UN and the government. The selection of evaluation sites and respondents employed a combination of purposive and stratified sampling methodology to ensure that substantial information were generated from the data collection approaches used. The criteria for the selection of sites and respondents were agreed on with UNICEF and partners. The process had to deal with the fact that these projects ended six months ago so that it was easy to gather the adolescents and youth in one meeting. The level of difficulty in gathering the respondents to a FGD was greater amongst the parents who had to work in the rice fields to take advantage of the rainy season. The other difficulty was tracking down the field workers who may have been employed elsewhere. Findings and Conclusions: The evaluation found that the four AYP projects generated adolescent and youth participation in varying degrees of achievement despite cultural, economic, political factors seemingly unfavorable to young Cambodian boys and girls. There were strong elements of participation in some projects not present in others. In general, the strongest participation was in action or accomplishment of their projects and weakest in assessment and analysis and in advocacy and articulation. This may be attributed to the agency’s inadequate understanding of the principles and practice of participation. Lack of relevant guide materials, manuals, or training packages on the principles and standards of participation is another reason. There were evidences showing that the four projects appeared to be adult-led and adult-driven. The stories of adolescent and youth respondents showed that the impact of participation on them was strongest in the enhancement of their skills related to the project, their expressive ability, fighting off feelings of timidity and shyness leading to self-esteem and self-confidence, their social interaction skills and expansion of friends, better school performance, and better relationship with adults particularly with parents. The sustainability aspect of the projects is a big issue. Three projects discontinued upon withdrawal of UNICEF assistance. One of them managed to persist because of an external support. All of the projects appeared to be donor-dependent. The projects are limited to participation in media and participation in the communes as opposed to many other types and settings of participation such as school, family, caring institutions, etc. There was not enough evidence to show that the projects fully addressed equity issues in the project coverage. The four projects tend to focus on older adolescents and youth inadvertently disregarding the participation of younger children under 15 years of age, who have the same right as the older children based on the CRC. There is a strong tendency to create elite groups of articulate and smart young boys and girls in the community because of preference for the best members that could potentially produce the best results. This may have worked to the disadvantage of disadvantaged groups who may have desired to get involved in the projects but did not possess the qualifications. There was no particular gender issue in the four projects. The projects have no child protection policy. The protection and safety of the adolescents and youth while engaged in project activities did not come out as a key concern among the projects. One of the reasons given was that there has not been any protection issue happening in the past and because of commonly perceived peace and safety in the kingdom. Measuring the results of the interventions is a challenge because of the absence of baseline data and that the statement of goals and objectives of all the four projects could have been more results-oriented and formulated in “SMART” way. AYP programming in UNICEF Cambodia In the previous country programme of UNICEF Cambodia (CPAP 2006-2010), the evaluation found that AYP appeared to be treated as “projects”, such as: youth in the radio, youth on TV, youth in the commune council and youth in the promotion of child rights. AYP was principally considered a responsibility of a specific section, the Advocacy and Social Mobilization Programme. In the CPAP results matrix, AYP was not considered a key result area. The mid-term evaluation of the same CPAP recommended greater attention to capacity development of adolescents and youth groups particularly in taking community action in analyzing their situation, finding local solutions, demanding basic services and monitoring the delivery of quality basic services. The evaluation found that this was barely addressed in the succeeding years. In the current country programme of UNICEF Cambodia (CPAP 2011-2015), the evaluation found that AYP has now been considered under cross-sector support to facilitate the planning, coordination, monitoring, evaluation and operations of participation across sectors in the entire country programme. However, AYP is still not regarded as a key progress indicator and is still largely considered the responsibility of one section, namely, Policy Advocacy and communication (PAC). A focal point has been designated and sent to training. Currently, there are no discreet AYP projects being supported by the office. Based on the questionnaires submitted by the various sections of the office, AYP has not yet been effectively integrated into the current country programme. As a continuation of previous partnerships in the last Country Programme, AYP is presently focused on collaboration with the UN system and the Youth Section of the MoEYS on the drafting and approval of the National Youth Policy, at the initial stage, and now on the implementation of the Policy. The evaluation recommends that the four project documents be redesigned to make them more rights-based, vision of adolescent youth and participation clearly articulated and well-defined, goals and objected stated using SMART as standards, outcome indicators consistent with the principles of genuine participation, and choice of strategies empowering. Targeting the project beneficiaries or participants should address the issues of equity, gender, age, educational attainment, and class origin. They also need to orient the project personnel at all levels on the guidelines, principles, theory and practice of meaningful AYP. They should continue the training of adolescents and youth leaders with more emphasis on assessment and analysis and advocacy and articulation. The projects also need to address the following gaps or inadequacies in: synergy among the four projects, protection measures, sustainability, awareness of adult stakeholders on AYP, and monitoring mechanism for AYP. UNICEF needs to develop a comprehensive capability building and awareness raising package on the theory and practice of AYP designed for adults. The package must be accompanied with other necessary materials relevant to AYP such as a sample child protection policy in AYP, minimum standards in working and consulting with children; and documentation of good practices on participation in various settings. Lessons Learned (Optional): The evaluation learned that despite cultural, economic and political barriers, Cambodian adolescents and youth can have a meaningful participation in the commune council and effectively engage with commune council leaders given enabling environment and appropriate training and exposure. Although not fully successful, CoDeC and CAMP have demonstrated that the commune council could be an excellent platform for youth participation in local governance. The positive impact of participation on adolescents and youth can serve as a natural advocacy instrument to address cultural bias against the participation of young people in community affairs and in decision making. Meanwhile, their parents, as well as, the commune leaders could be effective advocacy allies if encouraged and trained to speak in support of adolescent and youth participation. The set of five roles that adolescents and youth could play in a rights-based development programme is a useful evaluation lens but flexibility and creativity are needed to apply them considering historical, political, economic and cultural differences affecting the level of AYP. Treating AYP initiatives as discrete projects, and not as a general key progress indicator, can get in the way of promoting coordination and synergy among sectors in UNICEF, as well as, with government, non-government partners and the UN family. Good practices in AYP from the four projects Each of the four UNICEF-assisted projects, in their own uniqueness, has demonstrated some good practices that could be widely applied in programming for AYP. EA has illustrated that organizing radio listening groups could be a good entry point for the formation of commune youth clubs. CAMP has shown that more spaces for AYP are created when they are organized than when they act individually on their own. CoDeC has proven that forging an agreement with the commune council leaders on the participation of organized youth in the commune council meetings is a good strategy in “penetrating” the commune council. SCY has proven that given opportunity, appropriate training, and communication resources, young people could produce high quality youth-oriented television products on their own with minimal adult guidance. Full report in PDF PDF files require Acrobat Reader.

- Marketing Executive at Synergy Technology Services - B.A. at University of Delhi - Business Analysis - IT Software, Software Developer/ Programming, Software Services Summary: Passionate marketing professional with a high degree of creativity, expertise in branding, promoting, collateral development, planning and strategising. . What do I have to offer (Haves): areas of expertise: website design, website development, open source customization and development, Joomla, Drupal, cake PHP, Java development, .net development. What do I seek (Wants): seeking opportunities in website design, website development, open source customization and development, Joomla, Drupal, cake PHP, Java development, .net development. Shikha Singh's Profile Overview Marketing Executive at Synergy Technology Services Industry : IT Software Department: Technology, from Sep 2006 till now Job Description : Establishing and building strong business relationships with clients. Experienced in driving marketing initiatives of the company. Involved in Pre-sales & Marketing activities to enhance sales efficiency. Strategic planning, business development and market analysis. Managing and strategizing sales promotional activities for new products and services. Expertise in use of social media marketing to network and community building. . University of Delhi from Jan 1997 till Jan 2000 Shikha Singh's Additional information Web Profile : http://www.peerpower.com/pub/shikhasingh2 Shikha Singh's Personal Details Interest:reading, music, movies PeerPower.com is a networking site for top professionals enabling them to profit from networking and connect with thought leaders. Join PeerPower >> Shikha Singh's Connection Vivek KohliChief Technology Officer at Sterlite Technologies Limited jaideep khandujaNo Current Company Mentioned Viral MehtaOwner at Swastika Enterprise Kandan MuthusamyDelivery Manager at IBM India Private Limited Kamal MamgainPortal Management at Indiamart Intermesh Limited View All

Cellulose, the most abundant organic molecule on Earth is found mainly as a structural component of plant and algal cell walls, is also produced by some animals, such as tunicates, and several bacteria . Natural cellulose is a crystalline and linear polymer of thousands of D-glucose residues linked by β-1,4-glycosidic bonds, considered the most abundant and renewable biomass resource and a formidable reserve of raw material. It does not accumulate in the environment due to the existence of cellulolytic fungi and bacteria, which slowly degrade some of the components of plant cell walls. Both fungi and bacteria possess enzymes such as laccases, hemicellulases and cellulases, which efficiently degrade lignin, hemicellulose and cellulose, respectively [2-3]. In plant cell walls the cellulose microfibrils are encrusted in lignin and hemicellulose in a complex architecture that, together with the crystallinity of cellulose, makes untreated cellulosic biomass recalcitrant to hydrolysis to fermentable sugars . However, a group of proteins with cellulose disrupting activity (expansins, expansin-like proteins, swollenins and loosenins) have the capacity of relaxing cell wall tension by disrupting the hydrogen bonds binding together cellulose fibrils and cellulose and other polysaccharides through a non-enzymatic process, improving subsequent sugar releasing [5-8]. An efficient degradation of this polysaccharide content into fermentable sugars could improve the production of biofuels. Rising energy consumption, depletion of fossil fuels and increased environmental concerns have shifted the focus of energy generation towards biofuel use . In this chapter, we focus on cellulose degradation by cellulases in order to enhance sugars release from biomass. Cellulose structure, allomorphs and its hydrolysis by cellulolytic organisms such as fungi and bacteria, is also reviewed, as well as cellulases structure, CAZY classification, their synergistic activity and the recently cellulases identified by metagenomic analysis, an excellent tool in this search of better cellulolytic activity. Another theme analyzed in this chapter is related to crystalline structure of cellulose, the main impediment to achieve full cellulose hydrolysis, and the role of proteins recently reported with cellulose disrupting activity that have improved saccharification processes. These proteins represent good candidates as an additive to enhance sugar production from plant biomass. 2. Structure and composition of the cell wall It has been estimated that the net CO2 fixation by land plants per year is approximately 56 X 109 tons and that the worldwide biomass production by land plants is 170–200 X 109 tons (Table 1). Of this amount, 70% is estimated to represent plant cell walls (revised in ). Lignocellulose is a renewable organic material and is the major structural component of all cell plants. Lignocellulose plant biomass consists of three major components: cellulose (40–50 %), hemicellulose (20–40 %) and lignin (20–30 %) (Figure 1). |Assimilated CO2||56 X 109||| |Plant biomass||170-200 X 109||| |Cell walls||150-170 X109||| |Cellulose||100 X 109||[13-14]| |Wheat straw||540 X 109||| |Soybean straw||200 X 109||| |Sugar cane bagasse||54 X 109||| Minor components are proteins, lipids, pectin, soluble sugars and minerals (Table 2) . It has a thickness of ~0.1 a 10 μm contrasting with <0.01 μm of cell membrane formed by proteins and phospholipids . Examples of such biomass are angiosperms (hardwoods), gymnosperms (softwoods) and graminaceous plants (grasses such as wheat, giant reed and Miscanthus). Cell walls should play a wide array of disparate and sometimes opposing roles: the resistance to mechanical stress is necessary as well as the shape of the cell and protection against pathogens; at the same time, besides it must be reasonably flexible to withstand shear forces, and permeable enough to allow the passage of signalling molecules into the cell . 3. Cellulose structure Cellulose is the main component in the plant cell walls, and is made of parallel unbranched D-glucopyranose units linked by β-1,4-glycosidic bonds that form crystalline and highly organized microfibrils through extensive inter and intramolecular hydrogen bonds and Van der Waals forces, amorphous cellulose correspond to regions where this bonds are broken and the ordered arrangement is lost (Figure 2).The cellulose chains aggregated into microfibrils are reported to consist of 24 to 36 chains based on scattering data and information about the cellulose synthase [20-21]. Consecutive glucose molecules along chains in crystalline cellulose are rotated by 180º, meaning that the disaccharide (cellobiose) is the repeating unit . Two different ending groups are found in each cellulose chain edge. At one end of each of the chains, a non-reducing group is present where a closed ring structure is found. A reducing group with both an aliphatic structure and a carbonyl group is found at the other end of the chains. The cellulose chain is thus a polarized molecule and the new glucose residues are added at the non-reducing end allowing chain elongation (Figure 2) . A wide variety of Gram-positive and Gram-negative bacterial species are reported to produce cellulose, including Clostridium thermocellum, Streptomyces spp., Ruminococcus spp., Pseudomonas spp., Cellulomonas spp., Bacillus spp., Serratia, Proteus, Staphylococcus spp., and Bacillus subtilis . 4. Cellulose crystallinity In plants, cellulose is synthesized by CESA proteins (Cellulose Synthase) embedded in plasmatic membrane arranged in hexameric groups called rosettes particles . Cellulose crystallites are thought to be imperfect, the traditional two-phase cellulose model describes cellulose chains as containing both crystalline (ordered) and amorphous (less ordered) regions. Crystalline structure of cellulose implies a structural arrangement in which all atoms are fixed in discrete position with respect to one another. An important feature of the crystalline array is that the component molecules of individual microfibrils are packed sufficiently tightly to prevent penetration not only by enzymes, but even by small molecules such as water. While its recalcitrance to enzymatic degradation may pose problems, one big advantage of cellulose is its homogeneity [1, 26-27]. Highly ordered, crystalline regions are interspersed with regions containing disorganized or amorphous cellulose, which constitute 5 to 20% of the microfibril. Many studies have shown that completely disordered or amorphous cellulose is hydrolysed at a much faster rate than partially crystalline cellulose; this fact supports the idea that the initial degree of crystallinity is important in determining the enzymatic digestibility of a cellulose sample. Crystallinity, is a measure of the weight fraction of the crystalline regions, is one of the most important measurable properties of cellulose that influences its enzymatic digestibility [19, 28-30]. A parameter termed the crystallinity index (CI) has been used to describe the relative amount of crystalline material in cellulose. Generally, in nature, crystallinity indexes range from 40% to 95%, the rest is amorphous cellulose . The degree of polymerization, (DP) is the number of monomeric units in a polymer molecule, which in cellulose it ranges from 500 to 15,000 but varies depending the substrate (Table 2). |Substrate||Crystallinity index||Degree of polymerization||Ref.| |Carboxymethyl cellulose (CMC)a||NA||100-2000||| |Filter paper b||0-0.45||750||| |Wood pulp b||0.5-0.7||500-1500||| |Fluka Avicel PH-101 b||0.56-0.91||200-240*||| |Fluka cellulose b||0.48-0-82||280*||| |Sigma α-cellulose b||0.64||2140-2420*||| 5. Cellulose allomorphs The crystalline structure of cellulose has been studied since its discovery in the 19th century, its structure was first established by Carl von Nageli in 1858, and the result was later verified by X-ray crystallography [34-35]. In the past decades, many data on the polymorphism of cellulose were analysed, being the most reliable data published after 1984, when the results of NMR spectroscopic studies of cellulose were reported . The repeating unit of the cellulose macromolecule includes six hydroxy groups and three oxygen atoms. Therefore, the presence of six hydrogen bond donors and nine hydrogen bond acceptors provides several possibilities for forming hydrogen bonds. Due to different arrangements of the pyranose rings and the possible conformational changes of the hydroxymethyl groups, cellulose chains can exhibit different crystal packings . Four different crystalline allomorphs of cellulose have been identified by their characteristic X-ray diffraction patterns and solid-state 13C nuclear magnetic resonance (NMR) spectra: celluloses I, II, III (IIII, IIIII) and IV (IVI, IVII). The most important allomorphs are cellulose I and II . Some difference in symmetry and chain geometry have been found in unit cell dimensions of various allomorphs and some parameters have been established: a, interchain distance, b unit chain length and c, intersheet distance, as well as the angles α, β and γ which are the angles between b and c, a and c, and a and b, respectively, (Table 3) [38-40]. [i] - I, Fresh water algae Glaucocystis nostochinearum; Iβ, Tunicate Halocynthia roretzi; II, Ramie cellulose (mercerized); II, Regenerated cellulose (Fortisan); IIII, Marine algae Cladophora. All crystal structures have been determined at 293ºK, except allomorph II (Fortisan) that was also determined at 100ºK (italics). Cellulose I is the most abundant form found in nature, is a mixture of two distinct crystalline forms: cellulose Iα, the predominant form isolated from bacteria (Acetobacter xylinum) and fresh water algae (Glaucosystis nostochinearum); and cellulose Iβ is the major form in higher plants such as cotton and wood celluloses, ramie and animal celluloses, for example in the edible ascidian Halocynthia roretzi . Cellulose from the marine algae Claudophora sp. and Valonia ventricosa is a mixture of both forms, predominating Iα . Currently, cellulose I is receiving increased attention due to its potential use in bioenergy production. Cellulose Iα has a triclinic one-chain unit cell where parallel cellulose chains stack through van der Waals interactions, with progressive shear parallel to the chain axis. Cellulose Iβ has a monoclinic two-chain unit cell, which means parallel cellulose chains stacked with alternating shear (Figure 3) . Cellulose II is the most crystalline thermodynamic stable form, it can also be obtained from cellulose I by two distinct routes: mercerization (alkali treatment) and regeneration (solubilization and subsequent recrystallization) . Cellulose II, like cellulose Iβ, has the monoclinic unit cell (space group P21). The different arrangement of the chains (parallel in cellulose Iβ and antiparallel in cellulose II) is the most substantial difference between these two polymorphs. The cellulose is a highly rigid macromolecule due to the presence of a three-dimensional hydrogen bond network in addition to the C-O-C bonds between the glucopyranose rings. In the absence of such hydrogen bond networks the chains are much more flexible. These hydrogen bonds are responsible for both the poor solubility of cellulose and the difference in the reactivity of the hydroxy groups in esterification reactions (Figure 4) . Cellulose IIII and IIIII can be formed from cellulose I and II, respectively, by treatment with ammonia; in a reversible reaction. Besides producing the different allomorphs of cellulose, this chemical treatment can also alter other physical properties of cellulose, such as the degree of crystallinity and therefore enhanced cellulase accessibility and chemical reactivity. The degree of conversion of cellulose I to cellulose IIII depends on the reaction period and the temperature used in the final stage of the treatment [47-48]. Cellulose IV can be most easily prepared by heating cellulose III, and therefore, two polymorphs of it also exist -celluloses IVI and IVll obtained respectively, from celluloses IIII and IIIII. In general, cellulose IV could be prepared by treatment in glycerol at 260 °C after transformation into cellulose II or III. Cellulose I cannot be transformed directly into cellulose IV [46, 49]. Fibrillation makes cellulose IVI less suitable for crystallographic analysis: that is, it makes it more difficult to interpret cellulose IVI as a crystal. For these reasons, it is unclear whether is a crystal with an orthogonal unit cell or a less crystalline form of cellulose I . A thorough review of cellulose crystalline allomorphs can be found elsewhere [46-47]. Although considerable progress has been made in elucidating the crystal structures of cellulose in microfibrils, they are still not well understood, and a deeper understanding of cellulose structure is required [50-51]. 6. Cellulose-degrading microorganisms Since cellulose is very difficult to degrade as a component of plant cell walls, only a few microorganisms specialized for plant cell wall degradation can hydrolyse cellulose. Among these, anaerobic and aerobic genera of Domain Bacteria and fungi of Domain Eukarya are included. Generally speaking, two types of systems occur in regards to plant cell wall degradation by microorganisms. In one type, the organism produces a set of free enzymes that act synergistically to degrade plant cell walls. In the second type, the degradative enzymes are organized into an enzyme complex located in cellular surface called the cellulosome. This complex is very effective in degrading plant cell walls . Anaerobic and aerobic bacteria have different strategies to degrade cellulolytic substrates; whereas anaerobic bacteria degrade cellulose using cellulosomes, aerobic bacteria secretes enzymes capable of degrading cellulose that freely diffuse to reach the substrate. Anaerobic bacteria of the order Clostridiales (Phylum Firmicutes) are generally found in soils, decaying plant waste, the rumen of ruminant animals, compost, waste water, and wood processing plants; these bacteria have also been found in insects like termites (Isopteran), bookworm (Lepidoptera), and so, in a symbiotic relationship in their guts responsible for cellulosic feed digestion. Anaerobic hydrolysis represents 5% to 10% of global cellulose degradation [53-55]. Aerobic bacteria with cellulolytic activities of the order Actinomycetales (phylum Actinobacteria) have been found on soils, water, humus, agricultural waste (sugar cane) and decaying leaves, these bacteria excretes enzymes capable of degrading cellulose (cellulases) . In aerobic bacteria Pseudomonas fluorescens subsp. cellulosa, Streptomyces lividans and Cellulomonas fimi cellulolytic systems of degradation have been reported [56-58]. Some anaerobic bacteria with cellulolytic activity are Butyrivibrio fibrisolvens, Fibrobacter succinogenes, Ruminococcus flavefaciens, Clostridium cellulovorans, C. cellulolyticum and C. thermocellum [59-61]. Due to the significant diversity in the physiology of cellulolytic bacteria, sometimes is difficult to classify bacteria as mentioned above, therefore, on this basis, they can be placed into three diverse physiological groups: (1) fermentative anaerobes, typically Gram-positive, (Clostridium and Ruminococcus), but with a few Gram-negative species (Butyvibrio and Acetivibrio) that are phylogenetically related to the Clostridium assemblage (Fibrobacter); (2) aerobic Gram-positive bacteria (Cellulomonas and Thermobifida) and (3) aerobic gliding bacteria, (Cytophaga and Sporocytophaga) [1, 53]. The ability to utilize lignocellulosic material is widely distributed among fungi, from chytridiomycetes to basidiomycetes. Among fungi, the most efficient at using wood as substrate are the basidiomycetes, considered the principal taxonomic group involved in the aerobic degradation of wood with all its components, they are the main organic material decomposition agents. These aerobic fungi produce extracellular enzymes allowing lignocellulose degradation (lacasses, hemicellulases, and cellulases), although some Ascomycetes are able to degrade cellulosic compounds as well. Unlike aerobic fungi, some of the Chytridiomycetes anaerobic fungi, have multienzymatic complexes similar to cellulosomes of bacteria [1, 3, 62-63] some members are anaerobic species living in the gastrointestinal tract of ruminants such as Anaeromyces, Caecomyces, Neocallimastix, Orpinomyces and Piromyces. Examining the taxonomic composition of cellulolytic fungi inhabiting the decaying leaves and rotting woods of forest soils, zygomycetes are represented by a single genus, Mucor, while ascomycetes and basidiomycetes are represented by genera such as Chaetomium, Trichoderma, Aspergillus, Penicillium, Fusarium, Coriolus, Phanerochaete, Schizophyllum, Volvariella, Pycnoporus and Bjerkandera. Two of the most studied fungi, due to their industrial relevance, are Trichoderma reesei and Phanerochaete chrysosporium. Nowadays, more than 14,000 fungi, which are active against cellulose and other insoluble fibres, are known [1, 24, 64-66]. A more detailed list of cellulose degrading bacteria and fungi is listed in Table 5. 7. Cellulose degradation mediated by cellulosome Selective pressure of evolution is the force driving microorganisms to adapt a new environment, in anaerobic conditions is necessary a machinery for the extracellular degradation of substrates, such as the recalcitrant crystalline components of the plant cell wall. Due to this, the anaerobes tend to adopt different strategies for degrading plant components, being the cellulosomes the most remarkable feature. (extracellular cellulolytic enzymes) |Ascomycetes||T. reesei||Cel, Xyl||Wheat straw||[68-69]| |A. niger||Cel||Sugar cane bagasse||| |Schizophyllum commune||Cel, Xyl||Microcrystalline cellulose, rice xylan||| |Basidiomycetes||P. chrysosporium||Cel, Xyl||Red oak, grape seed, barley bran, sorghum||[2, 63, 73]| |Cel, Xyl||Oak and cedar sawdust, rice husk, corn stubble, wheat straw and Jatropha seed husk||| |Fomitopsis palustris||Cel||Microcrystalline cellulose||| |Anaerobic rumen fungi| |Chytridiomycetes||Anaeromyces mucrunatus||Cel, Xyl||Orchard grass hay||| |Caecomyces communis||Cel||Microcrystalline cellulose, alfalfa hay||| |Neocallimastix frontalis||Cel, Xyl||wheat straw||| |Aerobic bacteria (cellulosomes)||Actinobacteria||Acidothermus cellulolyticus||Cel||Whatman paper No1, Microcyrtsalline cellulose,| Azurine crosslinked hydroxyethylcellulose (AZCL-HEC) |Anaerobic bacteria (cellulosomes)||Firmicutes||Clostridium thermocellum*||Cel||Crystalline cellulose||| |Thermomonospora fusca*||Cel, Xyl||wheat straw, oat spelt xylan||| |Caldicellulosiruptor kristjanssonii*||Cel||Microcrystalline cellulose||| |Anaerocellum thermophilum*||Cel, Xyl||Microcrystalline cellulose, xylan||[85-86]| The occurrence of a cellulosome was first observed in the thermophilic bacterium, C. thermocellum and has now been described in a number of mesophilic anaerobic bacteria and with some anaerobic fungi particularly Piromyces sp.[52, 67]. Cellulosomes are large extracellular enzyme complexes capable of degrading cellulose, hemicelluloses, and pectin; they may be the largest extracellular enzyme complexes found in nature, although the individual cellulosomes size range from 0.65 MDa to 2.5 MDa, some polycellulosomes have been reported to be as large as 100 MDa, . The cellulosome structure is characterized by two components: (a) the non-enzymatic scaffolding proteins with enzyme binding sites called cohesins, (b) enzymes with dockerins proteind interacting with cohesins in the scaffolding protein (Figure 5). Depending of the bacterial species, the scaffolding protein varies in the number of cohesins and cellulose binding modules (CBM) that binds the cellulosome tightly to the substrate and concentrates the enzymes to a particular site of the substrate. Recently, a more complex cellulosome structure with multiple interacting scaffolding proteins that allows the binding of as much as enzymes has been revealed . The cohesin-dockerin interconnect the different scaffoldin components, whereby the specificities among the individual cohesin-dockerin complexes dictate the overall supramolecular architecture of the participating components . In short, the enzymatic cellulosome system may exceed the potential of non-cellulosomal degradative system due to its structural organization, efficient binding to the substrate, the variety of hydrolytic enzymes acting synergistically . Cellulosomes have not been identified in bacteria (or eukarya) that grow above 65 ºC, and have not been identified in the Archaea . 8. Cellulose degradation mediated by non-cellulosomal enzymes Aerobic cellulolytic bacteria and fungi use a system for cellulose degradation consisting of sets of soluble cellulases. Cellulases are inducible enzymes by cellulosic substrates, which are synthesized by a large diversity of microorganisms including both fungi and bacteria during their growth on cellulosic materials.These microorganisms can be aerobic, anaerobic, mesophilic or thermophilic. Among them, the genera of Clostridium, Cellulomonas, Thermomonospora, Trichoderma, and Aspergillus are the most extensively studied cellulases producers . The aerobic cellulase mechanism evolved in terrestrial microorganisms that colonise solid substrates and therefore secrete cellulases to enable degradation of the substrate. Because of the recalcitrance of plant cell walls some cellulolytic microorganisms secrete up to 50% of their total protein during growth on biomass or cellulose [53, 90]. Cellulases are composed of independently folding and structurally and functionally discrete units called domains, making cellulases modular enzymes. Structurally fungal cellulases are simpler as compared to bacterial cellulosomes [32, 88, 92]. Fungal cellulases have two independent domains: a catalytic domain (CD) and a cellulose-binding domain (CBD), which is joined by a short poly linker region to the catalytic domain at the N-terminal. The CBD is comprised of approximately 35 amino acids, and the linker region is rich in serine and threonine . It is clear that the role of the CBD is to bind the enzyme to the cellulose so that the CD keep closer to the substrate and it also gives the CD time to move the chain into its active site before the enzyme diffuses away from the cellulose. It is still not clear whether the CBD also can modify cellulose or otherwise assist cellulose hydrolysis by the catalytic domain . The mixture of free cellulases act synergistically to degrade crystalline cellulose increasing the specific activity up to fifteen fold higher than that of any individual cellulase . 9. Cellulolytic organisms from extreme environments Novel enzymes with application in industry require improved features to tolerate extreme conditions of temperature, pH and salinity. Some microorganisms live in these environments, so called extremophiles and are considered a source of enzymes with potential biotechnological applications. Extreme environments host a number of cellulolytic microorganisms, such as the Gram–negative Antarctic bacterium Pseudoalteromonas haloplanktis, collected from seawater, which secretes a psychrophilic cellulase, Cel5G, this cold adapted enzyme displays a high specific activity at low and moderate temperatures and a rather high thermosensitivity induced by a decrease of the intramolecular interactions [96-97]. Extremely thermophilic cellulose-degrading microorganisms are of particular and biotechnological interest owing to the presence of highly thermostable enzymes. A deeper analysis of these organisms is reported in [89, 98-99]. The group of thermophilic cellulolytic prokaryotes includes two aerobic species, Rhodothermus marinus and Acidothermus cellulolyticus, and numerous anaerobes of the genera Caldicellulosiruptor, Clostridium, Spirochaeta, Fervidobacterium and Thermotoga (reviewed by (100)). All members of the genus Caldicellulosiruptor are extremely thermophilic, cellulolytic, and non-spore-forming anaerobes with Gram-positive type cell wall, capable of fermenting different types of carbohydrates and have been isolated mostly from neutral or slightly alkaline geothermal springs in New Zealand, Iceland and California . Recently, thermostable cellulases have also been reported in the thermophilic Geobacillus sp. R7 that produces a cellulase with a high hydrolytic potential when grown on pretreated agricultural residues (corn stover and prairie cord grass). In fact, it was demonstrated that Geobacillus sp. R7 can ferment the lignocellulosic substrates to ethanol in a single step, improving bioethanol production with important potential for cost reductions. Cellulases genes were also identified in several Sulfolobales strains, however, their physiological function is not well understood [101-102]. Another thermophlic bacterium Anaerocellum thermophilum degrade lignocellulosic biomass untreated as well as crystalline cellulose and xylan . While cellulases are widespread in Fungi and Bacteria, only one archaeal cellulase, an endoglucanase from Pyrococcus furiosus, has been reported. This enzyme exhibits a significant hydrolyzing activity toward crystalline cellulose even tough it lacks a CBD, the role of this intracellular enzyme in Archaea is unclear, given that Archaea are apparently unable to grow on cellulose [103-104]. In the alkali tolerant fungus Penicillium citrinum an alkali tolerant and thermostable cellulases were found which may have potential effectiveness as additives to laundry detergents . In this search to improve cellulases activity, hybrids of hyperthermostable glycoside hydrolases have been constructed as reported by , for example, using the structural compatibility of two hyperthermostable family 1 glycoside hydrolases, P. furiosus CelB and Sulfolobus solfataricus LacS a library of hybrids using DNA family shuffling was created. This study demonstrates that extremely thermostable enzymes with limited homology and different mechanisms of stabilization can be efficiently shuffled to form stable hybrids with improved catalytic features. Alkaliphilic, thermophylic and halophilic microbial species have the potential to yield valuable new products for biotechnological industry. Alkaliphilic polymer-degrading enzymes such as proteases, lipases and cellulases are most frequently isolated from Bacillus or related species. Cellulases and lipases are important not only as components of washing detergents, but they are also applied in the paper and pulp, pharmaceutical, food, leather, chemical or waste treatment industries [107-108]. 10. Cellulases structure Proteins with hydrolytic activity such as cellulases and hemicellulases comprises a complex molecular architecture of discrete modules (a catalytic domain (CD) and one or more CBDs), which are joined by unstructured linker sequences . The catalytic domain spans more than 70% of protein sequence. A sequence analysis of these domains in different cellulases shows a significant variability between them, in fact, active site of the enzyme has distinct three dimensional arrangements: in tunnel shape for a processive exo degradation or in a cleft shape for an endo degradation. This domain is N-glycosylated and is responsible of the cleavage of the glycosidic bond, which occurs through an acid hydrolysis mechanism, using a donor of protons and a nucleophyle or base such as glutamic and aspartic acid [1, 110-111]. The cellulose binding domain facilitates hydrolysis by keeping the catalytic domain nearby the substrate, therefore the presence of CBD is important for cellulases starting and processivity . The CBDs, which is usually O-glycosylated, contain from 30 to about 200 amino acids, and exist as a single, double, or triple domain in a protein. Their location in the protein can be both, C or N terminal and occasionally is centrally positioned. The CBDs bring the enzyme into a closer and prolonged association with the substrate, increasing the rate of catalysis, this domain was found to function more efficiently in substrate degradation, and removing the CBM from the enzyme or from the scaffolding in cellulosomes dramatically decrease its enzymatic activity (revised in ). In the union of CBD and cellulose, some non polar residues left exposed, mostly tyrosines and tryptophans, showing the flat face of their aromatic ring towards the pyranose ring, this interaction is stabilized by polar residues that form hydrogen bonds . Besides cellulases, CBDs have also been found in other polysaccharides degrading enzymes: hemicellulases, endomannanases and acetilxylanesterases . The linker peptide is a sequence of amino acids connecting the cellulose binding domain and the catalytic domain. This linker contains from 6 to 59 amino acids and functions as a flexible hinge that allows the independent function of each domain . The sequence of the linker varies between enzymes, however, the composition is typically rich in proline, treonine and serine, like in the sequence PTPTPTPTT(PT)7 of the endoglucanase of C. fimi and NPSGGNPPGGNPPGTTTTRRPATTTGSSPG of the cellobiohydrolase CBHI of T. reesei. Treonine and serine residues of the peptide linker are highly O-glycosylated to be protected from proteolysis; if the linker is completely absent or is too short then both domains, CBD and CD, obstruct each other and the affinity reduces. Based on the similarities of the linker between cellulases it has been suggested that it could be acting as a flexible hinge facilitating independent function of the domains (Figure 6) [115-116]. 11. Mechanisms of cellulose biodegradation Once the cellulase has recognized a free chain end, it threads the chain into the tunnel to form a catalytically active complex (CAC). Because cellulose decrystallization in water is free-energetically unfavourable, the tunnels or clefts of cellulase CDs contain hydrophobic and polar residues that form favourable contacts with the chain. Several studies have mutated hydrophobic residues in the CD tunnels of cellulases and chitinases (structurally similar to cellulases), and have demonstrated that hydrophobic residues need to be present in the CD tunnels for digestion of crystalline cellulose to occur . Additionally, in have shown that removal of hydrophobic residues in cellulase and chitinase tunnels can increase processivity rates on more accessible polymers. Once a cellulase forms a CAC with a cellodextrin chain, the hydrolysis reaction occurs usually via a retaining or inverting mechanism, depending on the directionality of the enzyme. After the reaction occurs, the product must be expelled and another CAC formed by threading another cellobiose unit into the CD (Figure 6) . In most cases, the hydrolysis of the glycosidic bond is catalysed by two amino acid residues of the enzyme: a general acid (proton donor) and a nucleophile/base . Depending on the spatial position of these catalytic residues, hydrolysis occurs via overall retention or overall inversion of the anomeric carbon. Recently, a completely unrelated mechanism has been demonstrated for two families of glycosidases utilizing NAD+ as a cofactor [118-119]. The retaining glycoside hydrolase mechanism leads to a net retention of the configuration at the anomeric carbon (C1] of the substrate after cleavage, since the hydrolysis of a glycosidic bond creates a product with the same configuration at the anomeric carbon as the substrate had before hydrolysis. The inverting glycoside hydrolase mechanism leads to a net inversion of the configuration at the anomeric carbon (C1] of the substrate after cleavage. This is performed via a single nucleophilic displacement mechanism, where the hydrolysis of a -glycosidic bond creates a product with the -configuration, and vice-versa . 12. Cellulose biodegradation Although more than a dozen fungal species considered as cellulose degraders have been reported (including T. viride, T. reesei, F. solani, A. niger, A. terreus, P. chrysosporium, B. adusta and P. sanguineus) [3, 74]; and even with cellulases identified in nematodes (Bursaphelenchus xylophilus, a nematode infecting pine wood), yeast (Aureobasidium pullulans) and marine bacteria (Saccharophagus degradans), the search of new cellulases genes continues. This have led to the construction of metagenomic libraries and bioprospecting analysis from several environments: buffalo rumen, higher termite guts, bovine ruminal protozoan, decomposing poplar wood chips and hardwood forest leading to the identification of new genes and organisms with cellulolytic activities [107, 121-130]. To have a better impression of the latest developments regarding fungal carbohydrate-active enzymes, the following sections will discuss the enzymes needed for cellulose degradation. (a) Cel7A binding to cellulose, (b) recognition of a reducing end of a cellulose chain, (c) initial threading of the cellulose chain into the catalytic tunnel, (d ) threading and formation of a catalytically active complex, (e) hydrolysis in a processive cycle and ( f ) product expulsion and threading of another cellobiose (shown in yellow in e and f). Image reproduced with publisher´s permission . Multiple types of modular cellulases formed by catalytic and carbohydrate binding domains have been discovered, including at least two exo-β-glucanases, or cellobiohydrolases (CBHs,CBH I and CBH II), four endoglucanases (EG; EG I, EG II, EG III, EG V), and one β-glucosidase (BG) . Cellulases are O-glucoside hydrolases (GH, EC 3.2.1.), a widespread group of enzymes which hydrolyse the β-1,4 linkages or glycosidic bond between two or more carbohydrates or between a carbohydrate and a non-carbohydrate moiety. GH are classified into cellulases families on the basis of amino acid sequence similarity [31, 132]. A classification of glycoside hydrolases in families based on amino acid sequence similarities has been proposed a few years ago. Because there is a direct relationship between sequence and folding similarities, this classification reflects the structural features of these enzymes better than their sole substrate specificity, and helps to reveal the evolutionary relationships between these enzymes, which represent a convenient tool to deduce information of the mechanism [132-133]. Out of the currently existing 125 families, 15 correspond to cellulases (GHF 1,3, 5, 6, 7, 8, 9, 12, 44, 45, 48, 51, 74, 116, and 124), and 64 families group the cellulose binding domains (see http://www.cazy.org/). In an excellent review of and classification system for many CBD families is provided. The widely accepted mechanism for enzymatic cellulose hydrolysis involves synergistic actions by endoglucanases (EGL, EC 184.108.40.206], exoglucanases or cellobiohydrolases (CBH, EC 220.127.116.11; 1,4-β-D-glucan-glucanhydrolase and EC 18.104.22.168; 1,4-β-D-glucan cellobiohydrolase), and β-glucosidases (BGL, EC 22.214.171.124). Endoglucanases hydrolyse accessible intramolecular β-1,4-glucosidic bonds of cellulose chains randomly to produce new chain ends; exoglucanases processively cleave cellulose chains at the reducing and non-reducing ends to release soluble cellobiose or glucose; and β-glucosidases hydrolyse cellobiose to glucose in order to eliminate cellobiose inhibition (13). These three hydrolysis processes occur simultaneously as shown in Figure 7. The activity of cellulase enzyme systems is much higher than the sum of the activity of its individual subunits; a phenomenon known as synergism, so they have to be considered not just simply a conglomerate of enzymes with components from all three cellulase types, but as a mixture that efficiently hydrolyse cellulose fibres. These enzymes cleave internal linkages in amorphous cellulose filaments, generating oligosaccharides with different sizes and creating new chain ends that can in turn be attacked by exoglucanases (135). The cellulolytic process is initiated by endoglucanases that randomly cleave internal linkages at amorphous regions of the cellulose fibre and creating new reducing and non reducing ends that are susceptible to the action of cellobiohydrolases . Endoglucanases are monomeric enzymes with a molecular weight that ranges from 22 to 45 kDa, although some fungi such as Sclerotium rolfsii and Gloeophyllum sepiarium have endoglucanases twice this size . In general, endoglucanases are not glycosylated; however, they sometimes may have relatively low amounts of carbohydrate (from 1 to 12%) . Unlike other endoglucanases reported with optimum pH 4 to 5; the only known endoglucanase with a neutral pH optimum is that from the basidiomycete Volvariella volvacea, expressed in recombinant yeast. Basically, their optimum temperature ranges from 50 to 70 °C [138-139]. Exhaustively hydrolysing cellulose also requires the action of β-glucosidases (BGL) (EC 126.96.36.199), which hydrolyse cellobiose, releasing two molecules of glucose and thereby provide a carbon source that is easy to metabolize. Fungi causing white and brown rot, mycorrhizal fungi and plant pathogens produce these enzymes [2, 135]. According to , primary hydrolysis occurs on the surface of solid substrates and releases soluble sugars with a degree of polymerization (DP) up to 6 into the liquid phase upon hydrolysis by endoglucanases and exoglucanases. This depolymerisation step performed by endoglucanases and exoglucanases is the rate-limiting step for the whole cellulose hydrolysis process. The second hydrolysis involves primarily the hydrolysis of cellobiose to glucose by β-glucosidases, although some β-glucosidases also hydrolyse longer cellodextrins. The combined actions of endoglucanases and exoglucanases modify the cellulose surface characteristics over time, resulting in rapid changes in hydrolysis rates . To assay endoglucanase activity, there are substrates that are used, such as carboxymethylcellulose (CMC), a soluble amorphous cellulose form that is an excellent substrate for endocellulases and its hydrolysis does not require a CBD . Also known as cellobiohydrolases, these enzymes catalyse the successive hydrolysis of residues from the reducing and non-reducing ends of the cellulose, releasing cellobiose molecules as main product, which are hydrolysed by β-glucosidases. They account for 40 to 70% of the total component of the cellulase system, and are able to hydrolyse crystalline cellulose. Exoglucanases have shown specificity on the ends of cellulose, such asT. reesei cellobiohydrolase (CBH) I and II that act on the reducing and non-reducing cellulose chain ends, respectively . These enzymes are monomeric proteins with a molecular weight ranging from 50 to 65 kDa, although there are smaller variants (41.5 kDa) in some fungi, such as Sclerotium rolfsii. Low levels of glycosylation (around 12% to none at all) are found in these enzymes; and their optimum pH is 4 to 5, with an optimum temperature from 37 to 60 °C, depending on the specific enzyme-substrate combination [137, 140]. Exoglucanases form part of the cellulolytic machinery of the fungi causing white and soft rot and they are found only in some of the basidiomycetes causing the brown rot, such as Fomitopsis palustris . Crystalline cellulose (Avicel, bacterial cellulose or filter paper), which is the main form of cellulose in most plant cell walls are good substrates for exoglucanase activity assay, because it has a low DP and relatively low accessibility; however, some endoglucanases can release considerable reducing sugars from Avicel . β-D-glucosidases hydrolyse soluble cellobiose and other cellodextrins with a DP up to 6 to produce glucose in the aqueous phase in order to eliminate cellobiose inhibition . These enzymes have molecular weights ranging from 35 to 640 kDa, and they can be monomeric or exist as homo-oligomers, as is the case β-glucosidase of the yeast Rhodotorula minuta . Most β-glucosidases are glycosylated; in some cases, as that of the 300 kDa BGL from Trametes versicolor, glycosylation may be superior to 90%. Their optimum pH ranges from 3.5 to 5.5, and their optimum temperature ranges from 45 to 75 °C (3). β-D-glucosidase activities can be measured using cellobiose, which is not hydrolysed by endoglucanases and exoglucanases . 17. Synergy between cellulases Synergistic cooperation between cellulases is a prerequisite for efficient degradation of cellulose, but its molecular mechanisms are not fully understood. Synergistic action has been observed between two different cellobiohydrolases and between endoglucanases. However, more synergistic mechanisms have been proposed [143-144]: Synergy endo-exo, occurs between endo and exoglucanases, where the action of endoglucanases provide free ends of the cellulose chain to the exoglucanases. Synergy exo-exo, exoglucanases progressively act on reducing and non-reducing ends of the cellulose chain. Synergy between exoglucanases and β-glucosidases, the latter process cellobiose produced as final product of the action of the exoglucanases. Intramolecular synergy between catalytic domain and cellulose binding domain of cellulases. As a whole system, plant cell wall polysaccharides should be degraded efficiently not only by synergy between cellulases but with participation of the other degrading enzymes as xylanases. In (145) a synergistic mechanism between cellulases and xylanases in order to saccharify wheat straw for bioethanol production is reported. More recently, a new type of synergism between enzymes that employ oxidative reactions to break glycosidic bonds and hydrolytic enzymes was reported in chitin degradation . Although a significant amount of information has been generated related to the action of cellulases and their mechanisms to degrading cellulose, the biodegradation of crystalline cellulose is still a slow process because the substrate is insoluble and poorly accessible to enzymes. To overcome this situation scientists have optimized ratio of cellulolytic enzymes, and it was found that the best saccharification of crystalline cellulose is achieved with the enzyme blend: 60:20:20 (CBHI:CBHII:EGI) wherein a saturated level of BG was included to eliminate cellobiose inhibition . In a different report, the impact of the cellulase mixture composition on cellulose conversion was modelled, and the findings suggested different optimum ratios for substrates with different characteristics, specifically degrees of polymerization and surface area . Also, researchers have pointed out the use of proteins that relax plant cell wall structure as a complementary activity before action of cellulases in order to improve saccharification. 18. Plant cell remodelling proteins In addition to lignocellulose-degrading enzymes, there are also enzymes involved in remodelling the cell wall, which could facilitate its later degradation. Expansins are pH-dependent wall-loosening proteins required for cell enlargement and expansion in many developmental processes. Although to date their precise mechanism of action remains unclear, evidence point toward a role in dissociating the cell wall polysaccharide complex that links together wall components, thus promoting slippage between wall polymers and, eventually, expansion in cell wall [148-149]. These proteins are coded by large multigene families present from bryophytes to angiosperms and also present in monocotyledonous plants (rice, maize), dicotyledonous plants (Arabidopsis), ferns and mosses. Expansins have no hydrolytic activity (glucosidase) and therefore, it has been suggested to work by breaking hydrogen bonds between cellulose fibres or between cellulose and other polysaccharides (xyloglucans), using a non-enzymatic mechanism (Figure 8) [150-153]. Expansins have molecular weights ranging from 25 to 28 kDa and, like cellulases, have a two-domain modular structure and an approximately 20 amino acids-long amino-terminal signal peptide . Domain I occupies the N-terminal part of the protein, and it has a DPBB (Double Psi Beta Barrel) structure. It is homologous to the catalytic domain of members of glycoside hydrolase family 45 (GH45), which includes mainly β-1,4-endoglucanases of fungal origin. The DPBB domain of members of this family adopts a six-stranded beta barrel structure forming a substrate-binding groove. Despite the presence of the GH45 catalytic domain in expansins, no hydrolytic activity has been detected for the latter . Domain II, at the C-terminal end, is homologous to group II pollen allergens from grasses. Some authors have speculated that this might be a polysaccharide-binding domain, due to the presence of aromatic and polar amino acids on the protein surface, where two tryptophan and one tyrosine would form a planar platform of aromatic residues favouring this binding (149, 154). Domain II folds as a β-sandwich formed by two sheets of four antiparallel β strands each (Figure 8). In fact, a β-sandwich formed by 3 to 6 β strands per sheet is the most common fold in carbohydrate-binding modules of proteins binding substrates such as crystalline cellulose or chitin . (a G2A protein from Phleum pratense; PDB 1WHO). In (a), the domain I forms a barrel; amino-acid residues that are conserved in expansins are indicated in the single-letter amino-acid code. Images reproduced with publisher BioMed permission . Expansins are classified in four families: α-expansins (EXPA), β-expansins (EXPB), α-expansin like-proteins (EXLA) and β-expansin like-proteins (EXLB) . The EXPA family includes proteins participating in the relaxation and extension of plant cell walls through a pH-dependent mechanism; these proteins would participate in developmental processes such as organogenesis, the degradation of cell walls during the ripening of fruits and other processes where relaxation of the cell wall is crucial [156-159]. The EXPB family includes group I pollen allergens from grasses. These proteins are secreted by pollen and have been suggested to soften the tissues of the stigma and style to facilitate the penetration of the pollen tube . EXPB proteins, unlike EXPA members, relax specifically the cell walls of grass cells, probably reflecting differences regarding the organization of cell walls between grasses and dicotyledonous plants. Although an HFD motif, that is known to form part of the active site of endoglucanases, has been found in domain I of EXPA and EXPB family members, they do not have hydrolytic activity [5, 160]. The EXLA and EXLB families do not have this sequence motif, which suggests that their mode of action differs to that of the other expansins. The EXLA and EXLB families are comprised of proteins identified by sequence analysis which, despite possessing the two- organization typical of expansins, have a number of divergent sequence features that separate them from the EXPA and EXPB families . Another group included in the expansin superfamily is the expansin-like X family (EXLX), comprising proteins that exhibit weak sequence homology with the domains of EXPA and EXPB members, and identified in organisms other than plants, such as the mucilaginous fungus Dictyostelium and the bacteria Bacillus subtilis, and Hahella chejuensis [161-164]. The denomination of expansin or expansin-like is reserved for proteins exhibiting both domain I and domain II. Proteins with only one of these domains are not classified as expansins . However other proteins with similar disrupting activity of the cell wall have been reported. Expansins and expansin-like proteins have been detected in angiosperms such as Arabidopsis thaliana, Oryza sativa, Zea mays and Triticum aestivum, gymnosperms such as pine and poplar, ferns such as Regnellidium diphyllum and Marsilea quadrifolia and the moss Physcomitrella patens. Some members of the expansin superfamily have been found even in a potato-infecting nematode, Globodera rostochiensis, where they are hypothesized to promote the infection process [165-169]. 18.2. Novel proteins with expansin-like activity In , a swollenin gene from T. reesei denominated swo1, was cloned and expressed in Saccharomyces cerevisiae, coding for a protein that modifies the structure of cellulose in swollen regions of cotton fibres (hence the name) without releasing reducing sugars. Swo1 is a fungal expansin-like protein, containing a pollen allergen domain and a cellulose-binding domain. Proteins with expansin activity could be used to improve the efficiency of cellulose bioconversion processes. For example, a swollenin purified from A. fumigatus has been used in combination with cellulases to facilitate the saccharification of microcrystalline cellulose (Avicel) . In also is described the synergism of an EXLX from B. subtilis in the enzymatic hydrolysis of cellulose and recently, and a new protein with expansin activity from the basidiomycete fungus B. adusta, denominated loosenin (LOOS1] was cloned and characterized . Not only expansins, but also swollenins and loosenin represent good candidate as pretreatment to enhance sugar production from plant biomass. For example, loosenin activity was efficient to release reducing sugars (after cellulase treatment) from Agave tequilana, a crop extensively grown in some areas of Mexico, which shredded fibrous waste is usually burnt or left to decompose. Indeed, A. tequilana fiber became a susceptible substrate for a cocktail of commercial cellulases and xylanases in the presence of LOOS1. Loosenin shows optimum activity at the same pH as most cellulolytic enzymes, opening the possibility to use them as a mixture. This protein is able to relax the structure of cotton, enhancing up to 7.5-fold the rate of release of reducing sugars from agave fibre. Something similar was observed when a cucumber expansin was incubated with a compound of cellulose and xyloglucans of bacterial origin and occurred a rapid relaxation of the structure of this compound, suggesting that expansins modulate the binding between cellulose fibres and xyloglucans, relaxing or breaking the bonds keeping them together . Given the optimum pH of LOOS1 (pH 5) and other expansin like proteins, they could be applied to processes of saccharification of natural substrates, facilitating the release of reducing sugars together with cellulases. For example, it might be used as an additive to obtain fermentable sugars from pretreated yellow poplar as reported in . In , used swollenin as a pretreatment of cellulosic substrates and observed that even in non-saturating concentrations, a significant accelerated hydrolysis occurred. They also correlated particle size and crystallinity of the cellulosic substrates with initial hydrolysis rates, and it could be shown that the swollenin induced-reduction in particle size and crystallinity resulted in high cellulose hydrolysis rates. The efficient enzymatic saccharification of cellulose has been a challenge over the past 50 years, mainly due to its crystallinity, which make it a recalcitrance substrate with a high potential to be used as a carbon source. The bioconversion of cellulose to ethanol is the process where most interest has been focused. Fortunately, increasing of the loosened cellulose surface area by the use of non-hydrolytic proteins, a process known amorphogenesis, would allow access to hydrolytic enzymes making the saccharification process more efficient . Cellulose biodegradation represents the major carbon flow from fixed carbon sinks to atmospheric CO2, this process is very important in several agricultural and waste treatment processes. Also, cellulose contained in plant wastes could be used as a raw material to produce sustainable products and bioenergy to replace depleting fossil fuels. However, one of the most important and difficult technological challenges is to overcome the recalcitrance of natural cellulosic materials, which must be enzymatically hydrolysed to produce fermentable sugars. In order to achieve this goal, new enzymes with cellulolytic activities are being improved and organisms with novel properties have been found. Although the efforts are being directed to improve cellulolytic activity, proteins capable to relax plant cell structure (expansins, swollenins and loosenin) could be used as a biological pretreatment since they would be disrupting crystalline structure of cellulose making it more accessible to the enzymes and enhancing sugar releasing.

In my career I have progressed through music and film, on to creative and technical roles with Apple, startup companies and most recently as a managing consultant with IBM in the areas of organizational innovation and change. I apply all those experiences in my own consulting practice working from small local enterprises to global corporations. Yet having seen more good ideas fail than succeed I have pursued doctoral studies to understand why that is so. And I feel I have come up with some answers. Building a strong synergy between your business, purpose, technology and people is the key yet it requires a new way of perceiving innovation and developing your business.

With the passing of Labor Day comes the official end of the summer movie season and it's not been kind to Hollywood this year. In fact many analysts have essentially been giving the season a "F," which isn't surprising given that this year will mark an eight-year box office low with revenue down nearly 15% and attendance falling 5%. Yet it's not all doom and gloom as some trends did emerge this summer that can help any investor with a media stock in their portfolio make the right moves to beat the box office at its own game. This summer saw at least 15 films (spread out across nearly every studio) that were either sequels or were created with the idea of it spawning a sequel. Many studios are in fact now doubling-down on franchises and it's not hard to see to why, but before investing know there are risks. For Paramount (a subsidiary of Viacom (NYSE:VIA)) though, it was able to take those risks and overcome them. In fact all of Paramount's summer films were meant to capitalize on that trend and for the most part the idea worked. Transformers: Age of Extinction dominated the summer with a billion dollars worldwide and the Teenage Mutant Ninja Turtles made a triumphant return to the big screen with $166 million earned so far. While the third film in the equation, Hercules, starring Dwayne "The Rock" Johnson couldn't quite grow to mythical proportions it didn't matter in the long run. Here the other two movies not only helped Paramount, but helped the company's consumer products divisions. In the case of the Turtles it also benefited Viacom subsidiary Nickelodeon which will use that success to help launch the sophomore season of its own well-received Turtles animated series. Synergy at its best. Again, while it worked beautifully for Paramount, other studios took a big hit. Sony (NYSE:SNE), for example saw major success from 22 Jump Street and Think Like A Man Too, but its big summer tentpole smash The Amazing Spider-Man 2 short-circuited. Saddled with a $200 million budget, the movie needed a huge showing to become profitable and ended up with just $202 million at the box office. That poor performance actually helped negate the success of its two adult comedies as the web-slinger was all most analysts wanted to focus on. Now to be fair Spider-Man 2 was saved by foreign audiences that pumped $500 million into the film, ballooning its total to just over $700 million, but the fact remains the film made $60 million less domestically and $49 million less internationally than the original did back in 2012. As a result Sony pushed the already greenlit third film in the series to 2018 and gave its originally slated 2016 slot to Sinister Six, an ensemble film highlighting Spider-Man's rogue gallery. It's the complete opposite of the success Marvel's had with its multiple Avengers universe branded film series and a big reason why Disney (NYSE:DIS) looks like the better buy if you had to choose between the two. Yet no matter what, Lions Gate (NYSE:LGF) had it worse as its only summer films (Step Up: All In, The Expendables 3) crashed and burned in back-to-back weeks. Step Up: All In earned just $6.4 million its first week out…the lowest performer in the series thus far and Expendables netted just $15 million. Both film franchises actually opened to less and less money with each new edition. Even international audiences are abandoning Expendables as this one has earned just $93 million overseas where the last one took in $311 million. Granted the movie hasn't opened in every market yet but it's not likely it will climb to that height. The moral here is that big budget doesn't always mean big return. With Spider-Man 2, Step Up: All In and The Expendables 3 audiences tuned them out because they were cookie cutter and paint by numbers. There was nothing new with any of them, whereas something like Disney's Guardians of the Galaxy brought something radically new to the table and is being rewarded for that type of risk. It's the same thing with Warner Brothers' Godzilla which was not only the studio's only real hit of the summer but one of the season's biggest surprises. Keep that in mind when looking ahead to next year's slate which features an insanely high number of sequels, including ones from The Avengers, Jurassic Park, Ted, Terminator, Magic Mike and The Fast and The Furious. In the short term though if you want to invest in a studio with an upcoming sequel that's likely to draw a big crowd and not see a big upset, go with Warner Brothers (a subsidiary of Time Warner (NYSE:TWX)) which seems destined for success with Horrible Bosses 2 and The Hobbit: The Battle Of The Five Armies. Ironically you could also go with Lions Gate which will more than likely bounce back thanks to The Hunger Games: Mockingjay: Part 1 film this November. Still, the safer long-term bet is going to be Warners, as it looks increasingly strong given its just announced slate of DC Comic-centric films that kicks off in 2016 with Batman V. Superman: Dawn of Justice. Pay close attention to what the WB is doing with its super heroes as that stock could skyrocket if they come anywhere close to the success its main rival has had in recent years. Audiences have proven this is a brand they want to see on the big screen and now that it may finally be done right, Superman and his friends could be flying high for years to come. Make sure to subscribe to this column for more articles breaking down the summer box office trends and how it impacts both current and future investors. Disclosure: The author has no positions in any stocks mentioned, and no plans to initiate any positions within the next 72 hours. The author wrote this article themselves, and it expresses their own opinions. The author is not receiving compensation for it (other than from Seeking Alpha). The author has no business relationship with any company whose stock is mentioned in this article.

|Page (1) of 1 - 03/22/12||email article||print page| MSPAlliance(R) and N-able Technologies(R) Team to Offer Competitive IT Services Edge to MSPs WorldwideLeading Managed Services Association Endorses N-able's IT Automation Platform and Technician Runbook; Launches Series of Joint Seminars to Help Partners Build Highly Successful, Scalable and Standards-Based IT Services Businesses (March 22, 2012) OTTAWA -- (Marketwire) -- 03/22/12 -- N-able Technologies® and MSPAlliance (MSPA) today announced an expanded relationship that includes a new series of joint webinars, seminars and enablement resources focused on empowering managed service providers (MSPs) to evolve their network operations and managed IT services best practices. Starting in April and offered free of charge, this new international series of partner-led enablement seminars and trainings will focus on the technical and business aspects of managed IT services. The first joint webinar will take place on April 11 and feature N-able MSP Elite Partner and MSPA member Rob Norman, CEO of Vnetrix. More information on upcoming events including registration and dates can be found at www.n-able.com/company/events/. Additionally, as part of the expanded alliance, MSPA has endorsed N-able's IT automation platform and complementary MSP Technician Runbook as the IT industry's only standards-based managed services solution. For more than a decade, the MSPA has served as the world's largest professional association and accrediting body for the managed services industry. "N-able Technologies stands alone as the only IT automation platform for MSPs that offers channel partners a standards-based managed services solution that truly delivers the technology, the processes and IT automation MSPs need to provide consistent and scalable IT services to a wide variety of small and mid-size businesses," says Charles Weaver, president and CEO, MSPA. "The automation within N-able's N-central technology and volume of tribal knowledge captured within its new MSP Technician Runbook is astounding and aligns with the criteria outlined in MSPA's Unified Certification Standard (UCS)," says Weaver. "We are pleased to strengthen our alliance with N-able in 2012, and see great synergy and shared partner value in our business certification and N-able's new MSP Technician Runbook." Announced in December 2011, N-able's MSP Technician Runbook provides MSPs with a blueprint for building a strong foundation of repeatable, scalable IT processes that will directly lead to greater productivity, utilization and profits. To date, hundreds of N-able partners are using the Runbook to build greater technical efficiency within their organizations. The MSPAlliance UCS for Cloud and Managed Service Providers is a business certification and audit for the cloud computing and managed services industry. Developed by MSPs for MSPs, this certification and audit is one of a kind and is the longest-standing managed services and cloud computing certification in existence. "N-able has always led the market in partner enablement and business support," says Gavin Garbutt, CEO, N-able Technologies. "With the introduction of N-central 8, automation manager and our new Runbooks, we've pushed innovation to new heights and delivered the next generation of managed IT services software and business enablement tools." "N-able's Technician Runbook is exactly what we needed to take our business to the next level and really scale our network operations center and IT service offering," says Norman. "It's definitely game-changing technology that will have a lasting impact on our business as we grow our service offerings and bring on more customers." "The MSPAlliance is a powerful force within the MSP channel, offering the highest and most comprehensive levels of certification in the industry," concludes Garbutt. "We're thrilled to share our vision of partner enablement and success with Charles and his organization, and look forward to driving greater adoption of standards-based managed IT services and certification throughout the global reseller and MSP partner community." MSPAlliance® was established in 2000 by Managed Service Providers (MSPs) for MSPs. Today MSPAlliance has over 15,000 corporate members world-wide and has become the world's largest industry association and accrediting/certifying body for the managed services and cloud computing industry. MSPAlliance's sole mandate is to educate the business consumer on managed services -- bringing to them credible, ethical, certified and accredited managed services and cloud providers. As an industry body, MSP and vendor members of the Alliance work together to self-regulate and bring credibility, professionalism, ethics and to the managed services and cloud industry. About N-able Technologies N-able Technologies is the global leader in remote monitoring and management (RMM) automation platform for managed service providers (MSPs) and IT departments. N-able's award-winning N-central® software and complementary toolsets are proven to reduce IT support costs, improve network performance and increase productivity through the proactive monitoring, management and optimization of IP-enabled devices and IT infrastructure. N-central features an industry-first freemium model that drives down the cost of remote management and accelerates the mass adoption of managed services. With offices in North America, the U.K., the Netherlands and Australia, N-able is 100% channel-friendly and maintains strategic partnerships with Microsoft, Intel, IBM, CA, Cisco and APC, among others. Vice President of Marketing and Business Development Office: 613-592-6676 x304 Toll Free: 1-877-655-4689 x304 (US/Canada) 00-800-6225-3000 (outside US/Canada) WhiteFox Marketing (for N-able Technologies) Copyright @ Marketwire Related Keywords: N-able Technologies, MSPAlliance, MSPA, RMM, IT, MSPs, Managed Services, N-central, Runbook, N-able, Sales & Marketing, Business Issues, Cloud Computing, IT Management, infrastructure, Management, CEO/CFO, Australia, Marketwire, , Business,

New Content Updates Educational Webcast Alerts Building Products/Technology Notices Access Exclusive Member Content A 60-minute, on demand Webinar for facilities professionals The growing green building movement has ushered in new technologies and practices, all geared toward creating more sustainable, environmentally responsible facilities. From smaller carbon footprints to energy savings to reduced operating costs, the benefits of greening commercial buildings are many. These benefits, however, often are accompanied by legislative and legal issues in regards to construction, renovation and contract drafting. Without a thorough understanding of the incentives -- and liabilities --associated with sustainable building and management, facility professionals can miss key opportunities to build, retrofit and run a bona fide green building. In this Webinar, presented by attorneys William Grimsinger and Gina Vitiello, you will gain a thorough understanding of how federal energy incentives, credits and deductions (including the American Recovery and Reinvestment Act of 2009) affect your green building and renovation initiatives. The synergy between LEED points and tax credits will also be addressed, as will the myriad legal issues associated with green building, including common issues regarding litigation, contract drafting and dispute resolution. Legally Green: How to Maximize Green Building Incentives - and Protect you Investment. Special price $149. Get instant on-demand access - View this Webcast Learn at your convenience! View as often as you like. Available for one year from date of purchase. You Get Expert Advice Building Operating Management magazine has assembled a world-class group of presenters to bring you up-to-the-minute information on legal issues related to green buildings and sustainability. Wiliam O. Grimsinger, Shareholder - Houston Office, Chamberlain Hrdlicka Law Firm William O. Grimsinger has extensive experience counseling individuals and businesses of all sizes with regard to tax and business problems. He represents clients in federal and state tax controversies, both civil and criminal. He has handled and managed IRS and state civil audits and IRS criminal investigations. Mr. Grimsinger has represented clients in IRS and state administrative protests and appeals, and has prosecuted civil tax cases, defended criminal tax cases, and filed and litigated claims for refunds as well as represented clients in civil litigation related to tax matters. Mr. Grimsingerís practice includes federal and state business tax issues for private and public companies; payroll and employment tax matters for private and public companies; voluntary disclosures for businesses and individuals; and tax matters for individuals, including tax shelters, income tax, employment tax, and individual and transferee tax liability. He has successfully resolved matters including business income and deductions; white collar crime investigations; heavy truck and fuel excise tax matters; employment tax liabilities; assessed and asserted penalties; individual liability of business and individual tax assessments; worker classification disputes; and tax collections. Gina M. Vitiello, Shareholder - Atlanta Office, Chamberlain Hrdlicka Law Firm Gina M. Vitiello practices contract law and commercial litigation with an emphasis on issues related to the construction industry across a wide variety of projects including hospitals, hotels, courthouses, airports, office buildings, ambulatory surgery centers, prisons, power plants, water treatment plants, manufacturing facilities, educational and military facilities, retail properties and multi-family residential complexes. Ms. Vitiello represents clients in contract negotiation matters, dispute avoidance/resolution and litigation. She has extensive experience in handling large, complex construction claims involving delay and impact damages, as well as design and construction defect issues. She also assists in drafting construction and commercial contracts, including general contracts, professional service agreements, construction management agreements, design-build contracts, subcontracts, joint venture agreements, energy savings performance contracts, and long-term service and maintenance agreements. She advises clients on state, local and federal government contract and procurement issues, as well as government bid dispute issues. Ms. Vitiello has served as outside regional construction counsel to one of the largest specialty subcontractors in the country, for which she provided daily counsel on virtually all construction-related issues, from disputed change orders to termination of defaulted subcontractors. She has significant litigation experience, having litigated cases in more than 15 states and having handled matters involving commercial and public projects spanning across the country and internationally. Gina is a LEED Accredited Professional as certified by the U.S. Green Building Council (USGBC) and is able to counsel clients on many different aspects of "green building" legal issues.

me, you may not have heard of Rafał Kwiatkowski, but he has already made an international name for himself, winning a number of big international competitions, touring widely and working closely with Penderecki on new works such as a cello version of his Viola Concerto. He is also a thinking musician, as his excellent booklet notes for this CD amply prove. Kwiatkowski’s musical horizons are wide, embracing chamber music and a diversity of genres. Concerning Shostakovich he is on record as saying “elegance is not always the goal. Shostakovich, which has so much energy, doesn’t have to be beautiful; it must be violent.” In terms of recording as opposed to live performance there is no difference: “I like to record,” he says. “What I like is that we can play the piece as many times as we want to get what we want. Sometimes when you listen to a live performance and a recording, the piece has a different life. But I put in the same emotion when I record and when I play. I never feel impassive or indifferent at a recording session.” by the results on this disc, he can easily make his point. These recordings have a ‘live’ quality, while at the same time being spotless studio tapings. The Polish Radio Orchestra is a crack team, and give their all for their artistic director Wojciech Rajska. The orchestra has a glossy string sound, nicely tuned winds and brass, and a sensitivity to colour which adapts to the mood of the music – acidic and punchy to rounded and mellow, while never quite losing that edgy sense of danger in Shostakovich’s Witold Lutosławski Studio must be a large space, as the acoustic is pleasantly resonant. The balance, often difficult in these concertos, favours the soloist as one might expect, but the musicians are realistically matched, and the solo cello mixes in with the orchestra at tutti passages in much the same way as it would in the concert hall. very recently encountered the Cello Concerto No.1 as played by Han-Na Chang I was a bit concerned that my ears might find it hard to accept yet another new version, but in this case I warmed immediately to Kwiatkowski’s style and musicality. No, he is not as ‘in your face’ and spectacular, but that is not always what you want. Neither is he safe and pedestrian – he doesn’t sound as if he’s taking risks, but that’s what happens if you are good enough. I have to admit, I have heard the second Moderato movement more emotional and involving, but this is certainly a version I could take onto my desert island without feeling I was missing too much – with this kind of music, it’s your own mood which often dictates your response, and either way it’s not so much Kwiatkowski who is reserved, more the orchestra. The cadenza is poetic and nicely shaped, Kwiatkowski showing that it’s not all violence – his lyrical playing in this and the second concerto is second to none. the first concerto is excellent, the Cello Concerto No.2 is more the star on this disc. I found my tear ducts being tugged right from the start, with that grim darkness shot through with genuine passion and human emotion. Kwiatkowski’s deep, rich tone lives and breathes through the entire range of his instrument, and the orchestra seems to respond to his eloquence. This concerto is often seen as the more ‘difficult’ of the two, but with this combination all of the intellectual challenges seem to fall away, leaving deeply moving music played with convincing warmth and commitment. There is a pay-off for this of course. All of Shostakovich’s little colours and digs are present, but in what is essentially a romantic reading the sharper edges of the composer’s dry, almost deprecating wit do become chamfered a little. Take the second Allegretto movement: surely we’ve heard those string pizzicati with more grit and drive? Indeed, but the movement builds with organic power, and with titanic blasts from the double-bassoon the true business of the movement shows genuine impact. at the final Allegretto, the horn-calls near the opening are a little recessed, and might have been a little wilder. Once the meat of the movement kicks in however, so again do those goose-pimples. Kwiatkowski revels in these most expressive of melodic lines, singing them with personality and a sense of freedom without distorting their shape with irritating mannerisms or attempts to ‘improve’ on the intentions of the composer. conclude, this recording is one for the long term – one with which to live. It may not have the punishing grit of some: the hair-raising climaxes are proportionate, but might not take you out of your comfort zone in the same way as others. There is nothing essentially missing however, and the synergy between soloist and orchestra is impeccable. Rafał Kwiatkowski is something a bit special, and lifts these recordings from being just very good to being ones with which you will be reluctant

March 2009 4x4 Truck & Automotive News - RPMPosted in Project Vehicles on March 1, 2009 0) ( Raptor R Takes Podium In Baja 1000 The Ford F-150 SVT Raptor R race truck, based on the production version of the upcoming 2010 F-150 SVT Raptor and powered by a specially calibrated version of the available 6.2L V-8 engine, making 500 hp, survived the grueling 41st Tecate SCORE Baja 1000, finishing the 631-mile race in 25:28:10, earning a third-place finish in Class 8. Long considered one of the toughest off-road races in the world, the Ford F-150 SVT Raptor R race truck that participated in the Baja 1000 was a collaboration between the Ford Special Vehicle Team (SVT), Ford Racing, and Foutz Motorsports. The pickup was entered into the race to test the durability and performance of the 2010 F-150 SVT Raptor, which goes on sale in the summer of 2009. Ford engineers will analyze all of the data recorded in Baja and apply lessons learned to the production vehicle. The Ford F-150 SVT Raptor R in the Baja 1000 also served as a test bed for the development of a lineup of race-proven, desert-tested, off-road performance parts that will be available through the Ford Racing catalog. Ford brought some of the best stock class off-road truck drivers together to drive the F-150 SVT Raptor R in the Baja 1000. Drivers of record were Steve Olliges, Randy Merritt, Greg Foutz, Bud Brutsman, and SVT Vehicle Development Engineer Gene Martindale. Team Hummer Takes Three Baja Podium Spots Team Hummer once again demonstrated the inherent off-road capability of the Hummer H3 as Chad Hall piloted his stock-full class No. 861 H3 Alpha to become the first stock-class vehicle to finish the 2008 SCORE International Baja 1000. Hall's race in the H3 Alpha was virtually trouble-free with only one flat tire to repair during the entire race. Hall finished the race in 19 hours, 22 minutes, 47 seconds, averaging a speed of 32.58 mph. Hall's victory marked his seventh Baja 1000 class victory and secured his first-ever SCORE International stock-full season points championship. Hall's victory marks the second consecutive Baja 1000 in which he and the H3 Alpha were the first stock truck to cross the finish line. Team Hummer owner and off-road legend Rod Hall celebrated his 71st birthday by piloting the stock-mini No. 760 Hummer H3 to a second place finish, securing his third consecutive stock-mini season points championship. Hall partnered with Mike Winkel and sister publication's Petersen's 4-Wheel & Off-Road's Rick Pw to finish the race in 22:51:17, despite two flat tires and a steering seal failure caused by an impact with a large boulder. Josh Hall, along with regular co-driver Sam Cothrun, were joined for a leg by Four Wheeler's Sean Holman and piloted Team Hummer's third entry, the No. 863 stock-full Hummer H2 SUT to a third-place finish after battling the desert and mechanical problems throughout the race. Hall and the H2 crossed the finish line in 24:50:06. One of the three Halls has been the driver of record on a class-winning team in the SCORE Baja 1000 for eight straight years and 12 times in the 15-year history of the stock class. With 30 class wins, the Halls continue to be the winningest family in the history of the race. Be sure to check out next month's issue for our exclusive Baja 1000 coverage. For $2, This Jeep Could Be Yours Just when the economic outlook seems bleak, the California Association of Four Wheel Drive Clubs (CA4WDC) steps up to the plate with a $2 Jeep. Each year, CA4WDC buys a brand-new Jeep, tricks it out with everything a died-in-the-wool four-wheeler could dream about, and then raffles it off at their annual February convention...for two bucks! This year's rig, a 2008 Jeep Unlimited Wrangler, is outfitted with an Atlas II transfer case, 35-inch BFGoodrich tires along with a Fabtech lift, a Warn 9500 winch on a Hanson bumper, a K&N intake and Banks Power exhaust, a Body Armor rear bumper, a Tuffy Security console and rear slide-out, PIAA and Warn lights, and an Off Road Unlimited roof rack...and the list goes on. It also sports heaps of other cool stuff from Premier Power Welder, Jeepers Jamboree, Spidertrax, Rockhard, Staun, and Hi-Lift. And because we off-roaders often camp out, or get stuck in the mud, the $2 Jeep Unlimited also comes with recovery gear and camping gear. Runner-up prizes aren't bad, either: second is a Premier Power Welder, third is two tickets for the 2009 Jeepers Jamboree, and fourth is an 11,000-pound Pull-Pal and case. How to enter? Tickets are $2. Buy 10 and get a special seller's raffle ticket for a set of four BFGoodrich tires (your choice). This year's $2 Jeep will be raffled on February 14th, 2009, at the CA4WDC convention in Primm, Nevada, and you don't have to be present to win. Order tickets at 800/4x4-FUNN or point your browser to www.cal4wheel.com. BFGoodrich Tires Takes 22nd Overall Win In Baja BFGoodrich Tires, the official tire of the SCORE Desert Racing Series, conquered Mexico's Baja peninsula by earning its 22nd overall four-wheel victory at the 41st Annual SCORE Baja 1000. Facing a talented and diverse field of 347 starting entrants, BFGoodrich Tires drivers Roger Norman and Larry Roeseler mastered the rugged terrain of Mexico's Baja peninsula to capture the overall four-wheel title. The Norman Motorsports Ford F-150 Trophy-Truck outfitted with BFGoodrich Baja T/A KR off-road tires completed the race in 12 hours, 40 minutes, and 33 seconds after logging an average speed of 49.81 mph despite blinding dust and heavy fog near the end of the race. This was Roeseler's fifth straight class win in the SCORE Baja 1000, having won the last four years driving with Troy Herbst in Class 1, all five occurring on BFGoodrich tires. Roeseler's overall win gave him a race-record of 13 overall race wins, including three in the four-wheel division to add to his previous 10 motorcycle titles. It was also Roeseler's 17th career class win in this race. Out of a field of 26 SCORE Trophy-Trucks, the top six overall finishers for the class and the race were equipped with BFGoodrich Tires. In addition to supplying its renowned Baja T/AKR tire, Baja T/AKRT tire, and all-new Mud-Terrain T/AKM2 tire for the race, BFGoodrich Tires was on-site, providing extensive pit and communications support to more than 100 teams through its fleet of off-road motorsports support vehicles. More than 150 off-road enthusiasts/volunteers donated their time to help make the race happen. The following is a complete list of BFGoodrich Tires 2008 SCORE Baja 1000 class winners: * Trophy Truck-Roger Norman/Larry Roeseler * Class 3-Darren Skilton * Class 5-Pedro Brassea * Class 10-Lobsom Yee * Class 11-Ramon Fernandez * Stock Mini-Gavin Skilton * Stock Full-Chad Hall * BC Class-Chris Kemp * Sportsman Buggy-Jerry Smith General Tire Solidifies Return To Competition General Tire capped off its triumphant return to off-road competition with a stellar showing in the 2008 Tecate SCORE Baja 1000. When the dust finally settled on the unbelievably grueling desert course, General had scored two class wins, two Second Place and two Third Place class finishes. Marc Burnett, driving his Ford Ranger "Ironman-style" through the entire course, took the win in Class 6 with a time of 27:02:31 (23.35 mph). In Class 9, First Place went to Cisco Bio and his co-drivers Jorge Martinez/Pancho Bio/Francisco Guerrero, with a time of 21:51:40 (28.88 mph). The team of Mike Horner, Cory Susag, and Ted Hunnicut piloted their General Tire/Synergy Motorsports Toyota Tundra to the Second Place podium in Class 8, with a time of 24:57:05; and Kent Kroeker and co-driver Rudy Iribe took the General Tire/KORE Dodge Ram 2500 to a Second Place podium finish in Stock Full. Rounding out the Third Place position Ernie Negrete, Oscar Venagas, and Gabriel Diaz-Peralata came in with a time of 20:52:27. All of the teams raced on General Tire's Grabber competition tire or the Grabber AT2 tires. Grabber competition is designed with a tough, three-ply Duragen-reinforced body construction to stand up to the rigors of off-road conditions; the Grabber also features a newly-developed competition-specific tread compound. The Grabber competition tires are designed in size 37x12.50R17 for class 8 and trophy truck/trick truck and 35x12.50R17 for class 1, 6, 7, 7 S, stock mini, and ProTruck. General Tire also has a complete line of Grabber tires for the passenger and light-truck market. Land Use Notes 2008 SEMA/SAN Legislative Victories The most powerful tool in protecting the hobby continues to be an informed and active enthusiast. This was demonstrated in full force as SAN members from across the United States and Canada voiced their opinions to lawmakers considering hobby-related legislation. Here is a brief look at some of the legislative victories in 2008. Gas Guzzlers: SAN members defeated a bill that would have required the California Air Resources Board to impose a fee on the sale (or lease of one year or longer) of a new passenger motor vehicle that has a gross vehicle weight rating of 10,000 pounds or less; a manufacturer's suggested retail price of more than $80,000; and a federal fuel-economy rating of 15 miles per gallon or less. Emissions Inspections: The SAN defeated a bill that would have required biennial emissions inspections in all areas of the state, while retaining the existing exemptions. Annual Inspection: SAN members in California defeated legislation to require annual smog-check inspections for vehicles 15 years old and older. The bill would also have required that funds generated through the additional inspection fees be deposited into an account which could be used to scrap older cars. Pre-'76 motor vehicles would have remained exempt under the bill. "Gas Guzzlers": The SAN defeated legislation that proposed a new-car surcharge tax, which would have escalated based on carbon emissions. Depending on the vehicle purchased, this surcharge could have required owners to pay up to $2,500 more for the vehicle and affected consumers' ability to purchase the vehicle of their choice. Engine Tax: SAN members defeated legislation to establish a progressive fee for state motor vehicles based on engine size. These fees would have been collected by the state at the time of initial vehicle registration and at subsequent renewals of registration. These fees would have been in addition to fees and taxes normally required for registration or renewal. Exhaust Noise: The SAN defeated a bill that sought to ban vehicles equipped with an exhaust system "that has been modified to make more noise or sound than the vehicle made when manufactured." The measure would have allowed law enforcement officers to seize and impound a vehicle upon making a subjective determination that the vehicle was in violation. Project Titles: SAN-supported legislation to create classic motor-vehicle project titles was signed into law by Governor Steve Beshear. The new law applies to vehicles at least 25 years old, not road-worthy, and currently without a title or with a title from another state. Under the law, a classic motor-vehicle project title would prohibit the use of vehicles bearing these titles on the highway but, once restored, a regular title could be issued. Emissions Tax: The SAN helped defeat legislation which attempted to reduce greenhouse gas emissions with a new-car surcharge tax which escalates based on carbon emissions. Depending on the vehicle purchased, this surcharge could have required owners to pay up to $2,500 more for the vehicle. Grilleguards: New York SAN members defeated legislation to prohibit the use of grilleguards attached to a motor vehicle's chassis. The measure relied on unsubstantiated claims that grilleguards create the potential of greater harm to other vehicles in the event of a collision and obstruct airbag sensors, rendering the airbags useless in an accident. The bill would have required owners of vehicles currently equipped with grilleguards (including those purchased with this equipment from a dealership) to remove these guards. Custom Vehicles: A version of SEMA-model legislation to create a vehicle registration and titling classification for custom vehicles was signed into law by Governor Phil Bredesen. The new law defines a custom-built car as a vehicle that is built for private use and is not constructed by a licensed manufacturer or remanufacturer. Under the law, kit cars and replica vehicles will be assigned a certificate of title bearing the same model-year designation as the production vehicle it most closely resembles. Scrappage Program: The SAN defeated a bill that would have implemented a vehicle scrappage program and financed it with a progressive purchase and use tax and higher registration fees for some new motor vehicles based on fuel-efficiency ratings. Funds collected under the program would have been used to dismantle vehicles deemed by the state to be "clunkers," regardless of their historical value or collector interest. Greenhouse Gas Taxes: The SAN defeated two bills that sought to tax vehicle owners in an attempt to reduce motor-vehicle emissions. The first bill would have established two separate progressive fees for state motor vehicles based on (1) engine size and (2) calculations of carbon emissions. These fees would have been collected by the state at the time of initial vehicle registration and at subsequent renewals of registration. The second bill sought to establish a progressive annual excise tax for all passenger motor vehicles based on the U.S. Environmental Protection Agency's (EPA) fuel-economy ratings. This tax could have required some vehicle owners to pay up to $240 each year. Inoperable Vehicles: For the third time, SAN members defeated a bill that would have further restricted the ability of vehicle hobbyists from maintaining inoperable vehicles on private property. The measure would have redefined "abandoned motor vehicles" to include vehicles or vehicle parts which are either unlicensed or inoperable, or both, are not in an enclosed building, and have remained on private property for more than 30 days. Under current law, the abandoned vehicle law applies primarily to vehicles on public property. The bill would have made violation a misdemeanor offense punishable by substantial fines, community service, and jail. U.S. Federal Issues Wilderness Legislation: Congress embarked on an aggressive push to designate as much as 2 million acres of land as "wilderness." Use of motorized vehicles is prohibited on wilderness lands. The issue is consequential to SAN members as less riding areas will be open for off-highway vehicle (OHV) use. President Bush signed into law a SAN-opposed bill creating the 106,000-acre Wild Sky Wilderness in Washington state. The SAN supported an alternative to preserve existing roads and trails on about 13,000 acres of the land. A number of other bills were being considered to designate new wilderness areas in California, Idaho, and New Mexico, among other locations. The SAN has recommended that the pending legislation protect OHV use by excluding "cherry-stemmed" roads and trails.

Apple seems to be able to weather the buffeting storms of the stock market and temporary bad news because they have synergistic portfolio of products that work together and can survive ups and downs better than the company could when it was Mac only, according to Business Week. Evidence of that is provided by the initial concern over the number of iPhone activations announced earlier this week by AT&T. Appleis stock took a severe hit, but immediately afterwards, Apple announced that its had sold a record number of Macs for the quarter, 1.76 million, a new record and that Mac sales had a growth rate nearly three times the rest of the PC industry. Apple stock recovered all its losses and then some. "Appleis ability to develop, launch, and support new products, using the same R&D and sales and marketing investments, creates [earnings] leverage that is substantially greater than people thought even six or twelve months ago," said Goldman Sachs analyst David Bailey. Analysts, done with the initial iPhone fervor, are starting to look at Appleis long term prospects now. "Itis a solid start," said Piper Jaffrayis Gene Munster. Referring to the initial iPhone sales numbers, he said, "Itis a disappointment relative to the whisper numbers, but youive got a bunch of [PC industry] analysts who are rookies to the cell-phone space. But if you talk to any mobile phone analyst, theyid say the iPhone is off to a strong start. And none of this changes the fact that we still think Apple is going to sell 45 million iPhones in 2009." [iPO emphasis added.] Apple is benefitting from a unique synergy in their product line. The Macs, the Apple TV, the iPhone, and soon some iPods are all running some version of Mac OS X. All the producs are designed to work together. The message from Apple is consistent with respect to the advantages ot these products and how they all work together. As a result, investors feel Apple has many more legs to stand on. Itis probably no accident that Steve Jobs refers to the three components of their business, Macs, music, and iPhone as three legs of a chair. Now, Apple really has its work cut out as it plans to expand the iPhone business into Europe and Asia along with new models and enhancements. "Weire past the initial bubble [of sales to Mac fans and early adopters], and back in the building-the-business phase," said Mr. Munster. Thatis the message investors want to hear, and thatis why Appleis business and wealth are soaring.

BIG USA, M&J Wilkow Acquire Interest in 1 MSF Pittsburgh Shopping Center - Oct 09, 2012 BIG Shopping Centers USA, an investment firm headquartered in Beverly Hills, Calif., and M&J Wilkow, a full-service real estate company headquartered in Chicago, have teamed on a joint venture to purchase 765,000 square feet of a 1.4 million-square foot, open-air shopping center in Pittsburgh, Pa. Known as The Waterfront, the property is situated on 265 acres along the Monongahela River and is the region’s second largest shopping center. The property is located on the former site of U.S. Steel’s Homestead Steel Works, once the largest steel mill in the world. “The Waterfront is a high profile development in a strong retail market that creates the ideal long-term hold opportunity,” Stanley L. McElroy, Jr., BIG Shopping Centers USA’s president, told Commercial Property Executive. “Pittsburgh has become a model for a diversified economy, strong job growth and educated work force. With the strength of the retail market benefitting from the local economy coupled with a low unemployment rate, we feel extremely confident about this investment. This is the first partnership between the two companies and McElroy believes it’s their synergy that will help the deal be successful for both. “We are confident that our combined skillsets are the right formula to reinvigorate The Waterfront and bring it to a higher level,” McElroy said. “BIG brings a wealth of retail experience while M&J Wilkow brings its operational and management acumen—along with local experience and knowledge—to the partnership.” Located seven miles from downtown Pittsburgh and across the Homestead Greys Bridge from Squirrel Hill, Shadyside and Oakland, The Waterfront stretches across Homestead, West Homestead and Munhall boroughs. “The Waterfront was built to serve primarily the east-end communities of Pittsburgh,” McElroy said. “The Waterfront is part of a mixed-use development that is almost a submarket or city within itself. The typography—265 acres of flat land only seven miles from downtown—can’t be duplicated on a similar scale within 10-15 miles.” In addition to approximately 70 shops, restaurants and entertainment venues, The Waterfront also includes 300 Class A residential units, more than 600,000 square feet of Class A office and research and development space and three hotels. “BIG Shopping Centers USA seeks long-term hold type of retail real estate investments; we’re not a market-time opportunist investor,” McElroy said. “We believe in buying the right shopping center with the right fundamentals in a solid trade area that has demonstrated long-term economic growth, job growth and sustainability. The Waterfront fits these criteria.” Anchored by Target, Lowe’s Home Improvement and Giant Eagle, the power center features TJ Maxx, DSW, Dick’s Sporting Goods, Marshalls, Bed Bath & Beyond, Office Depot, PETCO, Old Navy and Best Buy. The lifestyle component integrates soft goods with entertainment and dining amenities featuring an upscale AMC Loews Theatres, Barnes & Noble, ULTA, The Gap, PF Changs, BRAVO!, Cucina Italiana, Dave & Buster’s, Rock Bottom Brewery and Panera Bread. Lowe’s Home Improvement, Target, Giant Eagle, Macy’s, Costco and several outparcels were not included in the sale. “There will be changes to the property to create an environment where customers want to spend time with family and friends,” McElroy added. “We see a real opportunity to create not only a better place to shop, but a new community partner in The Waterfront. We are finalizing our strategic plan for the property but expect preliminary changes to be apparent in 2012.” McElroy expects that not only will the center be a gathering place for shopping, dining, entertainment and service amenities, but also a responsible community partner through sponsorships and community participation. Terms of the sale were not disclosed.

Labor Day, Bill Moyers BILL MOYERS: In past decades, the voices of the labor movement swelled the Democratic chorus. a Good Man . . . 'DO YOU ever think that people like us, who are serious, now feel like fools?" asked that great philosopher Bill Moyers re cently. 5.3 Scale of 1 to 10Read: 74Propped: 33Comments: 9Click Prop It to Raise Score Bill Moyers: The "Misery Index." and the Middle Class >> Posted by: TechnologyExpert 20 hours, 10 minutes ago 5.3 Read: 74 Propped: 33 Working Americans, and that's most people, are experiencing the "big ... Bill Moyers interview with Andrew J. Bacevich It's oil. I think historians a hundred years from now will puzzle over how it could be that the United States of America, the most powerful nation in the world, as far back as the early 1970s, came to recognize ... Just don't listen to or read what offends you Jason Salzman has an incredible idea suggesting that KOA provide liberal balance to Limbaugh's commentary. McCain and the laughing ad Here's a classic political spot, created for the 1968 presidential campaign by Tony Schwarz, the Yoda of 1960s political advertising. Bacevich speaks to Moyer about the American Empire BILL MOYERS: Here is one of those neon sentences. Quote, "The pursuit of freedom, as defined in an age of consumerism, has induced a condition of dependence on imported goods, on imported oil, and on credit. Insight: Messy Means of Deliverance " Y ou need to read a book called Broken by William Moyers," a woman said to me during a conversation about alcoholism. Faith and Reason: A mixed marriage Bill Moyers asks the question, "In a world where religion is poison to some and salvation to others, how do we live together?" I love the question and wish I had an answer. 1.3 Scale of 1 to 10Read: 54Propped: 17Comments: 1Click Prop It to Raise Score Moyers Journal : Capital Crimes Pt.1 >> Posted by: scott4261 23 hours, 19 minutes ago 1.3 Scale of 1 to 10 Read: 55 Propped: 17 Prop it With former lobbyist Jack Abramoff, who is already serving five and a half ... Photo Credit: Bill Moyers' picture is courtesy of Moon Battery. Photographic illustrations of Bill Moyers are copyright © by their respective holders. The images are published with permission or as allowed by the copyright law's fair use or quotation provisions. If any copyright holder objects to an image being included, please notify us and it will be removed immediately. Top Synergy reveals the methods and means that have led to the development of the popular Relationships Analyst. While some aspects are more suited to experienced astrologers, you will find a lot of fascinating topics that may sway you from any conservative views you may have about relationships. Find out why Astro Profile has become such an important self-improvement tool. And now, you can also get your own report, just like the ones we prepared for all the famous people on our database. With thousands of famous relationships and their Astro Profiles, you can analyze your relationships with your mentors and favorites and find out what types of relationships work best for you . You can also learn in great detail how they handle their relationships and other aspects of their lives, and what makes them tick. A knowledgebase about common topics is growing thanks to your inquiries and in-depth exploration of the workings of the Relationships Analyst. Enjoy your reading and help to further boost the FAQ section by posting your questions and comments. Tell me who your friends are and I will tell you who you are. This ancient saying is also true when it comes to our love-, business-, and other relationships. This is why we are here; to make the most of ourselves, a courageous choice that enhances all aspects of life, relationships included. So come and join us, your friends who respect your imperfections, love your resolute, and embrace you for the wholesome being that you are! Top Synergy's popular Relationships Analyst calculates the intensity of the commitment, intimacy, passion, and synergy in your relationships. With this free yet powerful tool, you will also understand what types of relationships are most likely to work for you and your partner. The report also features your RQ (Relationship Quotient) score for the most common types of relationships, such as love, business, friendship, intellectual, sensual, etc. Enjoy practical articles about building and enhancing relationships, improving our self-awareness, and other interesting topics. Dr. Brenda Shoshanna - our anchor author and a world-renowned relationships psychologist - offers you the benefit of her vast professional experience. We seek more articles about more topics by more authors. Are you the one or know of any? Here you will find up-to-date news from around the world about relationships. Hundreds of hand-picked links are neatly organized by categories such as: dating, relationship support, sensual relationships, self improvement, and more. There is a special section dedicated to relationships in the new age: astrology, psychic, tarot, dreams, spells, etc.

Not long ago, I engaged in a conversation on Twitter about the de-motivating effects of placing extrinsic motivators on A players. This resulted in a fun discussion about the nature of motivation and whether the concept of an “A player” is even a useful classification. I’ll leave the discussion of extrinsic-vs-intrinsic motiviation stuff to Dan Pink. But what I don’t see is a really coherent explanation about what it means to be an “A player”, how a person becomes one, or whether the term has entered the MBA-buzzword graveyard with “proactive” and “synergy”. Is the term “A player” fair, or even useful? Popularized recently by the management style of Steve Jobs, the term “A player” has come into broad usage by management types who wish to sound knowledgeable. Which, sadly, is where good business terms go to die. That said, the term does carve out a spot in your brain to understand that not all people in an organization are equally valuable. “A player” refers to the power plants of your organization: the people who supply an abundance of high-quality output. This means that there are “B players” and “C players” who produce less useful output and are more likely to be sort of “along for the ride” in an organization. “A player” is a role, not a permanent label Yes, it is dangerous to use a term that looks and feels like a classification or labeling system for people, especially one that implies a judgement as to that person’s value. But it is a hard truth that some people are more valuable to an organization than others. That said, it’s crucial to note that “A player” refers to a role a person plays. I’ve been an A player, a B player, and a C player at various times in my career, and sometimes even at the same job. Identifying an A player Whether you’re looking to hire and keep A players or trying to figure out if you are one, here are some observations I’ve made about people I’ve seen as A players: Has a trail of accomplishments: A players leave behind visible, tangible results of their work, as they are results-oriented. A players ship. Seeks out feedback: They don’t reject criticism outright, and actually seek feedback, since their ego is less valuable than getting something done. Has confidence in own abilities: They’re not confident as in boastful, but as in the opposite of insecure. A players rarely shy from a challenge, knowing that it is a matter of patience and work to see something through. Not big on seeking permission: They tend to choose the work they think will have the biggest impact and go for it, steamrolling obstacles in their way. Self-evaluating and self-correcting: A players tend to introspect, are driven to improve themselves, and correct mistakes quickly. Not interested in gossip: A players view “office drama” as a needless source of distraction rather than fodder for conversation. Helps others succeed: A players are inspired, rather than threatened, by the success of their peers. They actively seek to help others become successful. By this definition, B and C players are often insecure, complaining about office politics or “playing the game” against their successful peers. They hide their work, rarely shipping, in fear of criticism. They tend to wait for permission to move forward. They tend to wait for a lot of things to be in place before moving forward. Redefining your role: How to become an A player I believe that A players are generally B players who figured out that they alone are in charge of when they ship, what they ship, and the quality of their work. The most important factor in becoming an A player is whether you can attach to a goal that is larger than your ego and insecurities. One that is worth risking failure for. One that is worth breaking the cycle of permission-seeking for. Preferably one that can be accomplished in a matter of a few weeks, lest you burn out before completing the goal. With this goal burned into your brain, you’ll pull together the resources you need to accomplish it. You’ll naturally find someone to help you with gaps in your skills, because you’ll want to see this through. And once you’ve accomplished it, you’ll never want to go back to B-player-style work again. You simply won’t be able to tolerate it. It’ll drive you crazy. Then, the work begins again of finding the next goal that is similarly motivating. Yes, finding that goal is easier said than done, but I’ll bet you can find it if you pay attention to what is around you. How to lose your A players Many organizations don’t actively identify their A players until they start to leave, and management staff, in a panic, begins some misguided effort to get the remaining A players to stay. Steve Jobs famously said “A players like to work with A players. B players hire C players.” This, of course, comes back to the fact that B and C players aren’t confident in their abilities, and need to hire people that won’t show them up. A players form ad-hoc alliances whose goal is to ship, while B and C players tend to form committees whose goal is to prevent things from being done wrong. A players don’t react well to committees, forms, or bureaucratic processes that add friction to the act of building and shipping. Each point of friction adds up until A players realize that they aren’t able to operate at their full capacity. They may even verbally warn their management (who often aren’t receptive, or make empty promises of change). And being high-value employees, they know they can succeed somewhere else that promises less friction. It’s a lifelong process Some of the A players I’ve met seem as if they were born that way, but for most of us, it’s a lifelong process of self-refinement. A lot of my struggle is to subjugate my ego long enough to really seek and apply feedback. But to individuals, I can promise that the benefits of developing yourself into an A player are abundant. No one has the world in front of them quite like high-performing individuals. And to organizations, the benefits of cultivating an environment that rewards A-player behavior are even greater. If you’ll identify and reward your A players, they will drive a culture of results and shipping that defines the best companies in the world. After posting this, I realized that people may take the wrong message from all this. If you’re reading this, you’re probably an introspective person. If you’re introspective, you have a leg up on 95% of the population. You’re well on your way and very well could be an A player already. Just because there’s still room to grow doesn’t mean you aren’t amazing already. So take any self-criticism with a grain of salt, and realize that the fact that you’re even evaluating yourself puts you in the category of people I’ve defined above as A players.

It is certainly no secret that a fourth entry in the Doom franchise has been a long time coming. Ever since the survival horror-centric Doom 3 first hit the gaming scene back in 2004, FPS aficionados have been clamoring for a title in the highly revered FPS series that stuck to its fast-paced and old-school roots while boasting the latest gaming technology that powered the demonic carnage and made it look devilishly bloody and gratifying. That is exactly what id Software delivered recently when the new Doom finally hit store shelves to critical and commercial success. Doom 2016 (to avoid confusion with the original title) is a true return to form for one of the founding fathers of the first-person shooter genre. It takes all the elements that made the first two games ridiculously enjoyable and indelible while tweaking them and giving them a fresh coat of id Tech 6 paint to provide an experience that offers a seamless synergy between past and present, making it stand out from most other shooters crowding the current gaming market and serving as a testament to id Software’s resilient development philosophy and adaptability. But most importantly, Doom 2016 is not merely an unmitigated and glorious celebration of pure, unadulterated and gory running ‘n gunning. It is an exemplary showcase of careful FPS design that transcends its simultaneously nostalgic and refreshing experience goal and structure. Throughout a lengthy development cycle and brainstorming process, id Software managed to bake into Doom 2016’s DNA a slew of clever and intricate design decisions that bring the entire game together and turn it into something that is much more than the sum of its individual parts. These well-thought out design choices provide Doom with the very essence that imbues it with presentational and gameplay character, an incredible feat that was made possible by id Software’s commitment to sticking closely to the experience goal they envisioned and wanted to fully realize. Such a delicate attention to detail helped shape Doom’s core gameplay and turn already enjoyable scenarios into essential and carefully crafted pieces that form the larger picture. In this analysis article, I’m going to be taking a look at three major components that constitute Doom’s immaculate design: combat, exploration and mobility. For each one of them, I’ll describe the various sub-elements that help enhance that particular field and positively contribute to the peerless gameplay flow of the overall experience. 1 – Combat Doom 2016’s first essential component is also the meat-and-potatoes that has come to define the series’ timeless formula as a whole: the intense and frantic combat that is enhanced by the wide assortment of larger-than-life weapons and the sizable roster of terrifying demons that seek to turn Doomguy into chunky carrion. Interspersed in the wildly chaotic encounters with the hordes of Hell are myriad design touches that turn the already stellar gunplay into a tactically demanding bullet ballet that necessitates the player’s full attention and careful use of combat strategies for them to survive and overcome the overwhelming and relentless odds that are incessantly thrown at them as if there was no tomorrow. 1a) Weak/strong foes and different Glory Kill animations compel the player to assess the situation while firing at demons before finishing them off Right off the bat, the player will notice that the demonic entities come in different shapes and sizes. Not only that, but each one of them possesses a unique set of moves and certain amount of damage resistance that determine their respective danger and priority levels in the heat of battle. As a result, the player must carefully plan out their strategies for each and every foe. Imps, for instance, are fairly frail and can be taken out easily at point blank range, while more imposing enemies like Barons of Hell and Mancubi require Doomguy to exercise more caution to avoid devastating projectiles and ground pounds with wide splash damage. These varying tactics can turn into a hectic ragbag when facing off various monsters, which requires the player to pay attention to their surroundings and determine the best course of action with regards to shooting demons before delivering the final blow. Speaking of final blows, Doom 2016 took a page out of Brutal Doom with the addition of Glory Kills, context-sensitive animations that can be triggered close to a staggered enemy to accrue health and ammo pickups. While the executions themselves are delightfully gory in their own right, the wide array of different Glory Kills the player can pull off depending on the enemy, their targeted body part, and Doomguy’s position further entice the player to get up-close and personal with the hellish opposition and put them out of their misery in the most stylishly gruesome way possible. This satisfying method of rewarding the gamer for their efforts in combat compels the player to experiment even more when facing various enemies that come in different distributions with each fight the player finds themselves in. 1b) Situational/environmental changes in combat ingrain muscle memory in the player which is fostered by the length of the campaign But it’s not just the attack patterns of enemies that the player will have to memorize while in combat. How the environment is laid out and where the power-ups and pickups are located in the virtual space are factors that the gamer will have to strongly consider while mapping out potential routes they’ll have to take in order to survive. This constant shift in level design and enemy/object placement forces Doomguy to think on-the-fly without so much as stopping for a second while demonic hordes are hot on his tail. This emphasis on perpetual thinking results in the player memorizing actions to the point where it becomes second nature to them, such as switching to specific weapons for particular situations and collecting health/armor/ammo pickups at a certain time to maximize their replenishing effectiveness and avoid wasting precious supplies. This old-school approach to tactical adaptability works not just because of the well-thought out scenarios the player will find themselves in, but also because id Software ensured that the gamer would have plenty of time to get into the groove. Thanks to the single-player campaign’s sizable length, the player is able to foster and tweak their muscle memory to their heart’s content and liberally as they progress through the game, allowing them to make more room for experimentation while traversing levels that become increasingly complex and fighting enemies whose numbers and strength increase at a steady rate. Being able to leverage the tools at the player’s disposal AND giving them enough breathing room to switch between different strategies is one of Doom 2016’s many design accomplishments. 1c) Combat performance, weapon/armor upgrades and power-ups turn encounters into a chase that fuels the combat loop With all of these sub-elements combined, the most important takeaway from Doom 2016’s combat begins to materialize before the gamer, and it’s one that forms the basis of every encounter in the game: conflict is all about chasing one’s target. There are many gameplay aspects that point to this conclusion. The weapon and armor upgrades the player acquires throughout the game enables them to take on the opposition more directly and aggressively, rewards for combat performance are proportional to the percentage of enemies killed in a level, and power-ups such as Berserker and Quad Damage stimulate the player’s lust for copious bloodshed. It all adds up to a message that is lucidly conveyed at the start of the game: “They [demons] are rage, brutal, without mercy. But you. You will be worse. Rip and tear, until it is done.” This “hunter” style of gameplay is delightfully nostalgic and gratifying in its own right, but it also serves an indispensable purpose in the grand scheme of things. Not only is it responsible for providing Doom 2016’s cathartic moments, but it also perpetually drives the incredibly dynamic combat loop that accompanies each and every encounter Doomguy finds himself in. This loop acts as a mental guide for the player when it comes to planning out tactics, and feeds confidence, mettle and glee into their mind whenever the gamer enters a combat environment and anticipates the chaos that shall ensue. It’s a tangible feeling that psychologically rewards the player for all their past efforts, and begets a sense of spiritedness that maximizes gameplay immersion, resulting in an experience akin to shooter nirvana. 2 – Exploration Another facet of Doom 2016’s design that is just as crucial as the combat is the strong emphasis on uncovering every nook and cranny in the various levels the player is going to traverse. Ever since the days of health packs and armor pickups, exploration has served as one of Doom’s vital gameplay cornerstones as well as the yang to Doom’s yin (combat), providing the player with a brief moment for recuperation before jumping into the fray once more. But more than that, exploration acts as a potent stimulant for the player’s penchant for discovery, a fact that id Software took into account and fully leveraged by tweaking the various components that go into making the act of unearthing secrets a breezy and pleasant endeavor. 2a) Splitting different upgrades ensures varied and interesting exploration As the first game in the series to feature upgrades for Doomguy, Doom 2016 adds another layer of depth to the Doom gameplay formula, including the age-old practice of uncovering every nook and cranny in each level. id Software accomplished that feat by splitting the sundry upgrades the player could get their hands on into different collectibles such as Praetor tokens (armor) and field drones (weapons), as well as Rune Trials that Doomguy can partake in to hone his combat skills and earn runes for enhanced gameplay. Not only does this result in more dynamic and entertaining exploration, but it also fully satiates the player’s thirst for secrets by providing them with a plethora of varied items that stimulate their determination to investigate each and every corner on the map. What makes this design decision even more interesting and carefully thought-out is that id Software could have easily settled for experience points when it came to character customization and upgrades, and called it a day. Instead, id decided to adopt the collectibles approach because they knew that the inclusion of new objects for the player to uncover in their travels would coalesce nicely with the health and ammo pickups that served as the primary secrets in past Doom titles. The amalgamation of hidden items in Doom 2016 engenders a potent exploratory symbiosis that serves as the fuel that powers the flow of discovery throughout the whole game. This, along with the engaging combat and multilayered environments, ensures that the player will always keep themselves busy in the most immersive fashion possible. 2b) Multiple routes and sprawling vertical levels work together to enhance the satisfying Metroidvania-style exploration and amplify the worth of collectibles Speaking of multilayered environments, another aspect of Doom 2016 that id Software paid close attention to while designing the exploration bits was to ensure that the game bore the same sprawling and interconnected level design as its predecessors. While that fact is fairly obvious to the player while traversing the virtual space, Doom 2016 takes that old-school facet up a notch by incorporating a pronounced amount of verticality into the mix. This, combined with the many routes the player can take (or must take to unlock remote areas) in each level, gives the game a Metroidvania-esque structure that begets the positive side effect of turning exploration into its own little escapade, which in turn taps into the player’s adventurous self and triggers within them the impulsive desire to unearth every golden nugget strewn about the levels. By combining the intricate environmental layout of classic Doom games with a prominent multileveled approach to level design, Doom 2016 manages to not only build upon the formula set by its forebearers where maps are concerned, but it also increases the value of the secrets meticulously scattered in each level, further baking into the player’s mind the idea that each collectible is worth obtaining. It is a subtle but nonetheless pleasing mental trick that id Software cleverly leveraged by increasing the amount of effort the player would have to put into their trek through uncharted territory so that it matches the reward (i.e. the varied upgrades and miscellaneous secrets). By achieving that fine balance, id never coddles or swindles the player with regards to finding secrets, which guarantees the long-term sustainability of exploratory appeal and gratification. 2c) Figurines, secret levels and interactive objects fuel the nostalgic drive within the player, which feeds back into the exploration loop As a game that conspicuously honors its roots through its design and style, Doom 2016 makes no secret of its tendency to pay homage to its forebearers in more ways than one. Case in point: classic-themed secrets. Strewn about each level are delightful nods and winks to past Doom games the player can come across in their travels. Doomguy figurines that play E1M1 every time they’re picked up, smartly hidden entrances to 90s Doom levels with enemy and object placement identical to their classic counterparts, and interactive objects that evoke memories of previous Doom games (e.g. Super Turbo Turkey Puncher from Doom 3) combine to create a certain amount of nostalgic drive within the player depending on their past experience with the Doom series, a drive that reinforces the title’s overall character and charm. But these palpably nostalgic secrets serve a much greater purpose than simply putting a smile on the player’s face: they also further solidify the appeal and importance of exploration in Doom 2016 and feed right back into the aforementioned flow of discovery while the player is not battling the hordes of Hell. The latter is particularly important since, like combat, exploration needs to be kept consistently entertaining throughout the length of the experience for the player to continuously derive steady amounts of pleasure from their various endeavors. By injecting more flair into the secrets, id Software ensured that their quantity AND quality were on par with the rest of the title, avoiding the issue of in-game content feeling like patchwork, and thus preserving the feeling of exploratory satisfaction the player gets when finding new secrets. 3 – Mobility Doom 2016’s final design component is also the one that received the biggest upgrade, turning an already essential survival tool into an incontrovertibly exhilarating gameplay mechanic: mobility. While the first two games demonstrated a fondness for brisk movement in their fast-paced scenarios and sprawling levels, Doom 2016 ups the ante to nigh-on unparalleled heights by endowing Doomguy with context-sensitive environmental prompts and extra vertical agility for enhanced traversal. With these much-welcome inclusions also comes a series of touches that id Software implemented into the game to further amplify the effectiveness of the player’s motional tools and encourage them to make full use of them. 3a) Wide open levels and speedy movement compel the player to cover a lot of ground Like the original Doom titles, Doom 2016 aims to simultaneously impress and daunt the player by dropping them into expansive maps whose size invites curiosity and uncertainty. More than just a measure to keep Doom 2016’s design in line with that of the originals, the open-ended nature of the environment serves two vital purposes: it enables Doomguy to keep his options open and execute them without constraints in combat by taking full advantage of his spacious surroundings, and it heightens the sense of adventure that the player gets while they are out exploring the various interiors and exteriors for hidden secrets and pickups that permeate each and every map. Such wide open levels invite the player to think about all the possible combat outcomes and exploration routes, giving each map a unique identity that pertains to both presentation and gameplay. Although the sheer breadth and depth of the levels are incredibly impressive in their own right, what really compels the player to explore them without any fear of overly laborious backtracking or wasted time is the blazing speed at which Doomguy moves around. More than just a design choice that aims to emulate the feel and flow of classic Doom games, Doom 2016’s default movement speed has also been carefully chosen and tightly tweaked in order to compensate for the amount of space the player would have to traverse to see everything that the game had to offer. Not only does this make maneuvering a pleasantly breezy endeavor that compliments both combat and exploration, but it also greatly benefits the similarly swift pacing of the game in the long term, providing the player with a constant stream of adrenaline that keeps them motivated throughout the game. 3b) Relative lack of fall damage and thrust boots remove fear of liberal mobility and provide a smooth counterpoint to Doomguy’s meatiness With large, open-ended environments and a strong emphasis on verticality governing the spatial structure of Doom 2016, id Software made its intentions very clear through the design of the levels and how they communicate the degree of motional freedom the player possesses, a fact that is further cemented by one of Doomguy’s most convenient suit functions: Impact Compensation, which substantially nullifies the chances of sustaining fall damage when dropping from great heights. By relaxing and/or eliminating penalties for moving with little to no restraints around the virtual space, id lets the player do the thinking where traversal is concerned and highly encourages them to carve out their own path across each level. This grants Doomguy a tangible degree of control that wonderfully complements the free-form design of the gameplay. The general lack of navigational sanctions in Doom 2016 is made even more lucid by one of the tools Doomguy gets his chunky hands on early in the game: thrust boots. Essentially acting as the player’s double-jump function, these handy and practical garments accentuate the swiftness and snappiness of the title’s movement model on both a vertical and horizontal level, but their utility isn’t limited to enabling the player to bridge the literal gap while exploring later campaign levels. The thrust boots, in all their agile glory, provide an interestingly harmonious counterpoint to Doomguy’s meaty build, and accentuate his ferocious and sturdy demeanor by increasing the range and effectiveness of his marksmanship and CQC chops. As a result, the player’s footwear serves multiple purposes that enhances both the combat and exploration bits of Doom 2016. 3c) Mantle maneuver and in-flight mobility bake flexibility into Doomguy’s movement model Of course, with a reinvented approach to level layouts also comes a few design considerations aimed at making mobility compatible with Doom 2016’s multilayered levels and minimizing the player’s potential irritation whenever they err in their spatial calculations. id Software’s solution to that challenge is twofold. The first half consists of the player’s ability to mantle over ledges when they move towards them. This simple but highly useful maneuver provides just the right amount of leeway to the player when they’re executing their traversal plans without feeling too generous or restrictive, allowing the game’s level of navigational complexity to remain uniform, i.e. matching the mantle mechanic’s zippiness and snappiness with other brisk maneuvers such as running and jumping around the environment. The second half corresponds to a Rune Trial that is tied to the thrust boots and grants the player a considerable amount of nimbleness when equipped: in-flight mobility. This bonus enhancement essentially gives the player an additional amount of control over their jumps that’s comparable to what they have when moving on the ground, making their mid-air lethality and maneuverability akin to their onfoot counterparts which in turn enhances the flow of gameplay. When combined, both the mantle mechanic and in-flight mobility upgrade serve to make Doomguy’s motional capabilities flexible enough for the player to better interact with their surroundings while still having their navigational skills constantly put to the test, especially in combat where quick thinking and planning can spell the difference between life and death. Doom 2016 is the gaming equivalent of Neapolitan ice cream: its three individual parts may be scrumptious on their own, but become downright irresistible when blended into a single scoop. From the minutia of combat that forge the player’s strategic and situational adaptability to the multilayered level design that invites mobility and exploration, Doom 2016 does a great job of compelling the player to take advantage of the title’s systems to create their own play style. Not only does Doom 2016 succeed in revitalizing the series that popularized the FPS, but it also manages to make a convincing case for attention to detail in design by demonstrating its finer qualities through the moment-to-moment action and exploration to create a consummate experience. The devil is, indeed, in the details. Let me know what you think of my article in the comments section, and feel free to ask me questions! I’ll do my best to get back to you as promptly as possible.

McIntosh 2150 hopes of synergy Hoping for relevant feedback, confirmations, suggestions, etc.. I am planning a dedicated listening system around my vintage McIntosh MC 2150 solid state Amp. The availability of streaming music has reignited my interest in Hi-Fi and I am nearly ready to pull the trigger on the following equipment which is about at the limit of my budget: Parasound Halo P5 pre-amp KEF LS50 speakers *CD player (inexpensive) *I was advised the DAC in the P5 can be used to process the Airport express and the CD player for excellent results. It’s hard to define what I am looking for as far as sound goes, but the terms warm, non- fatiguing, engaging, musicality, all sound close to the mark?? I like all types of music, Roberta Flack to Nine Inch Nails, however, when critically listening I would most likely choose Classical or Jazz. Listening to these products or others prior to the sale is not realistic (except the return option) as brick and mortar stores are gone in my area. My current system consists of The Mac amp, Klipsch KG4 speakers and a Denon DCM 460 (chose back in the day due to the variable output feature and me not having/affording a pre-amp). I currently use Tributary A1 Silver RCA cables and Tributary 12AWG Speaker wires. 14 x 19 room carpeted 75% or the area. Thanks in advance. This forum has been immensely helpful so far and I appreciate the time posters spend informing others.

Welcome to the Dynacop Homepage DYNACOP (DYNamics of Architecturally Complex Polymers) is a new 7th Framework Marie Curie Initial Training Network, involving ten universities and two industrial companies across Europe. The scientific objective of DYNACOP is to obtain a fundamental understanding of the flow behaviour and the dynamics of blends of topologically complex macromolecular fluids and their role in processing and properties of nano-structured blends. These materials exhibit complex dynamics and rheology and, in many cases, show hierarchical relaxation over many different timescales. This in turn affects the processing and properties of the final materials. Such fluids include branched low density polyethylene, which is a fundamental material that appears in plastics of all forms. The processing of these materials, and the relation to properties, has frustrated and encouraged industry for many years: a simple recurring problem is instability in extrusion that leads to imperfect plastic parts, and with costly results. The ability to predict and control this behaviour as a function of molecular chemistry has attracted a long history of collaboration between academia and industry, including the partners of DYNACOP. In order to rationally design appropriate materials and processes for various technological applications, a rigorous, knowledge based approach is needed. This is especially urgent in the face of current opportunities offered by tailored molecular engineering of polymers at the industrial scale, and the proposed use of these materials in nano-structured composites for smart applications in devices, electronics, and high performance applications. The training objective of the ITN is to provide young post-doctoral researchers with the necessary interdisciplinary knowledge and experience in the field of soft materials properties, much needed throughout Europe, which will allow them to address some of the many scientific and technological challenges in the field. This will first and foremost be achieved through a collaborative research program and portfolio of training courses intimately linking industry and academia. To ensure fruitful collaborations, the participating research groups will work around a limited number of model systems; exchange the samples, and apply to them the techniques and/or theoretical approaches developed in the different laboratories. The research groups are selected to obtain the needed synergy, as they have different backgrounds/expertise, in physics, chemical engineering, chemistry, and materials science. Very high profile international visiting scientist will bring their expertise to Europe to participate in the training and research.

Shouldn't be any problem. I have driven the 800s to bursting with a 100W/ channel. 3 responses Add your response The RB-1091 will be just fine with the 802Di. I am using a RB-1092 with my N804 and have plenty of reserve power left on tap. When I purchased my 1092 my dealer really pished me into buying the 1091 monos but at the time I did not have the extra room. For the monies today the RB-1091/1092 are a tough cookie to beat. The RB-1092 is in my general listenig room for everday music. In my analogue room I am using McIntosh. What you heard was the superb synergy of the Classe / B&W combo that is not an accident but is a result of these two legendary companies working together towards the best reproduced sound that can be had today. That's not to say there is not other companies out there doing the same, just that this pairing is certainly one of the best at it today. The Classe amps are smooth, dynamic and appear to be nearly perfectly matched with those speakers so you should trust your ears and think that in the future you may want to move up from the Rotel (which is very good in their own right) to something from Classe. The new 800 series is amazingly good and would be a fantastic choice to start building an superb, high performance music system. I'd bet they would sound mighty darn good with your Rotels until you could move on up to the wonderful Classe line. Buy em.

Discover new restaurants, spas, things to do & more great deals added daily! You can change your email preferences at any time Please send me personalised Groupon emails for the latest offers for great local services, shopping and travel. By clicking Continue, I agree to the Terms of Service and Privacy Statement. Valid on 1 unit per transaction, for Local or Getaways deals. New customers only. Max discount £30. Exclusions apply. Full details: gr.pn/promofaquk Full details: gr.pn/promofaquk Customers can learn about self-employment, limited companies, and making business decisions during this two-hour class Two-Day Practical Introduction to Cisco Networking Devices at Synergy Networxx Aspiring technicians can participate in this two-day introductory course to learn the basics of network management and maintenance

KDKA-A PD Jim Graci Adds Management Responsibilities at KDKA-F PJ Kumanchik Also Takes On Additional Role, Robert Mangino, Shelly Duffy To Afternoons On KDKA-A April 16, 2015 at 5:04 AM (PT) CBS RADIO/PITTSBURGH ups News KDKA-A/PITTSBURGH PD JIM GRACI to also serve as PD for Sports KDKA-F (SPORTS RADIO 93-7 THE FAN). His appointment is effective on MONDAY, MAY 4th. GRACI takes on the role previously held by RYAN MAGUIRE who is transferring to a similar role at CBS RADIO Sports WQAM-A/MIAMI (NET NEWS 4/16). Additionally, PJ KUMANCHIK, News Director and Executive Producer at KDKA-A, will also serve as Exec. Producer at SPORTS RADIO 93-7 THE FAN. SVP/Market Manager MICHAEL YOUNG said, "JIM and PJ are a strong and very competent managerial team. They have performed very well in developing and executing the programming vision of KDKA-A. With much synergy already existing between KDKA-A and KDKA-F, I believe their expanding programming roles at SPORTS RADIO 93-7 THE FAN are a natural progression, and will benefit our various audiences.” Robert Mangino, Shelly Duffy To Afternoons CBS RADIO News-Talk KDKA-A/PITTSBURGH is moving evening host ROBERT MANGINO and Hot AC WBZZ (100.7 STAR) morning "BUBBA SHOW" co-host and KDKA Lifestyle Editor SHELLY DUFFY into afternoons as the new hosts of the KDKA AFTERNOON NEWS, beginning APRIL 27th. MANGINO and DUFFY replace BILL REHKOPF, who left KDKA in JANUARY for sister News WNEW (ALL NEWS 99.1)/WASHINGTON-BALTIMORE for the second time; ROSE RYAN-DOUGLAS stays on the show as news anchor, with field reporter JOE DESTIO and Sports Detector JEFF HATHHORN. PD JIM GRACI said, “ROBERT is a great quarterback to tie it all together while Shelley has a unique perspective about life in PITTSBURGH.”

News media bias in general Here's another web site you should visit: Media Bias dot com. Exposing the bias in mainstream journalism. Is the System Rigged? You Betcha. In what sense is the system rigged? Consider Big Media — the elite columnists and commentators, the dominant national press, and the national and cable networks, save FOX. Not in this writer's lifetime has there been such blanket hatred and hostility of a presidential candidate of a major party. "So what?" They reply. "We have a free press!" But in this election, Big Media have burst out of the closet as an adjunct of the regime and the attack arm of the Clinton campaign, aiming to bring Trump down. Half a century ago, Theodore White wrote of the power and bias of the "adversary press" that sought to bring down Richard Nixon. "The power of the press in America," wrote Teddy, "is a primordial one. It sets the agenda of public discussion; and this sweeping power is unrestrained by any law. It determines what people will talk about and think about — an authority that in other nations is reserved for tyrants, priests, parties and mandarins." at the Self-Destruction of the Media Gatekeepers. [W]e normals have grown tired of the media elite's lies, and today's technology allows us to ignore the people who would presume to tell us what we can and cannot know. The Democrat Media Complex. [Scroll down] What [Andrew] Breitbart was alluding to was the reality of the press in America as the press acts as a piano on which the government plays the public in whichever direction it desires. The objective of the press today is not merely to inform, but to instruct the millions of impressionable American minds on what to believe, who to believe, and how to believe. The content is so rigidly controlled today that in a way the fourth estate has now become nothing more than an institution of the government restricted to publishing and advancing White House directives and Democrat policy agendas. The role that the press plays is to make clear to the American people what the Obama adminstration [sic] is doing, why the adminstration is doing it, and why it is forced to act in a certain way. Timely news and commentary: Morning News" All in for Hillary. I was listening to the radio when America's Morning News came on with some election "news". It was essentially a campaign ad for Hillary Clinton disguised as "news". It dwelt on the made up "scandal" of Trump accusers that have been mostly debunked. Not a single word about the multiple Hillary scandals from exposing U.S. classified information, pay for play as Secretary of State, transferring half a million dollars to the campaign of the wife of the FBI individual who was supposed to be investigating Hillary, and on and on. I have never seen the full force of the organized media so completely all in for one candidate before. Can You Trust The Press? I remember several years ago when there were complaints that young people were going to journalism school, not to learn how to accurately report the news, but with the idea that journalism would allow them to change the world. That unfortunate misconception has played out as your see. However, the world of information has changed. Deception and the Big Media Lie. It "pains" Jordan Chariton at Mediaite to say so, but "Trump is right — the [news] media is dishonest." WikiLeaks has exposed the "jarring ... alliance between supposedly neutral 'analysts' and 'journalists' with Hillary Clinton." Case in point: interim Democratic National Committee chair Donna Brazile, who was exposed "tipping off the Clinton campaign to a CNN town hall question she'd be asked the next day." (She denies it.) But Brazile is just one in a "long list of phony 'analysts' and 'strategists' — as well as anchors and reporters — who were clearly in-the-tank for Hillary Clinton all along." The "wider media lie" is that what you see on-air "is being delivered by neutral arbiters and journalists." Confronts NYT Reporter On Bias: Know Any Pro-Life Reporters? MSNBC host Chris Matthews confronted a New York Times reporter on media bias during a "Hardball" segment Monday, asking whether she knows anyone at the paper who is pro-life. "And really this is something I think that is kind of an effective argument," NYT reporter Yamiche Alcindor told Matthews, referring to GOP nominee Donald Trump's argument the "elite media" is biased against him and is helping rig the election. "Because people really do feel when they go and get the news that they are really getting it from these people who have some sort of plan to rig this election, or rig the economy, or don't want to cover the real issues." I Now Feel Compelled To Vote For Trump. Bias has always been a factor in journalism. It's nearly impossible to remove. Humans have their thoughts, and keeping them out of your work is difficult. But 2016 saw the remaining veneer of credibility, thin as it was, stripped away and set on fire. More than anything, I can't sit idly by and allow these perpetrators of fraud to celebrate and leak tears of joy like they did when they helped elect Barack Obama in 2008. I have to know I weighed in not only in writing but in the voting booth. The media needs to be destroyed. And although voting for Trump won't do it, it's something. Mainstream Partisan Media Is Going Too Far. The partisan media is insisting that the election is all over, Hillary has won, and there's no need for you backwards Trump voters to bother anymore. The polls all confirm that Hillary has won, except they actually don't. ABC just said that Hillary has opened up her widest lead yet, popping up to confirm my first paragraph. Hillary wanted to run against Trump, as she thought him the easiest to defeat, and the partisan media cooperated all during the Republican debates by focusing entirely on Trump and not really giving the other 16 candidates much of a chance to get a word in. Hillary told another of her whoppers, claiming that 17 of our intelligence services had verified that Wikileaks was a Russian production and suggesting that they were trying to get Trump elected. Not true. Rotten to the Core. [T]hanks to WikiLeaks and others who are doing the job the Democrats' propaganda apparatchiks wearing the hats of the mainstream media refuse to do, we know what we're getting in the event Hillary Clinton is our next president. We know that the Clinton campaign and the Democrat National Committee control what's written and said about the presidential campaign. So much so that Politico's Glenn Thrush, who, recognizing how thoroughly he was whoring himself out to a corrupt political establishment when he allowed John Podesta to edit — or "approve" — an article he'd written about the campaign, self-identified as a "hack." Thrush shouldn't feel so guilty (are you kidding? Of course he should, and then he should leave the profession in shame!), as he's hardly alone. Podesta's emails are a treasure trove of collaboration between the Clinton machine and willing media stooges. Official Schools CNN's Brian Stelter on Liberal Media Bias. Liberal media bias has become painfully obvious during the 2016 election cycle. Between the severely lopsided coverage of political scandals and WikiLeaks exposing just how cozy the media is to the Clinton campaign, it's nearly impossible to deny its existence. But that didn't stop CNN's Brian Stelter from trying on Reliable Sources Sunday [10/23/2016]. "But how is this anything more than the team that thinks it's losing and trying to work the refs," he started off his show by asking, but Stelter may have bitten off more than he could chew with an RNC official who gave him an ear full. Gets Blasted In Virginia Beach. It's not like the media can say they didn't know this was going to happen. fight Trump, journalists have dispensed with objectivity. Any objective observer of the news media's treatment of Trump can certainly conclude that reporters are taking a side in this election — and they don't have to be wearing a button that says "I'm with her" for this to be readily apparent. The irony is that the media's Trump bashing may wind up having the exact opposite of its intended effect. Polls shows that journalism is one of the least respected professions in the country, and with Trump calling out media organizations for their bias, widespread slanted reporting is bound to reinforce this point — and to backfire. Trump's campaign is throwing down the gauntlet to the political class. If journalists are seen as the mouthpiece of that class, they may soon find themselves covering tosses aside his credibility. As a media critic for the Washington Post and CNN, Howard Kurtz was a reliable apologist for liberal bias in reporting. Moving to Fox News pushed him away from that. But with the departure of Roger Ailes and the rise of Trump, Kurtz has regressed into a PR man for a press corps that only 6% of the nation trusts, according to a poll by the Associated Press. There was a third debate this week. Kurtz wrote that Trump did well for 89 minutes but wiped that out in one minute by something he said. Blows Off the Echo Chamber. There is no news cycle. There is no national debate. There's no Ed Murrow, no Walter Cronkite, no figure of authority from whom the public can learn the facts with a reasonable degree of trust. [...] Sixty-two percent of Americans get at least some of their news via social media according to a Pew Research survey and the proportion is growing fast. Facebook and other social media allow individuals to customize their news consumption on the basis of recommendations and re-posting by friends, and news consumers increasingly depend on their networks rather than the media. [...] Only one in nine Americans believes that Hillary Clinton is "honest and trustworthy." Rejects 'Liberal Media' Label, Says Conservatives Have Fox News & Social Media. Appearing on Thursday's NBC Today, special correspondent Tom Brokaw dismissed Donald Trump's accusations of liberal media bias: "His complaints have been, apparently, that he thinks there's a media conspiracy of some kind. The media conspiracy consists of The New York Times printing his tax returns..." Co-host Savannah Guthrie downplayed the Republican nominee's complaint as something all candidates say: "And we probably can't find any presidential candidate in modern history who didn't feel that the media was definitely stacked against that candidate." of Trump-Lampooning TV Shows Nears 30. Filled with avid Clinton supporters, it is no secret that Hollywood disproportionately targets Donald Trump. Three months ago, an MRC Culture study determined that more than twenty TV shows had attacked him; now, with only three weeks until the election, the count has increased to nearly thirty. final State Dinner packed with media guests. Three weeks before the presidential election, the White House has stacked President Obama's final State Dinner heavily with guests from the media. No fewer than 22 journalists and media types were attending the glittering dinner in honor of Italian Prime Minister Matteo Renzi in a giant tent on the South Lawn Tuesday evening. Typically the White House includes a handful of journalists as guests at state dinners. Among the attendees were Chuck Todd, host of NBC's "Meet the Press;" Savannah Guthrie, co-host of NBC's "Today" show; George Stephanopolous of ABC's "This Week;" Gayle King, co-anchor of CBS's "This Morning;" and Haim Saban, billionaire chairman of Univision, America's largest Spanish-language broadcast network. Trump Derangement Syndrome Incites Violence. The media are going to great lengths to instigate a public hatred toward the Republican candidate. Consider the remarks from Jonathan Allen of Roll Call, who called Donald Trump a "subhuman" who has a "blackened soul." It's too easy for someone on the edge to take those remarks and decide that something has to be done about such a person. Meanwhile, the New Republic seems to suggest that Trump firebombed his own North Carolina campaign headquarters, presumably to use it as a means to obtain power. If it were true, wouldn't that make him the new Hitler, and therefore deserving of any and all the violence visited upon him? Of A Former Journalist In The Corrupt Media Establishment. I doubt anyone needs to be reminded that the media is rotten to the core; even the most reluctant and closed-minded people are accepting this as a given now. But despite the media being widely condemned nowadays (my special thanks to Germans for bringing the word "Lügenpresse" back), few people know or understand what's really going on in the journalistic kitchens, where the foul slop of lies that people are fed every day is cooked up. [...] The bottom line is to always remember that the media is not your friend in any way, shape or form, even if its lowest tier operatives fit the description of hapless victims rather than nation-wrecking enemies. The media must be opposed, exposed and boycotted at every turn until it starts bleeding money and choking on its own venom. is the list of reporters that John Podesta cooks for at his home — the biggest names in media. A couple of days ago, when reading through the Podesta emails, I came across one from April 8th with Podesta sort of bragging to the President of the Soros-backed propaganda machine — The Center for American Progress (CAP) — about how he was cooking for 30 of her reporter friends. Todd Hosted Swanky Dinner Party At His Home For Top Clinton Campaign Official. "Meet the Press" host Chuck Todd and his wife, a Democratic consultant, hosted a dinner party at their Washington D.C.-area home last year for Jennifer Palmieri, Hillary Clinton's communications director. An invitation for the shindig was sent on July 11, 2015 to John Podesta, Clinton's campaign chairman. Podesta's hacked emails have been released online by Wikileaks. The party, which also involved a cocktail hour, was thrown for Palmieri and her husband, Jim Lyons. shower Hillary Clinton with campaign cash. New Yorker television critic Emily Nussbaum, a newly minted Pulitzer Prize winner, spent the Republican National Convention pen-pricking presidential nominee Donald Trump as a misogynist shyster running an "ugly and xenophobic campaign." What Nussbaum didn't disclose in her dispatches: she contributed $250 to Democrat Hillary Clinton in April. Trump would be up 15 points without media's 'one-sided assault'. Hillary Clinton would be facing a double-digit polling deficit against Donald Trump if media bias against the Republican presidential hopeful didn't exist, former House Speaker Newt Gingrich argued on Sunday [10/16/2016]. "I think that without the unending one-sided assault of the news media, Trump would be beating Hillary by 15 points," Gingrich, a top Trump ally, said during an appearance on ABC's "This Week." Trump trails Clinton by 5.5 percent in the current RealClearPolitics national polling average, and he has fallen behind her in a number of battleground states that are critical to his path to victory. Rivera: I Have Never Seen 'the Mainstream Media ... Be So Partisan'. Fox News' Geraldo Rivera said Friday [10/14/2016] that he has never seen the mainstream media be so partisan in terms of their involvement in the presidential election. [...] "And I also want to say[,] imagine how daunting it is if you're Donald Trump and you wake up every day knowing that there are 20 of the best investigative reporters at the Washington Post and 20 of the best investigative reporters at the New York Times on your case every day, every night, 24-7," he added. Lockstep Partnership Between Clintons And The Media Is Bad For America. That this information is coming out is all so obvious that if you saw all these warning signs — and everyone saw these warning signs — and still supported Trump, you should look inward. Still, it's intriguing that there was an obviously coordinated push. the media reveal stolen truths? The reason we know about these leaks is the common thread among them — the willingness of the media to publish what was apparently stolen. Hence the question: Can the government hold the press liable — criminally or civilly — for the publication of known stolen materials that the public wants to know about? In a word: No. should investigate Brazile providing questions to Team Clinton. For a media that will somehow emerge from this election season much worse in the eyes of the American public than before it began, Tuesday was the decided low point. A WikiLeaks email dump of just one person's account — Hillary Clinton's campaign chairman, John Podesta — shows just how corrupt and compromised our media is today. Exhibit A is former CNN contributor Donna Brazile, currently on a temporary friendly suspension from the network after taking over as Democratic National Committee interim chairwoman following the humiliating resignation of Debbie Wasserman Schultz during the Democratic National Convention in July. As you recall, Wasserman Schultz was forced to step down after a separate WikiLeaks email dump showed top levels of the DNC were actively attempting to take down the candidacy of Sen. Bernie Sanders (I-Vt.). Media Is Liberalism's Achilles Heel. [A]bout half the population hates so-called journalists and is voting accordingly. That hate is destroying the media's business model, and they are scared. You can see it in their frenzied doubling-down on the same foolishness that made us hate them in the first place. We complain that the media hacks are taking sides and they publicly reject objectivity. the Final Demise of the Mainstream Media. If this year's presidential election has a silver lining, it is the final demise of "mainstream media." Which is not to say that liberal media are going away; they aren't, of course. But liberal media's claim to being mainstream — reliable, objective, fair, unlike fringe or partisan news sources — is gone forever. That is a good thing. No one could follow this year's campaign without understanding that the media formerly known as mainstream have jettisoned any pretense of neutrality, or even of journalistic integrity, in their desperation to preserve the status quo by electing Hillary Clinton president. Fair enough. We know where they stand. Are The Mainstream Reporters Who Are Open About Their Anti-Trump Bias. Reporters covering the presidential election from a myriad publications including The New York Times and NBC have expressed negative opinions about Republican nominee Donald Trump in writing, a Daily Caller investigation reveals. The journalists all expressed their thoughts about Trump over the past year on Twitter. Farewell USA Today! (I Hardly Knew Ye). Thursday [9/29/2016], USA Today announced its editorial board felt so strongly, it was time to take a historic stance and deviate from its longstanding "no endorsement" policy, urging readers to reject Trump. Accompanying the announcement was an awkwardly-staged video with a USA Today media reporter "interviewing" the editorial page editor in a scripted event that was supposed to appear off the cuff. For me, it will be difficult to view USA Today from now on as the newspaper it once was. After all, when an editorial board admits this sort of bias, it's reasonable to suspect they'll see fit to deviate from other normal editorial policies, slanting their news coverage in subtle if not overt ways. USA Today now joins a cadre of media and journalists who have sacrificed their once-sacrosanct role of trying to remain at least relatively unbiased for the sake of the audience they serve. Months Too Late, A Media Panic. The political press is panicking, and some are starting to contemplate desperate measures. Anxiety among Clinton allies has led them to demand that political media take the reins from her lackluster campaign. Members of the political press appear spooked enough to debate the pros and cons of the proposal. The threat posed by a Donald Trump presidency is so great, some on the left contend, that it demands extraordinary measures — by serving as judges of his mendacity. Given how accommodating the political press was to Donald Trump when he was useful to the left, the predicament in which the press finds itself today is both revelatory In Denial! Media 'Doesn't Exist,' Calling Us 'Media' Is 'Lazy and Unfair'. Washington Post media reporter Paul Farhi wrote a very strange article headlined "Dear readers: Please stop calling us 'the media.' There is no such thing." The headline in the paper was "What's wrong with the media? For starters, it doesn't exist." Low poll ratings and complaints from both parties have caused Farhi to suggest the media is some sort of phantom menace. Holt, 'Registered Republican'? Not at the Office. The Washington Post and Time magazine are trying to play up the fact that debate moderator Lester Holt is a registered Republican — as if this means anything about his performance. Registering only gives you the right to vote as a Republican. It doesn't mean that you actually do. It could just be a public-relations ploy. Grows as Trump Gains. Many in the media seem to be getting that horrible, sinking feeling that Donald Trump could actually win this. And they're not going to let that happen! I'm not one of those who think the mainstream media get together in some kind of cabal and plot the destruction of Republicans. I've been in the mainstream media, and I know they don't. What I do know is that nearly all of them are moderate or liberal, often talk to each other as if conservatives are bad or crazy, and that their outlook affects their reporting. Usually, they don't realize it or wouldn't admit it to themselves. And sometimes liberal bias is done on purpose. What I see happening now is reporters suddenly coming to the unthinkable conclusion that a Trump presidency could actually happen and, whether by design or not, they're amping up the negative Trump coverage. denounce the media for not derailing Trump's candidacy. The liberal media are freaking out over the possibility that Donald Trump might win the presidency. They are denouncing their profession, decrying what they see as a press corps that coddles Trump and castigates Hillary Clinton, and demanding a change before it is too late. Let's take a deep breath and see if they have a credible case, or whether this is pure partisanship. U.S. Media are Infected with "Ideological Affluenza". Not only do the media project an air of pontificating superiority and elitist entitlement, but it goes much further. These dolts are professionally conditioned to actually believe it. poll: American trust in news media falls to lowest level in history. A major pollster has some stark news: "Americans' trust and confidence in the mass media 'to report the news fully, accurately and fairly' has dropped to its lowest level in Gallup polling history, with 32 percent saying they have a great deal or fair amount of trust in the media. This is down eight percentage points from last year," writes Art Swift, an analyst for the Gallup poll, which first asked the nation to weigh in on the press in 1972. "Over the history of the entire trend, Americans' trust and confidence hit its highest point in 1976, at 72 percent, in the wake of widely lauded examples of investigative journalism regarding Vietnam and the Watergate scandal," Mr. Swift said. Journalism is Dead as we Once Knew it. "It used to be that if you read a story written by a journalist you didn't really know whether that journalist liked the person he was writing about or didn't. And I always said, 'the best journalists were the ones who when I read the story about me, I couldn't tell whether he liked me or not.' And when I read that I said, 'that's a real journalist.' I don't read many stories like that ever — there just aren't any." According to Huckabee, today there are an increasing number of examples of liberal bias in the mainstream media. Invented Lie About Trump Mocking Disabled Reporter. Just when you think the media could not possibly become more loathsome, the Fourth Estate bullies prove you wrong again. The Washington Post's latest ugliness was to exploit the disability of a newspaper reporter in order to smear the Republican nominee for president. Then — and this is the least surprising part of the story — the Post lied about it. media journalists rationalize their war on Trump. The mainstream media's lopsided coverage of the presidential campaign has gotten so blatantly anti-Trump and pro-Hillary that even some progressives are starting to notice. [...] Was it an "idealistic form of journalism" when the media carried on its "slobbering love affair," as Bernie Goldberg put it, with Barack Obama in 2008? Where were the intrepid "guardians" of the public weal when the media ignored the gaps in Obama's history, his fabrications in his memoirs, and his associations with the racist pastor Jeremiah Wright and the unrepentant terrorist Bill Ayres? Or when Journolist, an online discussion group of journalists and activists, colluded to downplay these unpleasant facts and coordinate negative coverage of the Republicans? Or how about CNN Political Correspondent Candy Crowley in the 2012 presidential debate, violating every canon of professional objectivity when she intruded herself into the debate in Obama's favor by backing up his false claim that he had called the Benghazi attacks an act of terror? And don't forget Univision anchor Jorge Ramos, [...] Anti-Trump Frenzy Will Backfire. The media can land a few punches, but they will not win this fight on their terms, because the media itself has become a central part of the problem. Their attacks are not on Trump, they are on all of us. looks inward, deems slanted Trump coverage warranted. Lately some, including The New York Times, Vox and Bill Moyers' website, have not only owned up to Trump's accusation, they've embraced it. "If you deplore media cowardice, you might think this is a good thing, not because Trump is a mortal danger to this country, although he is, but because it means the press is doing its job," Neil Gabler wrote on the journalism website of Moyers, the longtime PBS newsman who cut his teeth as a spokesman for Democratic President Lyndon Johnson. "Call it partisan bias if you like. I call it journalism." Ezra Klein, the Vox writer who as a Washington Post staffer organized a secret society of left-wing reporters dubbed "JournoList" that was shut down after it was exposed in 2010, acknowledged that the press is not giving Trump traditional treatment. anti-Trump frenzy signals the collapse of American journalism. This is a historic moment. Mainstream Americans will continue their migration to the Internet. That is their alternative and in using it they will continue the steady bankruptcy of the news organizations of MSM. Their abandonment of the standards for fairness and accuracy is completely willful. Is Overwhelming. After over two decades in the heart of America's spotlight, Hillary Clinton is still an unknown quantity for most Americans. That's thanks to one factor and one factor only: the love and worship of the mainstream media. Over the weekend, no less than six terrible stories broke that would have crippled anyone else's campaign. Manipulation of U.S. Politics Under Increased Scrutiny. Several recent articles are spotlighting a ridiculous transparency in the way the U.S. media is covering the 2016 Presidential Election. [...] Yep, the results confirm there is indeed validity to those people who point out this ridiculously over-the-top attack against candidate Donald Trump with the specific intention to advance candidate Hillary Clinton. As a reasonably minded person might say, at this point — it's unequivocal. journalism is collapsing before our eyes. Donald Trump may or may not fix his campaign, and Hillary Clinton may or may not become the first female president. But something else happening before our eyes is almost as important: the complete collapse of American journalism as we know it. The frenzy to bury Trump is not limited to the Clinton campaign and the Obama White House. They are working hand-in-hand with what was considered the cream of the nation's news organizations. The shameful display of naked partisanship by the elite media is unlike anything seen in modern America. Greenwald: The U.S. Media Is Essentially 100 Percent United Against Donald Trump. [Glenn] Greenwald, the progressive journalist who broke the Edward Snowden mass government surveillance storyline, was asked what he thought about Donald Trump's press conference recently in which Trump joked that Russia should release any emails it has from 2016 Democratic presidential nominee Hillary Rodham Clinton's illicit private home-brew email server from her time as President Barack Obama's Secretary of State. Media coup d'état against Trump. Fox News' Howard Kurtz brought my attention to a New York Times article by Jim Rutenberg, a media columnist, who views a Donald Trump presidency as "potentially dangerous" and he essentially encourages reporters to "move closer than you've ever been to being oppositional." [...] A 2014 Indiana University poll found that just seven percent of journalists identify as Republican. My guess is that once you remove Fox News and Wall Street Journal reporters from the sample then that percentage would be quite close to zero percent. Yes, Donald Trump and other Republicans are right. The media is biased. Yet, many voters, perhaps most, don't understand, possibly because teachers and professors, themselves mostly comprised of leftists, tell students that journalists are simply collectors and conveyors of facts. political insanity. Throughout history, real-life dictatorships have been known to "pre-define" reality via meaningless slogans, political correctness, and punishment of cerebral dissent. The fact that several months before elections we are constantly told that a candidate has already won definitely rings an alarm bell. Orwellian "Newspeak" morphed today into NewsSpeak, with the mainstream media acting as thought police. While we are being nonchalantly reminded about a long list of observable crimes that go unpunished, the media cheer those crimes' authors and try to contaminate us with the "enthusiasm." Grows Amid The Weaponized Media. Unfortunately when the wider U.S. electorate voted the Fresh Prince of Bill Ayers to be the president of the United States they were, perhaps unwittingly, ushering in a new era of fundamental change, governmental weaponization. Events and outcomes ceased to be determined by laws, and the politics of any given event became the overriding filter through which all action, or lack thereof, would be determined. The last seven years have provided numerous examples for points of reference. The IRS investigation of conservative groups was driven by politics, not legality. The investigation of officer Darren Wilson was driven by politics, not evidence or legality. The arrests of the Baltimore Six were driven by politics, not factual, substantial evidence. The FBI decision not to recommend an indictment of Hillary Clinton was driven by politics not evidence. These are just a few examples of manipulated common law principles that have been overridden by considerations of political benefits. CNN's parent company is one of Hillary Clinton's biggest donors. If you watched the first Democrat Presidential debate last night on CNN, it was plainly obvious that the head honchos did their level best to make it the Hillary Clinton show. The main moderator, Anderson Cooper, used to be a member of the Clinton Global Initiative; and he couldn't wait to interrupt each of the other candidates so that he could get back to whatever Hillary Clinton wanted to say. Clinton was front and center on the stage, and it wasn't by accident. worse than TV on Trump/Clinton coverage, report finds. If you think the television networks are biased toward Hillary Clinton in the current presidential race, a media watchdog wants you to know that newspapers are even worse. The conservative Media Research Center first compared TV news networks' coverage of two recent controversies involving Clinton and Republican rival Donald Trump. Clinton's appearance at a Kissimmee, Fla., rally with the father of Orlando terrorist Omar Mateen seated prominently behind her earned a fifth of the amount of coverage that Trump's ambiguous suggestion that Second Amendments advocates could "do something" about a Clinton administration's Supreme Court justices got. But when MRC looked at how the two controversies were handled by print journalists, the discrepancy was even more stark. Carlson Reveals the Sad State of Modern Journalism. Criticizing the current state of modern journalism, Tucker Carlson told Accuracy in Media (AIM) that journalists' obsequious behavior, blatant bias and monolithic worldview have compromised the integrity of the nation's fourth estate. [...] Questioned about the media's election coverage this year, Carlson opined, "I don't think by and large they have been covering it, they've been advocating on behalf of one candidate against another." He explained that regardless of the election's outcome, the media's advocacy has destroyed its claim Halperin Mocks 'Unscientific' Claims of Liberal Media Bias. Journalist and author Mark Halperin on Monday [8/8/2016] mocked the "unscientific" claims of liberal media bias from conservatives. With All Due Respect guest Donny Deutsch derided the 2016 campaign assertions as "conspiracy theories." After playing a montage of conservatives on Fox hammering journalists for coverage of Donald Trump, Deutsch seethed, "It's preaching to their audience which, A, loves conspiracy theories. I mean, they're talking to their audience." Trump: The media is no longer your friend. Dear Mr. Trump, Apparently you didn't get the memo — the one that told you the difference between competing in the primaries and running in the general election. Here's the bottom line: you are now facing off against Hillary Clinton, and the media is no longer in your corner. If you're wondering why The New York Times ran a piece about the Khan family a full 10 days after the Gold Star father spoke out against you at the Democratic convention, even though there is no breaking news on that damaging fracas, it is because they do not want you to win. That Cried Wolf. You are not dealing with the fourth state. You are not even dealing with a press that pretends to be objective. You are dealing with the propaganda arm of the Democratic National Committee. While Fox provides something of a counterbalance, most Americans still get their news from tainted leftist sources. DNC Emails: An Optical Collusion? For years, it's felt like the mainstream press was just a satellite office of the DNC — and in light of the 20,000 emails leaked this week, we know why. The intimate relationship between the Democratic Party and the media isn't just a conspiracy theory dreamed up by paranoid conservatives. Turns out, there's more bias in some newsrooms than there is at a Lois Lerner auditing party. From reporters giving party officials a chance to edit or comment on their stories to outright dictating what questions Democratic officials will be asked on air, the collusion uncovered in the pages of messages is astounding — even for the most cynical media critic. Attacks On Trump Expose The Media's Hollow Echo Chamber. Now that Donald Trump has finally secured the GOP nomination, we can look back at the last year and see unfolding events with greater clarity. The media frenzy surrounding this election, the 24/7 news-cycle, and Trump's gumption ensure we're constantly talking about him, analyzing his every move. Although the most fascinating presidential election in decades, it can get rather exhausting, and there's no end in sight. Whining About the Media Is a Losing Strategy. Media bias in favor of Democrats is a fact of life. This is blindingly obvious to most serious observers of American politics, and it has been repeatedly confirmed by serious studies of journalistic trends. It is also an utter waste of time for a GOP presidential nominee to whine about it. Complaining about the partisan press is like complaining about the weather. It accomplishes nothing. Yet, instead of emulating the successful strategies of Reagan and Bush, Donald Trump has allowed himself to be tricked into squandering increasingly valuable campaign time bellyaching about media bias. the scandal you won't hear about on cable news. [Scroll down] The biggest example of that was the non-story about Trump supposedly attacking the Khans, the Gold Star family who denounced him at the Democratic convention. If you actually look at what Trump said in response, the worst he ever did was ask why Mrs. Khan did not speak even though she appeared on the stage alongside her husband. Mr. Khan on the other hand questioned Trump's patriotism, his knowledge of the Constitution and essentially called him a bigot. In the real world, Trump showed admirable restraint in the face of this attack, especially when it was eventually discovered that Mr. Khan is an advocate of the primacy of Islamic sharia law over all other law, including the Constitution. But the Khan-troversy was just one of many hyped-up stories rolled out over two weeks by the national media so they could ask the one over-riding important question over and over: "When will Donald Trump withdraw as the GOP nominee?" To anyone who was watching with an open mind, it was obvious that the media was creating the story, not reporting it. the scandal you won't hear about on cable news. In the last two weeks, it has become obvious that a political scandal is unfolding which exceeds in scope anything seen previously in our country's 240-year history. What could that be? Is it the fact that leaked emails proved that the Democratic Party rigged the election cycle to ensure that Hillary Clinton would be nominated for president instead of her grassroots opponent, Bernie Sanders? Or the fact that it became firmly established that the Obama administration had essentially agreed to pay ransom to Iran for the release of our hostages? How about the fact that President Obama — acting more like Hugo Chavez than George Washington — announced from the White House that one of the two people who have a chance to be the next president of the United States is "unfit to serve" in that office? All of those were bad enough, but they don't come close to the importance of the political scandal that you will never hear reported on cable news or in the pages of the New York Times. Corruption At the Core — The Latest Evidence. Just a few days before the [Democratic national] convention Julian Assange's Wikileaks released over 20,000 emails hacked from the DNC. From the publically exposed internal emails what many of us have suspected was verified, that the DNC colludes with the mainstream media on their reporting. [...] Over 15 specific recent examples were exposed of mainstream media "draft sharing" their stories before publication. Draft sharing is a practice of sharing the drafts of stories with sources before the stories are published. Hispanic and black "buckets" of voters, "most brand loyal" to Democrats. While not illegal, from a reporting standpoint, the practice is unethical, according to journalism experts. Renita Coleman, a professor of journalism at the University of Texas at Austin, has said, "It's been a time-honored code that you don't show sources stories before they run." Trump Endorsements To Avoid Disunity Media Narratives. Corporate media (in full alignment with Wall Street) is our enemy. Corporate media is Tokyo Rose. There's a battle being waged on multiple fronts as the right-wing of the UniParty is left naked to their enemies, us. Trump Controversies 'Pushing Off' Coverage of Hillary Scandals. Acting like an innocent bystander with no control over NBC's reporting, on Tuesday [8/2/2016], Today co-host Savannah Guthrie declared that the media focus on Donald Trump's controversies made it impossible for journalists to also cover the scandals swirling around Hillary Clinton: "I mean, this story [of the Khan parents] has now been kept alive for four days... By the way, pushing off some otherwise negative stories about Hillary Clinton that might be leading all the headlines." Republicans, Cheering Democrats: The Media's Biased 2016 Convention Coverage. With both the Republican and Democratic conventions now concluded, it's time to judge the news media on how fairly they covered the two parties. Media Research Center analysts looked at various aspects of coverage, all of which demonstrate that journalists obviously favored the Democratic gathering. By a 12-to-1 margin, journalists spent far more time deriding the Republican convention for its negativity, even as their reactions to Democratic speakers were consistently positive and often enthusiastic. Cable news had its own unique biases: MSNBC carved out time on each night of the GOP convention for interviews with top Democratic officials, but — despite promises to the contrary — aired no such interviews with Republicans during the Democratic convention. Meanwhile, CNN devoted more than an hour of airtime during the Democratic convention to airing 18 party-produced videos, but only included three such videos during the GOP convention. Anchor Wolf Blitzer wasn't celebrating Clinton nomination. CNN is pushing back on claims that one of its lead news anchors was seen celebrating Hillary Clinton's historic nomination for president Thursday night [7/28/2016], calling the accusation "absurd." A video circulating online shows anchor Wolf Blitzer dancing to Neil Diamond's "Sweet Caroline" while drinking from a glass and waving his hands in the air, apparently at the network's CNN Grill in Philadelphia. "CNN celebrates Hillary: Blitzer toasts speech, dancing, party!" reads a headline at the conservative Drudge Report, linking to the video. But a CNN spokesman said Friday that Blitzer was not showing bias toward the Democratic nominee, only celebrating the end of the network's coverage of both parties' national conventions. To Ditch A Media That Vets Its Stories With The DNC. [Scroll down] They weren't just feeding stories to impressionable journalists, but the more enthusiastic partisans were sending stories to the Democratic National Committee for pre-publishing approval. The media hardly fares better with straightforward event coverage. Television media has chased a dwindling audience for so long by adding flashy graphics, skimpy clothes, and dirty laundry fillers that I don't know if they realize how insufferable they have become to listen to and watch. Apparently, they were all hunting for the same clickbait potential Trump supporter story behind the scenes. Then for the actual convention, they kept cutting away from the people at the podium, assuming — erroneously — that I wanted to listen to their commentary instead of the actual party officer on the stage. CNN's Persistent Bias. The bias of every CNN host I've seen, including Gloria Borger, Erin Burnett, Ashleigh Banfield, Christiane Amanpour, Wolf Blitzer, and the fawning Piers Morgan whose reportage has been the equivalent of french-kissing the entire Clinton family, has been disgusting and depressing to see. The only talking head who has seemed even slightly close to reasonable is Anderson Cooper. CNN gave copious air time to Bill Clinton's "interview" of Barack Obama, followed by Piers Morgan's sycophantic pro-Clinton propagandistic interview of Bill in which Morgan said that Senator Ted Cruz's Senate colleagues think Cruz is "crackers" (getting a guffaw out of Bubba) and suggested that the US is extremely fortunate to have the Clinton family, including Chelsea. But the worst of the bias was in their coverage of Cruz's filibuster. WikiLeaks Hack Exposes About Democrat Media Bias. Leaked emails seem to suggest that the Democratic National Committee maintains cozy relationships with mainstream media outlets but takes a more caustic approach with publications it believes to be conservative. According to these emails, party officials stonewalled and blacklisted the Washington Examiner when editors approached the party in May to gather the names of delegates to the Democratic National Convention for publication in a souvenir edition of its magazine. "I can send an alert to the state parties not to respond to this inquiry," DNC Deputy Communications Director Eric Walker wrote in an email of May 10. "Examiner is a right wing rag." Immigration and Astroturf. What if all isn't as it seems? What if the reality you found is completely false and contradictory to the reality you are told exists? The stories that now predominate the news headlines in America are not actually news at all. What passes for the news today is nothing more than carefully constructed narratives created by unseen special interests designed to manipulate your opinion while pushing an artificial agenda. This is the essence of what veteran investigative reporter Sharyl Attkisson defines as astroturf. Attkisson explains that astroturf disguises itself as being legitimate while in actuality it's not as astroturf is a "perversion of grassroots by corporations, special interests and political interests of all stripes exploiting the media and the internet to try and convince you [that] there's widespread support for or against an agenda when there's not." Let Liberals Destroy Fox News. The idea behind the Fox News channels was by no means a stroke of genius; it was actually a stroke of the blazingly obvious. Why not create a cable news network that was explicitly not another Democrat propaganda machine and directly target the 50 percent of Americans the rest of the media either ignores or treats like dirt? [...] Fox has so much influence, and makes so much money, because it's the only big player the space between the coasts. However, the left can't tolerate any dissent, and it will do all it can to try to ensure that Fox becomes yet another dull, goose-stepping transcriptionist for the coastal liberal elite. The Democrat Media Complex. [Scroll down] The objective of the press today is not merely to inform, but to instruct the millions of impressionable American minds on what to believe, who to believe, and how to believe. The content is so rigidly controlled today that in a way the fourth estate has now become nothing more than an institution of the government restricted to publishing and advancing White House directives and Democrat policy agendas. The role that the press plays is to make clear to the American people what the Obama adminstration is doing, why the adminstration is doing it, and why it is forced to act in a certain way. Of course, as we have become accustom to hearing, the Obama adminstration is always forced to "act in a certain way" because of the "obstructionist" Republicans. The effect of this is to demonize the Republican party to the point of capitulation. This formula for "reporting" by the press encompasses every single issue advocated by the Obama adminstration and the Democrat party. Mainstream Media Chose a Side and Now It's Paying the Price. What's super sad is that when I started counting all of the mainstream media reporters I respect I didn't run out of fingers. Most of them are just what Glenn "Instapundit" Reynolds memorably labeled "Democrats with Bylines." And that's literally true — something like 90% of them are, in fact, Democrats. And they act like it. [...] The MSM, of course, wants to have it both ways. It wants to be hailed as an institution composed of crusading truthtellers whose integrity and willingness to speak truth to power make them the cornerstone of a free society. Except most of them are really partisan hacks who lie endlessly for the liberal politicians they suck up to. Post and DNC Hold Joint Fundraiser for Hillary Clinton — Lawyers said "illegal", Did it Anyway. Apparently, The Washington Post was hosting a party. The DNC saw the opportunity to make a fundraiser out of it and sell tickets to the party to donors. However, the email chain shows the lawyers for the DNC said they can't publish the price for the tickets because the joint event would be illegal. Emails: DNC Had Off-Record Meeting With Wall Street Journal, Leaked Doc from Sanders Campaign. The Democratic National Committee held an off-record meeting with the Rupert Murdoch-owned Wall Street Journal in April, according to DNC emails released by WikiLeaks today [7/22/2016]. A leaked email featured a schedule of numerous meetings with the media that were scheduled to take place during the week, and also included off-record meetings with Buzzfeed and Bloomberg. Helped Set Expectations For RNC Protest 'Chaos' in Cleveland, and It Didn't Happen. The headline at Dan Zak's Arts & Entertainment column at the Washington Post early Thursday evening [7/21/2016]: "We were promised a riot. In Cleveland, we got a block party instead." Though his article's tone was generally positive, he did complain that "Cleveland is basically a police state this week." [...] So it's worth asking who made the "promise (of) a riot," or at least who built the expectation. To what should be no one's surprise, the Associated Press had a big role. The Media Covers Up Muslim And #Blacklivesmatter Terrorism. The media spin on Micah Johnson and Eugene Gavin Long, Omar Mateen and Mohammed Bouhlel is propaganda with a purpose. The purpose is protecting the media's political allies from being linked to the atrocities being committed by their friendly neighborhood Islamists and black nationalists. Every Muslim and black nationalist terrorist is crazy. Because the alternative is admitting that both movements use violence to achieve their goals. And that their political allies on the left are complicit in their crimes. As the violence increases, so do the cover-ups. Anyone who reaches the obvious conclusion about Islamic terrorism and #BlackLivesMatter is dubbed a bigot. A rash of politically motivated killers are dismissed as lunatics. Gun control is revived, not just for its own sake, but as a convenient distraction. Cleveland Show: Expect Reporters to Paint the GOP as Rigid, Intolerant and Ultra-Conservative. Here's a safe prediction about this week's Republican National Convention: TV reporters will paint the GOP as too conservative, hostile to women, anathema to blacks, and an all-around turn-off to voters. And that's not just because the ever-controversial Donald Trump is set to be nominated as the party's presidential candidate. Going back to the 1988 convention, the MRC has documented how reporters act like Democratic surrogates, lecturing Republican officials and delegates about how they are too far to the right and intolerant. Corey Lewandowski Still Being Paid by Donald Trump Campaign. Three weeks after hiring former Donald Trump campaign manager Corey Lewandowski as a commentator, CNN has begun to inform viewers that Lewandowski still receives cash from the Trump campaign in the form of severance payments. Media Matters notes that in two recent appearances on the network, hosts for the first time disclosed Lewandowski's continuing financial ties. Most recently, Lewandowski was introduced Tuesday on CNN Tonight as "former Donald Trump campaign manager Corey Lewandowski, who is still receiving severance from the Trump campaign." Narrative Of A Shooting Can't Be Formed Until The Media Knows All Races Involved. When we examine the three big media shootings of the past month, we can see a profound difference in the media coverage and the political response of Barack Obama, Inc, and his chosen successor, Hillary Clinton. I become more convinced with each tragedy that the Democratic modus operandi to a shooting tragedy is one sympathetic tweet as soon as possible, one statement condemning the violence the next day, then unceasing calls for gun control until the next tragedy. However, although these shootings were all senseless violence, and all resulted in lost American lives, and one should think that that would mean that perhaps a common thread of "we have a lot of unhappy people, maybe we should fix our narcissistic, autistic, overmedicated society into something resembling humanity once again," we instead bear witness to how the political regimes in this country can either use, or not use, each of these tragedies to their best interest, and so we see a different response to each. the Way, I Am Right About the News Media Being Afraid to Offend Blacks With the Truth. Recently, I've written four columns here that all had a similar premise: The news media is afraid to tell the truth when it comes to issues of race because nothing can get them in more trouble than being seen as racist, even if all they are really doing is stating facts. Well, we now have at least two new pieces of strong data suggesting that I am dead right. [...] The first comes from CNN's coverage in the aftermath of the killing of at least three police officers in Baton Rouge, Louisiana by Gavin Long. Long was a black man with an extensive social media profile littered with numerous racist statements against whites and connections to racist black groups. However, one liberal black commentator wanted to make sure that no one rushed to any conclusions based on the fact that we now have two massacres of police officers perpetrated by young black men within just a week (after all, rushing to a guilty verdict is an act usually reserved by the news media mostly for white police officers and college football coaches). Oops, We Started a Race War! As the chaos unfolded late Thursday night in Dallas, I was struck by how many members of the media insisted the protest was peaceful and we have to remain calm. [...] The reason these reporters were acting like teachers is that's how they see themselves. They don't just report the news, they Voxplain it. Of course, the problem with thought control is you need to keep correcting the course. First they tell us "racism is alive and well" and we should be disgusted with our country, but when that starts a riot, they backpedal and tell us we're overreacting. [...] The clowns on TV went to Cultural Marxism school so they're not trained journalists. They're trained socialists. This means they're experts at propaganda and controlling the populace while having little or no interest in the truth. Signal Writer Exposes 'Alarming' Media Bias at Top Journalism Conference on Guns, Women's Health. In an excellent piece on Monday [7/4/2016] for The Federalist, Daily Signal senior news producer Kelsey Harkness thoroughly detailed her time at the 2016 Investigative Reporters and Editors Conference (IRE) that led her to conclude that "the problem" in the journalism profession today "goes far beyond agreeing on the facts" after seeing media bias in panels about guns and women's health. Harkness began by emphasizing that she went to the conference with the intention "to learn about fairness, integrity, and hard work" and on issues like "gun rights, women's health, and policing," she expected there to be "equal weight" given to all sides. After making clear that she works for a site affiliated with the conservative Heritage Foundation, she realized that "during some training sessions I watched top professionals in their fields encouraging political bias against conservatives before reporters' pens could even hit paper." Shocked, Shocked To Find Liberal Bias At This Major Journalism Conference. In June, I had the honor of attending one of the top journalism conferences in the country, if not the world. For three days, I rubbed shoulders with reporters from places such as The New York Times, USA Today, and ProPublica. Call me naïve, but I expected to learn about fairness, integrity, and hard work. This means giving equal weight to politically divisive issues such as gun rights, women's health, and policing. Instead, during some training sessions I watched top professionals in their fields encouraging political bias against conservatives before reporters' pens could even hit paper. Pelosi Thanks Press for Creating 'Echo Chamber' on Gun Control. During a press briefing on Thursday [6/23/2016], House Minority Leader Nancy Pelosi openly thanked people in the news media for creating an "echo chamber" that provided extensive coverage of the Democrats' "sit-in" seeking legislation to promote stricter gun control even though the Senate didn't approve a similar measure. "Thank you all," the California Democrat said. "I never saw the gallery so full," she stated before noting that her staff "gave me six pages today. Six small-print, full pages listing of newspapers around the country where the sit-in was on the front page. I thank you for that. Thank you all." [is] Never Blamed for Bad Security. It seemed like every piece of bad news during the Bush years was somehow Bush's fault — and proof of his incompetence. [...] But absolutely no one in the media wonders for two seconds if Obama looks incompetent when a terrorist calls the cops to declare himself an ally of ISIS and shoots more than 50 people, killing 49. Instead, the post-shooting "news" focused on how the Republican love of "assault weapons" and hatred of homosexuals are the obvious targets for blame. What of Islamic terrorism? What of Obama's incompetence — his very real refusal to even call the threat by its name? It doesn't matter if it's San Bernardino, the Boston Marathon, Chattanooga, Benghazi or Fort Hood. No terrorist attack has ever cast the slightest shadow over this president. Can we have a do-over with the mainstream media? People are beginning to notice that the media is not addressing the real world, but their own political leanings, and truth and clarity and honesty are not to be found. Everybody's got an agenda, and truth just isn't in it. [...] This is at the same time that the ways media reaches us are fracturing and changing before our eyes. Do you read the same blogs or refer to the same sources as you did last year? And how much faith do you have that what you read is actually true? Do you know how to surf through the media rejecting the false and saving the real, and is the real real? Certainly our schools are not teaching our young what information is and what it is not, and how to manage the information we receive. They are not taught how to distinguish propaganda from truth, nor falsehood from reality. And it shows in the chaos emerging from the campuses. media is using you as pawns. Don't let them. Not liking Trump and opposing the left aren't mutually exclusive. It should be every conservative's duty to rebut dishonest left-wing propaganda. Prioritizing Trump-bashing over rejecting the malicious notion that Trump's rhetoric is strengthening ISIS or that alleged American homophobia is responsible for Orlando is surrendering to the left. Attkisson: Media Distorting Facts to Serve World Elites at Levels Never Seen Before. [Scroll down] "I just got back from a conference in Russia, of all places, where global journalists gathered to talk about this as a trend globally, where government interests, corporate interests, special interests have learned how to use the news media," Attkisson said, "how to use social media to control the narrative in ways, I think, more aggressively than has ever been done before." in newspapers, TV news hits bottom. Confidence in newspapers has hit an all time low in the latest Gallup survey, and TV news is also at a new low, the latest proof that Americans are losing faith in the media. Gallup found that just 20 percent have confidence in newspapers, a 10-point drop in 10 years. TV news saw an identical 10-point drop, from 31 percent to 21 percent. Poll: Not a Single White House Reporter Is a Republican. Not a single member of the White House press corps is a registered Republican, according to survey results recently published by Politico. Those results are buried in a story this week on President Barack Obama's relationship with the press. An infographic posted in the story reveals that not a single one of the 72 members of the White House press corps surveyed by the Virginia-based trade publication identifies with the GOP. Of the journalists surveyed, more than a quarter are registered Democrats and 13 percent are not members of any political party. Sixty percent are not registered to vote, but 72 percent of those polled said they think reporters should vote in elections they cover. Media Corruption that Helped Spawn The Donald. The charge that the news media is biased toward Democrats is an old one, but only because the truth of it is so ludicrously apparent. When the chief anchor of ABC News is a former Clinton operative, when the best investigative reporter at CBS News had to quit because the network wouldn't run her stories about Obama's malfeasance, when the former anchor at NBC News actually bowed to Obama like a courtier to a king, Andrew Breitbart's accusation that we're dealing with a "Democrat-Media Complex" seems much too polite. To some extent, the ideological corruption of our press is an outgrowth of the shattered American political consensus. As our politics has become more European and extreme, so our media has become more European and partisan. It is a shame, however, that news outlets should skew so entirely to one side, that fifty percent of the country should find itself insulted, coerced and lied to on a daily basis. Ways Orwell's 1984 Has Come True Since Its Publication 68 Years Ago. [I]t's a wonder so many Americans put faith in mainstream, corporate outlets for an accurate summary of the news, yet they still do. Just six corporations own 90 percent of all media platforms in the U.S., effectively controlling the narrative — whether on foreign policy, legislation, or any goal fitting its needs. Indeed, many call corporate media the government's mouthpiece for good reason — a number of executives and upper-level staff from mainstream outlets donate the maximum allowed to line the campaign coffers of politicians in every level of government. Plenty of others have proffered hefty sums to organizations with ties to candidates — such as the Clinton Foundation. Though the merits of a media without any bias could be debated endlessly, to surmise such intermingling of interests leads to favoritism in the press wouldn't be a stretch. What would be a stretch, however, would be calling reports from these outlets news in the traditional, original sense. When the government needs Americans' approval for, well, anything, it simply turns to the press to cough up an appropriately-tilted news item — and even Orwell, rolling in his grave though he may be now, would have called this process by the most honest non-Newspeak term available: propaganda. R. I. P. For a variety of historical and cultural reasons, most of those who work in the media are progressives. They believe that government must undertake to fix an array of social maladies, such as income inequality, perceived racial and gender disparities, and the general dangerous superstitions, bad habits, and cultural baggage of those of less education than reporters, investigative journalists, and Internet and television commentators. Yet sometimes simply reporting on society's perceived ills does not offer quite a rich enough landscape in which to save humanity. And sometimes reality offers examples that confound the progressive ideology. Therefore, journalists often fabricate stories and justify their cons as necessary means to achieve their higher aims. Roundtable Guests Seven Times More Likely to be Anti-Trump. Despite Trump being the only candidate remaining in the GOP race, his supporters accounted for only 12 percent of all participants (9 out of 73 total) in roundtable discussions on Sunday shows from May 8 to May 29. A staple of Sunday political shows, the roundtable discussions give a chance for pundits from across the political spectrum to voice their concerns and opinions about the political news of the day. The difference between liberals and conservatives is still significant when you include anti-Trump GOP guests. While Fox and CNN had equal numbers of Republican and Democratic guests, ABC, CBS and NBC had nearly three times the number of liberal guests (36) compared to either pro or anti-Trump Republicans (13). The purpose of having four participants is to encourage a wide variety of views in the discussion. By stacking these discussions with liberal journalists in addition to outright Hillary and Sanders surrogates, the networks are steering the narrative in a particular direction. Media Denial of Climate Change Thuggery. Powerful government officials collude with proponents of one side of a vastly complex national debate. They target the opposition. They use their broad investigatory powers to intimidate, financially punish and ultimately silence them. The legacy media respond to this egregious misuse of the public powers of office by collectively yawning and looking away. We expect the media to inform the public, to safeguard free expression and to promote robust debate. Yet time and again, the legacy media fail to deliver. They avoid colorful stories that cast doubt on the Obama administration's climate change agenda. They ignore the abuse of power perpetrated by four state attorneys general, at present count, on organizations that deviate from the party line on climate change. White House Correspondent Explains "How Obama Gets Away With It". [Scroll down] One of the news media's main jobs is to hold public officials accountable, from the president on down. But Mr. Obama is the beneficiary of news-media managers and reporters who mostly like his style and agree with his policies, from his reluctance to make strong military commitments to his advocacy for LGBT rights, fighting climate change and supporting tougher gun-control laws. Case in point: The administration's easy orchestration of the media story line about the Iranian nuclear deal, recently revealed by Deputy National Security Adviser Ben Rhodes, only scratches the surface of the White House's skill at managing a media happy to be managed. Given such a congruence of opinion, Mr. Obama's policies don't receive the scrutiny and analysis they should. Bias: From Nixon's Fund to Trump's Women. [Scroll down] One could go on - and on - with examples of media hit jobs like this targeting GOP luminaries. (Does the name "Dan Quayle" ring a bell?) Now, it's Donald Trump's turn. There on the front page of the Times was that story that has now been rebutted by one of its prime subjects. Meanwhile, as Sean Hannity and Newt Gingrich have pointed out, the Times can't find space for interviews with Bill Clinton's hanging out on the jet of a convicted pedophile who fills his plane with young women. Not to mention there is mysteriously no extensive investigation into allegations that Hillary Clinton was an enabler of rape and sexual abuse, as accused by women with names like Juanita Broaddrick, Kathleeen Willey and Paula Jones. Indeed, MSNBC's brusquely dismissed Broaddrick by saying her story was "discredited." By whom? Mitchell did not say. That this business of the liberal media hit job has been going on for decades is no secret. Some Thoughts on Facebook and Conservatives. [Scroll down] I still have great relationships with the folks at CNN though I have not worked there in four years. They were and are good people and I call many of them friends. I know many of them were to the left of me, but I thought they tried to balance out most topics. But, on multiple occasions I recall having to go on television to talk about news stories that originated on left of center websites and never once did so over stories from right of center sites except when I myself offered up the stories. Likewise, before most topics were discussed producers would send emails with relevant links to relevant stories on the topics. There were always more links to left of center sites covering the stories than right of center sites. Talking Points Memo and Think Progress more regularly appeared than a RedState or National Review link. It was not so much an intentional liberal bias as it was a world view and a relationship. When all your friends are looking at the same things on the internet, you'll find you are too. So it is with news producers and editors. Agents and the CIA. The CIA institutionalized the term "conspiracy theory" in its very successful attempt to derail the honest attempts to investigate the roles of various governmental agencies and individuals that were involved in the execution of President Kennedy in 1963. Of course, all clandestine state-sponsored secret service agencies (like the CIA, MI6 and the Mossad) routinely and shamelessly make use of lies, secrecy, deception and false flag operations in their daily affairs. It is a fact of life for such secret agencies and it is all accomplished in the name of "national security". The CIA has admitted that it routinely "plants" stories in the mainstream media. Those "press releases" contain disinformation that influences the perceptions of the electorate and thus national policy. to Media: Follow Late Night Comedians in Taking Down Donald Trump, GOP. Speaking to reporters on Wednesday [5/11/2016], House Minority Leader Nancy Pelosi instructed them to follow the lead of late night comedians (in the mold of The Daily Show or The Nightly Show) to take down Donald Trump and the Republicans to the point that she offered to "encourage" them to broadcast such exposes as the general election intensifies. Pelosi led into the suggestion for her like-minded media members by lamenting that she and her fellow House Democrats would not be able to showcase "a side-by-side and some of the egregious remarks" made by Donald Trump and allies due to House rules deeming such an exercise illegal. of Us Are Strangers in Our Own Party. No, this is not because of Donald Trump's victories over the past few months, although it is certainly a reflection of them. It is because the media has succeeded in helping reelect every single RINO incumbent in every election cycle and most open races, including in this much-vaunted year of the outsider. The system is rigged, but not in the way Donald Trump claims; he is the recipient of the rigged system. It is rigged because anyone who is truly a smart and principled conservative will be destroyed in a primary — either overpowered by the media or the superior power, money or fame of the non-conservative candidate who almost always runs as a conservative outsider as well. [...] [P]rincipled guys finish last because the media will ensure that outcome. Ready for the Biggest Media Assault You've Ever Seen — Aimed Squarely at Trump. Fox News made a name for itself by being the "fair and balanced" network. Conservatives found a place where their views were represented, although the station did have a representative selection of liberals to balance out the conservative point of view. Then along came the 2016 primary and the Trump circus. News stations and talk radio hosts quickly realized that if you put a reality TV star on your show, your ratings will go up. Even better (for them, not for America): if you put a reality star who regularly says completely unhinged things on our show, your ratings will go through the roof. Sadly, Fox became the worst Trump-ratings whore in the cable news business. Aren't We Having a National Conversation About Leftist Violence? [Scroll down] The media was happy to portray the peaceful Tea Party as a movement surreptitiously driven by racism without a shred of proof outside its opposition to Barack Obama. You will remember Paul Krugman blaming peaceful assembly and free speech for an insane person's "assassination" attempt against Kathleen Gifford, and Ezra Klein lamenting how scary things get when conservatives oppose liberal doctrine. Every shooting in America necessitates a thorough investigation into political proclivities of the perpetrator. Is he angry at the president? Did he ever register as a Republican? Is he fond of the Confederate flag? But only when the facts mesh with the helpful narrative do we hear about it. When a single incoherent nutjob shoots up a Planned Parenthood, the National Rifle Association and every pro-life organization — nay, every pro-lifer in the country — is called to do some soul-searching about their positions. All of it an attempt to chill speech. Zucker Concedes CNN Has Been 'A Little Too Liberal'. The President of CNN Worldwide is seeing the advantage of presenting its content down the middle of the aisle as opposed to inadvertently favoring one side. In a Wall Street Journal piece investigating the sweeping "ratings bonanza" that CNN has had in the 2016 election cycle, Jeff Zucker admitted that perhaps in the past the network has ostracized some viewers with its coverage. "I think it was a legitimate criticism of CNN that it was a little too liberal," Zucker conceded. The Great Culture War. [Scroll down] Similarly, the chattering skulls on television pull down six figure salaries and live in bunkered, whites-only communities. It is not an accident that they are crowded into the richest counties on earth, all of them around Washington DC. They are the petty royalty of the ruling class. To these people, normal Americans are aliens, indistinguishable from the people sneaking over the border. New York Republicans: Let's talk about New York values. [T]rue conservatives fully understand what Sen. Cruz meant with those words. He didn't mean the New Yorkers who rallied together for 9/11. Instead, he meant: [#1] The New York Times, which is nothing more than a house organ for the Democrat party. [...] [#2] The New Yorker, which was once a soft Left magazine that aimed to make its middle-class readers feel cultured, but that is now a hardcore Leftist publication that actively, aggressively proselytizes for the Democrat party and for Democrat causes (especially climate change). New York Observer writer resigns over paper's endorsement of Trump. The New York Observer's longtime restaurant critic revealed on Tuesday [4/19/2016] that he resigned from the publication last week after it chose to endorse Republican presidential front-runner Donald Trump. Vast majority of Americans don't trust the news media. Trust in the news media is being eroded by perceptions of inaccuracy and bias, fueled in part by Americans' skepticism about what they read on social media. Clinton, Donald Trump and headlines the Boston Globe will never show you. The cat is out of the bag. The mainstream media in America no longer even pretends to hide their bias and disdain against Republicans. Exhibit A was Sunday's [4/10/2016] edition of the Boston Globe dedicated to headlines about what America might look like under a President Donald Trump. [...] How could a major newspaper so ferociously engage in slashing and burning a Republican candidate? Are we living in the land of the free, or a Banana Republic? Newspaper reporter rated worst job in America. A new survey of the best and worst jobs in the country has declared that being a newspaper reporter is the worst career you could be pursuing. CareerCast just published its Worst Jobs of 2016 list. It cited fewer job prospects because of publications going out of business and declining ad revenue providing less money for decent salaries. The survey put the annual median salary of a print reporter at $37,200. York Observer political reporter quits over paper's Trump relationship. On Wednesday [4/13/2016], one day after the New York Observer endorsed Donald Trump, the paper's national political reporter, Ross Barkan, announced that he would leave the paper. How The Media Attack Religious Liberty. Most of the media won't acknowledge that Americans who refuse to participate in a gay wedding could have any sincerely held beliefs or good faith arguments to make. [...] One way the news media signal their dismissiveness of religious liberty is by insinuating that the entire debate is bogus. Editors do this by putting quotation marks around the term "religious freedom," as if this notion, when practiced by Christians, is somehow ambiguous or manipulative or deceptive. Now, if those quotation marks exist because the topic itself is up for debate, then why isn't there a similar journalistic standard for the usage of "inequality," "environmentalist," "civil rights," "investments," "loopholes" or any of the hundreds of other similarly contentious or loaded words in our political discourse? Another, more overt way of misleading the public about religious freedom is framing the debate as a struggle between open-minded, civil-rights seeking gays and a bunch of bigots frightened of progress — essentially the tone of every piece covering Mississippi's new religious liberty law. Commentator David Gregory's Wife Is The Attorney For Hillary's Ex-Aides In Email Investigation. The wife of CNN political analyst David Gregory is the attorney representing Hillary Clinton's ex-aides in the FBI's investigation into her private server usage, raising concerns of a possible conflict of interest. It was reported by Politico on Friday [4/1/2016] that Gregory's wife, Beth Wilkinson, is representing four of Hillary Clinton's former state department staffers in the FBI's investigation of Clinton's use of private email. Wilkinson is a former federal attorney who prosecuted Oklahoma City bomber Timothy McVeigh. Stephanie Cutter Fired by NBC News after Conflict of Interest Exposed. Stephanie Cutter, who was the deputy campaign manager for Barack Obama's 2012 presidential campaign, was hired and quickly fired by NBC News as a political analyst on Friday [3/18/2016] without ever appearing on the air, after it was reported that she had a massive conflict of interest. Cutter, whose last regular television gig was the failed Crossfire reboot on CNN, was set to join NBC News and MSNBC as a political analyst and "contribute exclusively on a range of topics across all platforms including Meet the Press, TODAY, Nightly and MSNBC," according to Politico's Mike Allen. That job, which was announced on Friday, was quickly undone when The New York Times reported on the same day that Cutter would be spearheading the efforts of a new group, the Constitutional Responsibility Project, to get Obama's Supreme Court nominee Merrick Garland approved. very short, unhappy MSNBC career of Stephanie Cutter. Eric Wemple at the Washington Post points out a good bit of detective work on the part of Politico which uncovered a plan to further bend the media dial in the direction of liberal political goals. [...] Anyone who watches cable news on a regular basis is familiar with Stephanie Cutter. She makes the rounds on a seemingly daily basis, sharing her "political analysis" with the nation on any number of subjects. She's also a veteran of the Obama political machine and the fact that she's no longer directly on the payroll hasn't changed the tune she sings. Matthews facing 'Hardball' questions over wife's campaign donors. Philadelphia native Chris Matthews, host of MSNBC's Hardball, is facing his own hard questioning over the booking of guests who've contributed money to his wife's congressional campaign. Kathleen Matthews is running as a Democrat in Maryland's 8th District. As reported by The Intercept, which broke the story, and the New York Post, whose Right-leaning bias contrast with Chris Matthews' Left-leaning bias, Hardball guests have contributed close to $80,000 to Kathleen's campaign, with many of the contributions coming within a few days of the guest's appearance on the show. this movie before. Every presidential cycle, the mainstream media select our candidate for us. Dole was the sane candidate, superior to the crazies. McCain was the "maverick," whose adoration was sung by all the liberals. Romney was the class of the field, otherwise dominated by ideological purists. [...] So, each cycle, the MSM purposefully take out all true conservatives during the primary, leaving their preferred RINO standing alone. Until, of course, their designated RINO wins the nomination. Then they turn. ABC Boss Bob Iger: George Stephanopoulos Is an Unbiased 'Person of Integrity'. Paul Bond at The Hollywood Reporter relayed that a representative of the conservative National Center for Public Policy Research challenged Disney CEO Bob Iger at a shareholders meeting about the network's liberal bias. Iger insisted that former Clinton publicist George Stephanopoulos — who didn't help any attempt to appear nonpartisan by donating $75,000 to the Clinton Foundation — Disney CEO Bob Iger Defends ABC News Over Accusations of Liberal Bias. "I assure you, if we felt George was not presenting it fairly or were bias, he would not be on our air," Iger said of George Stephanopoulos. "It's something we take very, very seriously, and we monitor closely." Walt Disney CEO Bob Iger defended ABC News and one of its anchors, former Democratic party advisor George Stephanopoulos, against charges of liberal bias when pressed to do so Thursday [3/3/2016] by a shareholder who works for a conservative advocacy group. reminded on air that he's a political operative playing a journalist on TV. The old rules embraced by the GOP establishment include politely granting legitimacy to all the biased political operatives with bylines who make the mainstream media an adjunct of the Democratic Party. But this election cycle, the two leading contenders for the GOP nomination are refusing to play by the old rules, to the dismay of the elites of both parties. Last night, appearing on ABC's election night coverage, Ted Cruz implemented the new rules. [Video clip] Pundits Often Fail to Disclose Financial Ties to Hillary Clinton. Tune into television coverage of the current presidential campaign, and you will undoubtedly hear from various pundits described as "former campaign strategists" and "political contributors" explaining the latest developments of the race. But in many cases, these pundits — though introduced as neutral experts on campaigns or party politics — in fact have financial ties to the candidates they praise on the air, according to an article on The Intercept website by Lee Fang on the subject. Fang began his missive by quoting Jeff Cohen, an associate professor of journalism at Ithaca College, who stated: "Journalism 101 teaches that reporters and TV news hosts must properly identify their sources and analysts." However, when the author reached out to NBC, CBS, CNN and ABC News, he did not hear back from any of the news organizations regarding any ties to Hillary Clinton's presidential campaign. bias tops big money as top voter complaint. Media bias is a bigger problem than high dollar donations for 2016 likely voters focused on the presidential election, according to a new national survey. Rasmussen Reports found that when asked "Which is the bigger problem in politics today," voters picked media bias over money, 47 percent to 45 percent. What's more, the survey found that voters believe that the media has too much power in politics. Sanders and Hillary Clinton Debate: Who Hates America More? The Democrat Party is the world's most successful hate group. It attracts poor people who hate rich people, black people who hate white people, gay people who hate straight people, feminists who hate men, environmentalists who hate the internal combustion engine, and a lot of bratty college kids who hate their parents. However, the real secret of the party's success is that it attracts the support of journalists who hate Republicans, and who therefore work tirelessly to convince the rest of us that we should vote for Democrats. Donors Helping Chris Matthews' Wife Into Congress. MSNBC's Chris Matthews has been accused by Bernie Sanders supporters of being blatantly one-sided in favor of Hillary and against Bernie Sanders, to the point that thousands of progressives have signed a petition calling for MSNBC to suspend the host of "Hardball" "because of his constant shilling for Hillary Clinton." The magazine Esquire sharply criticized Matthews' recent interview with Clinton as "ahistorical and out of bounds" for his attacks on Sanders. Now, research by The Daily Caller reveals that Hillary's biggest donors are backing Matthews' wife — Kathleen Matthews — in her congressional race in Maryland, even though many of them don't even live in the same state, much less the same district, that Matthews is seeking to represent. Sanders/Clinton Rocky Horror Show: A Sneak Peek. [Scroll down] Note that the MSM have been mute regarding the historical aspect of electing America's first Hispanic president. The MSM have been relentless in their attempts to convince voters that Dr. Carson is not authentically black; the guy thinks too white, void of a victim chip on his shoulder. Meanwhile, the MSM, Democrats and Hillary promote that her gender alone is a moral and just reason to put the first woman in the White House, placing gender above all else, including character, qualifications, and agenda. German Journalist Admits Live On Air National News Agenda Set By Government. A retired media boss at a major German state broadcaster has admitted his network and others take orders from the government on what — and what not — to report. National public service broadcaster Zweites Deutsches Fernsehen (ZDF), which was recently forced into a humiliating apology for their silence on migrant violence and sex assault is being drawn into a fresh scandal after one of their former bureau chiefs admitted the company takes orders from the government on what it reports. He said journalists received instructions to write news that would be "to Ms. Merkel's liking". Clinton's Secrets Contract Should [End] Her Candidacy. Simply receiving at least two emails containing top secret material on the nonsecure private server she set up for herself, as we know she did, and for which the Justice Department is investigating her, is an obvious violation of that contract she signed with the federal government (and, considering the national security implications, with the American people themselves). If it weren't for the steep slant of the dominant media, the revelation of Clinton's nondisclosure agreement would signal a perfect storm forming to doom her presidential candidacy. Lawful Acts of Political Resistance for Liberty Guerillas. [#2] Unplug from Big Media. Big media and the cable companies that pipe it into your homes are purveyors of the "Big Lie". The "news" is not about dispassionately informing, it's about framing the Narrative and shaping your world view to something compliant with the bigger goals of those who wield the levers of power. As the credibility of the corporate media continues to erode, the number of people turning to alternative sources of unbiased information escalates. This will turn out to be one of the biggest linchpins for success for the Liberty-minded. A secondary benefit of "unplugging" is that it denies the Fabians another source of slush funds (mandatory channels included in package lineups, surcharges, levies and taxes tacked to every cable bill) to redistribute monies to in-groups and dole out perqs and privileges to the "right" people. No "Major Scandal" in Obama Administration? The ongoing incestuous relationship between the Obama administration and the media often tilts in favor of the administration, leaving many scandals uninvestigated, minimized, or outright ignored. For example, both CBS News president David Rhodes and former ABC News president Ben Sherwood have siblings working for the administration. CNN's deputy Washington bureau chief, Virginia Moseley, is married to Tom Nides, a former Obama staffer under Secretary of State Hillary Clinton. And David Plouffe, Obama's former campaign manager, joined Bloomberg News, while MSNBC hired Axelrod. President Obama even joked in 2013 that "...David Axelrod now works for MSNBC, which is a nice change of pace since MSNBC used to work for David Axelrod." With so many members of the elite media in bed with the administration, Dartmouth College professor Brendan Nyhan's 2011 observation that "the current administration has not yet suffered a major scandal, which I define as a widespread elite perception of wrongdoing" becomes essentially meaningless. Media's Cockeyed Political Spectrum. Never, ever trust the liberal media to put politicians on a mainstream-to-extreme political scale. In their minds, Nancy Pelosi sits on the centerline of the political fulcrum. By that measurement, Jeb Bush looks like a fire-breathing extremist. servile media in Obama's America. [Scroll down] That pretty much sums up the media today, although they're nowhere near as honest about their true calling as was my editor, an old-style liberal who was open about his biases but still actually attempted to provide fair and balanced coverage. Nowadays, they don't even bother to pretend. Nothing has exposed this more than the media's servile stance toward the Obama administration, which can do no wrong except occasionally moving too slowly to the left for their taste. Newspapers, wire services and the major TV networks demonstrate the dangers of a Washington-based press gone native. Even Fox News, the exception to this rule, has only a few journalists who challenge the claims of the progressive social and cultural agenda. is George Stephanopoulos even allowed to cover Clinton campaign? Last year, George Stephanopoulos had a particularly antagonistic interview with the author of Clinton Cash, and shortly thereafter, it was revealed that he had donated a substantial sum of money to the Clinton Foundation. ABC stood by their man, though he did have to apologize on-air. The Washington Free Beacon is now reporting that Stephanopoulos has simply stopped disclosing his donations to the Clinton Foundation. Debate Moderator Andrea Mitchell: Two Decades of Spinning the News Hillary's Way. Longtime NBC News correspondent Andrea Mitchell will join Nightly News anchor Lester Holt in moderating tonight's [1/17/2016] debate among the three Democratic candidates for President. If history is a guide, Mitchell's participation is a good omen for Hillary Clinton, since NBC's "Chief Foreign Affairs correspondent" (who, despite her title, seems to spend most of her time covering U.S. politics) has a long history of fawning over the Democratic frontrunner. Form A Human Shield Around Democrats. The media spent this week protecting Bill and Hillary from the actions of Bill and Hillary. And they were happy to do it. The re-emergence of Bill's women, both willing and unwilling, is being ignored by the media and being spun when they can't ignore it. With Juanita Broaddrick's courageous return to the national scene, reporters are presented a choice: treating her how they've demanded all who claim to be victims of sexual assault should be treated, or ignoring her to protect the narrative of the Clintons being champions for women. Naturally they chose the latter. Progressives are progressives first and always. Tet Offensive: European Union Edition. [Scroll down] Over on the Fourth Estate, the global mass media have been almost entirely subverted, scripted and stage-managed for decades by these über-wealthy elites through a thousand channels greased with kickbacks, no-show jobs, and secret payoffs that are disguised as special stock offerings and private land deals. Media figures morph seamlessly into senior political advisors and corporate board members, adding millions to their portfolios with each well-timed transition. Even many retired generals and admirals eagerly wallow in this swamp of sell-out and sleaze. It should not be a surprise to anyone that so many politicians leave Washington or Brussels as millionaires. Just as it should not be a surprise that long-time CBS News anchor Walter Cronkite, "the most trusted man in America," was for his entire adult life secretly a leading member of the World Federalist Association, a fact he proudly revealed only after his retirement from in front of the camera. Delusional Self-Importance of the Liberal Media. I have long marveled at liberals' air of superiority and lack of self-reflection, which have always been particularly evident among liberal media elites and journalists. They tend to view themselves as sacrosanct and above scrutiny. Perhaps this attitude sprang from the British and, later, American tradition that the press is the Fourth Estate. It doesn't just serve to inform the people and make them better contributors to the democratic process. It is the virtual fourth branch of government, operating as a watchdog on the formal branches to further check their potential abuses of power. It is a heady concept to believe you function to keep the powerful in check. It is even more so when no one has ever told you that you, too, need to be kept in check. It! When the Media Kill a Story for Political Reasons. As Momma used to remind us, if you can't say something nice, don't say anything at all. What a great motto for reporters. That is exactly what the national media have done to an important story about the White House's intimate working relationship with MIT professor Jonathan Gruber, who helped craft the Affordable Care Act. You may remember Gruber from his infamous videotapes, the ones in which he called the American public too stupid to understand the law. He added their stupidity was helpful to Obama, Pelosi, and Reid in passing the law. The Obama administration snapped into action. At a press conference, the president noted that Gruber was not employed by the White House and said flatly that he had not played an important role in drafting the law. Media's Bias. Apparently, integrity and critical thinking are not qualities found in today's mainstream media. We know this after watching the CNBC-hosted Republican debate billed as one which would focus on "the key issues that matter to all voters — job growth, taxes, technology, retirement and the health of our national economy." Obviously, that did not happen. Instead, Americans watched moderators with the seeming intellectual prowess of June bugs disrespectfully hurl boneheaded attacksand stupid questions at GOP presidential hopefuls, offering millions of viewers a front row seat to observe in living color proof positive they are nothing more than extensions of, and left-wing propagandists for, the Democratic Party. For this gift we should be thankful. Liar of 2015: The Washington Post and Its Pinocchios. [Scroll down] The [Washington] Post, of course, was an early and gleeful adopter of the narrative of the unarmed black person shot for no reason whatsoever by racist police in Ferguson who apparently did that kind of thing all the time. This Lie infected more than just miles and miles of newsprint in the hard news sections. It was also reported and spread in the sports, lifestyle, opinion, entertainment, and virtually every other nook and cranny of the Post — even after the attorney general grudgingly admitted the entire thing was a hoax in March of this year. The lies are legion. A few of the more deceitful: The Post led the way in glorifying the hundreds of black Capitol Hill staffers who gathered for a photo op in their $1000 coats, soft leather gloves stretched into the air, proclaiming 'hands up, don't shoot.' [...] media bias claims boosted by scarcity of right-leaning journalists. A mere 7 percent of journalists identify as Republicans, and when they do give money to political campaigns they usually donate to Democrats, lending evidence to Republican presidential candidates' claims that they are facing a hostile audience when they deal with the press. As Republican candidates prepare for their fourth debate of the primary season Tuesday in Milwaukee, the people doing the questioning are increasingly in the spotlight, with their motives being questioned by the campaigns, voters and even by their fellow journalists. 65% say the news media has a 'negative effect' on America. An extensive new Pew Research Center survey finds that 65 percent believe that the news media "has a negative effect on the way things are going in the country." Some 56 percent said the entertainment industry has a negative effect. For comparison, 51 percent believe that the Obama administration has a negative effect and 40 percent say labor unions do too. The News Is Propaganda. Non-stop distractions are deliberately used by those in power as instruments of policy for the purpose of preventing people from paying attention to reality. Propaganda is used by those in power to manipulate language, thought, and opinion in a way that causes the progression from thought to action artificially. When the public is reduced to a state where people no longer care about the truth and are unaware of what that truth even is, propaganda takes hold and shows them what to do. The world [Josef] Pieper was describing is the world that we live in today as more and more Americans are subjected to a bombardment of propaganda that is based on the ever changing news cycle that predominates our lives. American Newspaper Wants to Rethink the First Amendment, Blames ISIS. Since 9/11, the federal government has seized upon a cowardly, craven act carried out by soldiers of Allah, most of them from Saudi Arabia: because of the actions of the 19 hijackers, the civil liberties of Americans have been drastically curtailed by such bureaucratic monstrosities as the TSA and the Department of Homeland Security. But rather than go after the evil at its source, the American government — cheered on by both left and right — prefers to punish its own citizens. The Media Are the Biggest Backers of the Trump Campaign. The media may be liberal, but they are not stupid. They know exactly what they are doing. And even though it appears for all the world that they are attacking Trump and hating Trump, they know good and well that what they are doing is helping him get the GOP nomination. Trump is operating a famously shoestring operation, campaign-wise; but he can afford to because he has received billions of dollars in in-kind donations from the press. than 30,000 sign petition urging CNN to fire anchor Don Lemon. More than 30,000 people have signed a petition calling on the news channel to fire bombastic newsman Don Lemon after he insisted that his colleagues Wolf Blitzer and legal analyst Sunny Hostin withhold deciding whether South Carolina "resource officer" Ben Fields used excessive force when removing a student from a classroom earlier this week. With an average of around 600,000 viewers, that's about 5-percent of Lemon's audience calling for his ouster. liberal media gets crushed. Last month, we saw the World Series and another set of debates in the presidential election. In the World Series, fair-minded umpires let the players play. They called balls and strikes the way they saw them. The best team won. In the debates, the umpires cheated. Under the guise of moderators, they didn't just call the balls and strikes — they delivered the pitches. They delivered pitch after pitch for the Democrats and called strike after strike against the Republicans. Conservatives Call Out the Networks for Their Labeling Bias. Last week, a Media Research Center study documented how ABC, CBS and NBC were using loaded labels to paint House Republicans, especially the Freedom Caucus, as ideologues who are outside the American political mainstream. Now, several leading conservative Congressmen have sent us statements blasting the networks for their slant. "Only in this town does doing what you told voters you said you were going to do mean you are 'ultra-conservative' or 'far-right,' Freedom Caucus chairman Jim Jordan told NewsBusters. CNBC Biased? You Don't Say! Question: What did Reince Priebus not know about CNBC — and when did he not know it? Priebus, chair of the Republican National Committee, sanctioned CNBC's sponsorship of last week's debate. When during and after the debate many of the candidates blasted the moderators for their bias, Priebus said that the moderators created a "hostile environment" and "it was one 'gotcha' question, one personal low blow after the other." Please. Why the surprise? After all, CNBC's parent company, Comcast, employs the Rev. Al Sharpton, Rachel Maddow, Chris Matthews — a virtual murderers' row of GOP-haters. Vigilance on Moderators. A debate among the Republican presidential candidates is supposed to benefit Republican primary voters. The moderators would, ideally, ask questions that reflect the values and questions of GOP voters, not the hive mentality of liberal partisans. To this end, Ted Cruz this weekend suggested banning anyone from moderating a GOP primary debate if they have never voted in a GOP primary. Liberal journalists developed the vapors — probably because they don't know any colleagues who ever voted Republican. No Republican Has Hosted Network Sunday Show or Newscast in 50 Years. In the wake of the CNBC debate debacle, Joe Scarborough went on an epic rant on liberal media bias on today's [11/2/2015] Morning Joe. He summed things up this way, in challenging the panel: "you can't do it and nobody here can do it: name the single Republican that has hosted a Sunday show, that has been an anchor of a news network for the big three networks over the past 50 years: you can not the liberal wing of the Democrats finally pushed the party too far? [W]hen the "protesters" get out of hand and go after the cops, national support for the movement plummets. Only 25% of respondents in a [recent] poll felt that the riots in Baltimore "were sparked by legitimate grievances" while a very solid majority described them as criminal actions. It's possible that the Democrats' candidates have spent too much time watching the skewed views of reporters on MSNBC and CNN and came away thinking that theirs was some sort of national consensus view while nearly the exact opposite was the case. It is odd how people can understand the media fraudulently influencing public opinion regarding racial stories (Trayvon Martin, Mike Brown, McKinney Pool Party, Eric Sheppard Jr, et al), yet become willfully blind when those same MSM methods are deployed within current political stories. Charlie Rose: Rubio's 'ultimate super PAC' Exhibit A. That didn't take long. Fewer than a dozen hours after Marco Rubio identified the unholy "ultimate super PAC" alliance between the mainstream media and Democrats generally and Hillary Clinton specifically, "CBS This Morning" host Charlie Rose unwittingly provided indictment-worthy evidence in abundance interviewing Florida's junior senator. debate that will live in infamy. [Scroll down slowly] The sneak attack had been effectively countered, and from that point forward, most of the candidates joined forces against the slippery sloppy questions. The entire nation rose up to ask, "Could those moderators possibly have not known how foolish they were? And what does that say about the mainstream media?" Watch the tape, or read the transcript of the debate online. You owe it to yourself to see the blatant attempt to manipulate public opinion by insulting the standard-bearers of the Republican Party. There is no reasonable, responsible Democrat anywhere who could defend the behavior of the three intemperate moderators. Debate Executive Worked In The Clinton White House For Al Gore. The CNBC executive who oversaw the disastrous Republican presidential debate is a former Clinton White House staffer, Breitbart News has learned. Brian Steel, senior vice president of communications at CNBC, was the second highest-ranking network official at Wednesday night's debate in Colorado after only CNBC CEO Mark Hoffman. Steel was described by an insider as the "executive on hand" for the debate, which was marked by the moderators' partisan attacks and gotcha questions for the Republican candidates. liberal media bias is real, and here's how it affected the CNBC debate. Since the Republican presidential debate on Wednesday night, there's been plenty of sturm und drang about media bias. Republican candidates and conservative commentators have piled on the CNBC moderators for their questioning. Many in the major media have responded with odd defenses, some claiming that there is no such thing as media bias, and that the Republican candidates were just upset about tough questioning. This mainstream response is wrong, and the quicker my colleagues in the press come to terms with this, the better off everyone will be. GOP Media Takedown: A Recipe for Victory. It's long been known that a leader can gain power by rallying the people against a boogeyman. And it helps when that boogeyman is real. When CNBC's GOP debate moderators couldn't help but be sanctimonious, supercilious, and self-important Wednesday night [10/28/2015], they did more than provoke a response from their intellectual superiors. They did more than further reveal the Establishment Media as a left-wing monolith, further discredit themselves, and further cement in minds that they're comic-book versions of journalists. They quite literally revealed a strategy for GOP electoral gains. Reagan PAC: RNC Must Turn Debates Over to Talk Radio, Rush Limbaugh, Mark Levin. Grassroots conservative group Citizens for the Republic has surveyed the wreckage of the CNBC debate, and is calling upon the Republican National Committee to let conservative media professionals moderate a debate. [...] Their presence would surely bring additional viewers, along with a tremendous amount of media synergy. Any network marketing department worth its salt — including mainstream media networks — should salivate at the thought of people like Ingraham, Levin, Limbaugh, Hannity, and Beck talking up a debate for days beforehand on their popular radio and television shows. The Media's Potemkin Village Starts to Topple. Wednesday night's CNBC Republican debate turned out to be a tussle between the three left-leaning "moderators" and the candidates on the main stage, most of whom can safely be described as center-right. And finally — thanks largely to the huge ratings bonanza that is Donald Trump — the American people got a chance to see the true, ugly, partisan, smug, self-righteous face of what we used to call journalism, but now is simply political advocacy employing computers and television cameras under the shield of the First Amendment. Ted Cruz punched the hardest when he went straight after the moderators: [...] Fix the GOP Debates. Why is it that whenever you hear about a speaker having his/her invitation rescinded from a college speaking invitation, it is always the left that complained? When was the last time you heard about conservatives protesting an event or speaker somewhere? Last night, the audience at the GOP debate booed the questioners from CNBC. When was the last time you heard a Democratic audience boo a media panel questioning Democratic candidates? A silly question indeed. The presumptuousness of liberalism runs so deep that I'm guessing John Harwood hasn't a clue that he was a biased jerk last night. As Marco Rubio suggested correctly — or as Glenn Reynolds puts it — most journalists are just Democrats with bylines. CNBC Beclowns Itself. There is not a sentient human on the planet who does not know, without a shadow of doubt, that the mainstream media is a left-wing collective or that its main mission is to ridicule, demean and render irrelevant anyone with conservative views. Its inhabitants have been indoctrinated in the universities they attended, and have marched into their media jobs with all the proper left-wing credentials; they are almost all Democrats who have never questioned WHY they are Democrats. Since critical thinking is no longer a skill taught in any American educational institutions, they do not know that they should or are allowed to question the orthodoxy with which they have been imbued. That the three principal panelists for CNBC were so smug, and thought they were so cleverly mocking, is a sad commentary on our elite media. They are not remotely elite. They are pathetic. So certain of their intellectual superiority, they ran headfirst moderators repeatedly booed as candidates Trump, others bash 'nasty' questions. Several candidates had very strong outings, but I must say, some of the moderators' questions came off as downright snide, bordering on insults. One question after another was just loaded, worded to denigrate the candidates. No wonder Ted Cruz got a big cheer from the Boulder audience when he attacked the questioners and called the debate a case study in mainstream media bias. and Jeb Bush Commit Suicide in Boulder. [Scroll down] The big story — the A-story — on Wednesday night [10/28/2015] — the actual full blown case of seppuku — was CNBC. The network will never seem the same. Their moderators — Becky Quick, John Harwood, and Carl Quintanilla — were so obviously biased you would have thought it was a parody, if you hadn't known it was real, a kind of black comic nightmare out of a leftwing theatre of the absurd. Ted Cruz superbly caught the temper of the evening when he called them out, specifying how they had attempted to poleax each of the candidates one-by-one. This turned the already alienated audience completely against the moderators with the candidates abandoning their competition and joining forces as well against the moderators in a red versus blue color war. 3: Ted Cruz Changes the Game. [Senator Ted] Cruz did not just criticize the questions; he made sport of them. He demonstrated just how infantile most of the CNBC crew was (Tea Party originator Rick Santelli not included). Cruz flat-out embarrassed them, and they knew it. [...] And because these precious egotistical and not very bright media mavens crave the love of the audience, I submit that this dynamic will go farther than just recasting the last hour or so of this debate. I think the moment was a shot across the bow of any liberal moderators in waiting for Republican debates. These candidates have now seen the light. They will not be cowed by gotcha questions, nor will they accept the liberal templates underlying the questions. The candidates will fight back, and they will get cheered while the moderators get booed. The mods don't like that. Unprecedented Bias. As a public relations professional who deals with the media every day I am disgusted by the media's intellectual dishonesty in their coverage of the ongoing conflict in Israel. Journalists have a responsibility to cover issues with accuracy and what we've seen thus far has been an infusion of bias and misinformation. [...] People who consistently read mainstream news sources, such as The New York Times, may be surprised to learn they are not as informed as they think they are. Clinton: American Royalty 2015 Style. Not since Senator Ted Kennedy went on prime time television in a neck brace to spin the reasons for the Chappaquiddick accident have I felt so manipulated by a politician as I did by Hillary Clinton in her testimony before the House Benghazi Committee. As it turns out these two incidents have more in common than one might think. [...] In the case of both Senator Kennedy and Mrs. Clinton, there was and is a sense of entitlement, some of it due to "American royalty" but much of it due to victimhood, the great weapon of liberalism. "I suffer. You owe." Denying "the first woman president" her destiny is simply too dangerous for any member of the media to be blamed for upending her quest. Rush Limbaugh Routinely Demonstrates: The Media's Lockstep Leftist Talking Points. We've time and again seen the media receive their messaging orders — and then march off all mouthing the Leftist talking point(s) of the day. Washington, D.C.-based talk radio host Chris Plante quotes a military friend of his describing the media not as a gaggle, but as a centipede. Multitudinous legs in coordinated movement — all headed in the same direction. Talk radio impresario Rush Limbaugh has long made audio cavalcades of this media mal-practice a routine feature of his show. He strings together "media montages" — innumerable examples of "reporters" magically all arriving at the exact same Leftist term(s) to describe the news of the day. They Really Hate Ben Carson. On Fox News, Carson noted that "the poor families of those individuals had to be hurting so badly." One of the hosts then made the following comment: "Dr. Carson, if a gunman walks up and puts a gun at you and says, 'What religion are you?' that is the ultimate test of your faith." To which Carson responded: "I'm glad you asked that question. Because not only would I probably not cooperate with him, I would not just stand there and let him shoot me. I would say, 'Hey, guys, everybody attack him. He may shoot me, but he can't get us all.'" He was asked, in essence, what he would do. Whether one agrees or disagrees with what he says he would do, it was hardly "blaming the victims." Yet, that is what the left accuses of him doing. Are Devoid of Critical Thinking Skills. If we are to ever bring America back to the point where she is great again, the majority of the citizens are going to have to acquire and hone critical thinking skills. Why is it imperative for the citizenry to be able to think critically? Because the mainstream media has abandoned its responsibility of reporting facts in exchange for distracting, distorting, propagandizing and protecting. The public education system also ran [sic] by liberals, has dumbed down the quality of education in exchange for explicit (non-age appropriate) sex education and revised negative American history. For these reasons, individuals must master the ability to think critically in order to navigate through the lies and distortions coming from the mainstream media so that we can elect people based on his or her record of accomplishments, stance on important issues, and the substance of his or her rhetoric. Why Carson Scares the Media. The media, having failed to stop Ben Carson's steady rise in popularity by treating him like Ralph Ellison's "invisible man," are now going nuclear on him. The number of press attacks launched on Carson has recently increased exponentially. And, significantly, the barrage has been far more vicious than any criticism directed at Donald Trump or the other GOP presidential aspirants. The GQ assault [...] is only exceptional for its vulgarity. Countless columns, articles, broadcasts and blog posts have portrayed him as "stupid," "insane," and even "racist." The media clearly fear Carson more than the other Republicans. Why? Says Mainstream Media Can't Stand Thought of a Black Conservative. Republican presidential candidate Dr. Ben Carson says one of his predictions is coming true: The mainstream media is manipulating reality, based on its ideological underpinnings, to come after him during his presidential campaign. "They're actually playing right into the narrative that I have predicted for them," Carson told host Matt Boyle on Breitbart News Sunday [10/11/2015]. "Because they can't stand the thought of a black person who is a conservative, who hasn't had to make it on their handout and be at their beck and call and doing the things that they want them to do. It just infuriates them." Journalists' Handbook: How to Write any Story Without Working At It. Simply put, corporate media simply doesn't understand the public disdain for the political class and is trying frame the foreign policy ineptness of the administration (and the former secretary of state) and the paltry offerings for the Democratic presidential race into a fairytale of a Republican civil war in which conservatives are destroying their party. Obama and Hillary have created world chaos with the ridiculous Arab Spring and Iran deal. Wanted: A President of Good Character. [The news] media are owned by half a dozen transnational corporations who shield trillions of dollars from American taxation, while whipping up daily headlines about flesh-eating bacteria. They wouldn't recognize the truth if it hit them in the face. Every sane person is turning to the web, because we know we'll never find it in the Big Media. The media has a problem right now. Obviously, the're going to push the nominee for The Democrat Party. That's not even up for debate. But the question (at the moment unanswered) is "which nominee for the Democrat Party is the most viable. Because there's no clear answer, the media is stumped on how to portray Hillary and Bernie. If they had their druthers, it would be Bernie. He's "admitted Socialist" and right in the media's wheelhouse. But they also know that "admitted Socialist" probably won't work in a general election. tangled web linking Sidney Blumenthal, CBS News, and a secret Clinton spy network starting to come to light. We may never get the truth about how the Benghazi story was manipulated, but the election prospects of Obama in 2012 and Hillary Clinton in 2016 are both profoundly impacted by the story. Was a Member of Clinton's 'Secret Spy Network' Doing While Working for CBS News? In March, an investigation by ProPublica and Gawker revealed that a "secret spy network" that was not on the State Department payroll, run by longtime Clinton aide Sidney Blumenthal, was "funneling intelligence about the crisis in Libya directly to the Secretary of State's private account starting before the Benghazi attack." Now the Weekly Standard has learned that Tyler Drumheller, the former chief of the CIA's clandestine service in Europe who was working directly with Blumenthal as a member of Clinton's spy network, was concurrently working as a consultant to CBS News and its venerable news program 60 Minutes. Is Obamism Correctable? There is not much of an idea any longer of investigative journalism. The press for the last seven years has largely chosen to become a Ministry of Truth. One reason why Donald Trump soars is that, after the press's canonization of Obama, the public relishes Trump's contempt for the media — and the latter have now lost the moral credibility to critique any candidate on the grounds of dishonesty, hypocrisy, narcissism, mendacity, or polarization of the electorate. and Oxfam caught bribing media to write crusading climate stories. News journalists are being bribed by the United Nations and the Oxfam charity to write scare stories about climate change ahead of the global climate treaty negotiations in Paris later this year. Details of the bribes — which take the form of ego-boosting "awards", global travel in CO2 generating airliners and financial payments — are contained in a news release just published by the UNDP today, an organisation headed by former New Zealand Prime Minister Helen Clark. Journalists' codes of ethics prohibit being induced to give favourable coverage, but those rules have increasingly been ignored in recent years by the use of backdoor mechanisms like funding journalism "awards" as a means of generating content and rewarding propaganda-writers. Electorate, Not Trump, Is Real Danger. The media seem to think that participation in elections is a big deal. [...] Despite many people who urge us all to vote, as a civic duty, the purpose of elections is not participation. The purpose is to select individuals for offices, including president of the United States. Whoever has that office has our lives, the lives of our loved ones and the fate of the entire nation in his or her hands. [...] If you want to fulfill your duty as a citizen, then you need to become an informed voter. And if you are not informed, then the most patriotic thing you can do on Election Day is stay home. under Not everyone should vote. and Cruz Battle the Liberal Media Narrative. Let's just say the Liberal Media Narrative — replete with double-standards — ain't what it used to be. Too many people, particularly conservatives and Republicans, are on to how the game works. Two of those people are Donald Trump and Texas Senator Ted Cruz, both GOP presidential candidates. How does the Liberal Media Narrative game work? Like this. [...] The Media and Criminal Justice. For over a year now I have watched as the media has regularly criticized law enforcement officers, inaccurately portraying officers as "racist", "overzealous", and "poorly trained", just to name a few. On the national level, we saw the media, without knowing all of the facts, persecute Ferguson Police Officer Darren Wilson. Fortunately, the entire truth was revealed and Officer Wilson was ruled to have acted within the law. But has anyone stopped to ask: where would we be today if Officer Wilson had been portrayed as a hero from the beginning? Ever since the Ferguson incident, we have seen at least seven officers murdered simply because they were officers. Sure, Officer Wilson was portrayed much more favorably after all of the facts were revealed. But by that point, the damage was done — not only to Officer Wilson, but to all of law enforcement. NBC partners with Dem political firm for 2016. NBC News is partnering with TargetSmart, a political data firm founded by Democrats that was also hired by the Democratic National Committee to provide voter information for the 2016 election. The partnership between NBC News and TargetSmart is intended to "enhance election coverage and study the voting process in America in depth," according to a Tuesday press release from NBC. Data provided by TargetSmart, which was founded in 2006 by veteran Democratic operatives Jeff Ferguson and Paula Kowalczuk, will allow NBC News "to perform non-partisan analysis, research voting habits, and identify voting trends at the state and local levels," the release said. Do 'All Lives Matter' or Not? The media, which lean overwhelmingly left, and the political fraternity, with its own leftist component, don't fool around much with narratives that contradict left-wing (aka "progressive") essentials. Among these essentials: the conviction that American whites, having racked up a record of racial oppression, are due for a comeuppance. On such terms, a dead white cop, shot by an inner-city (or in the Harris County case, a suburban) black man isn't half so interesting a story as an inner-city black man shot by a white cop. The First Rule of News Coverage. Here is the first rule of "mainstream" news coverage in America: Whenever the prejudices and illusions of left-wingers are confirmed by an individual incident, the incident is treated as representative; when those prejudices and illusions are contradicted, the incident is considered an aberration — and treating it as representative is deemed hateful. The Top 50 Liberal Media Bias Examples. Let's face it, liberal media bias has been around since there have been liberals to do the "reporting" of the news. But this fact should surprise no one. After all, the news media has always been filled with bias of one type or another. In fact, there was a time when American customers of the news knew exactly which newspapers sported which point of view. It was taken for granted that one newspaper supported one side and another newspaper a different side. a Lesson From Trump: Stand Up to the Media. There are several reasons why Donald Trump is popular with Republicans, even though he probably isn't a Republican himself, and certainly is not a conservative. One of them is the way he stands up to left-wing media. Media vs. Behavioral Standards. We all know that the mainstream media are biased. But they appear to have totally come out of the closet lately, exposing their true identity as leftist operatives. It was infuriating watching a CNN interviewer hammering Republican presidential contender Dr. Ben Carson. This despicable jerk kept trying to twist Dr. Carson's words to mean that Dr. Carson wants to bomb refugees with drones. [...] Also infuriating and evil is the MSM hiding the sick scandal happening at Planned Parenthood. In the latest video released exposing Planned Parenthood's black-market baby body parts business, one of PP's clients joked about shipping whole heads of aborted babies to research labs. I was stunned by the lack of media coverage and national outrage. Have we grown numb? Black Killer's Manifesto: Murders were a Response to Charleston. [Scroll down] This Part of the Game I Can Cleanly Blame on the Media: When the killer is Muslim, the media tries its hardest to not connect that killer to any other Muslim, or even the Islamist ideology. They want to draw as narrow a circle as possible around the killer, including no other people, so that a hypothetical half-crazy would-be Crusader won't think "I'll get my vengeance by killing one his compatriots." But when the killer is white, they expand that circle as wide as possible to indict all of white society. In the Charleston shooting, they blamed the Confederate flag and all the white people who admired that flag. [...] Would the media ever do that with Muslims? Would they start making random tendentious connections between a Muslim killer and all other Muslims, or a Muslim stage performer? Would the media blame CAIR? No, they would not. But they routinely do that when the killer is white — they go searching for the "root causes," and the root causes they're interested in are not specific to the killer; they find the sins to dwell within the hearts of all white people. Every Planned Parenthood Supporter Should Have To Answer. Question for the media: Do you believe there are two legitimate sides to the abortion debate? If so, should your theoretically unbiased editors and reporters be accepting awards from the best-funded and best-connected advocates for abortion in the country? Planned Parenthood handed out its Maggie Awards for Media Excellence earlier this week (named after the xenophobe quackologist Margaret Sanger), honoring 16 journalists from mainstream outlets like Buzzfeed, Yahoo! Health and MSNBC, for their work shilling for the group. Color me skeptical, but does anyone believe a senior health editor who accepts this honor can be trusted to ask questions that matter about the groups Skin Privilege: The Media's Love of Black Racism & Violence. The media has only been barely interested over the years in President Obama's 20-year membership in white-hating, America-hating, Jew-hating Rev. Jeremiah Wright's Trinity United Church in Chicago that is more or less a Christian version of the Nation of Islam. Wright and his ilk are no big deal the media assure us. They just speak in a different idiom that the rest of America is too ignorant and stupid to understand. In other words, white people can never "get" it because they're not black. Holding black people who do terrible things and hold repugnant views accountable isn't fair, according to the media. Journalists Accept Planned Parenthood Awards — Despite Horrifying Abortion Videos! While the media stay away from the recent videos exposing Planned Parenthood's trafficking of aborted baby parts, they are drawn to Planned Parenthood's annual media awards ceremony. During Planned Parenthood's Maggie Awards for Media Excellence Tuesday night [8/18/2015], the abortion giant recognized 16 journalists for pushing "reproductive rights." From Buzzfeed and Yahoo! to MSNBC, MRC Culture compiled a list of several prominent media attendees — and found a picture announcing the winners. about Planned Parenthood. Weaponizes for Hillary: Funnels $400 Million To Extreme-Left BuzzFeed & Vox. One need only watch 10 minutes of MSNBC to understand that NBC News is an extremist organization in favor of open borders, partial birth abortion, the government setting CEO pay, and destroying people's lives through the pushing of the Climate Change hoax. Unfortunately for NBC, though, the MSNBC experiment only resulted in a ratings catastrophe. To right the ship, NBC is promising that MSNBC will be moving from opinion news to straight news. We'll see. of Democrats' subterranean civil war emerge on Meet the Press. [Scroll down] Sometimes I have to pinch myself when I remember analyzing the media in the old USSR, where the story itself never told you the truth, but by careful weighing of why a particular line was being put forth, you could figure out what was going on beneath the surface. Which faction was trying to enhance itself at the expense of another? Why would one particular lie be featured more than other possible lies? We're getting closer and closer to that state of affairs here in the United States. Jon Stewart Handled the Biggest Stories. In the early days of Jon Stewart's tenure as the host of "The Daily Show," the comedian often made viewers aware that his program was just the "fake news." But over the past decade-and-a-half, the show weighed in on very real news stories, albeit with satirical slants. That approach led many to use the "Daily Show" as their primary source of news. media's failure goes beyond Trump and Sanders. Journalists and commentators tend to talk to the same kinds of people — political consultants, donors, other media types — and not so much voters out in the heartland. But the bubble is not necessarily just liberal in nature. Plenty of conservative media outlets and pundits have ripped Trump as a charlatan and been slow to grasp why he's connecting with so many Republicans. Post brings back venomous anti-conservative to cover presidential election campaign. The Washington Post has rehired Dave Weigel. He is covering the presidential campaign for the paper. In his last stint with the Post, Weigel covered the conservative movement. However, he lost his job due to vicious comments he posted on Journolist about major conservative figures and the conservative movement in general. Luntz to Press: How Many of You Attend Church Weekly? Only 9 of 70 Raise Their Hands. During Mike Huckabee's interview at the Family Leadership Summit candidate forum on Saturday, moderator Frank Luntz asked the reporters in attendance how many of them went to church or synagogue on a weekly basis. After doing a quick hand count of what Luntz estimated to be about 60 or 70 journalists, the pollster observed "Only nine of them" raised their hands. Day, A New Way to Hate. Unusually slow on the uptick, the neo-puritan elect have yet to coin a term for those who "hate" or "fear" the "transitioning" among us. "Trannyphobia" might have worked, but the playful term "tranny," which was acceptable until about a week ago, has joined the n-word and the f-word among the unutterable. Transgender activists will decide on a label soon enough. The Islamists did. In one of the more curious twists in recent progressive history, a media savvy cell in America chose to mimic gay activists who had been successfully using the "phobia" trope to defame opponents of their political agenda. The Islamists saw the same potential in the concept of "Islamophobia." With the media's help, they could and did tie their struggle to those of other marginalized groups and, in the words of one former activist, "beat up their critics." Media Used To Do Abortion Stings, Not Slam Undercover Work. After the release of a shocking video by the Center for Medical Progress that shows an abortion doctor talking about harvesting and selling baby parts, the mainstream media refused to cover the story. No surprise there. They also blacked out the grisly realities of Kermit Gosnell, an abortion doctor who severed babies' necks and drowned them in toilets. What the media in our country used to do — investigate and expose the truth — has been left to groups like the nonprofit Center for Medical Progress (CMP). Through the Human Capital project, these citizen journalists are undergoing extensive sting operations to document how Planned Parenthood sells body parts of aborted babies — a worthy undertaking considering the seriousness of the practice, the ethical questions swirling around it, and the fact that taxpayer money helps fund it. These journalists have been the watchdogs the mainstream media used to be. For Reporters Struggling To Cover Planned Parenthood. A few reporters wrote an initial story on the undercover video that caught the senior director for medical services at Planned Parenthood discussing the harvesting of organs from the unborn children killed by abortion. Another few reporters noted early political repercussions that followed, including the launching of state and federal investigations. [...] But given the many angles that could be covered, the lack of ferocity with which they're tackling this story is noticeable. Compare, for instance, what happened in the last month with coverage of Confederate flags. to Bush, Obama Has It Easy From Reporters. It is not uncommon for the President of the United States to receive difficult and sometimes inflammatory questions — especially if your last name is Bush. On Wednesday [7/15/2015], CBS reporter Major Garrett asked President Obama a pointed question about the four American hostages left in Iran and why they were left out of the deal with Iran. President Obama seemed to be angered by Garrett's question and said he 'should know better.' Since then, many have taken to social media and denounced Garrett's phrasing of the question. Caitlyn Jenner's reps 'demanded ESPYs award in exchange for PR plugs and Diane Sawyer interview'. Representatives of Caitlyn Jenner reportedly negotiated her ESPYs award in exchange for PR plugs in her upcoming TV series and threatened to pull out of her 20/20 interview. Reports have emerged that Jenner's team approached ESPN with the idea that she win the Arthur Ashe Courage Award just as details were being finalized for her 20/20 interview with Diane Sawyer on ABC. ABC and ESPN are both owned by Disney, and ABC aired Wednesday's [7/15/2015] awards ceremony. Survivor' director blasts Caitlyn Jenner courage award with disabled veteran meme. Hollywood director Peter Berg used a military-themed meme to blast ESPN's decision to give Caitlyn Jenner its Arthur Ashe Courage Award. Mr. Berg, who directed "Lone Survivor," shared an image of a double amputee next to the Olympic athlete formerly known as Bruce Jenner. Decision To Give Caitlyn Jenner The 'Courage' Award Just Backfired Big Time. It was indeed a spectacle. But the fallout from Wednesday night's ESPY Award presented to Caitlyn Jenner — the transgendered woman formerly known as Bruce — is certainly not what a cable net that relies on its fans for success wants to see. The homepage homage to Caitlyn's "courage" has been blasted with sharply negative comments on the ESPN website. Cruz Levels Politifact: 'Noxious Yellow Journalism'. In his new book, Sen. Ted Cruz, R-Texas, calls out "a new, particularly noxious species of yellow journalism that is beginning to infect what passes for modern political discourse. It's called 'PolitiFact.'" Cruz gives three reasons PolitiFact [is in error]: selection bias, liberal bias and inability to differentiate fact from opinion. If Hillary Was Republican Media Would Have 'Special Prosecutor Watch'. Sunday on Fox News Channel's "MediaBuzz," Republican presidential candidate Sen. Ted Cruz (R-TX) said if a Republican had done the ethically questionable things Hillary Clinton did with private email servers, Clinton Foundation foreign donations and former president Clinton's soaring speech fees the media would set up "every day on every Sunday show," a "special prosecutor watch." Cruz said, "Mainstream media is not fair and impartial. They are protecting Barack Obama and this presidency. I think no one is more ready for Hillary than the mainstream media." He continued, "If any Republican did what she's [Hillary Clinton] doing right now, she doesn't take any press interviews and the press is docile ... How many criminal investigations are ongoing into Hillary Clinton right now?" under media bias in Hillary Clinton's favor. Matters Flaunts Tax-Exempt Status While David Brock Admits Its True Objective. It's hard to argue that the past six months hasn't been a patently-embarrassing time to be in journalism: The Rolling Stone/UVA fiasco, the Brian Williams disaster, the George Stephanopoulos controversy. Trust in media has plunged to yet another all-time low as a result. But say this about Rolling Stone, NBC and ABC: At least each pays their fair share in taxes. The same can't be said about Media Matters for America, which enjoys thumbing its nose at logic and ethics by not paying a dime. Why? Because somehow it's [sic] founder, David Brock, arranged a sweetheart deal with the IRS to be a tax-exempt organization. Matters Founder: We Defend Hillary Clinton! Media Matters For America founder David Brock admitted Monday [6/22/2015] that his nonprofit, tax-exempt organization specifically defends Hillary Clinton, a political candidate for office, from Republican criticism. Brock's stunning admission calls into question the nonprofit status of his left-wing media monitoring organization. Brock made the admission in an op-ed defending his group's association with Sidney Blumenthal, Hillary Clinton's political adviser and informal Libya consultant. Editor Admits Her Magazine Engages In 'Liberal Cheerleading'. During a discussion on CNN's Reliable Sources about whether or not women's magazines were biased in favor of Hillary Clinton, Cosmopolitan editor Joanna Coles admitted that her magazine engages in "liberal cheerleading." Coles claimed that her magazine was "very interested in the issues around politics and how they impact our readers" which include "do they have access to contraception and God forbid should they need it, can they have access to an abortion." Official: Chris Matthews's Wife Kathleen Running for Congress in Maryland. Earlier today [6/3/2015] Kathleen Matthews made it official. The former journalist and wife of Hardball host Chris Matthews announced she's seeking the Democratic nomination for the Maryland congressional seat being vacated by Rep. Chris Van Hollen (D), who is seeking the U.S. Senate seat being vacated by Barbara Mikulski (D), who is retiring. We can expect the former WJLA-TV news anchor to tack hard to the left, as the Washington Post's Bill Turque noted that: ["]Matthews said she will bring [']an opportunity agenda['] for women and children to the campaign, focusing on pay equity, reproductive rights and an increased minimum wage.["] The Editor says... The article immediately above describes a situation from which media bias is likely to come forth someday soon. There are several similar items further down this page; in fact, it might be worthwhile to create a subsection for articles about the atmosphere in which media bias thrives: Cases where networks and TV stations have hired left-wing activists to pose as reporters, or situations where prominent news people are married to liberal activists. journalists need to practice what they preach. When they're on the other side of a microphone or press pad, reporters can be as thin-skinned, controlling and paranoid as the people they cover. And they can be as unforthcoming about themselves and their organizations as any What the MSM calls "reporting" is often just activism, careerism, and narcissism to advance the Democrat agenda. joins CNN as contributor. Dan Pfeiffer, a long-time top aide to President Barack Obama, is joining CNN as a contributor, network president Jeff Zucker announced Monday [6/1/2015]. [...] He left his post as the White House's senior adviser for strategy and communications in March as one of Obama's longest-tenured strategists. Overhead Study [is] a Trojan Horse. During the past few days the legacy media and the Internet have been flooded with news articles, editorials, and blog posts with titles like "Overhead costs exploding under ObamaCare." This all-too-predictable phenomenon has been breathlessly reported by outlets as different in their ideological perspectives as the Wall Street Journal and the Daily Kos. Sadly, when liberal and conservative publications are equally enthusiastic about breaking a story, it usually means the latter have been duped into promoting progressive propaganda. This case is no exception. Stephanopoulos out misses the point. This is an open-and-shut case: Stephanopoulos should never have conducted this interview without revealing his connection to the foundation. But does anyone actually believe that had he not made the donations, the interview would have gone differently? Are we all really surprised that a mainstream news media host might be predisposed to skewering an author who is causing damage to the presumed future Democratic presidential nominee? Voters Expect Biased News Coverage of 2016 Presidential Race. In the wake of the George Stephanopoulos scandal, most voters doubt the accuracy of political news coverage and think most reporters will slant their coverage of the 2016 presidential campaign. A new Rasmussen Reports national telephone survey finds that 61% of Likely U.S. Voters now do not trust the political news they are getting. American Presidential Debates. The startling mishaps and mismanagement of the 2012 debates informs the current need for reform. Without question, the most flagrant violation was the egregious conduct of debate "moderator" Candy Crowley. She interrupted the debate to claim that Romney was wrong and President Obama was correct on an important argument regarding the events of Benghazi. There was nothing moderate about her performance, and few remember that Crowley promised in advance that she would break the rules of the event in order to impose her own private sense of politics on the event. Conduct like Crowley's now casts shadows on the role accorded journalists and has swallowed up George Stephanopoulos as a potential moderator. Stephanopoulos has long been an obvious partisan in his role as moderator and it is peculiar that this now constitutes news. The role of journalists in these debates since 1960 is one of the most profound distortions of the proper notion of a debate. protected, connected liberal media elite. I hate the term "elite." This implies some sort of extraordinary skill, which in my experience in Washington, at least with the media and definitely in politics is not apt. [...] They aren't elite, but they are the political class. And they are protected. The Stephanopoulos kerfuffle is a great example. Why does this guy still have a job? The Stephanopolous Syndrome. The firestorm surrounding the disclosure that ABC host George Stephanopolous made and failed to disclose donations to the Clinton Foundation — while he was covering the Clinton for President campaign and the controversies surrounding donations to the Clinton Foundation — dramatizes a syndrome of secrecy and conflicts of interest that have brought widespread public disapproval against politics in Washington and leading institutions of the mainstream media. This syndrome of secrecy and conflict of interest involves a long list of dirty little secrets that Washington insiders do not want the American people to know. Stephanopoulos, Brian Williams and the media's sinking reputation. By failing to disclose his donations to the Clinton Foundation, George Stephanopoulos has damaged his credibility and tarnished his network. But you know something? He's got plenty of company. What an awful couple of years it's been for the news business, even by our already-tattered standards. Debates without moderators: The GOP Presidential Debates With This One Simple Trick. Rather than just introducing a topic and stepping offstage, moderators have weighed into the proceedings in ways that have a profound impact on the nominating process. No media personality should have such power. Celebrate the Death of |the Mainstream Media! All decent, patriotic Americans yearn for the day when the effects of emerging technologies combine with the mainstream media's insufferable progressive cheerleading to finally destroy it. Its death throes are underway, but it won't buy the farm overnight. The body of the mainstream media is still shambling along, wreaking havoc, long after it its brain has died. Part 2. The reason the press has been trying to corner interviewees into "admitting" that George Bush made erred in toppling Saddam Hussein is the need to reassure themselves that catastrophe in the Middle East isn't really their fault. The constant need to be told it's not their doing is a form of denial. The more certain they are of their blunder the more they will need to tell themselves that the sounds they hear aren't the footfalls of doom. The Hired Liars of Liberal Media. Andrew Breitbart used the phrase "Democrat-Media Complex" to describe the dishonest and hypocritical frauds who consider their partisan opinions to be synonymous with Truth and Virtue. Based on my own experience — as an ex-Democrat who has been in the news business since 1986 — I long ago concluded that most journalists don't notice liberal bias for the same reason fish don't notice water. It's everywhere, all around them, and it's all they've ever known. Because liberalism is the default mindset of nearly everyone in the media, it becomes a sort of self-confirming prejudice, where those who don't buy into the liberal mythology are systematically excluded from the industry and the few dissenters are ostracized within the industry. of savvy in GOP candidates dealing with biased media. Perhaps the worst moment of the Romney campaign in 2012 was the second presidential debate, where Candy Crowley's brandishing of a transcript conveniently at hand in response to President Obama's misleading claim of having identified Benghazi as a terror attack marked the end of the Romney momentum generated in the first debate. Fortunately, at least some of the GOP field this time around are showing the way in handling bias. Not Hateful To Point Out Bruce Jenner Isn't A Woman. Of all the trends currently working their way through journalism, there is perhaps none so baffling as the media's indulgence in the transgender narrative. Journalists appear to have acquiesced to this ideology en masse. No less a formidable source than the "AP Stylebook" declared a few years ago that Associated Press employees are to use "the pronoun preferred by the individuals" in cases where confusion may arise. [...] Journalists should not buy into this. Simply as a matter of factual accuracy, it is nonsensical: if tomorrow I declared myself head of the executive branch of the U.S. government, for instance, the AP would not suddenly be required to call me President Payne. Trust Liberal "Fact Checkers". The Democratic Party controls almost all of the news media. Some years ago, the Democrats came up with a great idea: they established "fact checkers" within Democratic Party newspapers to spin unfortunate facts in the Democrats' favor. Today, several such "fact checkers" are well known. Are they reliable? Of course not. Edward Murrow to Diane Sawyer, the deterioration of TV news. Somewhere, Edward R. Murrow is saying, "I warned you this would happen." This month (April 27) marks 50 years since the godfather of broadcast news died. [...] Murrow's visionary speech in 1958 to the Radio Television News Directors Association warned of the growing influence of corporate power in news reporting. He said the public interest could not be served when news was only "a commodity" to be sold for advertisers. He said electronic news was "an incompatible combination of show business, advertising and news." Journalism has been the loser in this combination ever since. star Rick Austin turns down CNN for being too biased. If you haven't heard of Rick Austin yet you're probably not somebody who is interested in disaster preparation. [...] The audience Austin reaches is not looking for entertainment so much as information on what they consider a vital topic. He needs to be taken seriously, not treated like some pop star, and the comedian chosen by CNN to host this show has a history of cynical, left wing propaganda disguised as comedy. kill more whites than blacks, but minority deaths generate more outrage. Nobel Prize-winning novelist Toni Morrison says she wants to see an officer shoot an unarmed white teenager in the back before agreeing that the "conversation about race" is over, but she almost certainly already has received her wish. An analysis released last week shows that more white people died at the hands of law enforcement than those of any other race in the last two years, even as the Justice Department, social-justice groups and media coverage focus on black victims of police force. Jarrett Kisses Reporters Before Interview. President Barack Obama's top adviser, Valerie Jarrett, went around the table and kissed reporters before an interview this morning [4/15/2015] on MNSBC's Morning Joe. The moment was briefly captured on live television before the network cut away to a commercial break. Jarrett Hugged by Panelists Before MSNBC Interview. Obama Senior Advisor Valerie Jarrett got a very warm reception before her interview on Wednesday's broadcast of "Morning Joe" on MSNBC. Team Hillary Hoping Handpicked Journos at Off-Record Dinners Echo Favorable Talking Points. ABC's George Stephanopoulos, MSNBC's Joe Scarborough, and a half-dozen reporters from CNN were reportedly among the media elites that attended an off-the-record New York dinner with Hillary Clinton's advisers on Friday evening [4/10/2015] ahead of her Sunday campaign announcement. Far-Left Nation? Bob Schieffer is retiring as host of CBS's Sunday morning political talk show, Face the Nation. CBS has announced that his replacement will be John Dickerson, who, among other things, is both the political director for CBS News and chief political correspondent for Slate magazine. [...] Bear in mind, too, that in all election cycles prior to this one, hostile "journalists" like John Dickerson presided over GOP presidential primary debates. Their objective was to make all the Republican candidates, and the party as a whole, look bad. Reince Priebus has, I hope, finally put that practice to rest (although leftists will still preside over the general election debates). But incalculable damage has been done, over the years, by Democratic Party activists masquerading as objective journalists. Skewed View of America Inside the Progressive Bubble. Ordinary Americans don't particularly care if Rand Paul is brusque with interviewers; they have a low opinion of journalists already. Ted Cruz's ideas are much less "extreme" outside of newsrooms. And only about one-third of Americans have a bachelor's degree, making Scott Walker closer to the "average American" than everyone else in the field. A lot of members of the media who are covering the GOP presidential candidates have exceptionally little in common with the voters who will select the Republican nominee. Thus, when the Republican candidates make their pitch to grassroots conservatives, the hot-take instant analysis from the big media voices usually concludes that the pitch was a belly flop. Dancing with the MSM. Rich, isn't it? The U.S. lives under the tyranny of feminism yet the MSM was in a snit about Rand Paul. Paul's tart responses to NBC reporter Savannah Guthrie last week on the Today Show earned him MSM brickbats. Odd, the media's protectiveness of gals, who are supposed to be the equal of guys. Yet the evidence is in, based on MSM reactions: girl reporters can't take the rough stuff, so men — that's Republican men — better let the Savannahs say what they please, driving their narratives over them. [...] Voters deserve more than being shovel-fed manure by reporters who are preprogrammed Democrat operatives. New Host of Face the Nation Advised Obama in 2013 to 'Destroy the GOP'. John Dickerson, replacing Bob Schieffer as the new host of Face the Nation, will continue the same level of objectivity that CBS has brought to viewers for half a century. In 1964, when CBS was one third of all television news, Walter Cronkite and Daniel Schorr repeatedly smeared Barry Goldwater as a crypto-Nazi. His successor, Dan Rather, blew himself up in spectacular fashion with RatherGate in 2004, as dissected by all those bloggers in their Pajamas, to coin a Website name. In 2007, Rather's successor, Scott Pelley, violating 32 flavors of Godwin's Law in the same fashion as Cronkite, "was asked why he refused to include global warming skeptics in his reporting. He responded, 'If I do an interview with [Holocaust survivor] Elie Wiesel, am I required as a journalist to find a Holocaust denier?'", as NewsBusters noted. To Go On The Offense Against Liberalism. [Scroll down] The mainstream media, also known the Democrats' Steno Pool, looks invincible, but it's vulnerable too. It needs eyeballs to live, so look elsewhere for your news and information. Every time you watch NBC News, you validate and empower liars who hate you and everything you stand for. So don't. There's a growing segment of conservative traditional and alternative media, and even a few mainstream journalists who still try to be objective, like Jake Tapper at CNN. Patronize them. Starve the lib-loving media until it either dies or reforms. The MSM needs you [...] a lot more than you need it. the Leftist Media the 2016 Issue. The enemy of conservatism in America is the leftist establishment — the leftist-controlled institutions of news, education, and entertainment. Take away these big, fat incestuously connected institutions, and the left in America is a circus sideshow and nothing else. Democrat "leaders" like Obama, Hillary, Pelosi, and Reid are slow-witted, mean-spirited, and narrow-minded sock puppets filled by the chubby hands of the leftist establishment. Indeed, the leftist establishment prefers empty vessels as nominal political leadership of the Democratic Party. Defeat the establishment, and the battle is won, but as long as the establishment luxuriates in unmerited respect, the values we treasure face constant peril. Army of Weaklings, Cowards, and Traitors. While the impact of the MSM is real, it's not what people think it is. The real impact of the media is on the politicians. Living in Washington and moving with the Washington cultural "elite," too many Republicans begin to believe that what they hear from their consultant class friends and the Washington Post is true. Those politicians begin to think they can't get re-elected unless they downplay their conservative values. Or they, like human beings everywhere, start drifting toward the positions held by the people they see and socialize with every day. Left wages total war; and then plays victim. On one side is the CEO of the world's largest company, the president of the United States and a growing chunk of the Fortune 500. On the other side is a solo wedding photographer in New Mexico, a 70-year-old grandma florist in Washington and a few bakers. One side wants the state to conscript the religious businesswomen and men into participating in ceremonies that violate their beliefs. The other side wants to make it possible for religious people to live their own lives according to their consciences. Yet somehow, the Left and most of the mainstream press paint the current skirmishes over religious liberty as conservative offensives. Media, 'Religious Freedom' Is a Real Thing. Why is it that the media regularly adorns the term "religious freedom" with superfluous quotation marks but not terms like "environmentalist" or "civil rights" or "marriage equality" — or any other of the many debatable issues of American political discourse? Well, maybe unbiased journalists feel a responsibility to intimate to readers that religious freedom is considered a dubious assertion by one side of the debate. And this would be a reasonable editorial decision if it were employed consistently. It's not. What's more likely is that editors and journalists consider the term "religious freedom" dubious because anything that strikes them as "discriminatory" or stands in way of "progressive" moral aims is by default Communism's Useful Idiots in Hollywood and the Media. There are tons of useful idiots in Hollywood and the mainstream media and the reason they can be so easily manipulated by Marxists is that they are either clueless or supportive of communists in their industry. I was just as uninformed until I did my homework [...] of 130,213 stories shows Obama bias in 2012 election. A sweeping study of some 130,213 news articles on the 2012 presidential match between President Obama and Mitt Romney has proven anew that there was a strong pro-Democratic bias in the U.S. and international press. The study, published in the authoritative journal Big Data & Society, also tested the campaign themes the media focused on and determined that Obama succeeded in stealing the economic issue from Republican Romney. "The 2012 elections saw an 'issue trespassing' strategy with President Obama taking the initiative on the economy," found the survey of stories produced by 719 U.S. and international outlets. Critic: MSNBC's '24 Hours a Day of Mess... Unwatchable'. Appearing on Fox News' MediaBuzz on Sunday, Baltimore Sun media critic David Zurawik mercilessly mocked MSNBC's low ratings, calling the network "24-hours a day of mess." Zurawik appeared on MediaBuzz to discuss a recent Quinnipiac poll that found Americans consider Fox to be the most trusted television news network whereas MSNBC was the least trusted network. Don't We Hear About Soros' Ties to Over 30 Major News Organizations? When liberal investor George Soros gave $1.8 million to National Public Radio , it became part of the firestorm of controversy that jeopardized NPR's federal funding. But that gift only hints at the widespread influence the controversial billionaire has on the mainstream media. Soros, who spent $27 million trying to defeat President Bush in 2004, has ties to more than 30 mainstream news outlets — including The New York Times, Washington Post, the Associated Press, NBC Nancy Cordes Perfectly Demonstrates Media Bias Problems. A Pew survey came out last week showing that conservatives don't trust many media outlets. And newspapers and magazines that are presented as ideologically neutral skew far to the left in terms of their actual audience. People joke about MSNBC being liberal but its audience, at least, is more conservative than those of NPR, the New York Times, Washington Post, The Economist, Politico and the New Yorker. But even the supposedly moderate media outlets such as CBS have serious problems with covering politics in anything approaching a neutral fashion. Fox News Is Winning. There are plenty of reasons that explain Fox News' ratings dominance over the past decade and a half, but a new poll from Quinnipiac University sheds light on at least one major factor: trust. When voters were asked "Whose news coverage do you trust the most?" Fox News beat out all other television news organizations — on network and cable. trusted name in news is ... Fox? It depends on how one measures trust, but Fox News wins in at least one definition provided by Quinnipiac in their latest polling. When ranked head-t0-head in a single question — notably asked after individual trust questions in this survey — Fox News wins by a significant margin against other national television news outlets, 29/22 over CNN and with NBC and ABC tied for a distant third at 10%. Eric Burns and the Cult of Liberal Media. People get "fired" in the media all the time. In fact the media is not unlike baseball. Personalities and shows come and go. Superstars emerge. Some burn for a long time — like O'Reilly — while others can fade. Glenn Beck was red hot and then no longer. Some get fired and rehired elsewhere by another team. Still others are the equivalent of those stalwart ballplayers or coaches in the majors who never gain superstardom but show up everyday for work and spend a career doing their jobs. While his ending experience at Fox clearly wasn't pleasant for Burns, in the world of media it is hardly unusual. Reasons Why We Really Hate the Media. [#1] It's one giant club. Trust me on this, as I was part of it for 25 years. They all went to the same schools, studied the same subjects, live in the same neighborhoods in Manhattan and Washington, D.C. Not only do they not know you, they don't know anybody who knows you. Matters Puts Entire Staff On Mission To "Bring Down Bill O'Reilly". Media Matters employs 45 paid researchers who have a very specific goal. They advocate for far-left agendas, create the scripted talking points for CNN, MSNBC and the alphabets, and they are mission destined to destroy Fox News. Regarding their mission to "destroy Fox News", they have now put their best men, top men, ALL MEN, every-single-researcher in the entire organization, on a single mission to eliminate FOX's Bill O'Reilly. need to learn how to turn the tables on the MSM. The Republicans have a serious messaging problem. Either they are totally clueless when it comes to public relations or they're just "Democrat Lites" as they've been described over the years. With the issue of funding homeland security ruling the headlines at this time, Republicans need to be talking every day whether it be news conferences, media interviews, Sunday morning news shows or speeches on the House floor, but get it out loud and clear to the public the reason why they are not defunding the Department of Homeland Security (DHS), rather it is Obama that would be defunding it because of his refusal to sign a bill that includes defunding his illegal executive order on immigration. the Ref: Law Prof Randy Barnett Details How Media's Lobbying John Roberts. Georgetown Law professor Randy Barnett has an excellent piece today at the Volokh Conspiracy blog detailing the lengths to which the liberal media is going to not-too-subtly lobby Chief Justice John Roberts on the upcoming ObamaCare subsidy case King v. Burwell. Liberal news bias now infecting sports coverage. And the host of radio's "The Mighty Gwinn Show" on Yahoo Sports, Dylan Gwinn, is blowing the whistle in a new book titled Bias in the Booth. It details a surge of liberal bias against conservatives in sports and he offered a reason for it to Secrets. "There is no real difference between mainstream media and sports media. They have the same background, go to the same schools, have the same pedigree, but instead of news went into sports," Gwinn said. Greatest Monster: A Scott Walker Presidency 'Would Be a Disaster'. Wisconsin Governor Scott Walker, who has won three statewide elections in a blue state, has so freaked out the leftist media it's a wonder if some of them will even make it to the day he declares his candidacy for president. Media Apologize for Calling Scott Walker an Un-American Racist Dictator? Liberal journalists from CBS's Norah O'Donnell to the Washington Post's Dana Milbank have questioned Wisconsin Governor Scott Walker for not rejecting Rudy Giuliani's comments about Barack Obama's patriotism and for his response to a "gotcha" question about the President's faith. But where were they when Walker himself was being called an un-American, tyrannical, racist woman-beater? Walker's welcome to the national stage from the press has been a far different one that candidate Barack Obama experienced. In 2004, the liberal media couldn't contain the chills up their legs when they first laid eyes on the "cool" "rock star" Senate candidate from Illinois. elites mock Middle America. Last week the DC-New York media responded in epic fashion to former New York Mayor Rudy Giuliani's comment that he didn't think President Obama "loves" America. They nearly tripped over themselves to ask every potential GOP presidential contender if he agreed with Giuliani; their braying eventually led to mocking Christians. In an interview with the Trib, Louisiana Gov. Bobby Jindal said that while Giuliani could have better framed his point, it was accurate. Then Jindal offered a critical observation: When we face truly grave concerns, from economic disconnection to radicalized Islam, why did this supposed issue rise above those others for so long and with such velocity? the news fit to... miss. It's hard to imagine MSNBC could manage to limbo below its own low credibility bar, but America's most shamelessly partisan cable "news" channel has really pulled it off. There's always stiff competition for bias in America's slavishly left-loving media. Think of Dan Rather's "fake but accurate" Bush-bashing National Guard story, Newsweek's flushed Korans fable and Candi Crowley's assist for President Obama in the 2012 debates. Yes, the "Morning Joe" wet kiss of an "interview" with U.S. Sen. Elizabeth Warren yesterday [2/24/2015] belongs in that company. Walker Is a Threat to the Existing Social Order. [Scroll down] But the whole controversy isn't really about Scott Walker's qualifications. It's about something deeper. On the surface, of course, it's certainly about Scott Walker. The left-leaning mainstream media senses that he's a potential danger. After all, he has won three straight elections in a swing state, while challenging the public employees' unions head-on and significantly reducing their government privileges. (This is precisely what makes him interesting to those of us on the right.) The mainstream media feel that they need to disqualify him now, so they're looking for anything they can use against him. Walker is officially the GOP frontrunner, and the media is out for blood. How do you know that Wisconsin Gov. Scott Walker has taken at least temporary custody of frontrunner status in the race for the GOP presidential nomination in 2016? Beyond, of course, the polls that show him rocketing to the front of the pack in critical early primary states like Iowa? The political press is coming down hard on him and his nascent campaign. After three unambiguous statewide victories in a Democratic state in just four years, Scott Walker is thoroughly vetted. If there were skeletons in his closet, the media and the myriad opposition researchers scrutinizing his past would have found them Smearing Walker With Giuliani. We can tell who the Democrat media fears among the GOP 2016 presidential field; it's tipping its hand. Fresh off the castigation of Scott Walker for his lack of a college degree and his refusal to be dragged into the question of evolution vs. creationism, Walker is now being dragged through the mud for failing to repudiate statements made by former New York City mayor Rudy Giuliani assailing the patriotism of President Barack Obama. GOP hopefuls need to learn about media 'gotcha' questions. The "gotcha" games of the liberal media have already begun. A couple of weeks ago, reporters following [Scott] Walker in London demanded to know if he believed in evolution. And before that, all the rage among the MSM was what possible Republican candidates thought about vaccines. Since then, some of those candidates have been asked about what other candidates said. It's a tried-and-true tactic for the leftist media: One nut job Republican utters the words "legitimate rape," and suddenly all Republicans are legitimate rapists. Media: When You Attack Obama, You're Attacking Them. It was just a few short days ago that President Obama said that Republican attempts to tie ISIS to a radical form of Islam are lying and helping to drive recruitment by not leaving out the religious element to their terror the way he does. After he said those things, there was no furor in the press. Journalists were not taking to social media to express their outrage at the President suggesting Republicans were aiding a barbaric Islamic terror group. They were largely silent. It was a whole different story however, when news broke broke just the day before about comments former NYC Mayor Rudy Giuliani made at an event for Governor Scott Walker. questions all Democrats must answer. If you think the mainstream media is not out to elect Hillary Clinton in 2016 every bit as much as it was for Obama in 2008 and 2012, then you need your head examined. The multi-day and ongoing demand that Scott Walker verify that Obama is Christian and loves America is a good example. Why is it that Republican candidates and politicians are required to verify the bona fides of Democrats? Media's Breathtaking Double Standards on Patriotism and 'Civility'. Democrats and Republicans play by different rules because the media enforces those rules, and members of the national press tend to be liberal Democrats. During the Bush years, we were often reminded, dissent was the "highest form of patriotism." Over the course Obama's tenure, dissent became dangerous, disrespectful, un-American and quite possibly racist. When a conservative figure says something that seems to impugn or question a prominent liberal's character or love of country, "civility" SWAT teams are dispatched to knock down some proverbial doors. Such transgressions mustn't stand. But when the dynamic is reversed, the civility police are curiously off duty. Secular Elites Ignore Religion. It is not too brash to say that "religion" is the one field that is frequently disallowed in serious discussion by the urban, bi-coastal crowd. For years the New York Times best-seller list would not contain any religious book. If you listened to NPR from 1970 to 1990, you would think that no one in America ever had a religious thought. Since that time, it appears that somebody woke up and sent an internal memo indicating that religion is now a legitimate subject for thinking people. Race-baiter MSNBC's Joy-Ann Reid Cancelled From MSNBC. Joy-Ann Reid used the George Zimmerman trial to advance her personal brand of hate and achieve a show on MSNBC. Mrs. Reid is friends with some of the most well known media racists, and promotes a divisive and toxic brand of race-based journalism in line with the "#F*** The and allegiance to the Church of Global Warming. I can think of no question that better peels back the layers of leadership when it comes to picking our next president. Twelve million illegals are presently living illegally and working illegally in the United States, sir. What is your position on evolution? A seething cauldron of hatred is boiling over in the Middle East, threatening one of our most important allies and hellbent on destroying America, madam. So, what do you think of evolution? Iran is fast building a nuclear bomb. So, you know, what do you think Should Declare War on the Mainstream Media. [Scroll down] What should Boehner do? I think he, and every Republican, should do what George H.W. Bush did to Dan Rather as the 1988 presidential race was heating up: eat the mainstream media alive. They are the enemies of the Republican Party and should be treated as such. Stop trying to curry favor because you won't get it. Bush laid a trap for Rather, insisting on the interview being live so it couldn't end up on the cutting room floor. It totally flustered Rather, greatly energized Bush's campaign, put the kibosh on his too-much-a-nice-guy image, and helped mightily to propel him to the White House. Make mainstream media bias the issue. Throw loaded questions and those premised on liberal assumptions back in their faces. Accuse them of bias when they are biased. Don't be Mr. Nice Guy. Jon Stewart turned lies into comedy and brainwashed a generation. Brian Williams lied about his personal exploits a few times. Jon Stewart was unabashedly and habitually dishonest. Though Stewart has often claimed he does a "fake news show," "The Daily Show" isn't that. It's a real news show punctuated with puns, jokes, asides and the occasional moment of staged sanctimony. It contains real, unstaged sound bites about the days' events and interviews about important policy matters. Stewart is a journalist: an irresponsible and unprofessional one. Go Collectively Insane over GOP Positions on Evolution. While ISIS burns Jordanian pilots and beheads American journalists, while the economy teeters on the brink, while Obamacare rolls out, while racial divisions plague America, the media have focused, laserlike, on the issue that matters most: opinions on Charles Darwin. Admits: Jon Stewart Tilts Left, His Audience 10-to-1 Liberal to Conservative. NPR's All Things Considered was surprisingly honest on Wednesday night [2/11/2015] about Jon Stewart's departure from The Daily Show. Stewart was credited for "influencing the way a generation of young people, especially liberals, view the news and politics." Correspondent Don Gonyea admitted the president of the College Democrats "sees Jon Stewart as being on her side" and cited research that shows Stewart's audience is overwhelmingly liberal. and the Myth of the Evening News. In our 24/7 news environment it is sometimes hard to remember the central role that the national evening news broadcasts played in American life prior to the cable revolution. [...] But while the toppling of yet another mainstream media giant is still a big deal, it also points out the fallacy inherent in the way most Americans once regarded the institution of the evening news. Far from being the source of objectivity and integrity, these shows were, and are, the product of news organizations that are not only flawed but also saturated with Five Ways Liberals Ignore Science. How do we deal with the false perception that liberals are more inclined to trust science than conservatives? Or, how do we approach the media's fondness for focusing on the unscientific views of some conservatives but ignoring the irrational — and oftentimes, more consequential — beliefs of their fellow liberals? 'We Got 600' TV Stations and 1 'Conservative Station'. A slip of the tongue? An inadvertently candid bit of sarcasm? Whatever his intention, President Barack Obama revealed to a crowd at Boise State yesterday [1/21/2015] his (correct) belief that the television media in the United States is dominated by liberals. in Kansas. The local news stories have not only been deliberately stingy with the details of how events unfolded, and have used a deliberately passive voice (e.g. "gunfire erupted"), but they have consistently characterized the suspects as "teenagers" or merely "teens". It was also several days before any identifying details about the four "teens" were reported; nor were their names reported for several days, and it was longer before their photos were shown. The cynics among us have almost come to expect that when a journalist's physical description of a suspect conspicuously omits anything about the suspect's complexion, there's a reason. And that's part of why the cynics feel that the media are following a template we've seen before, as in the way 17 yr. old, 6'2" and 175 lb. "little" Trayvon Martin was characterized as "a child", accompanied by a childhood photo, and the way Michael Brown of Ferguson, MO was characterized as a "gentle giant". outcry, News-Press is adamant on provocative term for immigrants. A few decades ago, it wasn't unusual for American newspapers to refer to people living in the United States without legal permission as "illegal aliens," or even "illegals." Those terms were criticized as offensive and eventually gave way to "illegal immigrant," a label that itself was jettisoned by most outlets two years ago, when the Associated Press banned the term from its stylebook in favor of language that more precisely describes a person's immigration status. Group Targets Comcast/NBC. The 65-page letter is addressed "Dear NBC Affiliate Owner." The sender: the Conservative War Chest, with spokesman Michael Flynn signing the letter. [...] The subject: Comcast/NBC Universal, now in the middle of a merger bid with Time Warner, and the larger issue of "the corruption of American journalism." There is also a two-minute video, found here. Comcast/NBC is accused of acting as a "leftist Super Pac sponsoring millions of dollars worth of attack ads disguised as 'news' that seek the political oblivion of conservatives and the Republican Party." Must Investigate Where the Media Fear to Tread. The liberal media are terrified that Republicans will actually do something with their power. On foreign policy, the [Washington] Post feared that Republicans could put in jeopardy President Obama's "outreach to Cuba and Iran." The term "outreach" implies that Obama is pursuing a wise and correct approach to our enemies in the communist and Muslim worlds. This is how a major liberal paper attempts to intimidate Republicans into letting Obama and the far-left have their way. Let's hope the Republicans are smart enough to see through this propaganda disguised as "news." Greatest Misses. Bill Moyers has retired from television (for the third time). His last show aired yesterday, though it will be repeated. Frankly, I didn't know Moyers was still on television. As the Washington Post reports, "Moyers' visibility has fallen in recent years, in part because Moyers & Company airs at different times on public station, sometimes in the wee hours, which complicates national promotion." There aren't hours "wee" enough to which to banish a hack leftist who spews such ahistorical nonsense as "I've lived long enough to see the triumph of zealots and absolutists, to watch money swallow politics, to witness the rise of the corporate state." Media Desperate for Jeb. The Jurassic media is on the march, and their goal is to help the Republicans nominate Jeb Bush in 2016. In order to achieve this goal, they have started to soften the battlefield of ideas with their stockpile of shallow psychological tactics. Trust in Media at an All-Time Low. Americans' confidence in the media's ability to report "the news fully, accurately, and fairly" has returned to its previous all-time low of 40%. Americans' trust in mass media has generally been edging downward from higher levels in the late 1990s and the early 2000s. in 2014. David Rutz of the Washington Free Beacon has compiled a partial list of the worst from MSNBC in 2014. I say partial because in order to do the subject justice, Rutz would have had to write a novel-length treatise. The Worst of MSNBC in 2014. MSNBC in 2014 was so much like other years: low-rated and highly ridiculous. [...] The Cycle's Krystal Ball offered viewers a new understanding of George Orwell's classic "Animal Farm" as a screed against the evils of capitalism. After being called out for butchering a timeless piece of literature, she naturally doubled down on her wrongness. That wasn't her only rough moment of the year. will Al Sharpton go? On Saturday afternoon, two New York Police Department officers, Wenjin Liu and Raphael Ramos, made the ultimate sacrifice. They were assassinated by man who was a member of the Black Guerilla Family gang and who quoted jihadists on his social media accounts. He said he was going to get revenge for the killing of criminals Michael Brown and Eric Garner. Meanwhile, on cable there is a network many real Americans refer to as the Karl Marx channel. They call themselves MSNBC. Granted there are more members of the flat earth society than there are viewers of the Karl Marx channel. Ratings Tumble, MSNBC to Debut Left-Wing, Internet-Based Shows. After failing at the ratings game on cable, left-wing cable news network MSNBC plans to take its "progressive sensibilities" to a series of some 14 new Internet-based shows on topics ranging from the gay lifestyle, to politics, to journalist navel gazing, and even sports. The new Internet network will be called "MSNBC Shift." MSNBC's ratings have kept it in near perpetual third place, behind CNN and far behind ratings leader Fox News. At times, even HLN, CNN's old Headline News station, has beaten MSNBC in the ratings game. In fact, MSNBC's third quarter ratings hit a record low with every one of its shows falling into the bottom of the cable ratings. Media Fail: Only 29% Oppose CIA Interrogation Methods. A Pew Research poll finds that the mainstream media and Democrats failed miserably in their coordinated attacks against the Bush Administration (and America) over Bush-era enhanced interrogation methods employed by the CIA against 3 terrorists to stop future terror attacks (and hunt down 9/11 mastermind Osama bin Laden). Only 29% said the methods in question were unjustified. A majority of 51% consider them justified. A clear majority refused to buy into the media's lies about these methods not working. A full 56% believe correctly that the intelligence gathered stopped future terror attacks. Only 28% disagreed. Endless Lies and His Media Accomplices. It was appropriate that the Democratic Senate report on "torture" was released on the same day that Jonathan Gruber was testifying about lying to the American people regarding the benefits of Obamacare. The Senate report was another form of deception, designed to confuse and mislead about what Obama has used in place of interrogation techniques of terrorists. Obama doesn't interrogate terrorists, he kills them. Yet, we are led to believe Obama believes in American values and practices them. The American people would see through the lies if only they could depend on a media that would lead them out of all the deliberate obfuscation. exec to head up Democrat midterm review panel. How cozy is the Democrats' relationship with the media and technology worlds? Close enough for Google executive chairman Eric Schmidt to head up a panel convened by the Democratic National Committee to figure out why they got creamed in the midterm elections, as CNN reports: [...] New Republic Commits Suicide. This morning [12/5/2014], pretty much the entire editorial staff of the New Republic resigned, in protest at the direction in which the magazine was being taken. [...] It is notable, perhaps, that one of the only people who did not walk out today is former Salonista Brian Beutler, a recent hire whose specialty appears to be writing whatever the Establishment Left needs to be written at any given moment and then throwing it at his enemies with gusto. Todd's wife aiding Jim Webb. Kristian Denny Todd, the Democratic strategist and wife of "Meet The Press" moderator Chuck Todd, is working with former Sen. Jim Webb as he considers a 2016 presidential bid, a Webb spokesperson confirmed on Tuesday [12/2/2014]. "She's been helping and advising him," Webb spokesperson Jessica Vanden Berg said. Todd previously served as the communications director for Webb's 2006 Senate campaign in Virginia. She is not currently being paid by Webb's office, according to spending reports for Webb's political action committee. Levin: The Left Is Whipping Up Ferguson To Cover Their Failures. My reaction is that Farrakhan is a violent, hateful racist anti-semite and the fact that the president of the United States didn't denounce those comments, the fact that the attorney general of the United States didn't denounce those comments, the fact that not a single Democrat went to the floor of the House or the floor of the Senate and denounced that man and what he stands for, and not even a Republican, as far as I know is unbelievable to me. As far as Jesse Jackson is concerned, Ferguson is not Selma and Michael Brown is not Emmett Till. a sane world, Sharyl Attkisson would be recognized with the highest commendations in journalism. Appearing at number five this week on the New York Times' bestseller list is Sharyl Attkisson's much anticipated debut "Stonewalled," the tale of a renegade reporter who was forced out of her job at CBS because of a supposed "anti-Obama bias." (Quick: name one reporter ever canned for having an anti-Bush bias.) evil lurks? The liberals know. On a good day, about 80 percent of the content generated by left-leaning websites will be spent explaining why Republican positions on x, y and z are really expressions of their fear and loathing of non-white Americans, and how modern conservatives descend from John C. Calhoun, Jefferson Davis, the 1948 presidential campaign of Strom Thurmond and the Ku Klux Klan in its entirety in one straight and unbroken line. MSNBC frets over the threat of the "dog whistle," by which one uses a commonplace phrase to send a sinister message to one's fellow bigots. Only their network's anchors are apparently able to hear them. AP Accused of Bias Against Israel. The Associated Press is pushing back against charges leveled by one of its former Israel-based reporters that the global news agency is systematically biased against Israel and specifically makes editorial choices meant to portray the Jewish state in negative terms. The article by former AP reporter Matti Friedman accused the organization's Jerusalem bureau staff, as well as other reporters who cover the issue, of having an innate "distaste for Israel." Friedman, who worked for the AP from 2006 to 2011, claims that these reporters choose and write stories about Israel based on "a belief that to some extent the Jews of Israel are a symbol of the world's ills." H8. The real haters are in the media, some of them the openly left-leaning media and some of them claiming to be mainstream. But oh, how vilely they spew their hatred. That's the most obvious takeaway from a perusal of this year's "Best Notable Quotables of 2014: The Twenty-Seventh Annual Awards for the Year's Worst Reporting," sponsored by the indispensable Media Research Center. This is my 17th straight year as one of the 40 or so volunteer judges for the awards, and each year the media's anti-conservative vitriol seems worse than before. Torch Is Being Passed to A New Generation of Right-Wing Media. Conservative media, never somnolent, is in a new and different boom period, led by millennial writers who are striking out against fresh targets. Anchor Jorge Ramos Speaks Out for Advocacy Journalism: 'Neutrality Helps the Oppressor'. Receiving an award before the Committee to Protect Journalists, Univision anchor Jorge Ramos delighted The Huffington Post by giving a stemwinder speech in favor of advocacy journalism, including his usual tub-thumping for immigration "reform." Ramos pointed to a quote by the great Nobel Peace Prize winner Elie Wiesel to bring his point home: "We must take sides. Neutrality helps the oppressor, never the victim." Awards Medal of Freedom to Supporter and Former NBC Anchor Tom Brokaw. President Barack Obama awarded the Presidential Medal of Freedom to 18 individuals on Monday afternoon [11/24/2014] with one of them being former NBC Nightly News anchor and reliably liberal supporter Tom Brokaw. During Monday's NBC Nightly News, current anchor Brian Williams used two teases and a segment by NBC/MSNBC's Andrea Mitchell to hype the ceremony. immigration edict has no legal justification. The broadcast networks refused to air the president's immigration speech, with some insiders admitting the networks found it too political. Besides that, the speech was insulting to anyone remotely familiar with our system of government, and it assumes that his base is so unhinged it will stop at nothing to get what it wants. The Editor asks... When have the networks ever considered Obama's speeches to be "too political" to put on the air? Obama Counted On 'Minions in the Press' to Help Cover Up Gruber Scandal. Appearing on Fox News's Special Report Monday [11/17/2014], columnist Charles Krauthammer suggested that the reason President Obama waited a week to comment on the Jonathan Gruber ObamaCare scandal was because the White House knew it could count on the liberal media to ignore the story. about the Jonathan Gruber ObamaCare scandal. Did Chuck Todd Say Too Much About MSNBC? Chuck Todd, NBC News Political Director and moderator of Meet the Press, just released his latest book "The Stranger: Barack Obama In the White House" chronicling the Democrat's first six years as president. While much of the book details the numerous political battles the administration was engaged in, three excerpts from the book are quite striking. Not only does Chuck Todd concede that MSNBC is openly leftist, the NBC host writes that "perhaps most frustrating to Team Obama was that even their allies weren't always allies." [is] So Isolated That Dem Senators Call MSNBC to Learn White House Plans. Morning Joe host Joe Scarborough and Meet the Press moderator Chuck Todd appear to have a much better relationship with senior Democratic leaders than President Obama does. "I actually had a senator — and it happens quite a few times where senators will call us saying, what are you hearing over at the White House? What are they thinking on this bill?" Scarborough said. Hayes' Attkisson Interview Sums Up MSNBC's Issues in One Question. [Scroll down] We've often explored why MSNBC struggles so mightily, particularly lately — a disturbing development considering an election was just held. Is the presentation outside of its morning show an echo chamber, which doesn't make for compelling television? Yes. Is the decision to go almost all opinion — even during dayside — making it impossible to discern one program from another? Yes. But here's one more point to consider: How high is the quality of the guests? Are those guests diverse from a political perspective? The answers are "not high at all" and "no". Rarely does a big-name Republican outside of a periodic Rand Paul interview ever appear on the network. Must Accept That This Year's 'War On Women' Was A Disaster. With a cartoonishly compliant media serving as attack dog for every Republican error or otherwise helping push the message, Democrats and abortion-rights activists couldn't conceive (definitely no pun intended) of a reason to change course. And in 2014, they had what they believed were some of their verdict explodes Democratic myths. As Democratic losses mounted in Senate races across the country on election night, some liberal commentators clung to the idea that dissatisfied voters were sending a generally anti-incumbent message, and not specifically repudiating Democratic officeholders. But the facts of the election just don't support that story. To Moderate Final NH Senate Debate — Despite Ties To Shaheen Operative. ABC News' George Stephanopoulos, a former aide to former President Bill Clinton, will be moderating the final debate here between incumbent Democratic Sen. Jeanne Shaheen (D-NH) and Republican Scott Brown on Thursday evening. But one thing that's not known to the public about Stephanopoulos is his longtime personal ties to one of Shaheen's top political advisers. Time to Trim the Debate Moderators' Role. As this campaign season draws to an end, doubtless many will comment on what was right and what went wrong for each party. Let me beat the crowd by stating whatever the outcomes of the Congressional and state races the notion of Republicans continuing to allow Democratic operatives posing as newsmen and women to act as moderators in candidate debates is one of the most inexplicably stupid blunders of all. And yet each election it is repeated. Let this be the last time. Here are some names and incidents that should be engraved forever on the RNC steps and in each republican officeholder's quarters: George Stephanopoulos, Gwen Ifill, Charlie Gibson, Candy Crowley, and James Pindell. Korps: The farce of the White House press. Is the White House press corps obsolete? Today its members are restless, grumbling about an Obama White House that claims to be the most transparent ever. From big issues such as the tapping of a Fox reporters's phone to the media blackout imposed on the president's golf game with Tiger Woods, the chorus goes up: When it comes to the press, President Obama may be even worse than ... Nixon. The Left's fantasy world is no amusement park. The Obama propaganda machine churns out fantasy to the liberal and Left media outlets, who obligingly publish and defend everything they put out. And since Fox News is the biggest media source that does not buy into this Fantasy World, they are the ones portrayed as living under false conceptions. The media embargo on "the B word". [Scroll down] If America's reporters are so concerned about race relations in the country that such descriptions are included immediately when discussing a case where a white person is charged with injury to an African American, how is such discussion less valid when the roles are reversed? [...] As much as some of these news outlets may hate to admit it, black people do, on occasion, commit acts of violence. And sometimes the victims of that violence are white. But somehow that's not a story. List: Every Journalist in the GameJournoPros Group Revealed. Last week, Breitbart News revealed a secret video game journalist mailing list used by a clique of influential writers, editors, and bloggers, some of whom attempted to bully their colleagues with it in an attempt to shape the news agenda for political purposes. We can today reveal the complete list of journalists, some 150 key industry figures, on the list. Outlets with representation span the entire video games journalism universe and include Polygon, Ars Technica, Wired, Eurogamer, Destructoid, Kotaku, Joystiq, TechRadar, and many other well-known brands in games publishing. plea for constitutional literacy on Constitution Day. Earlier this summer, I managed to perplex, perhaps even offend, a famous TV interviewer when I declared I wanted a federal government that followed the U.S. Constitution. Seemingly aghast, the interviewer went so far as to suggest my position was a "highly charged thing to say." Imagine that. A journalist who, owing to the Constitution, has the right to report freely and to speak freely, being uncomfortable to hear a fellow American swear allegiance to the Constitution and the Founding Fathers' vision of a limited central government. Mitchell: Obama's New Foreign Policy Advisers All MSNBC Regulars. MSNBC'S Andrea Mitchell claimed President Barack Obama's new cabal of foreign policy advisers "looks like a review of our guest list" on the liberal cable news network, with the AP's Julie Pace explaining that the White House is trying to bring the commentators "into the fold." Mitchell spoke Tuesday [9/9/2014] with Pace about Obama's Monday night dinner with the DC foreign policy intelligentsia, presumably designed to help craft a strategy to contain an aggressive Russia and defeat ISIS in the Middle East. But as the MSNBC host ticked off the guests — including former Clinton aide Sandy Berger, longtime Democratic adviser Zbigniew Brzezinski and former Democratic congresswoman Jane Harman — she couldn't help but notice a trend. 'World News' Anchor David Muir Loves 'Cool Kid Obama,' Mocked Romney. Starting on Tuesday [9/2/2014], ABC journalist David Muir will replace Diane Sawyer as the anchor of World News. Given the liberal legacy of predecessors like Peter Jennings and Sawyer, it's not surprising that Muir has a history of fawning over "cool kid" Barack Obama and attacking conservatives. The Media Research Center has compiled a Profile in Bias of his worst examples of liberal bias. a Lib 'Journalist' With Guts to Say He Wants Conservatives Banned from TV. Left-winger Ed Kilgore, who blogs for Washington Monthly magazine, made to comment on the new ideas that NBC has for revamping Meet The Press when Chuck Todd takes over the venerable Sunday political show (Todd himself is an old Democrat operative, by the way). In his August 25 post entitled, "Who Should Be Banned as Panelists For the New 'Meet?'," Kilgore notes that NBC president Deborah Turness is saying that she wants to have a panel of journalists question each guest as a sort of "coffeehouse conversation." [...] Kilgore thinks this is a terrible idea. Why? Because *gasp* that panel might have conservatives on it. So, Kilgore has a solution for this conservative "problem." He thinks NBC should ban all conservatives as panelists. Karma: Fox News soars as CNN reportedly to announce huge layoffs. According to a report in The Wrap, CNN and sister network Headline News are planning to lay off 550 staffers, a huge and very painful cutback. [...] Because progressives dominate 90% of media outlets and studiously ignore major stories like the IRS scandals, Benghazi, and basically anything harmful to Democrats, Fox News is handed the opportunity to reach the public with distinctive content unavailable elsewhere, and the public is responding. Most major media would rather be progressive than successful. the Titanic. What is the difference between CNN and the Titanic? The only casualties from CNN's sinking will be careers, not lives. For CNN, the bad news has hit. With no new race riots or crashing Malaysian airliners to boost ratings, CNN is back in the ratings basement again. While the normal rules of journalism may not always apply at CNN, the rules of business do. A business must bring in more money than it loses or it must make cuts. Since payroll is usually a business' single largest expense, that is often what is first cut. Mika Brzezinski Brags About Being Buddies With Eric Holder. MSNBC's Mika Brzezinski casually revealed her close rapport with Attorney General Eric Holder on Tuesday [8/19/2014], earning a gentle ribbing from co-host Joe Scarborough after claiming she's "in contact" with Holder and that their kids attend the same school. The "Morning Joe" co-hosts were discussing President Barack Obama's decision to send Holder to Ferguson, the small Missouri town wracked by violent riots since the killing of an unarmed black man by police ten 10 [sic] ago. "Sending Eric Holder — I've been in contact with Eric Holder over the past few months on other issues," Brezezinski said. "Our kids went to the same school." The Editor says... When she says, "the same school," I think she means the same expensive private school. Fail: Poll Shows Increase In Support for Ferguson Police. A very useful YouGov poll that tracks public sentiment about Ferguson over time shows that despite the 24/7 racial demagoguery from cable news network's like CNN and MSNBC, public opinion is moving in the exact opposite direction of what the media is aiming for. Between August 14-17 a plurality of only 45% believed Ferguson residents reacted unreasonably following the shooting of Michael Brown. Four days later that number jumped to a clear majority of 56%. Bloodbath at CNN, HLN: Axing of 550 Jobs 'Imminent'. Today's news of a coming bloodbath at CNN and HLN is a reminder that while CNN has been able to use the unrest in Ferguson to race-bait its way to better ratings, everyone knows that's temporary. Without something that allows the left-wing network to appeal to the lowest common denominator, CNN is almost certain to fall back into the ratings basement until something else comes along for the network to cynically exploit. 'D,' Showcase 'R'. It is such common sense as to be undeniable that basic journalism requires a party label to be affixed to a story about an elected public official, the president excepted. It is the DNA of the "who" in a news report. [...] But what happens when that cardinal rule is applied to one party but ignored for the other? Favoritism? Bias? No, it's far worse than just that. It is a commitment to abide by the rules of journalism with one party and then a deliberate attempt to protect the other, even if it means violating the most basic rules of news reporting. Rally Targets CNN Media Bias at Time Warner Center. The event page lists 1,200 attendees who RSVP'd affirmatively to attend the protest. "We are an independent group of people who share a common and STRONG bond with the beautiful country, Israel!" the protest's organization wrote. "We are tired of seeing the media berate and straight out LIE about the events taking place during this difficult time (and over time). [...]" is Betraying the Republic's Trust. The current occupant of White House has been in office for 6 years. He could not have achieved this without the refusal of the media to affirmatively vet his past, and then, the media's abandonment of all objectivity to actively support and protect Obama from all forms of criticism. In first averting, and then betraying, their indelegable public duty to hold government accountable for its actions, the media has betrayed the free republic that tolerates its existence in the first place. With their betrayal of first the public trust, and then the Republic's trust, the media has literally, and finally, cut its own throat. Only 40% of Americans get their information from the "Big 3" networks and newspapers. Reasons Not to Trust the 'What Me Worry' Media About Ebola. [#1] The Mainstream Media Love to Lord Their Superiority Over Us[.] Accusing the hoi polloi of panicking and then calling for calm is the first knee-jerk reaction of anyone who gets off on puffing themselves up as Our Betters. And that is our media personified. I believe and worry that the need to preen their superiority over us could affect the media's judgment. That's why the bloodless, slide-rule, Big Government-worshipping Spocks at Business Insider are already accusing others of panic ... even though no one is panicking. support Israel and the press hates it. One gets the impression that America's broad support for Israel's mission in Gaza over that of Hamas militants, support reflected in policy in Washington, is evolving into an obsession for members of the press. In fact, it seems that the more stubbornly Americans cling to their support for their country's democratic ally in the Middle East, the more frenetic and scolding the media's tone has become while covering the conflict. to Reporters on Midterm Election: 'We Need You to Be Messengers...' When asked at a press briefing on Thursday [7/31/2014] why her party's message is "not resonating with the electorate," House Minority Leader Nancy Pelosi told a room full of reporters "we need you to be messengers." Nunn: Favorable Media Bias Part of Democrat Campaign Strategy. Over at National Review, Eliana Johnson got hold of a confidential campaign plan for Michelle Nunn, the Georgia Democrat running for the U.S. Senate. Nunn is one of the two or three hopes Democrats have of actually picking up a Senate seat. The campaign is cynical, to say the least, especially in its assessment of Jews as a "tremendous financial opportunity" and Asians as "very tight." Ricochet looked at the report and found one area the campaign felt very good about: How Nunn could count on the media to be on its side and even warn them of in advance of GOP attacks. Attkisson: CBS Lost Interest in Government Watchdog Stories. In an interview with National Public Radio's David Folkenflik, former CBS investigative reporter Sharyl Attkisson said that the network discouraged her from pursuing stories on the Obama administration, and seemingly lost interest in her government watchdog stories to the point that they kept them off the air. Slams NY Times Editorial Page: 'Childish,' 'They Have No Influence. On Tuesday's [7/8/2014] "The O'Reilly Factor," Washington Post columnist Charles Krauthammer offered his assessment of the layout of the current media environment, particularly with regards to liberal bias. Krauthammer was particularly critical of The New York Times. In its news pages, he argued the Times offered the news through a leftward prism. However, it declared its celebrated editorial page inconsequential for its slant. IRS Lawyers Ready for Busy Week Ahead. The Obama administration has managed to keep the IRS story just below full-blown-scandal level for months now. The Washington-based establishment media, long friendly to Barack Obama and his White House, have been willing to accept at face value the increasingly implausible nothing-to-see-here claims of top IRS and Obama administration officials. Many reporters are eager to believe Democrats' claims that the scandal is yet another example of right wing hysteria. When Republicans make wild public accusations without evidence to support them, as we've seen in abundance in recent weeks, they make it easier for lazy reporters to move the IRS story from their "potential scandal" box to their "Washington dysfunction" pile. Rejects Illegal Aliens. If you watch the lame stream Pravda U.S. News you'd be inclined to think that only conservative communities take issue with busloads of disease riddled, contagion spreading, Illegal Aliens disbursed in their neighborhoods to overwhelm their social safety nets. [...] Here you see the same response from uber-liberal Chicago's South Side. But that doesn't fit the Pravda narrative, so you probably won't see Anderson Cooper or Rachel Maddow calling Chicagoans "bigots" or "racists". Ex-White House Flack Jay Carney To MSNBC? If it happens, Carney would follow in the natural footsteps of a few other aides to President Obama who were welcomed into the MSNBC family upon leaving their jobs. The last White House Press Secretary, Robert Gibbs, became an MSNBC contributor in May, 2013, while David Axelrod, a top aide to Obama, became one in February 2013. Primetime Ratings Crash, Worst in Eight Years. As July closes out, MSNBC has posted some of its worst ratings in eight years. The network came in third in total viewers and fourth in the key 25 to 54 age bracket for the month. In prime time, the network came in second in total viewers and third in the key demographic. This was MSNBC's worst showing in prime time in the key demo since 2006. 16 Reasons Why the United States is Going to Hell in a Handbasket. [#10] The stuff that you see on broadcasts like CNN aren't news or reporting but the controlled media simply spewing forth talking points that have been provided for them by the white house and other government agencies — this has been admitted to by main stream "news" organizations. Guard MSM Drops the Mask. Since its birth in the 1920s with the first national radio networks, the modern MSM has always had a cozy relationship with power, and until the creation of Fox News, one channel on your TV dial or satellite guide, that power has almost exclusively meant their fellow Democrats. The media have long voted overwhelmingly Democrat in presidential elections; as Walter Cronkite once said at a Radio & TV Correspondents Dinner in the mid-1990s, in-between feting the Clintons on his yacht in Martha's Vineyard, "Everybody knows that there's a liberal, that there's a heavy liberal persuasion among correspondents." Bias and the Obama Scandals. We live in a strange time. Historically, reporters and editors have believed that their job is to disseminate news. That is no longer true. Now, most reporters and editors believe that their principal function is to prevent people from learning things they are better off not knowing. Day after day, they run interference for their party, the Democrats. Blockading inconvenient stories from making the news is job number one. Media is blindly following Obama. That the leftist media remain a sucker for story lines about Democratic unity, as opposed to those about a Republican "civil war," is a disgrace that helps define the age of Obama. Uncurious and unserious journalists are not journalists. They are stenographers at best, shills at worst. Their abdication is destructive. The refusal to subject Obama to the same critical standard applied to Republican presidents provides cover for policies that lack public support. And that blackout of skepticism serves to keep potentially wayward Democrats in line. Then and only then is it possible to claim they are "starting to unite" behind a policy that doesn't exist. Fires Back: 'The Media Is a Willing Accomplice of the Left'. Wisconsin Governor Scott Walker appeared on Hugh Hewitt's radio show today to address the accusations of his involvement in a campaign finance scheme. Walker said two separate judges threw the case out and went after the media for still questioning his involvement, telling Hewitt, "The media is a willing accomplice of the left." Hewitt was particularly bothered by a TIME article titled "'Criminal Scheme' Will Haunt Scott Walker" that Hewitt said was "objectively slanderous." Walker said the media is completely ignoring the fact that this case was dismissed twice, and added, "You look at some of these media outlets, and they don't seem to care much about the truth." Public Confidence in TV News at All-Time Low. Public confidence in television news is at an all-time low, according to a survey released today [6/19/2014] by Gallup. [...] In the latest survey, conducted June 5-8, only 10 percent said they had "a great deal" of confidence in T.V. news, and 8 percent said they had "quite a lot" of confidence. Public Confidence in TV News at All-Time Low. Public confidence in television news is at an all-time low, according to a survey released today by Gallup. Only 18 percent of the Americans surveyed expressed either a "great deal" or "quite a lot" of confidence in that news medium. Matters founder funds 'journalists' to target conservatives. Does the Left really need another organization whose sole purpose is to attack conservatives? Apparently so, according to David Brock, founder of Media Matters for America, head of the liberal American Bridge PAC and board member of the liberal Priorities USA Action. Brock is going to bring his special brand of bias to the re-launched American Independent Institute — an obvious mock name considering it will be anything but independent. The goal of the institute will be to expose the "nexus of conservative power in Washington," according to Dylan Byers of Politico. Reasons Hillary Won't Run. 3) It ain't gonna be a coronation. HRC must have been taken aback last week when two members of the traveling sisterhood — Diane Sawyer of ABC News and Terry Gross of NPR — actually pressed her with uncomfortable questions about Benghazi and gay marriage, respectively. Hillary didn't respond well in either situation, and the ensuing coverage was instructive. If she can't count on favorable press coverage during the choreographed rollout of a self-reverential memoir, what does that tell us about how she'd do in debates against a determined opponent? The Editor says... In other words, Hillary can't win without the eager assistance of the news media, which confirms the obvious: that Obama wouldn't have won without that assistance. Warner CEO Blasted For CNN Bias at Shareholders Meeting. Time Warner Chairman and CEO Jeff Bewkes was blasted for CNN's left-wing bias at Time Warner's annual shareholders meeting Friday [6/13/2014]. The Hollywood Reporter's Paul Bond reports that Bewkes was confronted by shareholder Justin Danhof of the Free Enterprise Project of the National Center for Public Policy Research, with a litany of complaints about CNN's sharp turn to the left under Jeff Zucker. Danhof's comments were met with applause from The Least Trusted Name In TV News. MSNBC is the least trusted name in news, even less than the comedy program The Daily Show, a new Brookings and Public Religion Research poll revealed. Fox News Channel ranked as the most trusted name overall (25 percent of respondents) and with self-described independents (26 percent), while only 5 percent of all Americans rated the liberal channel its most trusted source of accurate information on politics and current events, Poll: The Number One Problem In Politics Is... Despite Sen. Harry Reid's near-daily speeches about the "un-American" Koch brothers and the vast amount of money they give to the Republican Party — all while the Democrats take billions from other interest groups — Americans are still not convinced that campaign donations are the number one problem in politics right now. That designation goes to media bias, according to 48% of the 1,000 likely voters polled for a Rasmussen Report. Big campaign contributions earned the #2 spot, with 44% of those polled. Among people who identify as Tea Party members, media bias is an even bigger problem — 77% say it's the number one issue. Media bias tops money as the biggest problem in politics. More Americans believe that biased media coverage is a bigger problem in politics than donations from fat cats, according to a new poll. Rasmussen Reports found that when given a choice, 48 percent of voters believe media bias is the No. 1 villain while 44 blamed big campaign contributions. And among Tea Party members, 77 percent said media bias and reports against the movement are the top problem in politics. Lord Obama. The media is not just overwhelmingly hard left, but hard left with a chip on its shoulder that its own views are neither accepted by the majority nor usually implemented by government. All the above scandals and embarrassments would have ruined a Bush, given that such mishaps would have been headlined daily in the New York Times (e.g., "VA, Benghazi, AP, NSA, IRS overwhelm sinking Bush administration") or Washington Post ("Bush Cabinet Paralyzed by Scandal"). For the media, Obama is not Jimmy Carter or even Bill Clinton whom they overwhelmingly supported. He is quite different — the first gold-plated liberal president since FDR, and probably the last for a while, intent on fundamentally transforming the United States, by redistributing income and accumulated wealth, and recalibrating the American profile abroad. How Conservatives Can Defeat the Media. For decades the media has collaborated with Democrats and the liberal elites in creating a superstructure that exists for the sole purpose of humiliating conservative candidates and spokesmen. It is proactive, universal, and often quite successful. It has also been virtually ignored by the conservative establishment, which consistently behaves as if American politics is a gentleman's pastime operating by the same rules that it did in the late 19th century. It can be said without exaggeration that the major public uproars of the 2012 campaign were either media-generated or immediately exploited by the downfall of American journalists. It ought to be a matter of deep shame that the most popular news website in the United States is the U.K. Daily Mail. And the fact that so many top editors and journalists in the United States happen to be from Britain is something that ought to disturb all those professors of journalism at elite schools like Columbia. You know, the ones that hand out big prizes like the Pulitzer, touting how wonderful our journalists are. Strangely enough, with all the university and foundation resources available for conferences, commissions, studies, and the like, nobody seems much interested in this embarrassing situation. There's a good reason for that. both barrels on partisan media. From Fast and Furious to Benghazi, and from the IRS to the VA, the national media has assiduously covered President Obama's tracks from start to finish, and is no doubt preparing to do the same for possible presidential candidate Hillary Clinton. Having heard enough, Sarah Palin this week let the media have both rhetorical barrels over their partisan covering for know-nothing Democrats, as highlighted on the Drudge Report. Just 7 percent of journalists are Republicans. That's far fewer than even a decade ago. A majority of American journalists identify themselves as political independents although among those who choose a side Democrats outnumber Republicans four to one, according to a new study of the media conducted by two Indiana University professors. [...] The great thing about this survey, called "The American Journalist in the Digital Age", is that its been conducted four previous times — in 1971, 1982, 1992 and 2002. That allows for some fascinating comparisons of how partisanship (or the lack thereof) among reporters has evolved over that time. What newspapers does he read? Harry Reid Scolds Press For Being Too Fair To Republicans. Democratic Senate Majority Leader Harry Reid reprimanded MSNBC's Chuck Todd — and indeed, journalism in general — for being too interested in treating Republicans fairly, claiming reporters "won't call things the way they actually exist." Harry Reid: Media covering for Republicans. The media are covering for Republicans in their political coverage, according to Senate Majority Leader Harry Reid. Asked by MSNBC's Chuck Todd in an interview aired Thursday [5/8/2014] why he won't allow Republican amendments to an energy bill, Reid shot back that reporters "won't call things the way they actually exist." Appalling Ignorance of Christianity. New York Times columnist Nicholas Kristof [...] admitted that when he was covering the presidential campaign of George W. Bush, he was surprised at how the candidate connected with Americans because of his evangelical faith; more surprisingly, Kristof admitted that he had "only the vaguest idea at the time what an evangelical was." Matters founder David Brock: We appreciate Soros funding to pursue journalists. Media Matters founder David Brock said Sunday [4/27/2014] that he's grateful for progressive billionaire George Soros' "generosity" and confirmed that he chooses to "pursue" journalists if he "starts to see patterns" in their work. Brock, his silver mane and bizarre vocal intonations lending him the likeness of a socially awkward Bond villain, sat in San Francisco for a softball interview with CNN's Reliable Sources to respond to the controversy surrounding former CBS News reporter Sharyl Attkisson. The liberal smear machine Media Matters has been hammering the brilliant female investigative reporter with the term "shoddy reporting" to describe her exposes on Obama administration scandals including Fast and Furious and Benghazi. Post hires ultra-liberal former union bully and nobody bats an eye. On Monday [4/21/2014], The Washington Post announced it had hired Philip Bump, a journalist currently at Atlantic magazine's The Wire, to cover politics for their daily blog The Fix. The move set off a chain of congratulations from across the political press corps. But lost in the media love fest was Bump's partisan past — a history left unspoken in either the Post's official announcement or any of the Twitter applause. Not only does Bump's archive at The Wire betray a palpable bias in favor of progressivism; his career as a journalist began when he headed a vicious pro-labor blog which published the names and addresses of opponents later targeted by unions. Responds to Attkisson's Claims About Network Reporting Bias. Former CBS News reporter Sharyl Attkisson has been very vocal about how CBS pushed back on reports she did critical of the Obama administration. On CNN's Reliable Sources Sunday [4/20/2014], Attkisson went after both her former network and Media Matters; the former for muzzling stories and the latter for targeting her. Attkisson has repeatedly argued that while CBS didn't really get in her way when it came to covering issues critical of George W. Bush, bus when it came to the same with President Obama, she was called a "troublemaker" and sensed a chilling effect for Attkisson: Some CBS Bosses Seemed 'Personally Defensive' of the Obama Administration. [Scroll down] Some CBS News managers are so "ideologically entrenched," Attiksson explained, that they're willing to quash or bury reports that could inflict political damage on the sitting administration. [...] "I didn't sense any resistance in doing stories that were perceived to be negative to the Bush administration. By anybody, ever." Sharyl Attkisson charges Media Matters helps produce news reports for CBS. Now that she has left CBS News, Sharyl Attkisson is revealing all sorts of interesting facts about the way news is shaped by ideologues. [...] In combination with the revelations on Politico carried by the Washington Post today, Attkisson's explanation of Media Matters' influence provide more reasons to distrust the mainstream media. Sharyl Attkisson Suggests Media Matters Was Paid for Propaganda Attack Campaign Against Her. Sunday on CNN's "Reliable Sources," host Brian Stelter was very critical of former CBS correspondent Sharyl Attkisson's reporting skills because she has spoken about her experience at CBS News where she witnessed as a common practice the killing of stories unfriendly to the Obama administration. Attkisson Claims CBS Moved On From 'Fast and Furious' as She'd 'Barely Begun to Scratch the Surface'. Appearing on Thursday's O'Reilly Factor, former CBS investigative reporter Sharyl Attkisson claimed that CBS "had barely begun to scratch the surface" of the "Fast and Furious" scandal before the network moved on from the story. She noted that the network showed similar reluctance for its coverage of Benghazi and the ObamaCare rollout. Before her resignation last month, Attkisson covered Obama administration controversies like "Fast and Furious" and Benghazi and her reporting helped the CBS Evening News win the Edward R. Murrow award in 2012. Yet she told O'Reilly that higher-ups at the network moved on from the "Fast and Furious"scandal "due to lack of interest, well before we found answers to a lot of questions." Dan Harris Denies Any Conscious Liberal Bias. ABC "Nightline" co-host Dan Harris appeared on the Steve Malzberg show Friday on Newsmax TV to promote his new book promoting meditation called "10 Percent Happier." After the two communicators discussed having panic attacks while they were broadcasting, Malzberg concluded the interview by asking about liberal media bias. Harris repeatedly said he was "open" to the idea, but insisted it was subconscious, and that "very, very powerful" people at ABC are conservatives. On Obamacare, Climate Change, Media Too Quick to Accept Facts are 'Settled'. CNBC contributor Rick Santelli ranted against the media's tendency to accept certain things as settled fact. According to Santelli, the media, "whether press, TV or whatever it is," aren't focusing enough on presenting hard data. Santelli argued that this was due to the media accepting data from third party sources as settled science. "Seven million, it's settled. Climate change, it's settled. It's all settled." He also expressed doubt about whether or not anyone was even capable of doing anything about climate change. The media hate Republicans. California State senator (and, until last week, candidate for secretary of state) Leland Yee was well-known as an anti-gun activist. Then, last week, he was indicted for, yes, conspiring to smuggle guns and rocket launchers between mobsters and terrorists in exchange for massive bribes. Some highlights, as excerpted by San Francisco Magazine. [...] This all sounds like news. You've got charges of huge bribes, rampant hypocrisy, illegal weapons and even a connection with foreign terrorists — and from a leading politician in an important state. But — and here's the part Hollywood would miss — outside of local media like San Francisco magazine, the coverage was surprisingly muted. Leland Yee Story, As a Free Press Would Tell It. Now, one might think that this is a major scandal. A prominent politician, a principled advocate of gun control, turns out to be a gun runner who wants to import shoulder-fired missiles, in exchange for a large bribe. How could the networks resist a story like that?! Poor CNN has been limping along with a lousy lane closure for what, two or three years now? A dynamite story like Yee's could put them back on the ratings map! Oh, one thing I forgot to mention — Leland Yee is a Democrat. So no national news organization has any interest in his story. Sorry. It's on the back pages of the local papers. This is more proof, if it were needed, that the Democratic Party's news media are not primarily interested in ratings or profits, but in advancing the party's narrative. Is A Fiasco, So Why Don't Media Report It? How do we know ObamaCare is failing? Ironically, because those very same "reporters" are doing the opposite of the Bush years. They're burying the story. They aren't in denial. They know the truth. They're just choosing to ignore it. They are pretending there are no broken promises about keeping your insurance plan, or keeping your doctor, or lowering your premium by $2,500 a year. They are pretending, like Ellen DeGeneres told the president, that "everyone" in America loves ObamaCare. Just how much coverage have they given to this, the most important domestic issue since Ronald Reagan's economic MSNBC: Hate Forward. MSNBC's entire primetime lineup is stacked with liberal journalists and pundits, who in turn have on more liberal journalists, pundits, and Democratic lawmakers as their guests more than 90 percent of the time. The subject matter, as anyone who watches MSNBC knows, is nearly always to gleefully and freely shred Republicans. One common point of contention: Daring to oppose the commander in chief. Yet, rather than engage Republican and conservative criticisms of Obama, anchors and guests often dismiss nearly all of them as stemming from a "hate" for the president. A few questions for the Cheer Leaders at ABC, NBC, CBS, AP, NYT, et al. You few, you proud, you journalists who inform Americans about their nation and the world; you inheritors of the glorious tradition of a free and vital press — may I turn the tables and ask you a few questions? Will any of you Obama cheerleaders ask the "Leader of the Free World" why he was so wrong and Romney was so right about the geopolitical challenge that Putin's Russia poses to America? Will you all apologize to Sarah Palin for y'all mocking her when she suggested Obama's weakness might encourage Putin to invade Ukraine? Ya, know, since she was so right and you all were embarrassingly wrong? President of Disney/ABC Television Sits On Soros-Backed Board. Ben Sherwood, the current president of ABC News who sits on the advisory board of the George Soros-backed Center for Public Integrity, will take over as president of Disney/ABC television in February of 2015. Sherwood will replace Anne Sweeney, who will be leaving next year after ten years. Sherwood will immediately become Co-President of Disney/ABC Television and continue his duties as President of ABC News. The Death of Journalism. Of course when Republicans are in office, liberal journalists become quite aggressive and love to launch investigations. When Democrats are in office, these same journalists help the politicians cover up their misdeeds. The identical press that blasted George W. Bush throughout his administration is totally uninterested in examining President Obama's failed policies, broken promises and weak leadership. The biggest omission has been a detailed examination of Obamacare and the President's many exemptions, extensions and revisions to the plan. We Report, We Decide. It is no wonder news organization credibility continues to decline. Rather than objectively analyzing and reporting the news, most major media organizations have become one large editorial page. And when they tire of attempting to report the actual news, they turn to the sensational. Attkisson: There Is Coordination Between Reporters And Politicians. Responding to comments regarding a Phoenix television reporter yesterday who initially claimed that the White House pre-screens questions from reporters, Attkisson said, "I wouldn't surprised if sometimes there is that level of cooperation with some questions. If I need something answered from the White House and they won't tell me, I'll call our White House Correspondent. They're friendlier with the White House Correspondents in general. So the White House Correspondent may ask Jay Carney or one of his folks about an issue and they will be told 'ask that at the briefing and we'll answer it.' They want to answer it in front of everybody. They do know it's coming and they'll call on you. There's that kind of coordination sometimes. I wouldn't be shocked if there's sometimes more coordination. [...]" Attkisson: Always a 'Chummy Relationship' Between Reporters and WH. Former CBS News investigative reporter Sharyl Attkisson appeared on Friday with Philadelphia-based radio host Chris Stigall where she was asked about a story that exploded on Thursday involving an accusation from a local CBS reporter who alleged that White House correspondents often submit their questions to White House Press Sec. Jay Carney in advance. The White House press corps strongly objected to this allegation, and the reporter who made this claim later walked it back. Attkisson said that, while she did not think this was a matter of collusion between journalists and political spokespeople for some nefarious purpose, there is some form of coordination between them. Attkisson added that there is a "chummy" relationship between reporters and political spokespeople that has been a feature of Washington D.C. that predates the Obama administration. My cross to bear — why I no longer hide my faith in the newsroom. Investigative reporter Sharyl Attkisson tweeted five simple words last week: "I resigned from CBS News." Seconds later, a website report explained why. Sources say she felt frustrated with the network's "liberal bias." If true, in a nutshell, she had become a square peg in a round hole, and was tired of pretending otherwise. [...] There's always a reason liberal bias is denied. But it alive and well in newsrooms. And it has been for decades. The same is true for religious persecution. The Editor says... TV stations don't mind featuring openly homosexual news reporters, but an openly Christian reporter is frowned upon, especially on the east and west coasts. vs. CBS: Reporter first tried to quit a year ago. CBS's Sharyl Attkisson announced this week that she is leaving the network, the culmination of a series of clashes between the investigative reporter and her bosses. But people familiar with the situation say that Attkisson actually attempted to resign one year ago, even starting to clean out her desk in the Washington bureau. Star Investigative Reporter Sharyl Attkisson Quits CBS: Democrat Scandals Not Welcome. Rumors of Attkisson's stormy relations with her superiors at CBS News have made the rounds for months and months. In conversations from last year, CBS News sources told the Erik Wemple Blog that Attkisson, who came to the network from CNN two decades ago, was frustrated that more of her reporting on Benghazi and other investigative pieces didn't make "The CBS Evening News" with greater frequency. CBS Departure Shows Big Media's Bias. [Sharyl] Attkisson is nearly alone within the broadcast media in pursuing Obama scandals, like the Benghazi attacks that killed a U.S. ambassador and three other Americans; the Fast and Furious gunrunning scandal that left U.S. Border Patrol agent Brian Terry dead; and the Solyndra scandal that wasted over a half-billion dollars of taxpayer money on a failed solar-panel maker. Last year, her computer was mysteriously hacked. Whether it's network corporate sponsors who don't want to anger President Obama, or news editors who love Obama's agenda, we're all in trouble if investigative reporting focusing on the president is persecuted into marginality. Media's Obama Protection Society. While [Sharyl] Attkisson is just one reporter and CBS has long since ceased being a dominant force in the national media, this may be a crucial moment in the history of American journalism. It was assumed that any major news outlet would regard aggressive coverage of all administrations as a given. But that ceased to be the case when Barack Obama entered the White House. If Attkisson is being shown the door at CBS it is not because her work is not highly regarded but because she has violated the prime directive of liberal media insiders: thou shalt not report on Obama in the same way that you reported on George W. Bush or even Bill Clinton. The liberal bias that conservatives have long complained about is out of the closet. The Associated Press Goes to Bat For the Democratic Party. Why do Republicans never seem to come out ahead politically when they go toe-to-toe with the Democrats? Part of the reason, at least, is that the press, to a greater extent than at any time in our history, is monolithically Democrat. The most important news organ is the Associated Press, whose articles appear in hundreds, or possibly thousands, of newspapers around the country. The AP pretends to be a neutral, just-the-facts information source, but it is nothing of the kind. While there are some good reporters at the AP, the overwhelming majority function, as to issues that are politically controversial, as advocates for the Democratic Party. Why the Media Will Never Treat Conservatives Fairly. As objective as the media claims to be, the so called Gang of 500 — the reporters and chattering class who develop the conventional wisdom in politics — is mostly of the left or married to the left. There is a revolving door between the media and leftwing politics that rarely exists on the right. It shapes the world view of the members of the media and necessitates conservatives working even harder to get their opinions, views, and stories heard. I have encountered this bias throughout the media in my professional life and seen it up close over the years. How AP altered its headline to protect Obamacare. Don't believe the press is in the tank for Obama and Obamacare? Well, check this out. [...] I realize this happens frequently, but the dishonesty is still breathtaking. And this is why much of the MSM cannot be trusted: they are not honest brokers of information, but a propaganda and marketing arm of the Obama White House, the Democratic Party, and the Left. Sharyl Attkisson resigns from CBS News. CBS News investigative correspondent Sharyl Attkisson has reached an agreement to resign from CBS News ahead of contract, bringing an end to months of hard-fought negotiations, sources familiar with her departure told POLITICO on Monday [3/10/2014]. Attkisson, who has been with CBS News for two decades, had grown frustrated with what she saw as the network's liberal bias, an outsize influence by the network's corporate partners and a lack of dedication to investigative reporting, several sources said. She increasingly felt that her work was no longer supported and that it was a struggle to get her reporting on air. of Edward R. Murrow in Sharyl Atkisson's departure from CBS News. CBS News has lost its strongest claim to be a fair and non-partisan news source with the departure of Sharly Atkisson from the network. The award-winning reporter has been squeezed-out because of her reporting on investigative themes inconvenient to the Obama administration, including Fast and Furious and the Benghazi Scandal — two incidents in which United States government officials lost their lives. Report: Star Benghazi Reporter Attkisson Exits CBS Due to 'Liberal Bias'. Apparently [Sharyl] Attkisson stuck out as an oddball to some at CBS and the rest of the media for daring to investigate power when it is held by a Democrat. Back in May, Breitbart News reported that the President of CBS News, David Rhodes, is the brother of President Obama's National Security advisor, Ben Rhodes. According to ABC News, Brother Ben was very much involved in the Benghazi scandal, specifically the infamous talking points that — with the help of the mainstream media — misled the nation for weeks in the heat of Obama's 2012 re-election campaign. Uneducated, And Eager To Deceive: Media Coverage Of Religious Liberty In A Nutshell. In the aftermath of the abominable media coverage of Arizona's religious liberty bill, an editor shared his hypothesis that journalists care about freedom of speech and of the press because they practice them. And journalists don't care about freedom of religion because they don't. But one of the most interesting things about modern media's deep hostility toward the religious, their religions, and religious liberty in general is that press freedom in America is rooted in religion. The Media, the South. As someone who moved from New Jersey to Mississippi eight years ago, I don't understand why leaders here don't more aggressively rebut the stereotypes the media perpetuate about the South. Because no amount of apologizing or explaining will ever change what the media think about us. Two New MSNBC Hosts Bring News Media-Obama Revolving Door to 30. With two political activists, who toiled for Barack Obama, starting hosting duties today [2/24/2014] with new shows on MSNBC, the Media Research Center's list of those revolving between working on behalf of Obama and positions in the news media has Shut up, they explained. The Democrat-Media complex works to in effect silence conservative critics rather than engage their criticisms and debate the issues. They employ a variety of programs and techniques to ensure that substantive points from the other side will either be ignored, distorted, demonized, or delegitimized. Fallon, Democrat Political Asset. The Obamas have had few more obsequious media allies than NBC's Jimmy Fallon. Now that he's taking over the hallowed ground of "The Tonight Show," Fallon's proven ability to spread his reach into viral videos on YouTube promises to become even more politically potent. Fallon's Obama-friendly sketches and interviews have become immediate "news" grist for the Comcast corps at NBC and MSNBC. The same sensation happens when Fallon is ripping into a Republican. Understanding The Left's Grip On Media. While talk radio and FOX grab much of the attention, what really broke the left's control over media was the Internet. Before its advent, one needed a large investment in a printing press or a broadcast tower to engage a mass audience; afterward, all one needed was a few hundred dollars for a basic computer and Internet service. The web shattered barriers to entry and, suddenly, pent up demand for information free of non-progressive bias met an onrush of supply. Larry King: I've 'never seen a bias off the air or on'. Larry King said that in his 26 years of experience at CNN and 20 years of work in Mutual Radio, he's never seen evidence of media bias — never. "I worked at CNN for almost 26 years. I worked in Mutual Radio for 20 years. I've been in the business 57 years. I have never seen a bias off the air or on," he told Newsmax TV. The Golden Egg. As far as Bill and Hillary Clinton are concerned, the media's horizon of expectations is stunningly narrow. It encompasses on the one hand the belief that the "secretary of explaining stuff" is a national treasure beyond reproach, and on the other hand the expectation that the former secretary of state will be our next president. Stories that fall outside of this horizon are problematized, scrutinized, ascribed to partisanship, and read with the sort of incredulity reporters are supposed to apply to public figures such as the Clintons. Phil Griffin Claims Station Has No Ideology. Some viewers may raise eyebrows as to Griffin's assertion that he doesn't run a biased network. In 2013, MSNBC hired former Obama presidential adviser David Axelrod and former White House Press Secretary Robert Gibbs to provide political commentary across the network's programming. Media critic Howard Kurtz admitted that he is very troubled by having two Obama loyalists as network advocates. News Fails to Disclose Soros Connection In Shriver Report on Women. The Media Research Center reports that a report promoted heavily by NBC News Special Anchor Maria Shriver was funded by a ultra-left political group funded by George Soros. Earlier this week Shriver was all over NBC News and MSNBC to talk about a study titled "The Shriver Report: A Woman's Nation Pushes Back From the Brink." The promotion of the report also allowed Shriver and NBC News to portray President Obama as "sympathetic to working mothers." This push focusing on women we see throughout the media, not just on NBC, is nothing more than the media prepping the battlefield to elect They fall right into his lap: Journalists jump for jobs on President Obama's team. Journalism and open government groups have criticized President Obama for falling short of promises to increase transparency, but that hasn't stopped reporters and editors from gobbling up jobs in his administration. One of the latest to go from covering the administration to promoting it is Dorie Nolt, who left her job as education reporter for The Associated Press to become press secretary at the Education Department. She joins at least 22 other former journalists who have worked or who continue to work in the administration, according to White House announcements, ethics filings and media reports. When the press is a poodle. This nation's Founders had a special role in mind for the media in the constitutional arrangements they carefully constructed. It was to provide a fourth source of checks and balances on the potential abuse of power by the three branches of government, by virtue of journalists' independence and, if assured freedom of the press, their ability to expose and, thereby, to counter overreaching presidents, legislators or courts. The Framers of our Constitution didn't reckon on the American media in the age of Obama, however. Misreporting Underscored Mainstream Media's Malfeasance. Tragically, what we have today are mainstream media that put the socialist and destructive policies of the far left well before objectivity, professionalism or the welfare of the American people and actively promote those "progressive" policies while simultaneously working to discredit conservative and common-sense opposition. No better example of this mainstream-media malfeasance exists than the case of ObamaCare and thousands of liberal "journalists" at the networks, cable networks, newspapers and radio outlets who chose — out of loyalty to the president and his naively utopian nanny-state beliefs — to shill for a program they knew to be built on a foundation of lies from day one. 2017 and the End of Ethics. Will there be a scandal if the new political appointees at the IRS sic their auditors on Moveon.org? What will the Washington Post say should the new president keep Guantanamo Bay open for five more years, quadruple the number of drone missions, or decide to double renditions? [...] In other words, because for the past five years the members of the Washington press corps have abdicated their traditional adversarial role as watchdogs of the executive branch, can we still have watchdogs at all in 2017? If the next president falsely swears that his new health-care program will not affect citizens' current coverage, what consequences could possibly follow? Unanimous Journalist Panel: Media Lean Left, Exist in Socially Liberal Echo Chamber. Top journalists from The New York Times, NBC News and CNN acknowledged Wednesday [12/18/2013] that, generally speaking, the national media has a liberal bias," Politico's media reporter Dylan Byers noted in a December 18 post recapping a Politico Playbook breakfast discussion held earlier on Wednesday morning. More than one panelist opined that it's not just that journalists tend to be liberal on policy questions but that they live and work in environments which are socially liberal. Journalist Panel, Including CNN's Tapper, Agrees Media Has 'Liberal Bias'. [Jake] Tapper argued it's not so much a liberal bias as it is a bias rooted in personal experience. He said a "certain type of person becomes a reporter," and while he didn't want to generalize, he said most reporters haven't gone through the same kind of experiences most others have, and acknowledging that fact leads to some of the best reporting. Attempted Character Assassination of Breitbart Protégé Brandon Darby. Darby became an emerging voice of the center-right populist movement called the Tea Party after working undercover with the FBI to stop former comrades from killing Israel civilians and using firebombs to hurt law enforcement and stop Republicans from assembling at the 2008 Republican National Convention. Darby chose to testify in highly publicized federal trials against members of the far Left and they tried to destroy him for it — and they did so with the help of mainstream left-of-center media outlets. Journalists Place Near Bottom in Poll Ranking Public Respect for Professions. Continuing a decades-long trend, members of the media placed near the bottom in a poll which asked respondents their opinions of various professions. In the Gallup survey, TV reporters were barely more popular than advertising salespeople, state-level politicians, car salesmen, members of Congress, and lobbyists with just 20 percent of respondents saying they had a favorable opinion. They were tied with lawyers. Print newspaper reporters fared slightly better at 21 points. Stunner: Ed Schultz receiving big bucks from unions. Does MSNBC know that one of its hosts is receiving large amounts of money form an interest group whose political activities he covers? Does the network have any journalistic ethics guidelines at all? Elisha Krauss of truthrevolt.org presents the results of a search of Department of Labor archives showing the amounts of money Schultz has received from politically active organizations he covers. Dylan Byers: MSNBC Is Everything the Left Accuses Fox News of Being. Today Politico's Dylan Byers got tough on MSNBC with two posts calling into question the channel's journalistic credibility. Byers started the day by going after MSNBC host Melissa Harris-Perry for something she said over the weekend. Harris-Perry claimed Sunday that the term Obamacare was an attempt by white people to denigrate a black President. Byers pointed out that "Hillarycare" and "Reaganomics" seem like similar appellations and asked, in light of these, how "Obamacare" could be implicitly racist while the other terms are not. Liberal media's chickens [are] coming home to roost. [Scroll down] In other words, the shift of cable news viewers away from liberal CNN and radical left (Forward!) MSNBC is considerable. Unlike monopoly newspapers, cable news viewers have a choice, and they are finding that those who uncritically supported Obama are less trustworthy and therefore are changing their viewing habits. Unmistakably, there is a trend here. Now They Tell Us. After spending three years promoting ObamaCare lies, the media elite now scramble to get out of the way of a train wreck they helped cause. Their backpedaling would be funny if so many lives weren't at risk. A Death Panel Toldja So. My pal Steve Malzberg, now hosting a show on Newsmax TV, scored big this week with an interview with leftist journalist Mark Halperin — co-author of Game Change, and the former ABC News political director who once sent a memo directing reporters to be biased in their coverage of the Bush-Kerry election. Halperin admitted that Obamacare includes death panels — committees of bureaucrats who will decide when your life is no longer of value to the state. Politico: Dems Prep to Trash ObamaCare. It is no secret that the Democrat party is hemorrhaging support in the wake of the disastrous ObamaCare rollout. [...] Politico's Mike Allen was on MSNBC this week, saying that they are "hearing" that Democrats will be very aggressive against the program in Congressional oversight hearings next week. If Politico is "hearing" something, it means Democrats are trying to leak the information to the public ahead of the hearings. Politico and Mike Allen, especially, are simply another communications vehicle for the Democrat party. Why Obama can't wave away this scandal. [Scroll down] Consider the events that would have been unprecedented scandals in a Republican administration — with teams of reporters digging and scratching daily at every nook and cranny in every bureaucratic corridor — that have instead been covered dutifully but with relatively little passion and almost no follow-up. Why? Because it would have hurt Obama, Might the Establishment Turn Against Obama?. [Scroll down] Meanwhile, the bulk of the media, dominated by progressive executives and editors, along with their useful idiots the journalism majors, made protecting progressivism's new poster child and mocking or ignoring anyone who dared to challenge him their primary mission. [...] The leftist media majority, meanwhile, followed the Democratic Party's talking points right down the line, as they were hired to do. And the doomsday clock for American liberty that is ObamaCare was carefully concealed through the obvious and simplistic tactic of delaying much of the law's implementation until after Obama's re-election. Group Tied to Obamacare 'Trains' Journalists on how to Spin Obamacare's failures. Every dictator knows that if you want to stay in power, you absolutely must control the media. Having a robust, honest, independent media is an important aspect of maintaining a government accountable to the people. However, the Obama Regime has worked very hard over the years to gain a stranglehold on the media and it shows. Digging for News vs. Digging out Obama. As the Obamacare fiasco deepens and broadens, and one watches the panic enveloping Team Obama, which strategy looks more desperate: Defending the indefensible or savaging critics as somehow responsible for this mess? The spin control is actually amusing when you consider that it isn't Team Obama trying to influence the media. It's the media doing damage control for Team Obama. Other Scandals, Virtually Ignored By Big Media. Obama only looks "relatively scandal-free" when the media quit doing their job and choose to dwell in a wonderland of denial. The Obama Facade Cracks at Last. Only now — five years into his presidency — are we seeing some cracks in the protective shield surrounding President Obama, and then only after the abuse of reporters' privacy has been threatened. Mainstream journalists have not scrutinized his controversial policies, nor have they held him accountable for questionable actions that have caused outrage among fair-minded critics and produced irreparable harm to the nation. Some facts are irrefutable, but the president has, by and large, deflected all blame and few in the media have dared question his policies and actions. Obamacare's Media Mandate. [Scroll down] So the question is now, will the media agree that if Democrats were so thoroughly invested in Obamacare, they should now pay the price at the ballot box for its collapse? Will they conclude that different voices are needed to moderate their ultra-liberal view of America? Will they, as often as they have acquiesced in the blaming of George W. Bush for every Obama failure, now rebuke the latter as fiercely and frequently as they did the former? Fat chance. No, even should pigs sprout wings, the media will defend their myopic view of the Democrat and Republican parties; even to the political grave. Obama just got used to saying things that were never challenged. He was going to close GITMO was one of the early promises. He even signed an executive order to close it within a year. But GITMO is still open and will likely stay open the day that President Obama flies home to Chicago in early 2017. I'm not good at predictions but I can predict today that [President] #45 will inherit GITMO. He said that you could keep your own health care plan or doctor. [...] It looks like millions won't keep their insurance. Where was the media on both of these? They weren't doing their job. This is why he got away with making these statements. Obama Ex-Chief of Staff Joins CBS News. The incestuous relationship between the mainstream media and the Obama White House continues unabated with the announcement today [10/28/2013] that Bill Daley, President Obama's former Chief of Staff, is joining CBS News as a contributor. Ted Cruz's father equates 'liberal media' to communist propaganda ministries. The father of Sen. Ted Cruz (R-Texas) said that the "liberal media" in the U.S. has an "evil agenda" that reminds him of the "ministry of misinformation" in communist countries like Cuba. In an interview with radio host Glenn Beck, Cruz said that the media was interested in "destroying what this country is all about." The 10 Rules In The Establishment Republican Handbook. [#4] Trash conservatives, but hold your fire against Democrats: There's a reason that both John McCain and Mitt Romney fought harder against their Republican primary opponents than they did against Barack Obama. The liberal media applauds you for saying mean things about conservative Republicans, but they hate it when you go after Democrats. The New Nexus: Media Left And Republican Moderates. The government shutdown has made it abundantly clear that the anti-conservative news media and the anti-conservative Republican establishment have joined together to the point where it's almost impossible to see where one ends and the other begins. Wussies! Every Last One of You. The liberal media can't help themselves. They have a huge crush on the President. He can do no wrong. [...] There's something very dangerous about the liberal love affair with the President. Fear of asking the tough questions crushes accountability. And without accountability, tyranny follows. Drown the Racist Terrorists!: Media Ramp Up Rhetoric Against Right. With the government shutdown now entering into its third week, the frustration and rage among the media elite is manifesting itself in ways above and beyond the usual-usual hostile coverage. Just two years after launching the New Tone-era, media elites are now openly wishing conservatives dead while comparing them to terrorists, criminals, and segregationists. Who Created the Gerrymandered Media? New York Times media columnist David Carr thinks its shocking that some smart people don't want to read his paper or the Washington Post. He was amazed to learn in a New York magazine interview that Justice Antonin Scalia a man who is widely acknowledged, even in the saner precincts of the left, to be an intellectual giant, won't read either of them and that his daily sources for news are limited to the Wall Street Journal, the Washington Times and conservative talk radio. Media's Off-the-Record Meetings with the President Really Need to Stop. Earlier this year, President Obama privately sat down with the primetime lineup of MSNBC to talk about selling his tax plan to the American people. Those journalists, or pundits, or hosts, or personalities, or however [...] we define those who host cable news shows these days, weren't there for an interview, they were there for instructions. Jake Tapper Acknowledges Media Bias, Says 'White House Press Briefings Are Quite Often Useless'. One of the things many conservatives admire about CNN's Jake Tapper is his willingness to speak truths typically too inconvenient for most in his industry. Jake Tapper on media bias: Most reporters have never fired a gun, worked 9 to 5. Award-winning journalist and author Jake Tapper says most reporters' bias comes from being out of touch. TruthRevolt Will Make MSM 'Pay' for Lies, Change 'Nature of Media'. Shapiro said TruthRevolt will be billed as the "anti-Media Matters." He emphasized that Media Matters has tried to destroy the careers of conservatives who are truth-tellers and TruthRevolt will "turn that around and go after the liars of the left-wing" and the mainstream media. Weakness Does Not Make A Political Party. Boldness is the stuff of leadership. Many have argued that the Republicans must not risk bad press. This is the fear behind the call to not shut down the government. They allude to the days of Newt Gingrich fighting President Clinton. The Republicans will never receive good press unless they are attacking other Republicans. staff if they are 'intersex,' 'transsexual,' 'genderqueer,' male-to-female. The 60,000-strong Thomson Reuters media empire, in an effort to determine its diversity success, is asking its staff of reporters, researchers, marketers and others to pick their sex from nine choices, including "genderqueer," a category for identities other than man or woman. According to the company's annual employee survey, choosing a sexual identity doesn't have to be based on a worker's actual sex, but instead "a person's innate, deeply felt psychological identification." Dangerous Times: The Crisis-Monger. Obama thrives on crises, not solutions. That's the key to this whole administration. [...] He believes that politically he can't lose with a completely obedient media spinning everything his way. As long as Americans are suckered by our monopoly media, we will never solve any real problems. Instead, we will be drawn into phony crises instigated by Obama and the Democrats. Any real dangers, like nuclear proliferation and the Jihad War, will be ignored as long as Democrats are in power. The only permanent solution is to fire the mendacious media, and that is completely up to you. The World According to Andrea Mitchell. Now's a good time to bring this up as Mitchell, one of the biggest Obama supplicants on the boob tube, improbably receives the National Press Club's highest honor, the Fourth Estate Award, at a gala banquet tonight [10/4/2013] in the capital city. Mitchell is receiving the prize even though it is designated for "a journalist who has made significant contributions to the field through a lifetime of excellence." Wendy Davis was a media hero and Ted Cruz is a 'grandstander'. It's sort of hard to believe, but the Washington media is filled with people who maintain that the major mainstream news media in the U.S. does not have a liberal bias. I don't spend too much time on the broader "media bias" case, because it's too hard to litigate. Point out disparate treatment, and a bias-denier can just say "the cases are equivalent." But Ted Cruz is giving us a very good point of comparison. Press Hires Lefty Activist Chris Tomlinson, Gets Its Money's Worth. In July 2011, the Associated Press hired Chris Tomlinson to be its Supervisory Correspondent in its Austin, TX bureau. The AP's news reporting is supposed to be neutral and non-partisan, but Tomlinson is not. He came to the AP from a gig at the Texas Observer, which is the same lefty publication that was once the home of Media bias springs up after seeds like this are sown: with ESPN sportscasters. The president is golfing [9/15/2013] at Maryland's Andrews Air Force Base, just outside Washington, with Tony Kornheiser and Mike Wilbon, co-hosts of ESPN's "Pardon the Interruption" program. The Media Protect Obama Where It Counts. [Scroll down] Historically, the purpose of the press was to inform people. But the principal purpose of our laughably misnamed mainstream media is to prevent people from learning things that might not be good for them. Or, rather, for the Democratic Party. Stengel Is at Least the 21st Journalist to Work for the Obama Administration. Keeping track of how many reporters went to work under President Obama is tricky. Do you count those who had some other job in between reporting and the Obama administration? Enacting the Liberty Amendments. Without getting into the detail of the potential disputes over the procedures for an Article V convention, it is certain that, even if two thirds of the States were to call for a convention, it would be tied up in litigation for years. And if it was ever able to convene, it would likely turn out to be the largest convocation of leftist law professors ever assembled, who would dominate the media coverage and assure that no amendments would issue which would accomplish anything sought by constitutional conservatives. Super-Media! With the Power to Detect Non-Existent Racism. In order to immunize the most left-wing presidential candidate the nation has ever seen, the Non-Fox Media went into overdrive reporting their fantasies of an America full of racists, constantly terrorizing innocent blacks. Of course, once Republicans got the Democrats to stop terrorizing black people, there was no one else doing it. Nonetheless, for decades, the media would highlight every apparent white-on-black crime, treating each such incident as the Crime of the Century. Hillary Clinton, the Press, and the Permanent Campaign. When the media decides that something or someone is or isn't in the "public interest," it will inevitably abuse the elasticity of that category. When the media sees itself as responsible for enabling or resisting trends in American politics, it tends to take sides. It is not the fault of the New York Times that the 2016 presidential campaign seems already to be under way. Media's Cruz Derangement Syndrome: 'Creepy,' 'Abrasive,' Born in Canada. The attack on Sen. Ted Cruz (R-TX) has begun. Fearful of Cruz as a prospective Republican presidential nominee in 2016, the media is now digging into his past, all the way back to birth. The Editor says... Why didn't Barry Soetoro (a/k/a Barack H. Obama) get the same treatment? Media Target the Powerless; Protect Powerful Liars, Bigots & Race Hoaxers. Last week, a nobody shopgirl was globally defamed after one of the most powerful people in the world publicly accused her of racism. Today, Oprah Winfrey's tale of being victimized by this shopgirl has completely collapsed. Meanwhile, the media are too busy talking about Winfrey's Oscar chances to vindicate this poor shopgirl's honor or to hold Winfrey accountable for her behavior. Politico Publishes Media Matter's Attack On CNN's 'Rightward Shift'. You have to give it to Politico and Media Matters. What a genius stroke to team up for an Orwellian attack against CNN that accuses the network of a "detectable rightward shift." Though David Brock, founder of Media Matters, has all kinds of space of his own to spew propaganda, Politico apparently felt this particular editorial was important enough to host and promote on their own real estate. BBC 'is twice as likely to cover Left-wing news stories than Right-wing ones' claims study. Long-running accusations that the BBC is biased have been backed by a study that found it was twice as likely to cover Left-wing policy proposals as Right-wing ones. America's Three Worst Pravda Press Organizations. The competition for the most loathsome news organization in the U.S is fierce. Based on their offenses against the basic tenets of journalism seen during just the past two weeks, some of which would have made the propagandists at the former Soviet Union's Pravda blush, three lame losers — Politico, the Huffington Post, and the Associated Press — have emerged as leaders of the left agenda-promoting, Barack Obama keister-covering brigade. Politico is the trailblazer in frequently tailoring and even altering its coverage to minimize Obama administration embarrassment. Is Obama 'Insuring' Softball Questions? [Scroll down] American media executives, and American journalists, might have political positions with which we cannot agree, and they might not even appear sensible, but for the most part, they are still intelligent people. And they remember a lot of what they hear or read. They see how this administration has approached dealing with those it might view as "enemies." They have heard how a president's choice for the FCC views control of the media. [...] So perhaps we should view these media "softball" questions as a pre-emptive defense position. That would be the most charitable view we could take. Otherwise, we would have to conclude that the mainstream media are acting in collusion with the administration to undermine the Constitution of the United States of America. Andrea Mitchell: 35 Years of Liberal Advocacy. On July 31, 2013, NBC chief foreign affairs correspondent Andrea Mitchell celebrated her 35th anniversary at the network and was predictably praised by her media colleagues. [...] Given how consistently Mitchell has toed the liberal line throughout her career of slanted reporting, it's no wonder why MSNBC's left-wing hosts also heaped accolades upon her. Mitchell Reports': Five Years of Cheering Liberals and Slamming Conservatives. On Thursday, MSNBC host Andrea Mitchell celebrated five years of her 1 p.m. ET hour show, Andrea Mitchell Reports, with highlight reels and congratulatory messages from her NBC colleagues. The accolades for Mitchell followed five years of her using the program to routinely praise liberals and bash conservatives. Obama Visited Amazon 6 Days Before Founder Bought WaPo. While conservatives and liberals consider the political leanings of Washington Post buyer and Amazon founder Jeff Bezos in an attempt to divine how his politics will affect those of the historic institution, the truth appears to be far simpler: the Post is now Bezos' latest political tool in a crony capitalist effort to work with the Obama administration. 88 Percent of New Washington Post Owner's Donations Went to Dems. Amazon founder and chief executive officer Jeffrey Bezos has agreed to acquire the Washington Post for $250 million, the paper announced Monday [8/5/2013]. Although not a major political donor, Bezos' donation history skews Democratic — 88 percent of his donations since 1998 have been to Democrats. Bezos has donated $17,000 to political candidates during that period, with only $2,000 to In the mood for fiction? Wait for new projects on Hillary. When did the Clintons become the Kennedys? Just what the world needs is not one, but two movie projects on the so-called virtues of Hillary Clinton. Has Obama set the bar so low that Hillary looks like a good alternative? With left-wing Tinseltown celebs in the Clintons' back pocket, the chances of her scandals being included in the CNN film and the NBC miniseries now in the works are slim and none. The film either will be the best example of revisionist history during our lifetime or a two-hour episode of "The settled now; Hillary will be president #45. Well, it looks like we won't have much to write about here for the next three years. The media, which knows all and tells some, has proclaimed Hillary Clinton the definite Democrat nominee in 2016. Trayvon Martin tragedy to fit. I never thought the Trayvon Martin/George Zimmerman case deserved nearly the attention it got. But reasonable people can disagree about that. What strikes me as unconscionable, however, is the way the supposedly objective media have not only sensationalized a tragedy but at times appear to deliberately bend the facts to fit a desired story line. Zimmerman case hurt media's image. A Pew Research poll this month revealed that less than a third of Americans believe journalists contribute "a lot" to societal well-being. That's more in a continuing stream of bad news for the media. Unfortunately, the press has done little to improve that image with its coverage of Trayvon Martin's death. Instead, reporters took a tragic situation and sensationalized it [...] Fig-Leafs Dirty Democrats. In the rare times the networks report on Democrats snagged in scandals, they conveniently forget their party affiliation. Scandalous Republicans, in contrast, get ID'd 100% of the time. Poll: Media Out of Touch on Voter ID Laws, 83% Approve. Remember how, during the media's failed months-long crusade to push for gun control, the GOP was under siege 24/7 from left-wingers like Chuck Todd, Joe Scarborough, and Wolf Blitzer armed with polls that showed 80% wanted background checks tightened, including a majority of Republicans? [...] Well, guess what else is an 80-20 issue? Voter ID. Reporters Tell Obama His Ideas are "Great"? We have all heard about liberal media bias, but this is just over the top. [...] In his speech that lasted over an hour yesterday [7/24/2013], President Obama said reporters praise his economic proposals as "great and tell him that they are "all good ideas". The speech which droned on for what seemed like ages, presented no new ideas and was dismissive of serious concerns with his administration. Licensed to Smooch. How do we believe a word of anything we read (or hear or see) from the Licensed Media (or the "state-run media," as Rush calls them) if they are not counter-balanced by the Non-State-Run Media? "Trust us, we're professionals" is not exactly reassuring given their recent track record as information falsifiers and administration cheerleaders. It's time for 'journalists' to discover journalism. I was recently speaking with two editors from top-10 newspapers who by their own admission see the world from different ends of the political spectrum and yet both were bemoaning the state of their profession. One — a bit right-of-center — complained how more and more reporters and editors are putting their ideology before their duties as journalists and skewing stories and "news" accounts to reflect or enhance that ideology. Davis' Shoes and America's Ideologically Monochromatic Newsrooms. For better or worse, we live in a pretty balanced country. Yet when you look around the newsrooms and editorial boards of most major media organizations, this ideological diversity isn't remotely reflected. At the New York Times, The Washington Post, ABC News, NBC News, CBS News, if you were betting that three-in-four journalists were pro-choice Democrats, it would be free money. Equally important, these reporters and editors are just like most everyone else they know. Associated Press, You're Why We Can't Have a Nice Country Anymore. Obviously it's too much to expect that the AP treat any Republican fairly, let alone a conservative Republican from Texas. By accentuating the trivial, AP plays up irrelevance and minimizes politicians' actual records. That's no accident, as it tends to help Democrats who have built up records of failure by pursuing leftwing policy, and downplays the successes that Perry and other GOP governors such as Scott Walker and Bobby Jindal have had in pursuing smaller-government policies that actually work. Former Producer Rips MSNBC as Obama's 'Official Network'. Left-wing media critic Jeff Cohen has been all over cable news as a contributor, but for a time he worked as a senior producer for MSNBC. Monday [7/8/2013], in the wake of the NSA spying scandal, Cohen lashed out at his former employer as the "official network of the Obama White House." This isn't exactly news to the most of us, but MSNBC's water carrying for Obama's massive surveillance state apparently woke Mr. Cohen up. In the news business, bias leads to destruction. Not Even Democrats Like MSNBC, Poll Finds. [A recent Gallup] poll showed Democrats turn to television first for news at a 54 percent rate, well above the Internet (18 percent), print media (12 percent) and radio (4 percent), yet MSNBC was used by them at the same rate as National Public Radio (2 percent). Who's the most opinionated in town? MSNBC. Bias is hard to measure because, like beauty, it's in the eye of the beholder. But the Pew Research Center tried to put numbers on it and they've codified what everyone already knows. Bias is an art, not a science, and their conclusions won't settle many arguments. The folks at Pew set out to determine the network with the most obvious bias, what Pew calls the most "opinionated." The winner, and hence the loser in the race for the viewers the advertisers covet most, is MSNBC. Zimmerman and Obama. In the likely event that George Zimmerman is acquitted, it is also likely that there will be explosions of racial violence all over this country. Even in the event of a guilty verdict, it is possible in this emotional situation that there will be violent actions by those on all sides of this tense issue, whether white or black, liberal or conservative. Sensible folks should be frightened for the fate of our nation now as the Zimmerman case dominates so much of the media. Lehrer Reveals Decades of Liberal Journalists Assisting Democrats in Presidential Debates. It may be 2013, but the race for the White House in 2016 is already heating up. The eventual Republican nominee will have to deal with the liberal media assisting the Democratic candidate in the presidential debates. In his 2011 book Tension City, journalist Jim Lehrer recounts several examples of that happening from 1960 through 2008. Briefing, Reporters Don't Ask Obama a Single Question About Scandals. During his flight to Africa aboard Air Force One, President Obama headed to the part of the plane where the travelling press corps was seated and held an impromptu news briefing. Despite the many scandals currently swirling around the administration including NSA spying and lying, Benghazi lying, and the revelation that the IRS's political attacks on conservative groups was even more widespread than originally thought, the left-leaning journalists did not ask Obama a single tough question. The Obama White House Tapes. [Scroll down] But a detailed examination of the videos reveals [IRS Union Chief Maureen] Kelley's eye-opening description of how the federal bureaucracy really works. A statement that was echoed separately by [ABC senior correspondent Claire] Shipman in her "Breakout Session 2." Unwittingly, they confirm exactly the charge made by an anonymous IRS official in Cincinnati that "everything comes from the top." A close look also reveals a stunning admission from [Cokie] Roberts of her own influence in the Obama White House as she openly boasts about directly influencing policy through Valerie Jarrett. Gallup: Less Than One Fourth of Americans Trust Newspapers. A new poll on newspapers and television news shows that Americans' confidence in the news industry continues to erode in this era of mass communications, reaching a low not seen since 2007. [...] Naturally, liberals trust newspapers more than conservatives. How Democracies Perish, Deathbed Edition. Paradoxically, the totalitarian world's great advantage in its cultural assault was the openness of the democracies themselves. Specifically, our free press became the communists' best weapon, as it gave them a strategic advantage: [...] Everyone saw freedom's warts, blunders, and impurities; from the totalitarian world, there were only declarations of purity and superiority, supported by apologetics from Western intellectuals, and mitigated only by vague, unsubstantiated rumors of secret police, repression of political opponents, and other implausible-sounding evils. [...] Today's Western totalitarian propaganda apparatus, still operating under its former, respected title, the "news media," functions on precisely the same mechanisms as the Soviet or Chinese propaganda operations described by [Jean-François] Revel: suppress, obfuscate, dilute and, when revelation seems unavoidable, delay. Obama's Climate of Intimidation. Both parties constantly make accusations that their rival is engaged in hypocritical, unethical, or illegal behavior. Given the drastic lack of ideological diversity in the American elite media, the general public usually only hears about such accusations against Republicans. Beyond the fact that biased reporting shapes public opinion to favor the left, it may also have an effect on law enforcement. The persistent lies that have been told about right-leaning political groups by leading Democrats, including President Obama himself, may have led to the IRS abuses of power that we've heard so much about in recent weeks. another arrest-ridden liberal protest gets the atta-boy from national press. The coverage of the Tea Party, especially racism charges, is meant to discourage home-schooling moms and flat-tax dads from getting involved and to put off possible newcomers. The press largely finds it distasteful when conservatives voice their beliefs in public and would like them to keep it as quiet as possible if they feel the need to talk at all. The persecution of Tea Party groups at the hands of the IRS institutionalized this message. One method was unfair and unethical; its ensconcing in the halls of government power was unconstitutional. But make no mistake about it. Neither is merely a mistake. Post: Family Relations Between Media, Obama Officials Does Not Affect Coverage. Let's start by going through the Post's article to create a list of journalists married to or closely related to officials within the Obama administration. The size and scope of this is bad enough. But what is most troubling is how high up this incest occurs in the worlds of both the media and the Obama administration. Progressives in the Media Ignore Uncomfortable Facts and Justify Their Bias. [Scroll down] Progressives don't want a level playing field, they want to disqualify their opponents at every opportunity so they can win unchallenged. Look at Obama. How did he win his first few elections in Illinois? Simple — by getting his opponents disqualified or playing dirty pool by unsealing divorce records to force his opponent to drop out so he could run unopposed. So it's no surprise at all that an Administration under Obama's direction almost immediately turned to trying to disqualify the opposition. Is this the result Media Fail to Break Even One of Four Obama Scandals. Over the past few weeks, four major scandals have broken over the Obama administration, and it is a very sad (and frightening) truth that our pathetic, American, lapdog mainstream media is not responsible for breaking even a single one. It's the Power, Stupid! Because the media work with the government in order to get their stories, they have an amazing amount of influence. The MSM (Main Stream Media) reporters are essentially the friends of the politicians; and we all know what influence friends can have on people. Additionally, since MSM reporters are almost all liberal they envelop the candidates in a cloud of liberal "reality"; in liberal reality when hundreds of thousands of people march in the dead of winter in DC for the right to life of every unborn American nothing really happens. the Latest Obama Scandals Robbed Liberal Media of Their Favorite Defense. The biggest problem for Liberals in these current growing Obama scandals is they have been robbed of their usual favorite defense/justification of Obama: "Bush did it too!" Perhaps you've seen this yourself over the past 4½ years. Quietly Gather at White House. NPR's Ari Shapiro posted an interesting Tweet on May 21. He discovered that a cadre of well-known lefty columnists and journalists visited the White House together, three of whom he mentioned by name. who spin for Obama are getting lonely as scandals pile up. Hard as it is to believe, there are still Obama administration loyalists out there in the media insisting scandals are not scandals. These are just bad facts (e.g. auditing tea partyers, spying on reporters, creating a false narrative on Benghazi) on which Republicans "seize" to attack the president — for doing things like politicizing the IRS, the Justice Department and national security. [I]t doesn't quite make sense, but their job, you see, is to keep spirits high on the left and defend and deflect criticism of the White House. Counting on a Double Standard. While not licking their chops at the thought of tearing into the president's aides about the IRS scandal, the Justice Department's fishing expedition into the AP's phone records, or Benghazi, they're asking a salient question of journalists: What would you do with this material if it was George W. Bush or Dick Cheney who were accused of lying about a terror attack, infringing on the rights of the press, or selectively enforcing the laws to punish political opponents? Media Performance Of Late Is Largely Due To Left-Wing Bias. One reason the major television and cable network news outlets get it wrong so often is because they sometimes would rather be first rather than right.[...] Another real reason they get so much wrong is because of their left-of-center bias. As we have seen time and again, the television news networks that lean left of center, such as CBS News, ABC News, NBC News, MSNBC, and CNN — there is not enough room to list all of the newspapers in the tank for the left — will give President Obama a pass for the exact same issues they targeted President George W. Bush. Be those issues golf outings, uttering factual mistakes or even foreign policy parallels. 'Today' Host to Marry Longtime Democrat Operative. The warm fuzzies were everywhere as "Today" co-host Savannah Guthrie announced on-the-air that she was officially engaged to her boyfriend of four years, Mike Feldman. Al Roker made jokes, Matt Lauer beamed like a proud poppa, the blushing bride-to-be flashed her ring... But what wasn't revealed is just who it is one of the most powerful women in media is marrying. Mike Feldman is a long-time Democrat operative. Earthquake: Did Carney Presser End MSM Monolith? Do not underestimate the significance: the Obama administration has not faced such an onslaught of truth-seeking since he took office in 2008, and further, no Democratic administration has been charged from all sides like this in recent memory. That press conference was unthinkable just days ago. Presidents of ABC and CBS News Have Siblings Working at White House With Ties to Benghazi. "CBS News President David Rhodes and ABC News President Ben Sherwood, both of them have siblings that not only work at the White House, that not only work for President Obama, but they work at the NSC on foreign policy issues directly related to Benghazi." So stated political consultant and media commentator Richard Grenell on Saturday's Fox News Watch. News President and WH Official Tied to Benghazi Scandal Are Brothers. One of the mainstream media journalists whose pursuit of the truth has been truly tenacious and nonpartisan is CBS News' Sharyl Attkisson. Her tough reporting has made life difficult for everyone from Hillary Clinton to the Bush administration and Congressional Republicans. She's also been relentless on the Obama administration's Fast & Furious gun-running scandal — and, of course, Benghazi. As we mentioned this week, Attkisson's tough investigative journalism is starting to bother unnamed CBS News executives. Obama official's brother is president of CBS News, may drop reporter over Benghazi coverage. The brother of a top Obama administration official is also the president of CBS News, and the network may be days away from dropping one of its top investigative reporters for covering the administration's scandals too aggressively. CBS News executives have reportedly expressed frustration with their own reporter, Sharyl Attkisson, who has steadily covered the Obama administration's handling of the Benghazi terrorist attack in Libya since late last year. The Sovietized American Media. What happened in the Soviet media was the systematic suppression of all real news and a purging of all serious intellectual inquiry. All news made the party leaders look good, or it simply wasn't news. All facts supported the theme that the latest Five Year Plan was working marvelously, whatever the clear facts of ordinary Soviet life might say to the contrary. [...] Isn't that the way things are in America today? Gun debate triggered media bias. If you thought President Obama was outraged after the Senate killed the plan to expand background checks on guns, you should have seen some members of the press. Even by the standards of today's partisan media environment, the response has been noteworthy. [...] The decision by some members of the media to come down so firmly on one side of a policy debate has only served to reinforce conservatives' longstanding suspicions that the mainstream media has a deep-seated liberal bias. The Top 50 Liberal Media Bias Examples. [#47] Anti-Christian Bias: There is, of course, one religion that the Old Media attacks with regularity: Christianity. The anti-Christian bias in the media is endemic. [#49] Abortion: Once again, this is one of those issues where the media presents "experts" to legitimize a story on abortion but those "experts" are always members of left-wing think tanks or abortion advocates like Planned Parenthood. Naturally, these "experts" are never identified for their bias. The media has gone out of its way for years to push the liberal agenda on abortion. The Curious Case of Kermit Gosnell. If there was ever a case of clear-cut media bias and cover-up, this is it. about "Doctor" Kermite Gosnell's news media coverage here, and more about his crimes here Know Thy Enemy II: the Media. The throng known as the "main stream media" has lost far more than its neutrality; it's also lost its institutional memory. While there isn't a journalist on or off payroll who can't recite his First Amendment rights verbatim, they seem to have collectively forgotten the responsibilities that accompany those rights; i.e. reporting the truth without regard to their personal political, religious or secular beliefs and inclinations. Guns Responsible for Global Warming. For every issue there is a narrative: a set of assumptions and boundaries of thought with which every story (and editorial) is tailored to agree. False narratives usually serve the left well. For over eighteen months, American politics was forced into as media narrative tat [sic] ignored everything else and focused on Obamacare which, we were told, would make health[ ]care cheaper and more available, the precise opposites of its effect. For months before that, we were told Obama's "stimulus" would create tens of thousands of jobs and get our economy growing. It did no such thing, but the media narrative helped it become law. Can You Imagine the Coverage If It Were Puppies? It is fascinating how much of a bubble the media lives in with that bubble so DC-NYC centric. It is again one of the problems for news organizations like CNN as it tries to rebuild. [...] In churches, local restaurants, and small town hair salons a lot of people across the country are talking about the terrible trial of Kermit Gosnell in Pennsylvania. It's just not the people who interact with those who produce the news in New York City. Working Up to Auschwitz. A demon has been revealed in twenty-first-century Philadelphia, and the three broadcast networks have been enforcing a policy of silence about the discovery. So have most major America's Economic Disconnect. The state of our economy has become a constructed fantasy created largely by mainstream media (MSM) narratives. Media accounts of economic performance over the past four years have ranged from confusing to inaccurate to flagrant happy talk and spin. Rationalization and selective reporting have created economic 'good' news and false 'hopes' where none existed or should exist. The techniques employed have included consistently biased memes, factual omission, factual commission, and even misdirection. Why They Won't Talk About Kermit Gosnell. You may not have heard much about Gosnell's case. That's because the mainstream press has chosen by and large to ignore it. There is no area of American politics in which the press is more activist or biased or unethical than social issues, the so-called culture wars. The Media Can't Bury McConnellgate. While the Watergate scandal may have been more about the cover up than the crime, the line crossed by Nixon's henchmen has always appeared to be a bright line that no one — not even liberals who can generally count on favorable media treatment — dare cross in this country. Yet someone or some group may have done so in Kentucky, and if that explanation of what happened at Senate Minority Leader Mitch McConnell's Louisville office holds up what follows will be an interesting test of the media's integrity. MSNBC's Touré founded militant anti-white student paper. MSNBC host Touré founded a student newspaper dedicated to black liberation theology while he was a college student attending Emory University from 1989 to 1992. Touré's flagship publication, The Fire This Time, lavished praise on famous anti-Semites, black supremacists, and conspiracy theorists whom Touré helped bring to campus. Before he became an intense-but-sardonic TV personality, Touré also decried "the suffocating white community" and defended a nationally famous fake hate crime. Shame On The AP For Surrendering To Left-Wing Language Policing. The Associated Press has rolled over in the face of political pressure and dropped the term "illegal immigrant" from their style guidelines. They have implicitly accepted the liberal notion that using the term outside the context of an action is offensive. "No human being is 'illegal,'" immigration activist Jose Antonio Vargas recently wrote. Apparently, the AP agrees with this fatuous, self-obsessed interpretation of the generations-old descriptor. bans the phrase 'illegal immigrant'. "It's 'illegal immigrant' no more" says the Associated Press, which banished the phrase from its usage guide on Tuesday — the latest stylistic edict for journalists who have for years juggled such terms as "undocumented worker" or "illegal alien," its politically incorrect variant. "The Stylebook no longer sanctions the term 'illegal immigrant' or the use of 'illegal' to describe a person. Instead, it tells users that 'illegal' should describe only an action, such as living in or immigrating to a country illegally," said the senior vice president and executive editor Kathleen Carroll. On 'Illegal Immigrant' Undeniably Political. It's no coincidence that a major mainstream wire service is banning the term "illegal immigrant" just as immigration reform gathers steam in Congress. The "P" in AP must stand for "Politicized." Jay Leno described it best, on Tuesday's "Tonight Show." The comic noted that "the Associated Press, the largest news-gathering outlet in the world, will no longer use the term 'illegal immigrant.'" Instead, "they will now use the phrase 'undocumented Associated Press Revises Another Politically Charged Term. Following on the heels of the Tuesday [4/2/2013] decision by The Associated Press to discontinue use of the term "illegal immigrant," the news agency on Thursday revised its stylebook entry for another politically charged term. The term "Islamist," the AP clarified in a Thursday afternoon alert to online stylebook subscribers, should not be used as "a synonym for Islamic fighters, militants, extremists or radicals." The reporters who banned "Illegal Immigrant". File this in the overflowing cabinet labeled: No Wonder the Mainstream Media Is Dying. On Tuesday [4/2/2013], the Associated Press announced that it is banishing the phrase "illegal immigrant" from its famous stylebook. The world's largest newsgathering outlet now advises reporters that "illegal" will "only refer to an action, not a person." AP directs writers not to use the terms "illegal alien, an illegal, illegals or undocumented" anymore, except "in direct quotations." It won't be long before illegal border crossers, illegal visa overstayers, illegal deportation evaders, document fraudsters and illegal alien traffickers are all referred to as "our fellow Americans." Without the quotations. Mark my words. Marriage Is the Media's Vehicle, Destination Is to Destroy the Church. If anyone wants to argue that the same government currently forcing religious institutions to purchase the abortion pill through ObamaCare will not eventually use civil rights violations in order to attempt to force the Church to perform same-sex marriage ceremonies — good luck with that. But this would have been unthinkable five years ago. Disney CEO defends ABC, ESPN against shareholder's complaints of liberal bias. Disney CEO Bob Iger defended the reputations of ABC News and ESPN at the company's annual shareholders meeting on Wednesday [3/6/2013] after one shareholder accused both networks of contributing to liberal media bias and the nation's declining trust in the media. Sharp Left Turn Began With Education Takeover. Realizing that they could actually influence the national polity, including elections, the media abandoned any semblance of journalistic balance and became shameless mouthpieces for liberalism, the Democrat National Committee, and any political cause or candidate of the political spectrum's left side. National reporters and news anchors have descended to the level of overt cheerleaders for the left. They blatantly run interference for Barack Obama, even to the point of abetting the cover up of major scandals such as Benghazi. Why Liberals Still Detest Fox News. More than 16 years after its founding and 11 years after it assumed its current perch as the most-watched cable news network, Fox News remains the favorite punching bag of the left. Liberals take it as an article of faith that Fox is not merely biased but a travesty that serious people should ignore. But the notion that there is something unholy about what is broadcast on Fox or that its mix of news and opinion is uniquely biased has never stood up to scrutiny. Media's Dirty War Of Words Against Pope Francis. The left has been trying to paint the new Pope Francis as someone with a dark past dating to Argentina's dirty war. One problem: Their allegations are falling apart. So now it's all about endlessly repeated innuendo. Coverage Almost Entirely Opinionated, While Fox News Includes More Factual Reporting, Study Says. True to its motto, MSNBC has been leaning forward. To the point that its opinionated programming far outweighs its "factual reporting," according to a new Pew study. While Fox News, too, had more opinionated programming, the network had a much smaller discrepancy between opinion and MSNBC Has Become Almost Entirely Saturated With Opinion. MSNBC's programming became almost entirely full of commentary and opinion in 2012, while "factual reporting" saw almost no airtime, according to a new report from the Pew Research Center. The report, which is part of Pew's annual comprehensive State of the News Media, found that opinion and commentary fill 85 percent of the airtime on MSNBC. The network only devotes 15 percent to "factual reporting," according to the Pew study. More reporting, less punditry. According to a new survey done by Pew Research for its Project for Excellence in Journalism, most of the major "news" networks are more opinion than reporting. MSNBC is the most opinionated network by far. About 85 percent of its programming is opinion, which media analyst Howard Kurtz reminds us "is cheaper to produce than reporting." The political media's declining power. A new Pew report on the state of the media exposes one of the worst-kept secrets in politics: reporters are losing their power to frame presidential contests for the average citizen. Must Be Prepared to Answer Obama's Lies and Deceptions. [Scroll down] Along with confiscating as much wealth as he can get away with, Obama believes that the tax code should be about punishing achievers and controlling behavior. Assisted by the media, Obama sells his perverted definition of "fairness" to low-info voters. Anyway, Obama knows that the mainstream media usually acts as his personal public relations firm, eagerly selling his lies to the public. shocker: Some voters still trust the news media. It may be hard for many educated voters to believe, but fully six out of every 100 Americans still find the news media Very Trustworthy. That compares with a proportion twice as large (12%) who find the country's professional deliverers of news Not At All Trustworthy. A new Rasmussen Reports survey of 1,000 likely voters reveals that more than four-of-ten Americans (41%) believe the average media reporter (and most of them are average) is more liberal than they are. Know Thy Enemy III: Celebrity Culture. In 1983, 90% of American media was owned by 50 companies. By 2011, that same 90% was controlled by just 6 corporations. The new Big Media cartel has given us a huge number of outlets, all controlled by a few corporate entities. This serves to give MSM the illusion of programming diversity without actually having to present any content with different points of view. Obviously this creates a concern from a journalistic standpoint — as the right wing has been arguing for years, and the left wing has been Goodbye to a Very Green Business Week. In the February 18-24 edition of Business Week, an editorial, "The Right Way Forward on Climate Change", contained this gem: "Still, the U.S. accounts for about 19 percent of all emissions — emissions that are causing global temperature increases, rising seas, and destructive droughts, floods, and hurricanes, according to a government advisory panel report released last month." When a magazine publishes such drivel, you should not read it. There are no rising temperatures Bob Woodward Retreats: Death of the Free Media. I have to ask with all due respect where has Woodward been all these years when scores of journalists and citizens have been threatened, marginalized or smeared by their government for daring to speak truth to power? During the Clinton era that would include anyone who dared to challenge the official narrative during the investigation into the death of Vince Foster or Oklahoma City bombing. Remember how Chinagate and Pardongate were shut down? Did Woodward not see how people were trashed during impeachment? someone mention Vince Foster and the Oklahoma City bombing? Know Thy Enemy II: The Media. The fuss over Fox's (admittedly) rightwing editorial orientation is surprising in face of the fact that they're outnumbered 6:1 by left leaning alphabet TV news outlets — ABC, CBS, NBC, MsNBC, CNN, PBS — 8:1 if you count TMZ and Comedy Central as news sources, which many do [...] media's approach to Rand Paul's filibuster: pretend it never happened. [The] front pages from some of the dominant newspapers in America provide a textbook example of mainstream media control over political dialogue in America. The media's playbook is simple: For Democrats, elevate good stories and bury bad ones. For Republicans, elevate bad stories and bury good ones. Because the drive-by media is no longer interested in reporting news, but only cares about obtaining outcomes, it is up to us [...] to offset the media hegemony. Our Father, Who art in the White House. Do you accept Barack Obama as your Lord and Savior? Chris Rock does — calling him our father, who art in the White House. The media does as well. [...] To the media, the man can do no wrong. He is universally portrayed as successful, moderate and bipartisan, when he has not one single measureable success, is probably the most left-wing president the nation has ever elected, and has 'reached across the aisle' only to publically slap those who have dared to disagree, or beneficently allow them to do as they are told. President Obama divides and strongarms. [Scroll down] In an earlier, better age, enterprising journalists would be curious about who in the White House conjures these fictions that are then foisted on the American people in the name of the president. They would dig for the work shop and roster of aides tasked with the job of misleading the nation. Not now. Now outright lies are considered business as usual, at least as long as Barack Obama is the beneficiary. Sen. Reid to the Press: 'You Guys Have an Obligation to Report' that Democrats Are Right. Senate Majority Leader Harry Reid (D-Nev.) said Thursday [2/28/2013] that the news media have an "obligation" to report that the Republicans are "unwilling to do what the American people want done" on looming automatic, across-the-board budget cuts. The Media Threat to Democracy. Today, the mainstream media — ABC, NBC, CBS, MSNBC, CNN, the New York Times, the Chicago Tribune, the Boston Globe, the LA Times, Newsweek, Time, and all the other mainstream media outlets — are unabashedly liberal. They have also been integrated into the inner workings of the Democratic Party and the United States government. The Obama administration tells the mainstream media what to report and how to report it. We now have a government-controlled press, not a free press. The Oscars, the Obamas and Camelot. The Obamas are the beneficiaries of a media whose liberal bias is beyond doubt. They also have a skillful staff that is ruthlessly manipulative and takes full advantage of social media and creative tactics. But mere bias and smart tactics don't fully explain it. No president or presidential family has been treated by the mainstream media with the sort of deference if not reverential awe the Obamas get since John F. Kennedy and his beautiful wife were in the White House. Bill Plante: Obama Administration 'Undercutting First Amendment,' 'It's State-Run Media'. Bill Plante, CBS News Senior White House Correspondent, made a rather shocking statement Sunday [2/24/2013] about the Obama administration's media strategy. Appearing on CNN's Reliable Sources, Plante said that to the extent the White House is able to "put out their own material" without the Washington press corps, "they're undercutting the First Amendment...it's state-run media". Gibbs and Axelrod pushing 'propaganda' on MSNBC. CNN's "Reliable sources" host Howard Kurtz and Baltimore Sun TV critic David Zurawik debated on Sunday [2/24/2013] whether MSNBC's hiring of former Obama officials Robert Gibbs and David Axelrod is punditry or propaganda. "Two of President Obama's fiercest and most visible defenders are now becoming television pundits," Kurtz said, asking Zurawik, a frequent "Reliable Sources" guest, about the move. Liberal Bias Central to Obama Media Edge. No matter how smart the strategies employed by the White House, the president's ability to skate through four years without getting seriously challenged by the mainstream media would not have been possible if most of those being played were not willing accomplices. Due credit must be given to the administration's ability to take advantage of technology as well as their brilliant if unscrupulous game playing with journalists. But without the liberal bias of most of the mainstream outlets that let the president play them like a piano, he would come across as a bully and a demagogue rather than the reasonable nice guy seen in those "60 Minutes" interviews he loves to give. Enforcing the Liberal Media Omerta. A basic rule of life: If you volunteer to be somebody's doormat, you forfeit the right to complain about the footprints on your back. The White House has merely exploited the unabashed fandom of the journalistic elite, which is so overwhelmingly liberal that they were only too happy for the opportunity to publish daily valentines to their presidential heartthrob. Magazine Hired Dem Lobbyist 'Media Specialist' to Get Obama Interview. Author Steve Brill claims that the New Republic magazine hired Democratic lobbyist "media specialist" Anita Dunn to help secure an Oval Office interview with President Barack Obama. The magazine ran the interview, which was in part conducted by former Obama campaign aide Chris Hughes, who now owns and publishes the New Republic, on the cover of their re-launch issue earlier this year. Obama's obedient lap dog. For more than four years, the fawning mainstream coverage of the president has been a national disgrace. The only standard was a double standard, and Obama accepted the adoration and demanded more. Never lacking in self-reverence, he came to believe that he can arbitrarily set the terms of news coverage, and cleverly uses carrots and sticks to get his way. He doles out interviews and chances to ask questions at news conferences to organizations whose coverage flatters him and promotes his agenda. and NBC News: Is journalistic integrity dead? The truth seekers have gone, the truth tellers are rapidly dying off. The "news" is little more than political campaign for a particular party. Every subject is skewed and skewered to the point that everything you see hear and read should be taken with the proverbial "grain of salt." A recent article on the popular progressive website Politico refers to Obama as a "puppet master", calling him "a master at limiting, shaping and manipulating media coverage of himself and his White House." While this states the obvious, they go wrong in their claim that the media is powerless to do anything except parrot White House press releases and accept them as cold hard facts. Whatever happened to questioning the "facts"? Chuck Todd: It's 'Mythology' That MSM Hostile To Conservatives. Chuck Todd can't imagine what could ever have given conservative politicians the idea that the MSM is unfriendly to them. columnist resigns after Kentucky paper refuses to run op-ed on publication's liberal bias. The lone conservative columnist at the largest and most influential newspaper in Kentucky says he quit writing for the paper because editors are refusing to publish his opinion piece calling the publication out for its apparent liberal bias. Columnist John David Dyche told The Daily Caller Monday [2/18/2013] that he's written for the Louisville Courier-Journal for about a decade and his column had never been rejected until last week. And Gibbs Deny 'Pro-Obama' Allegations. MSNBC's hiring of former high-ranking Obama staffers David Axelrod and Robert Gibbs once again puts the network in the position of having to defend itself against allegations of being decidedly "pro-Obama" in its reporting and analysis. Speaking with CNN's Howard Kurtz this morning [2/21/2013], the two pushed back against such accusations and instead claimed the mantle of "independent analysts." Extreme media alert. The insurance industry appears to be behind all the hype of extreme weather. Oops, your racism is showing. The New York Times and Washington Post have been called out for what grievance industry types like to call racism — treating a person of minority ethnicity more harshly than members of the dominant ethnicity. And the target, unsurprisingly, is Ted Cruz, the brilliant and tenacious new senator from Texas. Make no mistake: Ted Cruz is a serious threat to the liberal establishment because he is so damn smart and has the intestinal fortitude to stand up and call out Ted Cruz deserves cheers, not jeers. Imagine a new senator who ran a campaign of "no more business as usual." No more special interest politics, no more backroom deals — and he won. He came to Washington, and he delivered. He didn't stay quiet, he spoke passionately for what he believed in, and he made it clear he planned to shake up the status quo. How would the media react to a senator like that? Nothing but praise for standing his ground, right? Media dogpile on Ted Cruz. Freshman Sen. Ted Cruz R-Texas is breaking china in the Senate — and the media is responding. Here are the latest media stories and columns in just 24 hours — reacting to Cruz's Tea Party firebrand behavior — and fretting about his lack of comity in the Senate. The Editor says... If the media liked Ted Cruz, I would be deeply disappointed with him. That Ted Cruz Is So Canadian. As Bryan Preston and Stephen Kruiser noted last week, the liberal media has mounted a campaign to destroy Sen. Ted Cruz (R-Texas). He's a high priority target because he goes against everything the media has said about the Tea Party, and conservatism in general. For all the talk about the Tea Party's anti-intellectualism, Cruz received his B.A. at Princeton University, and his Juris Doctor at Harvard University. He also clerked for Chief Justice William Rehnquist. Our Incorrigible Media. For the last several weeks, as you are no doubt aware, the Washington Free Beacon and other news outlets — most of them conservative — have been investigating secretary of defense nominee Chuck Hagel's positions, finances, associations, career history, and utterances. Which seems to us to be precisely what you would expect an intrepid and creative and entrepreneurial press to do when the president of the United States nominates a controversial former senator to one of the most important cabinet posts in the land. Media Cover Up True State of Our Union. Even though Obama has failed miserably when it comes to managing the economy, and things have only gotten worse during his watch, the American media has spent the last two years intentionally covering this fact up. Instead of reporting on and pressuring the White House to solve a problem afflicting tens of millions, the media prefers to work in tandem with the White House to manufacture divisive distractions that boost his standing. Post Hires Lobbyist Hilary Rosen. The Washington Post has announced that it is adding Hilary Rosen, a long-time Democrat operative, attorney, and lobbyist, to its editorial pages. Rosen will join a parade of liberals and Democrat operatives, one Republican operative, and others as one of the "Insiders" writing daily political commentary. remember Hilary Rosen, don't you? Dreams From Our Fathers: Obama Resigns. [Scroll down] The left-wing media, still dominant in the United States, is a puzzle to say the least. They ought to possess every motivation to encourage both an economically strong nation in and about which to cover and live, as well as a militarily strong nation to protect their behinds from annihilation (as well as their jet-set vacation spots). Yet, they have become so enamored of a black man in the White House that he can do anything he wants regardless of the potential or actual consequences. Reasons America Is Becoming An Increasingly Nonfunctional Society. [#5] The mainstream media has become so partisan for the Democratic Party that it's not significantly different from a state-run media. Every news story and scandal is reported differently based solely on which party is involved. "Scandals" that would destroy the careers of Republicans are largely ignored and treated as irrelevant when Democrats are involved. You Don't Need a Weatherman to Know Which Way Journalists Blow. Remember back in what was it — 2006 or thereabouts — when left-leaning critics of President Bush couldn't stop talking about how nothing was more red, white, and blue than good old-fashioned American dissent? Why, our very country was founded by an act of dissent, didn't you know! [...] Those were good times, friends, and they stopped pretty much the minute that liberals and Democrats took control of the federal government. The antiwar movement disappeared once it became clear that Barack Obama wasn't going to shut down Gitmo or stop bombing places or [care] about that constitutional stuff he used to teach in law school. City: Why the Media Don't Care About the Poor. The media is intentionally protecting Barack Obama at all costs (see: cover up, Libya), and the media is populated by hive minds terrified of what might happen should they jump off the Narrative Plantation and actually report on the state of the economy. But via Glenn Reynold's Instapundit, we learn a third reason the media doesn't care about those struggling in Obama's economy: Washington DC has become the Imperial City. Steve Capus Oversaw 'Erosion of Journalistic Values'. You would think five documented instances of outright journalistic fraud from a single news division would result in a little more outrage from our journalistic overlords. You would also think that those who believe in the ethics of their profession would speak out, or that those with competitive instincts would leap at the opportunity to ding a competitor. But media has its own version of a the Blue Code of Silence. Why I'm Canceling My SI Subscription. I am going to let my subscription to Sports Illustrated lapse when it runs out this year. I hope lots of other people will do the same. Like too many other publications, the magazine has become dishonest, dishonorable and even occasionally despicable in its conformist, lockstep left-wing bias. Republican politicians and conservative positions are routinely insulted in articles having nothing to do with either. Door Spins Again: Boston Globe's Glen Johnson to Kerry's State Department. Glen Johnson, formerly the politics editor for Boston.com, the website of the Boston Globe, has become the latest journalist to join the Obama Administration working as a senior adviser for new secretary of state John Kerry. In a hilariously self-unaware press release, Kerry is quoted touting Johnson's supposed neutrality. Counting the Ways the Media Lies About the Economy. Pop quiz: What was the biggest news story this week? And I don't mean, what was the biggest news story according to Obama's media. Obviously, it was the economy taking a nosedive into negative territory last quarter, along with the fact that hardly enough jobs were created last month to keep up with population growth. Oh, and the unemployment rate increased. Of course the economy is the biggest story; it affects the most people and Obama's doing it wrong. But not only is the media never-minding the economy, much of the media coverage related to economic bad news is forever being spun into good news. On Bias, Yet Again. Any statement which helps Obama is deemed presumptively true by liberals. No fact-checking needed, no skepticism applied; if it helps Obama, then it must be true, right? Did Fox News make liberal media bias worse? If the 2012 elections taught us anything, it's that liberal media bias is alive and well — and effective. David Fredosso is out with a new book on the subject, called: "Spin Masters: How the media ignored the real news and helped reelect Barack Obama." As he notes in "Spin Masters," the establishment media seemed more concerned about Mitt Romney's dog Seamus and allegations that Romney gave someone a forced haircut, decades ago — than about Benghazi — or the fact that an Obama-authorized drone strike killed a 16-year-old American. What Difference Does It Make? Every day brings news that would be utterly different had Mitt Romney won the 2012 election. To answer the question Hillary Clinton recently posed to the Senate Foreign Relations Committee in another context: The facts on the ground make all the difference indeed. Even the dimmest New York magazine blogger ought to be prepared to admit that a hypothetical Romney administration would be subjected to far stricter scrutiny by the U.S. media than President Barack Obama has experienced. 'Obamedia' Ignore Major Events, Fabricate Others. Would Communist Russia's TASS news agency or Pravda newspaper have been any more subservient to the party in power, the chief executive who leads it, or the ideology at their foundation than America's major media outlets are being to Barack Obama, the Democratic Party and their socialist-style liberalism? Media Bias in the Age of Obama. [Steve] Kroft, as embarrassing as his interview was, is merely symptomatic of a larger phenomenon: the unprecedented swooning and cheerleading by the press for Barack Obama. To say that the elite media has a liberal bias is similar to declaring that the sun rises in the east. But it's never been this transparent, the infatuation never this deep, the advocacy this passionate. We Must Do Something About The Media. The media no longer hides it in their actions. They are fully fused with the Obama Administration and DNC. The only way in which they do hide it is by simply lying when confronted about it: They'll issue a snide denial, then go about doing precisely what it is they were accused of doing. This is dangerous and unhealthy. Shapiro: 'NBC News is a disaster area, an unholstered weapon for the left. "Brian Williams is an excellent example of how the media bullies the right," said Shapiro, author of the new book "Bullies: How the Left's Culture of Fear and Intimidation Silences Americans," in an email. "He claims objectivity, but he's obviously a leftist. I don't mind bias — I'm biased. But I don't lie about it. It's time to take on the media. It takes some reframing in our own minds, I believe, to grasp the idea that it is simply a political candidate or policy we are fighting. We must destroy the food chain that is rotting our country, the primary vehicles of which are the media and the government-run schools. CBS News' Political Director: Obama Must 'Destroy' Republican Party. The author of this outrageous left-wing fever dream is John Dickerson, whom Slate describes as "Slate's chief political correspondent". What Slate leaves out of its little bio, though, is that Dickerson is also the political director at CBS News. Dickerson is merely being Dickerson, and there's no doubt he speaks for legions upon legions of those in the media today. Leader: CNN Correspondent Wrote Obama Letter Every Day for Four Years. Most people would cut a 13-year-old girl some slack if she became obsessed enough with Justin Bieber to write the teen singer emails and letters all the time, but what if an ostensibly professional journalist were to do the same to a politician? This odd scenario actually is not a hypothetical, however. A CNN correspondent named Tom Foreman has been doing just that, writing a letter every single day to President Obama for the past four years. Campaign journalists 'swooned' over Obama during off-the-record bar visit. "The behavior of the assembled press corps was telling. Everyone, myself included, swooned. Swooned! Head over heels. One or two might have even lost their minds," [Michael] Hastings writes, as each reporter had a chance to speak personally with the president. "We were all, on some level, deeply obsessed with Obama, crushing hard, still a little love there. This was nerd heaven, a politico's paradise, the subject himself moving among us — shaking our hands, slapping our shoulders!" MSNBC: The Racist Network. MSNBC is arguably the most race obsessed cable news network on television and they beat a single drum constantly. In their narrow view, all white conservatives are racists, the Tea Party is a terrorist organization and the Republican Party is as white as the snows of January. This leads me to wonder why MSNBC also does everything it can to demonize black conservatives. The Obama-Media Love Affair. Media bias is not just a "problem" or an "annoyance." It is a fundamental challenge to the political health and future of America. How the fact-checking press gives the president a pass. A proliferation of "fact-checking" enterprises at various mainstream media outlets, combined with an increasing willingness to abandon what New York Times Public Editor Margaret Sullivan in September called the "false balance" of "giving equal weight to both sides of a story, regardless of an established truth on one side," produced a nearly consensus conclusion: "Let's Just Say it: Republicans Are the Problem." The Real Country-Killer in 2013. Simply trim a few percent from every program — here a little, there a little. Isn't that obvious? Yet big spenders howl as if entire programs must be completely eliminated — all or nothing. People will be cut off and starving in the streets if the federal spending spree is slowed. "What would you cut?" candidates are asked. This is a trap. Attack journalists twist whatever a candidate answers into a scandal of heartless cruelty. The Editor says... The trap only works because so many people make their decisions based on sound bites and bumper stickers, rather than rational thought. Is There a Constituency for Liberty in the U.S. Media? When I was a journalism student at the University of Tennessee 35 years ago, one thing we were told over and over again was that journalism served a "watchdog" role in keeping tabs on government. I had assumed (naïvely, of course) that the term "watchdog" meant serving as a counterforce against the predations of the state. Alas, what I have found that it really means is that modern journalists and their mainstream organs like the New York Times, Washington Post, Vanity Fair, Time and Newsweek, not to mention a gaggle of numerous smaller wannabe publications, are making sure that the state is using all of its powers and then some to push people into line. Hillary Clinton Must Answer for Benghazi. It's almost as if many in the mainstream press wish we could switch temporarily to a monarchy. That way we could coronate Secretary of State Hillary Clinton and assure her role as our next leader and be done with it. [...] Four Americans lay dead because of these failures, and most of the media seems entirely comfortable with this being swept under the rug. The Media's Gunsmoke. Eliminating guns is a separate goal from eliminating violence. The media supports the former but opposes the latter. It routinely props up the culture of death, guarding abortion with even more zeal than it condemns gun rights. "We need to have a conversation about the killing of unborn children," is a line you will never hear from CNN's Piers Morgan or Soledad O'Brien. The lamentations of posturing pro-abortion journalists over a coarsened culture don't count for much. President Obama's Pravda. The president has rewarded his campaign loyalists from MSNBC with an off-schedule West Wing meeting, where he's given them new talking points to win the next battle over taxes. Yes, this state-press collusion is happening in your capital, not just Caracas or Havana. The lovefest between Obama and MSNBC toadies Lawrence O'Donnell, Rachel Maddow, Ed Schultz and Al Sharpton actually took place on Dec. 4. Now They Tell Us The Economy Stinks. Little noticed in President Obama's "fiscal cliff" plan is a demand for a huge new stimulus package. Wait! Wasn't he and everyone in the press telling us just before the election how the economy was gathering steam? [...] In the crucial last few weeks before the election, the mainstream media were falling over themselves painting a rosy economic picture. Every upbeat bit of data made it to the front page; any bad news got buried. The Media Mogul Protection Racket. If you are a millionaire or billionaire looking to avoid negative or critical or even remotely credulous press coverage, stop what you are doing, invest in a media property, and employ liberal writers and editors. You will probably lose a lot of money, but the intangible benefits of slavish praise and deflected criticism will be priceless. Emphasis should be placed on the hiring of liberal writers and editors. MSNBC Hosts Spotted Visiting Obama White House. On Tuesday afternoon [12/4/2012], four of MSNBC's primetime hosts were seen entering the West Wing for a meeting with President Obama. Mantra Raves. It's not hard if you have a show on MSNBC. There's a mantra and all you do is repeat it, like a fourth grade math teacher going over the same fractions year after year until she starts to develop a dislike for 10-year-olds. I get home from work and click on the TV and MSNBC's Chris Matthews is saying "the rich" aren't paying their "fair share." TV news anchors quit on air, allege media bias. These brave people stood up for what they believed in and unfortunately they are in the minority. Most people either go along with the bias because they believe it themselves, or they know they can't advance their careers without going down the Fighting the Good Conservative Fight. Perhaps the only thing more daunting than the level of media bias with which conservatives have to contend, is the willingness of so many on the right to accommodate it. Nothing exemplifies this better than the RNC, the Romney campaign and Congressional Republicans sitting still when four leftist debate moderators were chosen for the presidential and vice presidential debates. Their spinelessness was "rewarded" when CNN hack Candy Crowley took the president's side against Romney on the issue of Benghazi in the second presidential debate. Jaws '12. For the past seven years, this column has chronicled the decline of the mainstream media's credibility. That decline has multiple sources, including the increasing polarization of American politics, which has made it more difficult to appear "moderate" and thereby conceal one's own biases; the emergence of new media that not only compete with the old but also act as adversarial critics; and the mainstream media's own hubris, their tendency to view their authority as an entitlement rather than a trust that they must continuously earn anew by adhering to standards of impartiality. MSNBC Looks To Battle Pro-Obama Reputation During Second Term. Many believe the network's "pro-Obama" reputation has, thus far, been warranted: A recent Pew study found that during the final week of the 2012 election campaign, MSNBC ran zero negative stories about President Obama; and not a single positive story about Republican challenger Mitt Romney. Pew: Positive media coverage of Obama surged in campaign's final week. President Obama had his best run of media coverage during the final week of the campaign, while positive coverage of Mitt Romney dwindled, according to a study released Monday from the Pew Research Center's Project for Excellence in Journalism. How The Press Helped Obama Over The Finish Line. It's hard to see how press coverage of President Obama's re-election bid could have gotten any more biased, but a new report shows the media managed to outdo themselves the week before voters went to the polls. MSNBC's Bias Against Mitt Romney Was Astonishing. No one really expects MSNBC's coverage to put a positive spin on Republicans — but in the final week of the 2012 presidential campaign, the network's coverage toward presidential nominee Mitt Romney skewed entirely negative. Losing the Battle to Spin the War. The media-entertainment-education-Democrat axis control the mainstream narrative, which means the 30-40% who are in the center (between conservative and liberal identification) generally will believe whatever Bill Maher, CNN or Politico says. Your Guide to Understanding the Media for the Next Four Years. There's no question we have a long four years ahead of us, and the fact that we're going to have to fight the mainstream media every inch of the way is only going to make those years feel longer. But if we're going to fight the media, we at least have to understand what we're up against and what the media's over-arching goal is. N.Y. Times: MSNBC Voice Of Obama's America. The New York Times, in a puff piece about its spiritual cousin MSNBC, said that the leftist network is the megaphone for Barack Obama. Sure, our ambassador was murdered and the Obama administration is lying about it, but the real story is that McCain is a grouch. CNN wants you to look over there! [...] Here's the rule: When a Republican screws up, that's the story. When a Democrat screws up, the Republican response is the story. Post-Election Survey: Voters Have No Confidence in Media. Most voters who watched the second Presidential debate saw CNN's Candy Crowley jump in and bail out President Barack Obama when he stumbled on Benghazi and correctly concluded she was biased in his favor. Journalists Found Donating Heavily to Obama Campaign. Here in the waning days of this campaign for the White House, Politico reports that many journalists, editors, and news personnel have donated thousands to Barack Obama's reelection campaign. MSNBC: Joke Network, Cont'd. The worst offender, Keith Olbermann, is now gone, not because of his crazed leftism or frequently embarrassing errors, but because he was an insubordinate employee. Of those who remain at MSNBC, Chris Matthews is among the worst. In another era, his reckless disregard for truth and unprofessional conduct would have brought his career as a journalist to a speedy end. At MSNBC, these qualities are apparently valued, as Matthews has been rewarded with a multimillion dollar contract. The worst media election since the last one. No matter which candidate wins Tuesday, it's clear the media didn't just cover this election, they shaped it. To paraphrase Dickens, it was the best of coverage and the worst of coverage. If you were President Obama, you got the best of coverage and photos of you with halos around your head. [...] The major media, on the other hand, turned Mitt Romney into a caricature straight off a Monopoly card. Wave goodbye to the Obama media. By tomorrow night we'll likely know the name of the next president. But we already know the loser in this election cycle: political reporters. They've disgraced themselves. Conservatives have long complained about liberal bias in the media, and with some justification. But it has finally reached the tipping point. Not in our lifetimes have so many in the press dropped the pretense of objectivity in order to help a political candidate. The media are rooting for Barack Obama. They're not hiding it. Media Favoritism May Be Hurting Obama. This election's X-factor may be a gift to Romney from the mainstream media. It is the suppression of public expression of support for him. However, while pre-election polls may not have been fully recording it, Election Day may finally capture Romney's true support level for the first time — to Obama's ultimate detriment. CNN political reporter not happy about favorable Romney coverage. There was a time when news reporters who covered politics were expected to keep their partisan leanings or preferences to themselves. That time is nearly gone. [...] And now, in the age of Twitter, we see political reporters increasingly not only taking advantage of the new technology to get information out to their readers faster, but also expressing their personal partisan opinions on what they are seeing and hearing out on the campaign trail. Are the TV anchors rooting for President Obama? It is widely perceived that the national television news industry skews left and in some cases actively supports liberal political candidates. While that is debatable on a case-by-case basis, the evidence is overwhelming that the folks who deliver the news to the nation are sympathetic to liberal causes, and that obviously favors President Obama during this election cycle. skewers Biden but is ignored by media. Imagine a scathing look at a vice presidential candidate. Put a "R" after that candidate's name, like Sarah Palin, and you get big-name books, a controversial film and lots of news coverage. Put a "D" after that candidate's name, even when he's still the sitting vice president, and it gets almost no attention. Obama's Homeless. There are more homeless right now, at this point in Barack Obama's presidency, than there were at this point in Reagan's presidency. That's significant because the homeless, at this point under Reagan, were used by liberals to torpedo Reagan's reelection bid. And yet, today, liberals are completely silent about the homeless under Obama. Liberals have not turned the homeless into a propaganda issue today, as they did in the 1980s. Rise of the Mediacracy. The media is no longer informative, it is conformative. It is not interested in broadcasting events unless it can also script them. It does not want to know what you think, it wants to tell you what to think. [...] The media isn't biased anymore, it's a player, its goal is turn its Fourth Estate into a fourth branch of government, the one that squats below the three branches and blocks their access to the people and blocks the people's access to them. Announcing the Winners of the Inaugural Walter Duranty Prize. A recent Pew Poll showed public dissatisfaction with the mass media has reached what Pew called a "fresh high," with 60 percent of Americans saying they have little or no trust in the mass media to report the news fully, accurately, and fairly. Personally, I wonder who the forty percent are. Obama's not-so-centrist Hampton speech. To hear Washington Post columnist Richard Cohen tell it, President Obama is "a man of the center — or maybe a wee to the left scrambles to downplay Obama's attendance at VP debate moderator's wedding. President Barack Obama was a guest at the 1991 wedding of ABC senior foreign correspondent and vice presidential debate moderator Martha Raddatz, The Daily Caller has learned. Obama and groom Julius Genachowski, whom Obama would later tap to head the Federal Communications Commission, were Harvard Law School classmates at the time and members of the Harvard Law Review. Moderator Martha Raddatz Hosted President Obama at Wedding, Never Told Public. The liberal media/politician/bureaucrat revolving door spins so rapidly, sometimes it's hard to keep pace. Today [10/10/2012] we learn via the Daily Caller that the moderator for tomorrow's vice presidential debate, ABC News reporter Martha Raddatz, hosted President Obama as a guest at her 1991 wedding to the man who would later become Obama's FCC commissioner, Julius Genachowski. ABC News' version of an impartial debate moderator. Tomorrow's vice presidential debate will be moderated by Martha Raddatz. The Daily Caller has reported that in 1991, Barack Obama attended Raddatz's wedding to the future president's law school classmate and fellow Harvard Law Review member Julius Genachowski. If that name sounds familiar, it's because Obama appointed Genachowski to head the Federal Communications Commission. What Obama's Raddatz connection really shows us. [Scroll down] Why might this matter? Even when overt favoritism isn't a factor, people who socialize are more likely to share a worldview. And that can be the most insidious form of bias. In short, Republicans are constantly being interviewed by people who see the world differently than they do. Over time, it's fair to assume this might pose a problem. Republicans tend not to cultivate these sorts of relationships. There are a lot of theories for why this is. Liberals, for whatever reason, seem to be more attracted to journalism and the arts. Conservatives might be too focused on their jobs and family to network or attend dinner parties? of Liberalism Marches to Re-elect Obama. Most people still get their news from national and local television, and from their local newspapers. Virtually all of the editorial pages of the major newspapers are liberal, and reporters self-describe as liberal far more often than they self-describe as conservative. Caddell: Media Have Become An "Enemy Of The American People". Caddell noted that while First Amendment protections were originally provided to the press so they would protect the liberty and freedom of the public from "organized governmental power," they had clearly relinquished the role of impartial news providers. Nowhere was this more evident than during the tragic death of a U.S. ambassador in Libya that was lied about for nine days, because the press and the administration did not want to admit it was a terrorist attack. "We've had nine days of lies over what happened because they can't dare say it's a terrorist attack, and the press won't push this," said Caddell. How the Liberal Media Ruined Obama. The fact is that this Obama we saw Wednesday night and have endured for the last four years is a product of our liberal leftist media. Obama was not ready Wednesday [10/3/2012], he has never been ready, and he will never be ready to be the leader this country needs, for he is the first president to have never been vetted. [...] It is the fault of America's leftist liberal media who have continually misled Obama into thinking he would never have to answer to his record. A Look at Chuck Todd and Conspiratorial Media Incest. [Scroll down] Flip on any major news network other than Fox and you'll be greeted by reports heralding gay marriage, an issue that has failed repeatedly in more than half the states, a generally liberal social world view, Washington compromising jacking up the national debt, and unquestioning acceptance that a poorly produced video on the internet caused our American Ambassador in Libya to die. You'll probably even get some poo-pooing about excesses of the First Amendment with regards to Coptic Christians and Citizens United, but rarely about pornography or the press itself. We Live Under a Media Coup d'État. We have long lived under this assumed reign of liberalism — in our media, in our schools, and through our entertainment. It is as pervasive as the air we breathe and as unquestioned. Fox News, even the Wall Street Journal, important as they are, exist under this reign and more often respond to it than initiate their own programs and investigations. Barack Obama is a product of this coup d'état. The Real Enemy. The list of flacks for leftism is drearily familiar: academia, public school systems, the entertainment industry, professional organizations, nonprofit foundations of vast wealth, the bureaucracies dependent upon social grievance and mind-numbing regulations (which includes not only federal and state bureaucrats, but "experts" in private industry who would have spent their careers mastering the arcane arts of regulatory compliance), and, of course, the media. It is this establishment which is our true enemy. Mainstream media is threatening our country's future. I think we're at the most dangerous time in our political history in terms of the balance of power in the role that the media plays in whether or not we maintain a free democracy or not. You know, when I first started in politics — and for a long time before that — everyone on both sides, Democrats and Republicans, despised the press commonly, because they were [mean] to everybody. Which is exactly what they should be. They were unrelenting. Whatever the biases were, they were essentially equal-opportunity people. That changed in 1980. Pollster To Megyn Kelly: Media Guilty Of Corruption Of The First Order' For Protecting Obama. Former Democratic pollster Patrick Caddell appeared on Fox News Channel with Megyn Kelly on Monday to elaborate on a talk he gave recently in which he claimed that the media has today become "the enemy of the American people." Caddell called the media's deliberate downplaying of certain stories that could damage Barack Obama's electoral prospects as "corruption of the first order." The great media slide continues. The distrust of the media becomes total. That's hardly news to anyone, except to the clueless editors and publishers of the big newspapers and the big mules of the television networks, who see their audiences shrinking and wonder why. Mainstream Media: Public Enemy No. 1. Mitt Romney can still win this election, but first he has to confront the largest single domestic threat to our liberty, our values, and our national and economic security — the mainstream media. Most mainstream "journalists" unethically supported then-Sen. Obama in 2008, and most have doubled-down on that bet in 2012. And that biased and corrupt support may be the least of their professional sins. Media Shocked GOP Hasn't Conceded. When the mainstream media declares that Mitt Romney is finished, they expect everyone in the Republican Party to not just listen but to act accordingly. That's the only way to respond to an astonishingly obtuse feature in Politico that centers on the willingness of GOP congressional candidates to embrace Romney. Gallup: 60% of Americans Don't Trust Mainstream Media. Gallup is out this morning with a new poll that contains a damning indictment of the mainstream media. 60% of Americans, an all-time high, do not trust the mass media to accurately or fairly report the news. Mind you, that isn't 60% of Republicans or conservatives, but Americans of all political persuasions. U.S. Distrust in Media Hits New High. Americans' distrust in the media hit a new high this year, with 60% saying they have little or no trust in the mass media to report the news fully, accurately, and fairly. Who needs elections when we have the mainstream media? Obama's Army. Obama's most successful reset, it turns out, was not with Russia but with the mainstream media: In their eyes we are back where we started, in 2008, and Obama is once again nothing more or less than a symbol of racial and political progress whose opponents are ideologues or reactionaries or bigots. This is the story line that has dominated news coverage of Obama ever since that first tingle ran up Chris Matthews' leg, and we know the media love story lines. They have been committed in this election to the twin notions that the Republicans are radical obstructionists and that Romney is an out-of-touch and gaffe-prone plutocrat. Neither the Republicans nor Romney can do anything to change such an impression once it has been set in media concrete. Why is the race close? The media's role as propagandist is evidenced in several ways. News stories freely mix opinion with fact. Interviews are conducted not to gather information but to prove points. Investigations are conducted not to uncover news but to create it. Instead of acknowledging the need for independent media watchdogs, members of the media appoint themselves to "fact check" the candidates. For example, the fact-checking website PolitiFact.com is owned and operated by the anti-Republican Tampa Bay Times and its staff includes a number of reporters. The Audacity of These Dopes. Mitt Romney makes a comment about how 47% of Americans are "dependent" on government handouts, and the media is outraged that he would tell the truth. The rest of America is outraged that the figure is 47%. This is why Americans cannot believe the media message that the president is winning. The press has to pretend, and they will, right up until November 6, when he will lose in a landslide. Strip away the Obama myth, and what are you left with? You are left with a man who is nothing more than an illusion. There never was and never will be a Barack Obama, because he is not real. The man reading from the teleprompter is nothing more than the sum total of the audacious hopes and dreams of delusional progressives — touted endlessly by a submissive press. Media lap dogs in hot pursuit of the wrong story. What we are in the midst of witnessing right now is a complete, Fukushima-style meltdown of the mainstream media. Without these slobbering lap dogs, President Obama never would have been elected in the first place. And now they are his only hope for staying in office amid all the global violence, a morbidly paralyzed economy and a national crisis of confidence so profound that the American Dream has become nothing more than quaint fiction for millions. Romney's "Secret Video" and the Dem Politics of "Squirrel!" [T]he same media lapdogs who had conniption fits when the late Andrew Breitbart and conservative investigative journalist James O'Keefe used undercover video are tripping over themselves to publish glowing profiles of Carter the Fourth and his impressive "furtive efforts" to secure the Romney tapes. Media Bias Designed to Save Obama's Presidency. Our media understand that, in the same way that Jimmy Carter lost Iran and America was humiliated during the Iranian hostage crisis, there is a danger that Obama will be perceived to have lost Egypt to the Muslim Brotherhood, as violent demonstrations continue in the Middle East and other Arab/Muslim areas of the world. Hence, attention is being directed to a film that has been on the Internet since July. It is a diversion intended to save Obama's presidency. Congress will likely investigate DOJ-Media Matters collusion, target group's tax-exempt status. Texas Republican Rep. Blake Farenthold said Tuesday that he expects the House Committee on Oversight and Government Reform to investigate collusion between the Department of Justice and Media Matters for America, in the wake of The Daily Caller's publication of emails between the liberal messaging group's employees and a top DOJ spokeswoman. Emails reveal Justice Dept. regularly enlists Media Matters to spin press. Internal Department of Justice emails obtained by The Daily Caller show Attorney General Eric Holder's communications staff has collaborated with the left-wing advocacy group Media Matters for America in an attempt to quell news stories about scandals plaguing Holder and America's top law enforcement agency. Referendum on the Liberal Media. The old media is dialing-up its defense of a failed Presidency. It will cost them. [...] America is not a totalitarian state, but more than a few Americans believe the nation has taken significant steps, during the Obama Presidency, in a totalitarian direction, and we are alarmed. Today, America's liberal media displays behavior typical of how news and political commentary outlets function in totalitarian states. The Real Culprits. Anyone willing to invest a little time in a search for facts can find plenty of them literally at his fingertips. But vast numbers of Americans are still totally dependent for their information — and thus in large measure for their political opinions — on the TV networks and the printed media. It is the duty of the press to perform the crucial function of enlightening the public. But the liberal media refuses to act as a guardian of democracy, fulfilling its obligation enshrined in the First Amendment. Rather than supplying its customers with unbiased, factual information, it feeds them a steady diet of blatant propaganda. The Fourth Estate, Still Thrilling to the Spirit of '08. By the time the presidential campaign had ended four years ago, the media's role in driving the outcome had become a fact too obvious to dispute. The impact of the journalistic horde's devotion to the Democratic candidates was clear, the evidence vivid — especially in the case of reporters transported to a state of ecstasy over candidate Obama's speeches. One New York Times reporter wrote of being so moved he could barely keep from weeping. Not for nothing did the role of the press become a news story in itself — an embarrassing one that might, serious people thought, serve as a caution during future campaigns. Campaign Coverage Goes Beyond Biased. In an interview this week, the president of CBS News insisted his network isn't biased. We agree. When it comes to the current election campaign, calling the mainstream press biased doesn't go nearly far enough. These days, the media aren't just tilting stories, they're acting like paid employees of the Obama campaign's PR shop. News President Appears Not to Understand What Bias Is. CBS News, current employer of the reporter caught coordinating attack questions against Mitt Romney and former employer of the disgraced Dan Rather, is actually not biased. So says its current president David Rhodes. [...] According to Rhodes, his news team is actually "constantly diligent" to avoid being accused of bias. Those who do so are simply trying to affix "labels" to what is actually objective reporting. The sun never sets on Obama's failures. Our adversaries are stronger. America and her allies are weaker. And yet, after spending practically a decade blaming every last thing, including the bad weather, on President Bush, the media seem determinedly uninterested in ascribing even the slightest amount of responsibility to President Obama. How Republics Fall. [Scroll down] This is how republics die, in thrall to the inane, the frivolous, and the inconsequential. A liberalism incapable of persuading the public to embrace its policies has been converted by its media tribunes into a publicity stunt. As a result, the nation that gave the world the Federalist Papers and the Lincoln-Douglas debates may very well reelect a flawed chief executive for no other reason than that he has been continuously portrayed as a super-nice guy by the media lackeys who tend the Obama cult. Media's Coverage Of Romney On Libya: American Pravda. When the Evil Empire was up and running, Americans used to have a good laugh at Pravda. How in the world could the Soviet people believe the tripe coming from those hacks? Well, the mainstream media in this country has become every bit as corrupt as Pravda and the reporters can't even claim that they're controlled by the government as an excuse. The media are doing the same thing now that they did in 2010 to drag Democrats across the finish line and depress conservative morale. the Media Lies: [Scroll down] It's so easy to go down rabbit holes of conspiracy wondering what people's real motives are in politics, but I just don't understand anyone who writes for a conservative site or even comments on one who does not focus on exposing how the corrupt media lies to benefit Democrats. That should be a paragraph, at least, in every article because whatever's being covered in the news that day is saturated with the corrupt media's pro-Democrat spin. I think the reason so many conservatives are so bad at picking up on this stuff is because it's so rare that they see anyone talking about it ... or calling out the conservative writers who pen "Doom Reports" instead of showing people just how shamelessly the corrupt media lies in service to the Left. Dezinformatsiya. Like the ineffable Debbie Wasserman Schultz, the Baghdad Bob of the DNC, who has mastered the dark art of looking you straight in the eye and lying right to your face, the media has simply declared the verdict they wanted to reach all along. [...] For the truth is, the conservative media effort is pathetic: uncoordinated, scattershot, internally contradictory and grotesquely underfunded. Whereas the Democrats have not only the mainstream media — beginning with its official mouthpiece, the New York Times, as well as the broadcast networks and two of the three cable networks — but also the George Soros-fueled resources of the "non-profit" Media Matters for America disinformation operation, whose stated mission it is to take down Fox News and to combat conservatism in general. President MSNBC. No one pretends anymore that MSNBC is an objective observer to the news. Obviously, the decision was made to be aggressively progressive. With the exception of "Morning Joe," where Joe Scarborough and Mika Brzezinski co-host a roundtable of commentators, politicos and actors who dispense praise and criticism equally to Democrats and Republicans, the cable network's other political shows are unapologetically pro-Democratic, pro-Obama. Double-Minded Republicans. Certainly, the media, the academy, and most of our society's major institutions are heavily influenced by progressives, if not outright controlled by them. It is therefore a given that elite opinion will portray Republicans as villains. Yet, that longstanding challenge for Republicans has never before been an The Pinocchio Press. Outside the world of journalism, fact checkers were pretty much unknown until recently. Like proofreaders, they work behind the scenes. Their job is quality control. The most rigorous fact-checking operations — The New Yorker's and Reader's Digest's are the best known among us who know about such things — would scrutinize every factual assertion in an article, reporting back so that any error could be corrected. Over the past few years, many organizations have promoted "fact checkers" by making them writers, or perhaps demoted writers by making them fact checkers. No, it's more the former, because other writers have been bowing to the "fact checkers" as submissively as Barack Obama upon meeting some anti-American dictator. A prediction of future media bias: October, liberal media will say economy springs anew. [Scroll down] Here's what will happen, beginning immediately after the Democrats' convention. The media will discover signs blossoming all over that the economy is recovering. Jobs are appearing and various indicators will show that the Obama tax-and-spend approach is working. By Nov. 6, if you read the paper or watch TV, we will be in boom times. The national debt will continue to rise. Unemployment may be as bad or worse. Social Security and Medicare will be as likely to go bankrupt. But from the liberal media's perspective, happy days will be here US journalists trade independence for access. In the US, journalists are sacrificing editorial independence in exchange for access to top politicians. The practice has a long history in Germany, where interviews often must be authorized before publication. In democratic societies, the media has long struggled with the political class to define what information is fit to print. While journalists seek access to high-level officials for a scoop, officialdom often does its best to control the flow of information to journalists in order to mold public opinion in its interests. The Huffington Post Whitewashes Sharia. Big broadcast news and print media offer Islamic supremacists and their leftist shills unfettered access to defame, lie about, smear, and give misleading information about freedom's fiercest defenders, without giving the victims of these vicious defamation campaigns the opportunity to rebut the false charges. This is twenty-first-century Goebbels-style propaganda. Islamic supremacists and their useful idiots on the left are given enormous power — the kind of influence and access to deceive and mislead the American people that Nazi propagandists were given in Germany. Stephanopoulos: No Bias in Media. MRCTV's Joe Schoffstall ran into "Good Morning America" host George Stephanopoulos at the Republican National Convention in Tampa, Florida. When asked if he believes there is a liberal bias in the media, he responds, "I don't." The Exact Opposite of Truth. In case you didn't realize it, the only claim [Chris] Matthews has to being a journalist is that he is a partisan Democrat. Matthews never worked a day as a reporter, never covered a city council meeting or a homecoming parade. After evading the Vietnam-era military draft by enrolling in the Peace Corps, Matthews moved to Washington and worked on the staff of various congressional Democrats before unsuccessfully running for Congress as a Democrat, later joining the White House staff as a speechwriter for Democrat Jimmy Carter, then spending the Reagan years as a top aide to Democrat House Speaker Tip O'Neill. Somehow, this ultra-political background as a partisan operative qualified Matthews for the job of Washington bureau chief for the San Francisco Chronicle. Media's One-Sided Coverage Is Clear Evidence Of Bias. The media should, at bare minimum, be expected to reveal the truth. But it won't even do that. Still the media focus nonstop on unsubstantiated reports about Mitt Romney's tax returns — not on anything substantial. MSNBC analyst Mark Halperin, when asked about Mitt Romney's tax returns on the Today Show, said, "The press still likes this story a lot." He added, "The media are very susceptible to doing what the Obama campaign wants, which is to focus on this." The fact the media are susceptible to do what any campaign wants is disturbing enough. But the way the media focus relentlessly on gaffes and ignores substantive issues when covering one side, while ignoring gaffes and issues critical of the other side, does serious damage to the integrity of news reporting. controlling American media like Hugo Chavez does in Venezuela. Award-winning actor Jon Voight told The Daily Caller at the Republican National Convention that he thinks President Barack Obama's administration has "taken over" the mainstream media in a manner similar to how leftist Venezuelan President Hugo Chavez controls media in his country. "The media has been taken over by this administration," Voight, an outspoken Hollywood conservative, said in an interview with TheDC. "It's not less than what has happened in Venezuela with Hugo Chavez, really, because you can't get the information through. I'm giving you this because I want to get the press my opinion. You can put it in any way you want to. But, it's become pure propaganda and we should be appalled." All Major Media Companies Donated More Money To Obama, Says NYT. For those who argue there's a "liberal media bias," this is likely to affirm those beliefs. personal ties link Obama administration to Commission on Presidential Debates. The moderator of the lone October vice presidential debate was previously married to a top Obama official, an association both ABC News and the left-leaning Commission on Presidential Debates do not view as a conflict of interest. ABC Senior Foreign Correspondent Martha Raddatz, whose role as moderator was announced on August 13, was previously married to Federal Communications Commission Chairman Julius Genachowski — an Obama appointee. Don't Just Stand There: Employ A Three-Question Test! You wouldn't call someone "anti-spoon" if he preferred to use a knife to cut his steak. [...] That's what makes the frequent misuse of the term "anti-government" so perplexing. It's a common refrain among left-of-center commentators when they search for adjectives to describe those who advocate for free markets, individual freedom, personal responsibility, and limited government. Why Isn't Romney Slaughtering Obama? [Scroll down] It is well-known that virtually all of the opinion-molding organs of American society are firmly in the hands of the leftists. These include: the media, public schools, academia, legal profession, foundations, seminaries, libraries and, sadly, many major corporations. Therefore, unless an individual is an exceptionally original thinker or is exposed to a countervailing inoculation, his mindset is inevitably shaped to be part of the liberal consensus. And the two venues that are most influential in this regard are the media and the government-controlled public schools. [...] Today — and for the last 30-50 years — the children of America are subject to a relentless barrage of left-wing propaganda that is strongly reinforced by what their parents see and read on TV, in the movies and in the newspaper. Clearing up this silly media bias business. The new Rasmussen poll reports that this time 51% of likely voters now fully expect reporters to help the incumbent Democrat keep his office, while only 9% expect reporters to help the Republican ticket of Mitt Romney and Paul Ryan. Nine percent? Really that much? Other Rasmussen findings: 18% of likely voters, presumably deaf, blind and living in closets, can't make up their minds, while 22% absolutely expect unbiased coverage throughout the remaining national agony and bonanza for commercial TV stations. Obviously, they only watch C-SPAN. Lamestream coverage leans left. Now "angry" joins an ever-growing list of moonbat-proscribed words and phrases that have been deemed "racist." Paying Newspapers for 'News Gathering'. Several newspapers have recently announced that far left leaning, non-profit foundations such as The Ford Foundation have given them hundreds of thousands of dollars to cover "the news." [...] Consider the left's main complaint about researchers funded by cigarette manufacturers or oil companies. They claim that the funding guides the research. Why shouldn't we assume that the funding of the news by hardcore, left-wing foundations wouldn't eventually (if it isn't already) coloring the coverage of "the news"? If money from oil companies makes research funded by them less reliable, or even bogus, then what does that make "news" funded by hardcore, left-wing foundations? See no evil. Our news media, especially as seen and heard during nationally broadcasted news, engages in highly selective story-choosing, story-telling and subsequent indignations and outrages that are first weighed on political scales. Early this month a spectacular story was given tiny attention, and none, as far as I watched, on nightly national newscasts. Poll: Media in Obama's pocket. Likely voters, by a five-to-one margin, believe that America's media is in President Obama's pocket and will treat his candidacy better than challenger Mitt Romney's as the election nears, according to a new Rasmussen Reports poll. The startling numbers point to an even more disturbing trend for the media: Reporters just aren't trusted to deliver the news in an unbiased fashion. The proof: Rasmussen found that when it comes to information about the presidential campaign, 48 percent of likely voters trust friends and family while just 26 percent trust reporters. Latest Word on the Trail? I Take It Back. The quotations come back redacted, stripped of colorful metaphors, colloquial language and anything even mildly provocative. They are sent by e-mail from the Obama headquarters in Chicago to reporters who have interviewed campaign officials under one major condition: the press office has veto power over what statements can be quoted and attributed by name. [...] Many journalists spoke about the editing only if granted anonymity, an irony that did not escape them. No one said the editing altered the meaning of a quote. The changes were almost always small and seemingly unnecessary, they said. Proof! Establishment media controlled. This may be the most important story broken by the New York Times in years. What it means is this: When Americans read these reports — whether in newspapers, wire services or on the Internet — they are not really reading news stories at all. They are reading approved, pre-packaged press releases from the government and politicians. But, even worse, they are not labeled as such. They are labeled as actual news. That's how low the national press establishment has descended. [...] These so-called journalists are selling their ethical and moral souls for access to politicians. And this practice raises expectations by politicians that they can routinely manipulate the press to their advantage. Obama's Media-Contrived Courage. The Obama media — the Gatekeeper Media who try to control what people know based on what fits their narrative — are proving almost daily that they're not in the news business. They are in the business of political activism, aimed solely at getting their guy another four years in the White House. Republicans Roll Over on Debate Moderators. Either Mitt Romney and the Republican party doesn't get it about the media, or they're just plain stupid. [...] Once again for terminally clueless Republicans: this presidential election, like every presidential election, is a two-against-one battle. It's your party on one side, Democrats and the mainstream media on the other. It's one thing not to get a fair shake and have to deal with It. it's quite another to embrace it with open arms. A Reporter with Convictions. A journalist who has made a career attacking the American Legislative Exchange Council (ALEC) also has an extensive criminal history, including drunk driving charges, possession of exotic hallucinogens, and the attempted invasion of a senior center while screaming homophobic slurs. Beau Hodai is a reporter for PR Watch, a publication of the Center for Media and Democracy (CMD). He previously worked for In These Times, a far-left labor publication. "Ugly Black Babies" and the Left. In mediaworld, abortion doctors are just noble people striving to protect the equal rights of women. In mediaworld, gay marriage activists are all ordinary loving couples who seek nothing more than to be left alone to snuggle as they choose, and opposing gay marriage is "controversial" for a business executive. In mediaworld, all children raised by gay couples are grateful for the experience and turn out as impressive as young Zach Wahls. Matter Who Romney Picks For Veep, the Media Will Hate Him or Her. This is as automatic as the debt-ceiling growing under Barack Obama. The media will hate Romney's choice for Vice President. It does not matter whom Mitt Romney chooses; this person will be hated, despised, and compared to Sarah Palin. There will be no comparisons to the nut-job, gaffe machine Joe Biden, because the media loves him and finds his foolishness endearing. "Someone get that VP a puppy." The media has failed miserably at "cracking" Romney, so the Veep will be the new target. [...] It is already happening. Have Your Way with the Local Newspaper. [Scroll down] Here are a few tips for getting your story in the paper, and for having it told (to the degree possible) the way you would prefer to have it told. If you are an elected official, assume that the reporter with whom you are speaking is skeptical and is seeking an opening for a good, juicy story. If you are a Republican candidate or officeholder, assume that the reporter thinks you're both stupid and self-serving. Not all reporters think that way, but the vast majority do. Confidence in News Hits New Low. Nearly 80 percent of Americans lack confidence in television news, a historic low, according to a new Gallup poll. Just 21 percent of adults expressed a great deal of confidence in T.V. news, a six-point drop from last year, and 25 points lower than in 1993, when Gallup first started asking the question. Americans' Ignorance About Socialism Is Unbelievable. Socialism has never worked but it is easy to sell to those who refuse to study history which is why progressives use academia as their base of operations. I'm willing to bet that "Animal Farm" and "1984" are no longer recommended reading in today's high schools. Big Brother is only a TV reality show to many of the young today who regard socialism and big government as a good thing because that's how the mainstream media presents it. Bain Capital and Media Bias. Most journalists will swear that, despite the fact they vote Democratic, they treat both sides fairly. Indeed, it is a rare event to read a news article that directly attacks the Republican party or one that praises the Democratic party. But that does not mean media bias does not exist. It does — its exercise is just subtler than this. And the last two weeks have been a great example of how it operates. NBC and NYT Employees Caught Contributing to Obama Campaign. Workers in news organizations ranging from the New York Times to NBC News are making donations to President Obama's re-election campaign even though many companies forbid employees to do so for fear that such contributions will raise questions about the staff's impartiality. National Media's Bias Erodes Public Confidence. The national liberal media's bias has eroded the public's confidence in the news they get. Americans' distrust of the national media will continue to grow until the national media provide the public with objective news reports. Recent bias displayed by the national media has caused one of its long-time defenders to grow "weary of trying to defend the indefensible." These recent remarks by former CBS producer Greg Kandra highlight the continued existence of the national media's liberal bias. As a result of the national media's use of selectively edited clips to push its liberal agenda, Kandra stated that he cannot and will not defend his former colleagues against claims of liberal bias. A Leftist Media for Obama. Left-leaning journalists like Walter Cronkite and Dan Rather were memorable names because, despite their leftism, they did not entirely compromise their professional journalistic standards. But who will remember the hordes of little Marxists who now dominate the mainstream media? What they share is the conviction that the journalistic profession is the handmaiden of social transformation, and Obama is the transformer. Thus, any sort of bias, omission, or speculative reporting is an acceptable means to the end of revolution. Washington Post Fact Checker: I Don't Fact Check Our Own Writers. In your meta moment of the day, Glenn Kessler, the Washington Post's Fact Checker, announced today [7/2/2012] that he will not grade comments made by political candidates about stories reported in the Washington Post, largely because he refuses to fact check stories published in his newspaper. Where Are Today's Woodward and Bernstein? Whether it's patterns in voting, financial support, or political identification, journalists are significantly more liberal than the average American. According to a 2012 Pew Research Center study, the public perception of that bias is increasing with 67 percent of Americans now believing that there is a bias in news coverage. Journalists have every right to hold liberal views, but it makes their job of objective reporting more difficult. Time For Super PACs to Tell the Truth About Fast & Furious. Forget about the media. No amount of shaming will ever convince those moral illiterates to tell the full and complete story of Fast and Furious. If you think Brian Williams and those who staff every other newsroom in this country went to journalism school to hold power accountable and inform the public, think again. They entered media for one purpose and one purpose only: to defeat the right and to further the leftist cause. The Most Pathogenic Media in History. We have the most pathogenic media in history — they create social divisions, ethnic hostilities, massive deliberate misunderstandings of the real causes of economic despair, and political "solutions" from the very people who created those problems in the first place. Our media are the worst plague virus in history because they spread falsehoods and block the truth. No society can solve problems if the media lie as a daily habit. Unmasking the media's birth certificate hypocrisy. [Scroll down] The answer is that the liberal media have become thoroughly corrupt. They no longer care to hold leaders of both parties accountable; rather, they act — and view themselves — as the communications arm of the Democratic Party. In short, their mission is not journalism, but propaganda. This is now blatantly obvious to the point of becoming a professional embarrassment. Journalists don't have good grasp of religion. Evidence of big media's bias against religion that doesn't advance the secular and liberal agenda of the Democratic Party is beyond dispute. Any faith attached to a conservative agenda is to be ridiculed, stereotyped and misrepresented. Islam is a notable exception. The media appear to bend over backward not to offend Muslims. Their Rules, Not Ours: Time to Vet Private Lives of Journalists? We now have three instances of three individual Politico writers digging up and publishing political oppo-research about the private lives of private citizens who don't support Obama, and the motive behind these attacks can only be for two reasons: 1. To change the narrative of effective criticism of Obama to the less flattering moments of the private lives of these individuals. 2. To intimidate and frighten others who might consider supporting a candidate not named Obama. Media Rekindle Their Obama Love Affair. The Washington Post defends its Mitt Romney hit piece by claiming it didn't collude with the Obama White House on timing. Collusion isn't the problem. The fact that they both share the same goal is. Cronkite and the Roots of Media Bias. It wasn't Fox that poisoned the well of journalism, as former New York Times editor Bill Keller recently alleged. Fox and other such outlets were brought into existence in an effort to balance a journalistic establishment that was already tilting heavily to the left. The real sin here is not bias or even partisanship but the pretense of fairness that Cronkite exemplified. The Media Mess of Pottage? [Scroll down] Ideology plays a major role, as an overwhelming majority of journalists and editors are politically left of the majority of the American people. But this craven cheerleading for and knee-jerk defense of the president raises the question: is there another more practical and base factor behind this unprecedented sycophancy? A September Gallup poll showed that 60 percent of Americans perceive a media bias, with 47 percent saying the media are too liberal and 13 percent saying they are too conservative, findings similar to the year before. Stadium promises never pay. [Scroll down] In a just-released article in the Journal of Sport and Social Issues, my colleagues and I studied media coverage of 23 publicly financed stadium initiatives in 16 different cities, including Philadelphia. We found that the mainstream media in most of these cities is noticeably biased toward supporting publicly financed stadiums, which has a significant impact on the initiatives' success. This bias usually takes the form of uncritically parroting stadium proponents' economic and social promises, quoting stadium supporters far more frequently than stadium opponents, overlooking the numerous objective academic studies on the topic, and failing to independently examine the multitude of failed stadium-centered promises throughout the country, especially those in oft-cited "success cities" such as Denver and Cleveland. about public funding of sports stadiums. Olbermann, Rest of Media Won't Chase Dog Stories Anymore. Jonah Goldberg broadened the argument beyond dog stories to the way the media frames stories in general. To the media, controversies are only distractions if they benefit Republicans. My complaint isn't about distractions, it's about the press's tendency to treat controversies that help Republicans as "distractions" and ones that hurt Republicans as Very Serious Issues. Our National Media Don't Deserve Their 'Mainstream' Title. The opinions expressed by the media are neither widespread nor accepted by the majority of Americans. To call today's national media "mainstream" is inaccurate. They are better described as the "liberal" national media. Regardless, the term "mainstream" should be dropped. According to a Gallup poll, 55% of Americans have little or no confidence in the national media to report fully, accurately and fairly. Americans are right to be skeptical about the news they receive. How can something be considered "mainstream" if the majority of people lack confidence Co-Founder: Most Journalists I've Known Are Democrats. In one of the more honest admissions of the obvious, Politico co-founder Jim VandeHei has admitted that the majority of the journalists that he's known in his career at a variety of publications "vote Democratic." Media Want Complexion To Count In Guilt Or Innocence. Whatever the ultimate outcome of the case against George Zimmerman for his shooting of Trayvon Martin, what has happened already is enough to turn the stomach of anyone who believes in either truth or justice. An amazing proportion of the media has given us a painful demonstration of the thinking — and lack of thinking — that prevailed back in the days of the old Jim Crow South, where complexion counted more than facts in determining how people were treated. Time to Stop Being Intimidated by the Left. [Scroll down] What has this selling out accomplished for the media? In a recent poll, 63% of respondents said the media were "politically biased in their reporting"; 66% believe that news stories are often inaccurate; 42% say the press is immoral; and 72% believe that "they [the media] try to cover up their mistakes." TV Corrects Itself, Just Not on the Air. What is it with television news and corrections? When the rest of the journalism world gets something wrong, they generally correct themselves. But network news acts as if an on-air admission of error might cause a meteor to land on the noggin of one of its precious talking heads. NBC used all of the powers at its disposal to amend the mistake, except the high-visibility airtime where the bad clip ran in the first place. MSNBC, the Faux News Network. Liberals have been feverishly attacking Fox News for years now, irate that the Left's monopoly on television news outlets has been broken. Conservatives, on the other hand, have tended to ignore MSNBC, even though that network is far more partisan, and less reliable, than Fox. Perhaps this is because of a perception that hardly anyone watches MSNBC. It is true, of course, that that network's ratings are nowhere near Fox's, but still, close to a million people watch the most popular MSNBC shows. That is far too many for a network that is not only ridiculously partisan, but spews hate on a Spittlegate, and the Left's 'Race-Gating' Tradition. The media's willingness to lie for the cause should shock no one to the right of Bill Ayers. What is particularly troubling about Editgate is that the major media, which once served as a firewall against fraud, now seem eager accomplices in its commission. Breitbart built Internet empire by combining new media, partisan slant. Get this: The Washington Post points its finger at someone else's partisan slant. about the untimely death of Andrew Breitbart. MSNBC'S Al Sharpton Sinkhole. NBC news used to be the channel for sober, boring Huntley-Brinkley journalism. It was liberal, to be sure but serious. NBC's news wasn't always objective, but it had a reputation for professionalism. Think Tim Russert. But in today's era, Brian Williams going on saucer-eyed burger runs with President Obama is a refreshing improvement over MSNBC's lineup, chock-full of vicious, uncivil, shamelessly partisan left-wing hacks. Ed Schultz and MSNBC's Sewer of Hate: This story emerges in a little known book called The General: David Sarnoff and the Rise of the Communications Industry by Kenneth Bilby. Mr. Bilby was a close associate of David Sarnoff's. The ultimate Sarnoff insider who was a two decades-long member of Sarnoff's management team. The book, a combined biography and insider's account of the legendary Sarnoff — the man who was known in his day as the creator of the modern NBC and "the father of television" (not to mention color television) — tells quite a tale. And in reading it, one is left speechless at just how far the network's mindless obsession with all things fashionably left — otherwise known as MSNBC — has now managed to steer the entire NBC network's reputation into a veritable sewer of hatred. Poking around the propaganda factory. [Edward] Bernays worked for Woodrow Wilson, the president who was re-elected because he "kept us out of war" and then promptly took us into World War I, where 117,000 American soldiers were killed in action. It was Bernays who helped come up with the justification of "bringing democracy to all of Europe," and was delighted to find out that the American public could be easily manipulated with slogans and blatant falsehoods. Although rarely acknowledged today, he laid the groundwork for modern political propaganda and in particular is the godfather of progressive techniques for pushing public opinions such as those used by moveon.org and Media Matters. Media Matters' targets revealed: business, wealth, Christianity. When David Brock applied for tax-exempt status for Media Matters for America, he told the IRS exactly who his group would be fighting against: businesses, wealthy Americans and conservative Christians. [...] Treasury Department documents — 88 pages that The Daily Caller obtained through a public records request to the IRS — reveal for the first time how the organization described its mission while applying for coveted 501(c)(3) non-profit status. Media Matters has made no secret of its adherence to progressive principles, but flagging Christianity as having undue influence in media is the latest revelation about the group's treatment of religion. Fights War on Christians. CBN News has uncovered Media Matters for America's foundational IRS documents — and they show that Media Matters was constructed as a weapon against Christians. According to its application for non-profit status, it was created in order to counter pro-Christian "bias in news reporting and analysis by the American media". Dishonesty: We know that most of the media is actively rooting for President Obama to be re-elected. But it used to be that the liberal press just tilted coverage, ignoring stories that reflected positively on conservatives and Republicans and hyping stories that helped Democrats and liberals. But now, national news agencies are actually lying to you, using out-of-context quotes that they get from websites and fabricating things all in an effort to advance the liberal agenda. Schultz Paid Nearly $200,000 By Unions in 2011, According to Labor Dept. A Labor Department spokesman confirmed to NewsBusters that Schultz received $190,000 from CWA in fiscal 2011, far from than the $7,500 he was paid by the union a year earlier. The spokesman said unions are mandated to report such payments as required by the Labor Management Reporting and Disclosure Act. For its fiscal 2010 payment to Schultz, the union characterized the payment as pertaining to "union administration," according to Labor Department records. The Editor says... I had never heard of Ed Schultz until I saw the article immediately above. Apparently he has a radio talk show as well as a show on MSNBC. Bill Moyers, Progressive Propagandist. The problem is not that Moyers admires Alinsky as a good man, but that he is intellectually dishonest and vindictive regarding those who don't share his admiration. His erudite tone and his measured, smooth-as-silk delivery seem to be aimed at damning what he portrays as knuckledragging conservatives as much as praising Saul Alinsky, and this stains Moyers's commentary with brutish propaganda. and the Suborned Media Employ Hegel's Dialectic. We are at a dangerous time in our Republic's existence. The warning signs are there and the Cultural Marxists have almost destroyed our national culture and society, the final brick in the foundation of a Marxist totalitarian state worse than that created and ruled by Uncle Joe Stalin. Political Puppet Show. [Scroll down] The television career of Stephanopoulos is merely an extension of his work as a communications director for Bill Clinton's 1992 presidential campaign and subsequently in the Clinton White House. Like the late Tim Russert (a lifelong Democrat who worked for Daniel Patrick Moynihan and Mario Cuomo) and Chris Matthews (a former aide to Democrats Jimmy Carter and Tip O'Neill), Stephanopoulos is merely one of many who have followed the well-trod path from Democratic operative to liberal media star. Obama's Law of Contraception. A thinking person would ask where the President has the legal authority to order the insurance companies to give away anything for free. But there are no such thinking persons in the Democrat Party-controlled press, which is ready to applaud a third-world style Obama benevolent dictatorship — benevolent, that is, if you are part of the party political machine. The Associated Press Conspiracy. Just last week AP released this directive to their members regarding its editorial 'standards' as applied to Koran burning: "Should the event happen on Saturday, the AP will not distribute images or audio that specifically show Qurans being burned, and will not provide detailed text descriptions of the burning," managing editor Thomas Kent wrote to AP staff. "AP policy is not to provide coverage of events that are gratuitously manufactured to provoke and offend." Shortly after the decree, numerous media organizations and their disciples fell all over themselves rushing to support AP's decision, ignorant of the fact AP has no problem breaking their own rules when convenient. Economic News From Big Brother, 'The Recession Is Over!' Big Brother sends us today's urgent Newspeak via the Associated Press... foundations lavish millions on Media Matters. Relying on tax returns and websites of wealthy U.S. foundations, a Daily Caller investigation has revealed the sources of more than $28.8 million in funding collected by the liberal Media Matters for America since 2003, the year before its formal incorporation. That sum represents 54 percent of every dollar the organization has raised in its history, making Media Matters a principally foundation-driven — not citizen-supported — activist group. Matters accepted $50K grant for 'fact checking' religious broadcasts. The liberal Media Matters for America organization once accepted a $50,000 grant to monitor and attack religious news outlets, according to tax returns examined by The Daily Caller. The grant came in 2006 from the ARCA Foundation, a 60-year-old philanthropy that funds Democratic causes. The foundation gave Media Matters the $50,000 "to support a Religious Broadcasting Project to expand the monitoring and fact checking of religious broadcasts," according to its tax return that year. Record High 67% See Political Bias in News Media. The downward slide of media credibility continues. A Pew survey released a few days ago found 67 percent of Americans see "a great deal" or "fair amount" of "political bias" in the news media, a record high for the poll by the Pew Research Center for the People and the Press which pegged the level at 63 percent just four months ago. Diabolical American Propaganda Storm Fogs Republic. What's intriguing about today's propaganda is that despite the West's many sophisticated democracies, which depend upon an unbiased media, we observe the press devolving into cheerleaders for socialism. How this occurred, in a nutshell, is simply that journalism — much like universities — was targeted as a strategic place to foment leftist ideas. Media Watchdog Threatens Press Freedoms. Media Matters For America head David Brock surrounded himself with "more security than a Third World dictator," including a semi-automatic-toting "assistant" protecting him from right-wing assassination squads, according to the Daily Caller. ... Recent revelations expose Media Matters as nothing more than a thinly disguised adjunct of the Democratic National Committee. With President Obama announcing he was breaking his campaign promise of refusing the help of Super PACs, you'll never guess who serves as the head of a new one called American Bridge 21st Century: Media Matters' David Brock. And there's lots of overlap in the two groups' donor lists. Inside Media Matters: Sources, memos reveal erratic behavior, close coordination with White House and news organizations. Founded by [David] Brock in 2004 as a liberal counterweight to "conservative misinformation" in the press, Media Matters has in less than a decade become a powerful player in Democratic politics. The group operates in regular coordination with the highest levels of the Obama White House, as well as with members of Congress and progressive groups around the country. Brock, who collected over $250,000 in salary from Media Matters in 2010, has himself become a major fundraiser on the left. According to an internal memo obtained by TheDC, Media Matters intends to spend nearly $20 million in 2012 to influence news coverage. of the morning: Soros monkeys coordinate with Democrats. The Daily Caller provides a deeper glimpse into the Soros-backed Media Matters/Democrat propaganda machine. ... The Media Matters sycophants have repeatedly attacked the few reporters digging intrepidly into the Fast and Furious scandal. the White House manipulating the media through Media Matters? The Daily Caller has a multipart exposé on David Brock and Media Matters which will surprise ... well, probably no one who reads this site. Speaking with former and current employees, Tucker Carlson, Vince Coglianese, Alex Pappas, and Will Rahn paint a picture of Brock as paranoid and out of control, but still supremely effective at getting his message out through the mainstream media. Bloggers Aren't Journalists, Neither Are Many Members of the MSM. [George] Stephanopoulos earned his political science degree at Columbia University and he has been a Democrat political lion ever since, apparently making him a desirable spokesman for the party's agenda. ... MSNBC, a cable station claiming to be "a leader in breaking news, video and original journalism," is anything but. It is stocked with partisan Democrat anchors and, in one instance, Morning Joe Scarborough, a former Republican RINO. Al Sharpton? Chris Matthews? Rachel Maddow? Lawrence O'Donnell? These are journalists? ... Watching MSNBC is a chore and an exercise in frustration waiting for the other side of the story. It simply will not be presented. Instead we are treated with angry scowls and insulting language thrown at Republicans. Ombudsman Won't Quibble: The Post Has a Liberal, Pro-Obama Bias. On Sunday, Washington Post ombudsman Patrick Pexton noted that Deborah Howell, Post ombudsman from 2005 through 2008, said at the end of her tenure that "some of the conservatives' complaints about a liberal tilt [at The Post] are valid." He added: "I won't quibble with her conclusion. I think she was right." Pexton said this even as he characterized his electronic mailbox as a harsh place when conservatives get going on the paper's fawning Obama coverage. Self-Destruction of the Mainstream Media. For the past forty years the mainstream media has become increasingly liberal and more overt in promoting the policies of the Democratic Party. This evolutionary process reached its zenith in 2008 when the media were instrumental in Barack Obama being elected President. Many journalists dropped any pretense of objectivity and became not only cheerleaders but active de facto members of the campaign. During the past two decades no other sector of the economy has experienced such overwhelming financial and employment devastation. Among the most conservative South Carolina primary voters, fully 89 percent had an unfavorable opinion of the media. The same poll showed Gingrich beating Romney in the primary, 37 percent to 28 percent — fairly close to the actual outcome. Conservatives not only resent the liberal media for trying to pick the Republican nominee (n.b. the media prefer Romney) but they also resent Republican politicians who, once elected, spend their careers appeasing the media while abandoning conservative principles (n.b. the supine leadership of the Republican party in the House of Representatives). Favorite SuperPAC, The Activist Old Media. Let's call it what it is now, folks. The biggest SuperPAC out there right now is the one working overtime to destroy any Republican who might be so bold as want to take on the media's Dear Leader in the White House. ... The Activist Old Media has two very specific goals in mind here, 1) keep the "horse-race" going as long as possible because it will help ratings and revenue, 2) work to damage whomever becomes the GOP winner. and the Media: Still Together after 100 Years. A century ago, a segment of the American media abandoned their role as facilitator of public discourse and became active participants in making politically achievable the transformative change being offered by the newly formed progressive movement. The marriage was undeclared, yet under the cover of darkness they conceived a leviathan child which fashioned a mammoth government beyond even the imagination of Hobbes. Conservatives frequently complain that our presidential candidates are chosen by the media for us but give little thought to how this is actually possible. It is, and has been for decades, the modus operandi of the media to work hard to predispose the attitudes of voters toward their candidate by planting the seeds of doubt about the chances of his opponents. Agenda Journalism: Reporters and news writers not only assume that they understand a story before it unfolds, they approach events with a cookie-cutter mentality, a prefabricated plot line. They come equipped with an entrenched political perspective that enables them to shape the news according to prior specification, a practice that has come to be known as "agenda journalism." ... Similarly, the controversy over the now-defunct Journolist group does not cloud the fact that a number of its members were clearly playing partisan politics, attacking Republicans and suppressing unsavory facts about Obama. Media Doesn't Tell Full Story About Obama's Fourth-Quarter Fundraising. Long, long ago, the Associated Press simply decided to stop being objective. Other than the final act of officially declaring their left-wing bias, the AP has done just about everything else required to announce that they are on a crusade, among other things, to ensure Barack Obama's reelection. But even then, you would think credibility would mean something to the AP. the Meat Grinder. [Scroll down] Conservative viewpoints are extreme, but the liberal counterpoints never are so. It's extreme to criticize contraceptives, but not extreme to give them to 12-year-olds in public schools. It's extreme to oppose all abortions but not extreme to favor every one of them (even partial-birth abortions) and want them funded with taxpayer money. It's extreme to believe in traditional marriage, but it's not extreme to support poly-amorous groupings of three or five lovers in loose "family" arrangements. Will Obama Go to War? [Scroll down] Three separate news reports from media outlets that are the first to cheer Obama and genuflect before his ideas. Three media outlets that are supported by a viewership made up largely of Liberal-Progressive-Democrats. Three media outlets with staffs and on-air talent that also overwhelmingly support the president and the L-P-D agenda. All three statements from official Obama administration spokespersons reported by the so-called mainstream media without comment. One needs only a minimal amount of imagination to visualize the reactions of these same media outlets if a spokesperson representing the Bush administration had spoken exactly the same words in exactly the same context. The biggest little story of 2011. If the mainstream media had their way, President John Kerry would likely be in the final year of his second term. Vice President John Edwards might be a leading candidate in the 2012 Democratic primary. In this alternate universe, John Kerry's three-month stint in Vietnam would be a footnote in his storied rise to power. And most Americans wouldn't know that he acquired three purple hearts without bleeding in battle. For the most part, that information reached the American electorate through new media — and in spite of the efforts of the broadcast news outlets. The No News Stories of 2011. As a general rule, when you watch a story on CBS, listen to NPR, or read the New York Times, assume that the news is prepped in such a way as to suggest the opposite of what really happened. Snooty Brand of Liberalism Comes to an End at ABC. On December 13 Christiane Amanpour announced she would no longer be host of ABC's This Week. Her run as host of that show was filled with shots at conservatives and their issues as she called Tea Party candidates "bizarre," and scolded that tax cuts would "hurt" the poor. has deep financial ties to new Sun-Times owners. It's nice to have friends in the media. Mayor Rahm Emanuel sure will have a ton of buddies in one key local media outlet, because virtually every one of the Sun-Times' new owners has been a major contributor, business partner or civic ally of his. Ezra Klein: From 'Journolist' To Liberal Activist. In the early days of the Gulf War, pundits marveled at the specter of Iraqi troops surrendering to journalists. Well, now it's even worse: Journalists are giving the Democratic Party its talking points. The Ever-Worse Establishment Media. Once again, the Media Research Center identifies the real haters. Fighting for The Mainstream. You're probably getting your news from people whose approach to information is so one-sided as to be dishonest — people, I mean, like Brian Williams, George Stephanopolous, and Diane Sawyer. And yet they appear thoroughly presentable: polite, well-spoken — exuding elegance and good will even as they go about demonizing anyone they disagree with. Koppel, Elitist Hack. To [Ted] Koppel, the nation was much better off when it was guided by a small and wise (and supposedly nonpartisan) national media elite that had the brains to separate the wheat from the chaff of information and tell the public how it should think. That's all been ruined now by the "democratization of journalism," and the public will ruin the country with their incessantly partisan ravings. The Media's Debacles. In both the coverage of the Ground Zero Muslim Community Center and Mosque and the coverage of the great demonstration organized in Washington by Glenn Beck attracting in the neighborhood of half a million Americans, the mainstream media once again revealed their bias, blatant selectivity, self induced amnesia, and a rush to judgment to "shame" the audience into guilt over their assumed Islamophobia, the newest charge in the litany of grievances with which the public has been maligned focused on racism, sexism, xenophobia and homophobia in the Military Scandal, Media Blackout. Let me preface the facts of this column with two disclosures: first, I have a deep and abiding respect for the United States military. ... Second, I have equal amounts of contempt for a mainstream media, which is neither mainstream, nor remotely interested in reporting the truth, if it interferes with their agenda. Secrets of the American Nomenklatura. [#1] The media and the Democrats are joined at the hip and have created a "hereditary celebrity class". One of the fastest ways to celebrity and fortune is to be the child of a politician or a well connected political operative. ... If you are a Democrat, like JFK, Jr, Mika Brzezinski, or Maria Shriver who can be counted to toe the party line, the door is wide open. The capper was the announcement this week, that Chelsea Clinton has been hired by NBC. Clinton to Report for NBC. NBC announced Monday that it has hired Chelsea Clinton to become a full-time special correspondent for NBC News. The appointment was immediate. Ms. Clinton will begin work on stories that NBC expects to use as part of its "Making a Difference" series, which runs on "NBC Nightly News," said Steve Capus, president of NBC News. The Editor says... Is Chelsea Clinton paving the way for her own political career? Is there any doubt that her reporting will be biased? And really, why is there a "Making a Difference" series on NBC? Journalists who "make a difference" — or even attempt to do so by expressing their personal opinions — are activists. Zurawik: NBC Hiring Chelsea Clinton a 'Journalistically Bankrupt Decision'. Baltimore Sun television critic David Zurawik on Sunday called NBC hiring Chelsea Clinton a "journalistically-bankrupt decision." Talking to CNN's Howard Kurtz about Clinton's debut, Zurawik said if she's been preparing for this all her life "it's been a largely wasted life". Media vs. the military. The Vietnam War and the Walter Cronkite legend inculcated a strong distrust of the media in the military establishment. The sentiment is that if the press can lose America's wars, it is something to be dealt with warily, if at all. But what comes across as bias is often the product of structural and unavoidable aspects of reporting. The primary role of the press is to expose and publicize information, while the military norm, based on the need for operational security, is to withhold and control information. Newspaper endorsements swing left. After overwhelmingly endorsing Republican presidential candidates from the 1970s into the late '80s, the United States daily newspapers have shifted editorial support in the past 20 years to Democratic candidates, a new study shows. To [Heck] with You People. Look, I am past exhausted talking about liberal media bias. It's real, we all know it, and people who deny it aren't even fooling themselves. But some things just have to be pointed out. Candy Crowley Picks Up MSNBC's Trial Balloon, Questions Cain's 'Blackness'. CNN's Candy Crowley and her absolutely shameful interview with Herman Cain over the weekend was yet another piece of evidence that proves my theory that the MSM is involved in one big left-wing conspiracy. They use each other, they work together, and because it comes so naturally thanks to their shared ideology and social circles, they don't even know they're conspiring. Trust me, that's the worst kind of conspiracy, and Journolist was only a symptom of something much more insidious and widespread. And MSNBC plays a very important role in this. New Media, Old Bias. Back in the old days — say, 10 years ago — Christians used to complain about liberal media bias. The newspapers and networks had a stranglehold on what was considered news. And because most members of the national media were part of the liberal cultural elite, polite indifference was usually the best we could expect. Now, of course, all that has changed, right? Will Happen When the People Realize that the Constitution Is No More? Dishonest, manipulative, agenda-consumed politicians who hold power will not easily surrender that power. Today, an overwhelmingly "progressive" mainstream media feed progressive politicians' lies as truth directly to the people, thereby reinforcing the lies, giving the lies credibility in the minds of a mostly gullible electorate. Tells Ingraham NBC's Todd Worked for Lib Senator. After radio's Laura Ingraham questioned Todd about this issue Thursday [9/8/2011], Fox News's Bill O'Reilly brought her on his program Friday saying, "We did a little research on Mr. Todd... His wife makes a living working for the Democratic Party. There is a report that Chuck Todd actually worked for Senator Tom Harkin, very liberal Senator from Iowa". is the left's biggest muckraker you never heard of. An obscure nonprofit investigative newsroom's editor in chief is paid $585,117 a year and the group gives away its online stories for publication by big-time "partners," including the New York Times, ABC World News, Salon.com and Associated Press. The 32 highly paid reporters seem to investigate only things liberals News Bias, Civil Disobedience, and John Adams' Rule of Thumb. Almost all of our TV "news" shows are unacknowledged, unchallenged, and unopposed Far Left to Moderate Left, pro-Big Government apologists. Occasionally they will make a daring foray out into the hinterlands of "fly-over country," and run a slanted expose on what those wacky Tea Party people are up to, but mostly they stick with their schtick — smug, anti-American, Leaning Left for 15 Long Years. Tonight [7/7/2011] MSNBC's cast and crew will gather in Washington D.C. to celebrate their network being on the air for 15 long years. In that time its hosts, reporters and guests have attacked conservatives and Republicans on everything from impeaching Bill Clinton and conducting a war on terrorism, up to the fight over public unions. All the while some of its reporters and hosts have been thrilled by the likes of Mikhail Gorbachev and Barack Obama. New Low: Hiring Al Sharpton as On-Air Host. When CNN hired Elliot Spitzer many complained hiring the disgraced former governor was a new low in cable news. Allow me to submit to you that with the hiring of "Reverend" Al Sharpton to be their 6pm host, MSNBC has smashed through CNN's record and established a record for finding a new host in the sewer of society that may never be topped. While CNN and others have hired people disgraced by political or sexual scandals, in hiring Sharpton MSNBC has contracted with a "Reverend" who bears false witness and a racial arsonist who is responsible for the deaths of at least eight innocent people. Where does all that bias get you? CNN Tanks in April, Hits Ten-Year Low. The era of the old media is over. CNN had the lowest rated month in eleven years in April; the last time CNN had ratings this bad, the date was August 2001. CNN had a grand total of 357,000 viewers, and just 108,000 in the crucial 25-54 age group. Ratings: CNN Hits 15 Year Low. Last week on Twitter, Piers Morgan taunted me with an invitation to come on his show and debate. We responded in the most serious way we could; we reached out directly to his producer and said, "anytime." Haven't heard back. Kind of glad now. I can get more attention strolling through a supermarket. CNN reaches all-time lows again. Forget April — May was the cruellest month for CNN. The third-place cable news network hit a 20-year prime-time ratings low last month, averaging only 390,000 viewers — down 51 percent from May 2011. Those were also CNN's lowest numbers, in prime time, since October 1991. Nation Magazine Editor Gets MSNBC Show. If you thought Comcast buying into NBC was going to change the overtly liberal bias at the network's news divisions, think again. On Monday [8/1/2011], MSNBC announced that Christopher Hayes, the Washington editor of the far-left magazine The Nation, will be getting his own show in September. effects of media bias. It is a well-told story that the mainstream media — at least to a small degree — have a liberal bias. It's surprising, then, that few people have examined, or even asked, a potentially more important question: Does the bias matter? If the media reports the news with a certain slant, how does it affect those who take in the content? Act: America needs more media bias, claim some on the left. What the self-styled opponents of balance really want is something resembling a state media monopoly — but one that is nominally independent and that is pliant when liberals run the government and adversarial when conservatives do. That is more or less what existed between the 1970s and the late '90s, when competition greatly weakened the authority of the formerly mainstream media. Strident leftism is not going to restore that authority. the Climate Blues. [Scroll down] Al Gore is not wrong to see that the media is changing into something that feels more like professional wrestling than like the hallowed network news broadcast in the Cronkite era. The public at large increasingly sees journalists as entertainers rather than arbiters. "The Daily Show" and "The Colbert Report" play this for all it is worth and increasingly the myth of the objective journalist is yielding to the idea of the engaged party frankly promoting an agenda. Education of a Compassionate Conservative. [Scroll down] Leftist assumption of control of academia and the media was so swift and thorough during the 1970s and 80s only because many conservatives had swallowed the liberal line that such values as self-reliance, merit, individualism, and fairness were not only immoral and indefensible but quite possibly racist and borderline fascist as well. proliferation of media is the best guarantor of accuracy. The multiplication of online news outlets unsettles some traditional journalists, especially those on the soft Left who have until now been accustomed to dictating the narrative. Blogs, they complain, are opinionated and tendentious. Well, yes; but try looking in the mirror, gentlemen. Hill Poll: Most voters see media as biased and unethical. Likely voters hold a dismal view of the news media, generally regarding reporters as biased, unethical and too close to the politicians they purport to cover, according to a new poll for The Hill. A full 68 percent of voters consider the news media biased, the poll found. Most, 46 percent, believe the media generally favor Democrats, while 22 percent said they believe Republicans are favored, with 28 percent saying the media is reasonably balanced. It's a close Race Between 'Don't Know' And 'Nobody'. The Most Trusted Political Reporter? The same poll that showed "undecided" narrowly beating Mitt Romney for the Republican presidential nomination also showed voters are just as divided on political reporters. When asked by pollsters at Suffolk University which political reporter "you trust the most," respondents (1,070 of them were polled) said "don't know" (21%) followed by "none" (15%). Suicide Compact. Is there a profit-making business — other than TV networks and The New York Times — that so disrespects its audience it works overtime to offend them? What other business metaphorically flips the bird to those who don't subscribe to their social, cultural and political worldview? That is precisely what big media does to a large number of potential viewers and subscribers. Michele Bachmann Rips Through the Shroud of Contempt. Control of the cultural and media landscape places some powerful weapons in the hands of the Left. One of their favorites is the Shroud of Contempt, which they use to muffle targeted individuals by declaring them unfit to be taken seriously. The public has been conditioned to applaud "moderates" and recoil from "extremists," so painting someone as a horrid extremist is an effective way to airbrush them out of the national conversation. Let Liberal Establishment Choose Our Candidates. Obviously, the liberal media do not have the best interests of Reagan conservatives in mind when they do their "reporting." So when they tell us certain GOP candidates are unelectable or electable, common sense would counsel us to take their advice with mounds of salt. Maybe this has something to do with it... in Congress invested in news media. Many members of Congress have financial interests in the media that cover them, financial disclosure documents show. The Center for Responsive Politics reported Wednesday [6/15/2011] some 60 senators and representatives, or their spouses, have investments in at least 19 media corporations. still despises Republicans. One can take MSNBC, hose it off, dress it up in moderate looking clothing and call it CNN. It is still a liberal network with an agenda that includes ridiculing Republicans and ensuring that their deity Barack Obama is reelected. John King is more dangerous than Chris Matthews because at least with Matthews the screaming leftist lunacy is laid bare for all to see. Perpetual Media War Against Palin Exposes Imbecility of Mindless Critics. Palin is loathed for what she represents, not for being dumb. Her "stupidity" is simply a shorthand rejection of her unacceptable political ideas. This became obvious when detractors were unable to provide meaningful examples of how she lacks intelligence. On Eligibility, It's Up to the States. For much of our American history, we had a safety net that existed to deal with that political class when its actions and its oaths became divergent — the press. What would Watergate have been without Woodward and Bernstein? Our press used to pride itself on being our watchdog — that assiduous, obstinate handful of reporters who knew, and revered, the service they provided our free nation. However, as we have painfully become aware, that press no longer exists in this country, as it has grafted itself onto the far left corner of that political class. To protect their real estate in that corner, they have refused to approach this issue honestly, and have, rather, responded to the citizens of this country with ridicule and derision. Media Bias in Layout. When it comes to printed news, the front page trumps all — especially the front page above the fold. This is the part of the paper that contains the headlines and the color pictures; it's the part of the paper that's put on display on the sides of city streets. On any given day, more people see the front page of a newspaper than any other page. The stories that make it to the front page above the fold are the ones the newspaper editors feel the public would — or should — find most important. Corsi Book An Important One. As I have come to learn firsthand, the anti-journalist does not seek to report the news. The anti-journalist attacks the people who do report the news or, just as likely, ignores them completely. When in attack mode, the anti-journalist disregards the facts and dismisses the fact finder as partisan, whacko, reckless, and inevitably, in regard to Obama, racist. No reporter in America knows this form of abuse better than Harvard Ph.D. Jerome Corsi. Soviet Propaganda Would Fit In With USA Of Today. Today, the Obama administration is inserting federal government dictates into major aspects of life and the economy in the USA. In the USSR, the governing Communist Party directed and controlled all aspects of life and the economy. Today in the USA, political correctness is used by American progressives to control speech and to suppress undesirable criticism. In the USSR, speech-control played a major role in silencing the opposition. The nuanced difference is that those who critique Obama administration policies are accused of being racists or bigots; in the USSR, individuals who criticized the government were described as spies, traitors or "enemies of the people." Soros' Ties to Major News Organizations: When liberal investor George Soros gave $1.8 million to National Public Radio, it became part of the firestorm of controversy that jeopardized NPR's federal funding. But that gift only hints at the widespread influence the controversial billionaire has on the mainstream media. Soros, who spent $27 million trying to defeat President Bush in 2004, has ties to more than 30 mainstream news outlets — including The New York Times, Washington Post, the Associated Press, NBC and ABC. the New York Times Gets Everything Wrong: It's the Left-Wing Bias. There's no secret anymore as to why the paper has become worse than it ever was. The editors and writers are on the political left; and they are pompous enough to think that since everyone they know thinks the same way, what they are writing is objective. This is not to say that its bias is a relatively new thing. It's just that in the paper's heyday, you could find relatively straightforward top-notch reporting. But even then, on certain issues, there was very little difference between the editorial side and that of the reporters. Paradise Lost. The new graduates of journalism schools are faced with few or no prospects of the future they envisioned. In the minds of many members of the mainstream media, the fault for this drastic turn of events lies with the conservatives and those ignorant masses in fly-over country, not with themselves. Therefore they lash out more than ever against conservatives and Republicans. If Republicans Acted Exactly Like Democrats. One of the best ways to illustrate the utter corruption of an ideology is one of the oldest: imagine if political party "x," did what political party "y" is doing, and see if it passes the stink test. For this purpose, I offer Exhibits A, B and C: Wisconsin, Indiana and the Oval Office, three places where what is occurring stinks to high heaven. The Government of the Big Lie. Faced with nationwide economic misery caused by politicians' runaway deficit spending, some people choose resignation, others, disengagement. Far too many Americans still robotically swallow the left-flavored pabulum which is spoon-fed to audiences by alphabet TV networks, newspapers, and the entertainment industry. ... Busybody politicians have fashioned decades of debacles. And yet many voters continue to cave in to manipulation by government-worshiping "journalists" and the busybody politicians. The Bias They Can't See: NPR's reporters, regardless of how much they might annoy us, are clever, intelligent people. As professional communicators, hired for their abilities and not how good their hair appears on camera, they know how to make words sing and dance. They understand how to advocate without advocating. Advocacy begins with the choice of stories to cover. When you cover the "controversial" Arizona immigration law with great attention and give very little attention to stories that reflect badly on immigrants, you exhibit bias even though no clear advocacy has been shown. Of course, the media will argue that they cover the "newsworthy" stories. This is convenient cover when you get to decide yourself what is and isn't The Media's Deadly Sin. As a nurse, I've learned that people's behavior tells us a lot about their underlying condition. My diagnosis of the media: The average liberal "journalist" today is a rigid ideologue who is Stylebook inconsistency is fruit of political correctness. Today, class, we will discuss matters like The Associated Press Stylebook (APSB) and such. ... Transgendered people, according to APSB editors, are called exactly what they want to be called. Think those editors grant the same courtesy to those who consider themselves pro-life? Guess again. Here's what you'll read under the APSB heading for "abortion": "Use anti-abortion instead of pro-life and abortion rights instead of pro-abortion or pro-choice." The APSB editors couldn't have been more flagrant in their double standards if they had written, "Pro-abortion and pro-choice people have pure, noble motives and seek to protect those rights cherished by all Americans, so much so that we're going to refer to them as champions of 'abortion rights.' Pro-lifers, on the other hand, are simply whacked out, anti-abortion America's Marxist Media. How did the mainstream media get to be the way they are? To find the answer, let's turn to an old source. Helen MacInnes was a Scottish-born novelist whose writing career spanned nearly four and a half decades. Most of her 21 novels dealt with the struggle against totalitarianism. During World War II, she wrote stirring novels of the fight against Nazi Germany. After the conclusion of that war, while other writers were busily plotting stories of the threat of a reincarnated Nazism, she was among the first to understand that communism, with its subversive hooks already well set in the upper levels of many governments, including ours, represented a far greater threat to human freedom. rope-a-doping Republicans on spending. [President] Obama passively professes his desire "to work with Republicans on responsible spending cuts." That prompts GOPers to produce multiple compromise proposals in the hope of finding one Obama will support, even as they wear themselves out promising not to shut down the government as they did in 1995. Meanwhile, Senate Democratic leaders are attacking GOP spending cuts as "mean-spirited, reckless and irresponsible," confident that most journalists will simply repeat their charges without lifting a finger to test their validity. The Media and the Republicans. [Scroll down] This evolution of the mainstream media culminated in the election of Barack Obama, who on the surface fulfilled all the requirements of an ideal presidential candidate for the chattering class. He was one of them. Ivy League educated, well spoken, attractive, and said all the right things designed to appeal to the myopic worldview of the New York-Washington-Los Angeles media axis. But above all he was African-American, an opportunity to wash away the collective guilt so imbedded in the psyche of the press. Barack Obama also knew that he had those tangible and intangible factors that would allow him to manipulate the media, and he did so. The mainstream media became, in the phrase often attributed to Lenin, useful idiots. MSM. In the fall of 2008 and early 2009, the left dared to dream big. Back then, we saw the Daily News' hagiographic endorsement of Obama (their publisher and erstwhile Obama speechwriter has since seen the light). This was quickly followed by Rahm Emanuel's ham-handed "Never let a serious crisis go to waste" quote. In early January of 2009, even before Obama took office, John Judis of the New Republic wrote, "A decade ago, I might have been embarrassed to admit that I was raised on Marx and Marxism, but I am convinced that the left is coming back." James Carville promised their reign would last for 40 years. ... Two years later, and all is lost. Major Networks, the Lamestream Media Again Shows Hypocrite Colors. By now just about every American, save for most of the Obama supporters, knows how "in the bag" the big networks of ABC, CBS and NBC are for the socialist loving, liberal Democrats from the Obama Administration on down to the bottom of the line. They keep proving it on a daily and 'Hail Mary' pass. CNN is struggling. The news and opinion channel, launched in 1980, has seen its all-important primetime ratings steadily erode since the creation of its primary competitor, the Fox News Channel, in 1996. Long gone are the days when CNN was the only game in town and had a monopoly when it came to 24-hour coverage of the news and issues that affect Americans. The decline in viewership of CNN has been arguably due to its left-leaning take on news and its leftist political commentary. Rewriting Ronald Reagan. Everything [Reagan] changed he managed to do against a daily wave of news media hostility to his agenda. Think of everything Reagan did, and then add: He did it all before Fox News. He did it all before the Rush Limbaugh phenomenon. He did it all before the instant battle cry of his defenders could hit the Internet. He did it all before C-SPAN caught on and people could enjoy the game of watching entire speeches and debates and then observing how the network tricksters discombobulated them into liberal hatchet jobs. The Equal Employment Opportunity Commission has expanded its definition of "discrimination" to include things that no one thought was discrimination when the Civil Rights Act of 1964 was passed. The Federal Communications Commission is trying to expand its jurisdiction to cover things that were never included in its jurisdiction, and that have no relationship to the reason why the FCC was created in the first place. Yet the ever-expanding bureaucratic state has its defenders in the mainstream media. The worst of Times. The New York Times today [1/30/2011] offers what it calls the backstory on its publication of the stolen WikiLeaks documents. It includes the intriguing fact that the White House didn't try very hard to deter publication, but the report by executive editor Bill Keller mostly reads like house propaganda and a Pulitzer application. There is a laugh-out-loud moment. It comes when Keller writes that "it is our aim to be impartial in our presentation of the news." It's hard to imagine he believes that. Certainly nobody else does. Olbermann Gone the News Media Is Now Even More Dishonest. Like most conservatives I am of course thrilled to see my political nemesis Keith Olbermann gone from his perch at MSNBC. His Angry Ted Baxter routine in which he hurled insults and dishonesty like a monkey hurls his own poop, was never a pretty sight. But that doesn't mean I couldn't at least somewhat respect Olbermann for flying his partisan flag. With Olbermann gone, the news media is somehow even more dishonest today than it I Wish I Were a Democrat. Oh, to be totally unaccountable for one's failures and blunders, pleading good intentions as a one-size-fits-all justification. Small wonder Democrats always talk of their plans for the future, not the results of their past activities. They never look back for good reason: how would they explain the endless vista of messes? But for the media, good intentions are good enough. And so the Democrats are portrayed as forward-looking, while the Republicans as stuck in the past. Democrat Diversion Strategy Succeeds Again. The Democrats and the left have once again succeeded in their most well-worn, time-tested, and effective tactic: diversion. For the past six days, the country has been watching the spectacle of the Republicans and those on the right defending themselves from absurd and trumped up accusations. This strategy has been so successful over the years that the left and their allies in the media are now greatly emboldened. The Media Has Declared... WAR! Journalism, like any business, enjoys great highs and suffers noticeable lows. Scandals of false stories have rocked no less than CBS and the New York Times in recent years. But this? This was different. This was a near-industry-wide failure. I will argue that this was the worst moment of journalism I have ever witnessed. This was not just an embarrassment, but it was a lie filled with such wishful hate as to damage the industry beyond repair to a huge portion of an audience already doubting or dismissing its credentials. What's worse is that no one complicit in this horrific failure to the core of credibility of the profession much cares. Journalism and Politics. A question that I have been asking for quite some time was brought to the fore once again with the pervasive and obnoxious liberal bias in the so-called news reporting of the assassination attempt on Congresswoman Gabrielle Giffords. Why does anyone continue to purchase and read the New York Times, the Washington Post, Time Magazine, and other mainstream publications which have replaced accurate reporting with faux news accounts rising to the level of outright lies? And why does anyone waste time watching "news" programs anchored and/or reported by the likes of Rachel Maddow, Keith Olbermann, Christiane Amanpour, and others on MSNBC, CNN, the BBC, and the like? Playing the Violence Card. The very word "demonstration" is a euphemism for "show of force." Labor unions have always used the threat of violence. "Community organizing" is what left-wing activists do when they are trying to gin up a rent-a-mob for the benefit of the TV news cameras. Just to be helpful, the MSM used to warn every year of "a long hot summer" if summer jobs programs for urban youth weren't passed. Whenever there is actual violence by lefties, as recently by "students" in Britain or by government workers in Greece, our lefty friends play both sides of the street. If there is property damage, they blame the police for not controlling the crowd. If rioters get injured, they blame the police for "overreacting." Did you know that almost all MSM reporters are labor-union members? Progressives and the 'Bad Stuff' in the Constitution. It is hard to actually believe that something as prototypically American as a public reading of the U.S. Constitution by people recently sworn to uphold it could be at all controversial. For that matter, it is even harder to believe that such an exercise should become the subject for ridicule by the very people — the press — whose free speech the founders went out of their way to protect. How Did All That Happen? How did villains become heroes, global warming become "climate change," and the most liberal senator become a "bipartisan" president? ... Lurking somewhere behind all these improbables is a rather small Western elite that is enormously influential in the media, government, the arts, universities, and Hollywood. Autism Fraud Just the Tip of the Iceberg. Last year the World Health Organization, having exaggerated the world AIDS problem by 12-fold, then hyped SARS and then spent four years terrifying us over avian flu (remember avian flu?), converted the mildest flu strain in decades (swine flu H1N1) into the first flu pandemic in 41 years simply by rewriting the flu pandemic definition. Aiding it was a study in Science magazine that completely misrepresented the citations it used as authority. 2010 a Banner Year for MSM's Ministries of Mistruth. In George Orwell's 1984, set in a pre-computer era, Winston Smith, working in the misnamed Ministry of Truth, alters documents that contradict or conflict with his totalitarian government's take on history, wiping out inconvenient truths or revising them to fit the current template. In 2010, the establishment press ramped up its propaganda role, acting as a collective of preemptive Winston Smiths. They ignored or massaged important news stories in ways that prevented the vast, relatively disengaged majority of the population (probably 85%, but perhaps as low as 80% thanks to the Tea Party movement) from getting their arms around the truth without doing a great deal of independent research. The 10 Biggest 'Non-Story' Stories of 2010. [#10] The Resurgence of State's Rights — Somewhat supported by the Tea Party movement, and certainly related to ObamaCare and Arizona's immigration battles, the broad issue of state rights in the context of constitutional government is garnering interest among Americans perhaps like never before. The 10th Amendment is being championed on an increasing number of fronts and even the concept of "nullification" has returned to our modern dialog. Big Media really isn't into the whole Constitution thing. It would never occur to them that Washington is less than omnipotent. aliens are illegal and alien. Are "illegal aliens" simply misunderstood "undocumented immigrants?" The Society of Professional Journalists (SPJ) Diversity Committee believes so, and it's engaged in a campaign to "inform and sensitize journalists as to the best language to use when writing and reporting" on the issue. That may sound nice, but there is nothing insensitive about calling a crime a crime. Conservatives More Charitable than Liberal Scrooges. While liberals often want to take other people's money and spend it the way they think is proper, liberals are, on the whole, hypocritically far less generous with their money than conservatives that they demonize are. Countless studies point this out, yet the false notion and stereotype that conservatives are harsh and do not care about others stubbornly persists, most likely because such false memes are propagated and perpetuated by the liberal members of the mainstream media. 2010, Media Scolded Americans as Anti-Islamic, Anti-Immigrant Bigots. Condemning everyday Americans as racist, anti-immigrant Islamophobes was a favorite media theme in 2010, as documented by the Media Research Center's year-end Best Notable Quotables of 2010. Polls showed most Americans supported Arizona's effort to curb illegal immigration and opposed building an Islamic center near the site of the destroyed World Trade Center towers — but on both scores the media elite stacked their coverage against the public. No great surprise here: York Times Editor Bill Keller is a registered Democrat. According to voter registration records, New York Times Editor Bill Keller is a registered Democrat. Keller has been registered as a Democrat since 1998 with his Manhattan apartment listed on forms as his address. The New York Times has long been criticized by conservatives as politically biased in favor of Democrats. In 2007 a Rasmussen poll found that 40% of Americans believe the paper has a liberal bias. The Editor says... That's only because 50% of Americans don't recognize bias when they see it. Latchkey Journalism. TV news' phony objectivity, once personified by avuncular Walter Cronkite, has mutated into the "bratcast." When CBS' Cronkite for decades told millions of viewers each day "that's the way it was," Americans were expected to take it as gospel truth from the lips of a grandfatherly wise man. In the Internet age, with its endless flavors of news reporting, a Cronkite is as obsolete as an 8-track tape player. Washington Democrat-Media Complex. When someone says "journalist" do you have a picture of a fedora-sporting, cigar chomping, agitator of jaded mien and independent mind, a man stubbornly outside the political establishment looking in and eyeing it all with suspicion? Do you get a flash of a writer that stands in opposition to entrenched powers, one looking out for the Little Guy? If so you've been watching too many black-and-white moves from the 1940s. Today, "journalist" simply means an extension of the Democrat Party. of Voters Are Angry At The Media. Sixty-six percent (66%) of U.S. voters describe themselves as at least somewhat angry at the media, including 33% who are Very Angry. A new Rasmussen Reports national telephone survey finds that 31% say they are not angry at the media, but that includes just nine percent (9%) who say they are not at all angry. It's Maureen in America Again. Especially after bad days, liberals like to go to columnists like Maureen Dowd at the New York Times for some reassurance that everything's fine with liberalism and it's just the rest of us who are a bad mix of weird, greedy, ethnocentric, dumb and scary. The Censorious Sound on the Left. Let's give the media a break and conclude that when it comes to Rush Limbaugh, they just have no common sense. Fine. That's where fact-checking comes in. A couple of minutes on the computer would have proven that these quotes were pure fantasy, put forward by radical leftists, with no substantiation whatsoever, purely to assassinate this man's character, as is their wont. But the Left — including many in the "news" media — is so blinded by its hatred of Rush Limbaugh that it will accept any accusation as authentic, and the more salacious, the better. Has Big Media Global Warming Bias Begun to Endanger the Public? Why did the AP and the [Boston] Globe de-emphasize Maine officials' snowpack warning, especially when doing so endangered the property and safety of the public they are supposed to serve? The Globe is owned by the New York Times Company. Both the Times and the Associated Press are heavily invested in the myth of When Bias Has Its Own Media. Bias always exists, but journalistic bias has a tipping point at which instead of a free press, we have a propaganda press. When does that tipping point occur? Henry David Thoreau wrote that there is a certain amount of injustice in government, just as there is a certain amount of friction in operating a machine. But when "friction has its own machine", then the injustice is no longer an unfortunate byproduct, it is now the purpose of the machine. Issues vs. The Mainstream Media. The mainstream media has become thoroughly useless to the American voter, offering information that focuses on personal quirks and foibles, rather than the candidates' positions and, if applicable, voting records on issues important to the American electorate. Perhaps this is why so many Americans are turning away from traditional media outlets for their information, political or otherwise. Since even before the 2000 election — and poll after poll, both scientific and not, bears this out — the American public has become intensely disenchanted with not only the status quo of our political class but with the grotesquely transparent engagement in political activism by our "free media bias is real, revealing. Polling of MSM journalists showed they voted 9-1 in favor of Bill Clinton over George H.W. Bush in 1992 and voted in the same margin for John Kerry versus George W. Bush in 2004. No surprise, then, that the Center for Media and Public Affairs found Kerry received 77 percent favorable coverage in 2004 while Bush received 34 percent favorable coverage — quite a chasm, in my view. Hypothetical question: If Bush had instead received nine out of 10 votes of the MSM in 2004, does anyone really believe Kerry would have garnered that 77 percent favorable coverage compared to Bush's 34 percent? Distrust in media hits record high. Fifty-seven percent of Americans do not trust the news media to accurately and fairly report the news, a new high according to a Gallup poll out Wednesday [9/29/2010]. The percentage of Americans who distrust the media has been steadily climbing since the mid 1990s, when distrusts in the news media rated hovered around The Election's Done; What Now? The statist ideology of Progressivism first shaped federal law in 1890 and has moved forward for 120 years, reshaping the states and cities along the way. Progressive education reshaped the public schools in the 1930s, proceeding since uninterrupted; it has produced generations of journalists who have evolved from professionals into political pimps for Progressivism. Dupes — and Traitors. One of the last mysteries of the Cold War is why so many seemingly intelligent Americans believed to the bitter end that the Soviet Union — history's most vicious dictatorship and an economic basket case — was paradise on Earth. Well, now we know. In his new book Dupes, Paul Kengor provides a stunning, detailed exposé of how the Kremlin set out to manipulate those among us whom Lenin famously described as "useful idiots" — Americans who could be made to fall hook, line, and sinker for Soviet propaganda and who then used their influence to swing public opinion behind the Soviet Union's policies. Journalistic Misfeasance. The Gallup Organization has just released the results of a poll that, for the fourth straight year, reveals that the "majority of Americans say they have little or no trust in the mass media to report the news fully, accurately, and fairly. The 57% who now say this is a record high by one percentage point." Those that do express trust in the media (43%) tie a record low. Why Are Voters Only 'Angry' When They're Tossing Dems Out? Interesting, isn't it, that if you listen to liberal journalists, the voters are always angry and stupid when they're tossing Democrats out. But they're high-minded and caring when they're giving Republicans the heave-ho. You may recall that in 2006 and 2008, when Democrats took over both Houses of Congress, it was those high-minded, caring "soccer moms," looking out for the welfare of their families, who went to the polls to vote for Democrats. They were never described as "angry" or "irrational" or "throwing a temper tantrum" — even though they were cleaning house just as the voters did Fire the Media. The Giant has awakened. The American voter just threw the bums out of Congress — not enough of them, but a very good start. The crucial question today is: Will the Giant just turn over and go back to sleep? ... The Giant must fire the media. It's the easiest thing in the world, as Rush Limbaugh has pointed out for twenty years and more. It's called the "on off switch" on your TV, or your browser, or your iPhone. the Election Approaches, Do Not Trust the MSM. I am ashamed to admit that there is one thing the contemporary mainstream media does well. Having spent years studying politics, history, and language, I find it amazing that media is able to convince people to believe conflicting narratives. The creation and perpetuation of these contradictory beliefs cannot be possible without a media structure, as well as an educational structure, that discourages, and too often scorns, analytical thinking. With Tagline, MSNBC Embraces a Political Identity. MSNBC, once the also-ran but now the No. 2 cable news channel, has a new tagline that embraces its progressive political identity. The tagline, "Lean Forward," will be publicly announced Tuesday [10/5/2010], opening a planned two-year advertising campaign intended to raise awareness of the channel among viewers, advertisers and distributors. Democrats got 88% of 2008 contributions by TV network execs, writers, reporters. Senior executives, on-air personalities, producers, reporters, editors, writers and other self-identifying employees of ABC, CBS and NBC contributed more than $1 million to Democratic candidates and campaign committees in 2008, according to an analysis by The Examiner of data compiled by the Center for Responsive Politics. Media Bias: The Chasm Widens. Thanks to the Washington Examiner, which analyzed data from the Center for Responsive Politics, we learn that "senior executives, on-air personalities, producers, reporters, editors, writers and other self-identifying employees of ABC, CBS and NBC" were overwhelmingly in the Obama camp. Overall, 1,160 employees of the big three networks gave Democratic candidates and campaign committees $1.02 million, while 193 contributed $142,863 to Republican candidates and campaign committees. That's a 7-to-1 ratio. with Sally Pipes on ObamaCare at Six Months. [Scroll down] "I would say the mainstream media, of course, always likes to increase the role of government in our lives, and Obama, Pelosi, and Reid believe that government can make decisions for the American people better than we can make for ourselves. It's an ideological vision that they have, and that is not the American way. Bozell Launches 'Tell the Truth' Campaign. Media Research Center President L. Brent Bozell III is calling on members of the liberal media to "Tell the Truth" about the administration's efforts to push the U.S. toward socialism. The Nexus between Liberals and Racists. Conservatives are disparaged, insulted, belittled, and denied the public pulpit, just as blacks once were. The common denominator in each travesty is the mainstream media. Deceptive Mainstream Media Techniques. Just a few decades ago journalism in this country was actually about reporting the facts. Yes, journalists may have leaned to the Left, but at least reporters made an effort to be fair. Today, journalists are more interested in "making a difference" than in any antiquated standards and they play by PRAVDA rules. Every news story is filtered through an ideological prism and instead of asking who, what, when, how, and why, the stories are framed around a simple rule: How can we hurt the Right and help the Left? conservatives suspicions regarding the media justified? Yes. Howard Kurtz whines that "[Conservative] candidates seem to regard it as an affront when reporters challenge them on their past statements and inconsistencies, which is a basic function of journalism. They are avoiding or limiting interviews with all but the friendliest faces as a way of circumventing the press. And some of them delight in skewering the mainstream media, a tactic that plays well with their base." It's interesting that Kurtz doesn't mention the Obama administration's attempt to boycott Fox News, and its ongoing complaints about that network. Reasons Government Has Become Completely Dysfunctional in America. [Scroll down] For a long time, the mainstream media in this country could fairly be classified as center-left. However, over time it has drifted from center-left to far-left and it has affected the way our politicians behave. Politicians on the Right know they can't get a fair shake from the media; so they tend to be overly cautious, even though the populace leans to the Right. On the other hand, politicians on the Left have been emboldened by the unwavering support of the media. the Media Ignored the Nashville Flood. In a climate where chatter is constant and ubiquitous, newsworthiness now seems to be determined less by what's most important than by what all those other media outlets are talking about the most. Sheer volume of coverage has become its own qualification for Offers Offensive Explanation For Why Media Ignored Nashville Flood. [Scroll down] Or how about this for a narrative: Tennessee was one of the few states Obama didn't win in November 2008. As part of the media narrative concerning Bush and Katrina was that he was racist — or, at the very least, that race played a factor in the slow response — couldn't the press have played up the "Obama Lost Tennessee" angle concerning why the White House didn't declare a state of emergency there until May 4[,] days after the floods began? Readers are advised that this "narrative" suggestion is by no means an accusation on my part that McCain's victory in Tennessee had anything to do with Obama's slow response to the Nashville floods. Instead, as media rarely need plausibility for their conspiracy theories, this would have been just as feasible a narrative as Bush's response to Katrina involving race. War of Words. As we know, the world of political journalism has radically changed in the post-WWII decades. The methods, the tone and the very role of media have morphed over time, although they have always been prone to liberal leanings. They began as mere reporters, whose sole function was to chronicle events in Washington. ... Then, as the influence of radical socialists who had begun to infiltrate journalism schools in the 1930s began to take effect, they came to view their profession as a way to "change the world for the better." The Left and Its Talking Points. The Journolist story demonstrates active, covert collaboration among leftists to plant political themes in the media. Long-time listeners of conservative talk radio are aware of audio montages where old-line media talking heads repeat verbatim a set of words that can't be anything other than shared talking points. A perfect example was the 2000-era Dick Cheney "gravitas" showcased by Rush Limbaugh. It's one thing to ask how proper reporting of Obama might have changed the outcome of the election. I'll ask a bigger question: Did old-line media journalists share talking points to prop up the global warming issue? about the JournoList scandal. Too Many Voters Unaware Of How The Mainstream Media Corrupts The News. My sister is an intelligent senior citizen but she doesn't watch Fox News very much though does watch CNN and upon further discussion told me she'd never heard of Anthony ("Van") Jones, the green-jobs czar ousted from the White House after Mr. Beck exposed his communist background. Her television news sources are CBS, NBC, and ABC, and, as a Democrat, she had no problem voting for the relatively unknown Illinois Senator Barack Obama. She also refuses to get involved with the World Wide Web. I've done a similar personal survey of persons I know to be Obama supporters and, similarly, their news sources are the same. Difference between 'World Opinion' and Left-Wing Opinion. Here's a challenge: Can you name one difference between what the media refer to as "world opinion" and left-wing opinion? Take all the time you need. No matter how much time you take, you probably won't come up with any examples. ... The world's media and virtually all international organizations are leftist in their politics, and they define "world opinion" and in turn shape it. Of course, there are other powerful institutions in the world that shape public opinion. But virtually none of them contravenes the left-wing views of the world media and world organizations on world issues. is not being televised. [Scroll down] Paradoxically, over the last two generations, the aging leftists have been quite successful in establishing their agenda without violence, by infiltrating and dominating the education, legal, and media establishments in our country. Teaming with the trade unions whose movement has been a tool of the International Communists for over a century, this coalition has succeeded in radically altering the American economic, political and moral landscapes. Their foothold has been so firmly established, especially in the media, that those promoting traditional American values can scarcely get their voices heard through what now amounts to the Pravda media. Good Riddance to Newsweek. It is extremely doubtful that The Washington Post will find a buyer for Newsweek magazine and it would not surprise me if Time magazine disappears as well. Both are an offense to anything that passes for journalistic ethics or practices and have been for far too long. ABC's Davis to SEIU. Another jump from the media to politics: ABC News's deputy political director, Teddy Davis, emails that he's leaving the network to join SEIU's already-muscular communications and politics operation. The Naked Left. The establishment media, which has been obviously tilted to the left for fifty years, petulantly denies any leftist bias. This utter denial continues more than forty years after Agnew's speech against the television elites in 1969 and in spite of polling data, such as a Gallup poll which shows a huge plurality considering the media more liberal than conservative and a Zogby Poll which shows 64% of Americans seeing a liberal bias in the media. Bozell Reacts to Americans' Heightened Anger with the Media. A new Rasmussen poll found an astonishing two thirds of American voters are at least somewhat angry at the media, including an entire one third who said they are 'very angry.' That's disturbing but unfortunately, not surprising. The liberal media lost touch with the public and fair reporting long ago, and Americans are sick of their lavish praise for a President that is leading our country and economy into a disastrous state. The American people are abandoning the old media by the millions because they are simply fed up." The Origins of the Lapdog Media. Noam Chomsky, a self-declared socialist, once said, "Any dictator would admire the uniformity and obedience of the US [mainstream] media." Never would he have imagined that his critique would apply more than ever to the present-day relationship between the mainstream media and President Obama. This march to the media's present role of being in league with the Obama administration is the culmination of the good-versus-evil narrative of modern journalism. Media no longer report just the truth. We've become so acclimated to politicians in both parties lying that we can hardly distinguish between fact and fiction or, worse, actually believe the drivel spewed by either. But at some level this is understandable as you would hardly expect objectivism from either party. The calamity in this cauldron of mendacity, however, is the media from whom one would expect a fair and balanced news offering. Media's fiscal credibility deficit. There's a good reason to remain pessimistic about deficits as far as the eye can see. It's called the "news" media. Legislators who want to get re-elected will clearly want to avoid any spending decision that will create bad national publicity. And our news media, the manufacturers of bad national publicity, will send crying victims down the assembly line at the slightest thought of a social spending cut Integrity in the Rear View Mirror. Looking for your integrity in the rear view mirror is becoming an occupational hazard in the newsroom. ... In the run-up to Obamacare; Social Security, Medicare, Medicaid, and prescription drug relief were all celebrated as social landmarks. Yet somehow these programs are never judged to be failures once they become corrupt and/or CNN's decline follows rise of grass-roots America. In a year when America's tea party activists have been surging, cable news networks that slam the grassroots movement have been dying in the ratings. Is it merely coincidence? As widely reported, 2010's first quarter ratings for cable news networks were released earlier this month. Compared to the numbers in 2009, Fox News Channel, frequently reported as a favorite of the tea partiers, actually gained 3 percent over last year's numbers, but MSNBC, whose left-leaning commentary has been far more critical of the movement, has dropped 15 percent of its audience. Bill Maher's 'Black' President. [Scroll down] It is the liberal media machine which ignores intellectual blacks like Thomas Sowell or Walter Williams and elevates racial hucksters like Al Sharpton and Jesse Jackson to the level of "community spokesmen." It is our leftist-dominated entertainment complex which continues to glorify black low-lifes and gang-bangers in music and on film. It is the liberal academics who continue to insist that America is a fundamentally racist nation, and that "reparation" must be made to peole who never experienced slavery by people who never engaged in it. to Advertisers: We're the Only 'Non-Partisan' Cable Network. Stuart Elliott of the New York Times's Media Decoder blog reported on Tuesday [4/13/2010] that CNN, a network known for its consistent liberal bias, is now incredibly touting itself as "the only credible, nonpartisan voice left" on cable television. Elliott noted that this spin was being pitched by the network at a Tuesday morning [4/13/2010] event for advertisers at the Time Warner Center in New York City. The Source Of Today's News Is Crucial. [Scroll down] Circulation figures for many liberal news publications have plummeted and yet this hasn't stopped the continual demonizing of the conservative majority in this country. It's as if their editorial boards live in a womb nourished by a placenta of left-wing dogma and are totally oblivious of reality. They still haven't a clue of what the Tea Party movement means and continue to portray it in a negative light. Reports that come from the Associated Press, Newsday, Newsweek, Reuters, The New York Times, The Los Angeles Times, and The Washington Post need to be read with a jaundiced eye. Notes Blatant Media Hypocrisy on Protestor Anger. Last night [3/30/2010], Bill O'Reilly used recent instances of inflamed, occasionally violent liberal protests to give his viewers a lesson in Media Bias 101. Lefties dominate the mainstream press, and are reluctant to cover events that don't suit their agendas, he stated. "The Mainstream media largely ignores crazy stuff generated by the far left because many media types sympathize with liberal politics." It's hard to put it more succinctly than that. about media bias related to "tea parties". Triumvirate Destroying America. [Scroll down] This boils down to the biased, dishonest, and fraudulent mainstream media posing a mortal threat to the survival of our democracy. If America is to survive as the greatest country on earth, it requires an informed citizenry getting the information needed to make sound judgments. That's not happening now, and until it does happen we'll be under the shadow of an existential threat. So, the public better start going out of its way to get both sides of the issue. That means they have to stop relying on the mainstream media as the exclusive source of news and commentary. the next 'crisis' will be manufactured. Now the MSM plays a vital role covering up initial results that fall well short of "expectations" and the financial justification erodes before our eyes. Never once does the MSM compare real versus actual results, or re-examine the business case, or question the ability to achieve the desired outcomes. The stimulus inability to create jobs and the inconsequential climate improvement promised by the "cap and trade" bill are conveniently ignored by the MSM. The Mainstream Media is an active co-conspirator to government greed and manipulation, hiding in plain sight, and has forfeited any credibility as a fair and balanced check and balance of power. of media bias in President Obama's favor. the worst: There is an unspoken but real impulse in today's media to see themselves as "independent" of America, even above America, not so much because they are superior to America but because America is so egregiously flawed. It is their role to shed light on America's failings. They're not keen at being seen as Americans. They choke at the idea of wearing flag pins. enraged speeches and street disorders across the country that accompanied the inauguration of President Bush may tell us more than we want to know about what is happening to this country. Elections are supposed to be an alternative to other ways of settling political differences, including riots, military coups and dictatorships. But riots have been re-christened "demonstrations" by the mealy-mouth Media's War on Conservatives: I've been writing a lot lately about the disconnect between the American legal profession and the American mainstream. The legacy media is no different from the bar on this score. Because of that, it is shriveling into extinction. It can't survive on a competitive playing field by enraging its consumer base — the only potential savior on the horizon is the possibility of a bail-out by our current Leftist government. Declare War on the Establishment Media. [Scroll down] I say that the establishment media is, as a collective entity, intellectually and ethically corrupt. Not just liberal, but intellectually dishonest, often knowingly, to a stupendous degree. So many examples could be given, but here's one that is apt right now: There is no standard too duplicitous on which these media folks will act on behalf of their liberal ideology. Journalists' Tweets Show Their Liberal Bias. Survey after survey shows the ideological bent of most mainstream press reporters favors the Democratic Party. And that's before one reads their stories, watches their news broadcasts and considers their collective mea culpa after giving Sen. Barack Obama the hands off treatment during the 2008 election cycle. Still, press members continue to cling to their impartiality pose. But watching how some reporters work in our Twitter-fied culture makes it even more obvious such a stance can't be believed. MSNBC President Phil Griffin Finally Comes Clean on Channel's Liberal Slant. It took a while, but MSNBC President Phil Griffin has finally admitted and embraced his cable network's hard-left slant. He told the Chicago Tribune that he will try to carve out a niche on the left, hoping some day to rival the Fox News Channel's record-setting ratings. Matthews: Washington Post 'Used to Be Liberal', Now 'Hard to Read Ideologically'. Chris Matthews could have a future in comedy if only his funniest moments weren't unintentional. Here's today's knee-slapper: The Washington Post is not ideologically liberal in its editorials. Mass media and private liberty. The spectacle of a White House warring against the single television news network which does not fawn over the president, and attacking his most prominent talk radio show critic, brings home just how bureaucratized information, opinion, and thought have become in America. In television news a handful of institutions determine what is newsworthy and what is not for those tens of millions who only get news from the video screen. That decision — what is "news" — decides everything. about Obama vs Fox News Channel. Liberal 'Journalists' Attack, Real Americans Suffer. Andrew Breitbart's recent smackdown of Max Blumenthal at CPAC (for his vicious smears against James O'Keefe) serves as a reminder to us all that when Liberal "journalists" attack, they have one goal — and it isn't reporting the truth. It is to win at any cost no matter what the damage is to the victim. It is called the politics of personal destruction and it reflects the utter nihilism of Liberalism. Tea Party Movement vs. Elites: The danger of the "birther" question is irrelevant because the elitist [New York] Times will always find something that they can use to try and discredit anyone who isn't liberal. And if there is a crowd of a thousand tea party protesters the media will canvas all of them until they find one willing to say something A Biased Media at Work. [Scroll down] This kind of frontal attack on conservatives is glaringly obvious, relatively straightforward and easy to counteract. Napolitano was forced to issue an apology to veterans [for the Homeland Security Report, "Right-wing Extremism"]. However, less obvious are the unrelenting, insidious tactics of mainstream media which disproportionately report events that favor liberals and liberal agendas over those of conservatives. The media has even gone so far as to censure (sic) coverage of stories that favor conservatives or conservative views. Such biased coverage or, entire lack of coverage, marginalizes issues important to the conservative agenda, damages the ability of conservatives to have their ideas accurately and fully presented and, ultimately, inflicts damage on the conservative position. James O'Keefe and the Fourth Estate's Double Standards: Reporters for top media outlets have masqueraded over the years as workmen, students, and even bartenders in their effort to expose corrupt officials and misdeeds — and, of course, to get a good story (and maybe some coveted journalism awards). Well, who could imagine such journalistic shenanigans in light of the way the mainstream media is portraying James O'Keefe III, 25, the videographer who became famous for exposing ACORN, the liberal community organizing group? Confessions of an anchorman. There is a case to be made that the steady drumbeat of hyped-up threats — SUV's that roll over, kitchen-counter bacteria, road rage, swine flu, amber alerts and the stations' willingness to enlist governments and institutions to solve those "perceived" problems, actually drives a lot of bad and unnecessary public policy. But it's a formula that has worked as a cash cow for your local TV station. Losing the Pro-Abortion Media Bias: Former New York Times reporter Alex S. Jones ... sees the bias in the mainstream media as not political but "cultural." He defines this as "a set of beliefs" that can "skew" reporting. Taking the word "political" out of the equation doesn't make any sense. truth" abortion: Many in the media resent any suggestion that they are either politically biased or that journalists' personal views stop them from doing a good professional job of accurately reporting the news. The way the issue of partial birth abortion has been reported — or not reported — gives the lie to such protests. Use and Abuse of Euphemism: Whatever you think of the practice of partial-birth abortion, surely no one can truly be pleased with the media convention of describing it as "a certain abortion procedure" or "a controversial abortion method." [...] Even the practice of referring to it on the second, third, or fourth mention as "what opponents call 'partial birth' abortion" is questionable. What do supporters call it? Bias, Witting and Unwitting, Among the Gods of Journalism The hidden agenda of unionized media: [Scroll down] You should also know that your "objective" network correspondent, roaming the halls of Congress right now trying to ferret out the "truth," probably pays hundreds, or even thousands of dollars in union dues to AFTRA every year. He or she, in all likelihood, depends on AFTRA for one of those "Cadillac" health insurance plans that is the subject of so much debate. ... Now, do you really think your friendly network correspondent is gonna criticize the Senate Democrats' bill? How To Kill Political Correctness Before It Kills Us. I've been doing consumer reports for over 34 years and, from my perspective, the No. 1 consumer issue is the sad state of the mainstream media. It has become something other than a segment of the media, and now can be correctly described as a propaganda organ of a Democratic Party controlled executive branch of the U.S. Government. What's worse, it is totally biased, dishonest, and fraudulent and can no longer be trusted to deliver the information needed by the American people. Ways Liberals Misjudge the American People: [Scroll down slowly] Because the Left controls the mainstream media, they can often get away with lies no conservative ever could. Put another way, conservatives tend to be more honest because they have to be while liberals are used to having the mainstream media cover up, ignore, and explain away their lies. The problem with that is that over time, the MSM has become less powerful and the new media has filled the gap. Rasmussen Survey: Voters See Media As Liberal, Biased & Too Powerful. A new survey from Scott Rasmussen finds that more than half of all voters (51%) believe "the average reporter is more liberal than they are," and two-thirds (67%) think the media have "too much power and influence over government decisions." Rasmussen's poll was released Thursday [1/14/2010]. You Ready to Subsidize Reporters? [There is] some recent poll data collected by the Pew Research Center. Only 29 percent of 1,506 adults surveyed said news organizations generally get the facts straight. The facts! Sixty percent said the press is biased, up from 45 percent in 1985. Just 26 percent said that news organizations are careful their reporting is not politically biased. War on Fox Is Liberalism's War on Dissent. Liberal politicians have been spoiled with mainstream media favoritism for so long that they believe anything other than sycophancy is mistreatment. Their selective outrage is as hollow as it is risible. In fact, Fox News seems much more conservative than it is because no other television network over the past half-century has been anything but decidedly liberal. A Leninist View of the American Media: Conservative exasperation with media bias is a tired refrain, a waste of energy. ... The premise that now guides the mainstream media is something we haven't seen before in this country — thus the never-ending consternation of conservatives at the blatant bias of the media and the nonchalance of its practitioners when caught in the act. We have seen press behavior like this before, though — not here, but in China and the Soviet Union during their classical Leninist eras. ... Where conservatives see dishonesty, double standards, and deception, media practitioners see themselves as fulfilling their role in consolidating Party power in pursuit of a socialist utopia. To The Ministry of Propaganda. Freedom of the press was included in the Bill of Rights for a reason. The founders of this nation expected the "fourth estate" to keep government honest by informing the public of the truth. When the press becomes a creature of government, and freely declines to report fully, completely and honestly to the public then it is no longer free. It has enslaved itself... Conservatives and the death of newspapers. Not long ago journalists were champions of free speech. Now they routinely manipulate, ignore or suppress information. They've become the gatekeepers of multiculturalism and political correctness. Total Disappearance of the Mainstream Media. Now it's time to look at the mainstream network news stations, if we must. How in the world could they lose out to cable stations to begin with, and why do they keep slipping? They slip because they do not deliver the news. They in fact deliver the news with innuendo and thinly veiled bias. When that is impossible, they simply skip the story. It is time to face facts; politics rules when it comes to news. The Slave Press. Freedom of the Press, like almost all our constitutional protections, has been murdered by the courts and the Left. Those who view slave masters like Castro as "liberators" have no notion of what freedom really means. The Left does not want the responsibility of freedom, especially in the arena of facts, ideas, and opinions. What we have today in America are willing serfs of The Slave Press. It exists solely to expand the power of the Left, and the Left exists only to grasp power and to choke liberty. Media Malfeasance. The majority of Americans realize the liberal bent of the old media. Most can identify opinion pieces that are increasingly presented as news, but they have to resort to the net or talk radio in order to be made aware of all the good news which is deliberately relegated to the back burner in the (remaining) newspapers and nightly news broadcasts. Our Dangerous Media. For decades, the old media, consisting of the big three networks and the newspapers of most major cities have had a stranglehold on what information gets disseminated to the public at large. The media elite have decided which issues qualify as news. Not surprisingly, the majority of the information that makes it to the airwaves or in print is overwhelmingly one-sided, reflecting a world-view steeped in progressive values and blatantly hostile to traditional values. What is Bias? Here are the "Seven Violations of Media Objectivity": 1. Misleading definitions and terminology. 2. Imbalanced reporting. 3. Opinions disguised as news. 4. Lack of context. 5. Selective omission. 6. Using true facts to draw false conclusions. 7. Distortion of facts. Media Has Lost the Public's Trust. A recent report indicates that the general public's trust in newspapers and television news are at all-time lows. In addition, another report shows that newspaper subscriptions are facing an accelerated decline. These reports, combined with the major networks news programs and CNN's continued slide in ratings, means the public is fed up with news coverage that is not fair and balanced. Slobbering Sycophants of the MSM. There was a time, after all, when Americans actually had a rather high opinion of those who brought us the news in a fair and reasonably objective manner, and when editors and publishers didn't allow their opinions to bleed all over the rest of the newspaper. But those days are long gone. Today, nobody trusts print or TV journalists. Liberals may have been delighted to find the MSM working overtime to get their guy elected last year, but in the final analysis nobody respects a whore. the Tank: A Statistical Analysis of Media Bias. During the 2008 presidential election, even center-left observers have noted the unmistakable bias of the prestige news media toward Democratic candidates and the Democratic Party in general. As we shall reveal, the bias of the media is pervasive, ideologically motivated, and quantifiable: that is, it has been admitted, measured, and analyzed in statistical terms. Those results reveal a media doggedly out-of-touch with the political center and tilted decidedly leftward. whine about conservative media: Neil Gabler, professor at the Annenberg School of Journalism at USC pretended to be unable to detect liberal bias in the media, including leftwing papers like the one he was writing in. Perhaps that's because he also failed to notice that the Annenberg School is run by a former Clinton Administration official and — like journalism schools across the country — its faculty is 100% leftwing. frivolity, dubiety and the truth in medialand: It is not news that the Establishment press hangs way out there over the leftward edge, and long has. In 1972 more than 90 percent of top people in the national print and electronic media voted for George McGovern. In April, 1980, only about 2 percent of the editors attending the annual meeting of the American Society of Newspaper Editors in Washington indicated in a survey they wanted Ronald Reagan to be the next president. deny conservative media bias: A new poll indicates most Americans disagree with top Democrats that there is a conservative bias in the media that shouts down and drowns out liberal voices. A Double Standard at CNN: The double standard at CNN is: when those on the right do something it is fishy and needs an expose. When the same thing is done on the left, it is just "the given." We must hold the media accountable. Conservatives have made a target of the liberal biases of the "mainstream" media. It has become a tired attack, wrung out of its freshness and meaning by constant repetition. So why not leave it alone? The reason is simple: It's too important to leave alone. The liberal media's ideological prejudices are growing ever more blatant, outrageous, and dangerous. Liberal Media on Life Support. [Scroll down slowly] Ten years ago, this might never have surfaced, as the media giants, in their lockdown control of the presses and airwaves, seemed to have things their own way. Then the Internet emerged as a free and alternative center of power, a 'press' that looked at the press with the critical eye that the press turned on others, and an age of exposure began. Skeptics took aim at the press and its doings. Blogs rose that put the Times under their microscope. Powerline and Hugh Hewitt took on local papers, which are now in some trouble. Instapundit pointed out double standards when and where they occurred. The Ten Worst Media Distortions of Campaign 2004. [For example] Dan Rather's forgery fiasco; ignoring, then attacking, the Swift Boat Veterans for Truth; spinning a good economy into bad news; and swooning over John Edwards' image [while] ignoring his liberalism. With One Exception, Every CBS Reporter, Director, Anchor A Liberal. Give Mika Brzezinski credit for candor. She has stated that during her 10 years at CBS, every reporter, producer and anchor she knew, with one exception, was a liberal. ... Will Mika's revelation trigger a frantic internal investigation at CBS to root out the Republican interloper? This is an original compilation, Copyright © 2015 by Andrew K. Dart Ex-Washington Post Ombudsman, Who Recognized Liberal Bias, Killed in New Zealand. Howell agreed with readers who saw "a tilt toward Democrat Barack Obama" in the paper's campaign coverage, as she had earlier determined "Democrat Barack Obama has had about a 3 to 1 advantage over Republican John McCain in Post Page 1 stories since Obama became his party's presumptive nominee." Turn: Judge and Decide the Worst Media Bias of 2009. For each of the 16 categories, pick one quote — the one you think is the most outrageous in the category. Then move on through all of the categories. Picks for Worst Media Bias of 2009 Unveiled. Nearly 8,000 of you participated in the public online voting for the Best Notable Quotables of 2009 (7,903 to be exact), weighing the idiocy and outrageousness of dozens of quotes from liberal reporters and celebrities. erupt in anger over MSNBC's leftwing bias. Anger erupted at GE's annual shareholders meeting on Wednesday [4/22/2009]. "The crowd was angry with MSNBC because of its leftward tilt," one person observed. "Some former employees said they were embarrassed by it." The complaints came hot and heavy. During the question-and-answer period, shareholders repeatedly asked executives about political views expressed on MSNBC Decries General Electric's Control of NBC, MSNBC ...But Only On Some Topics. The Huffington Post is concerned all of a sudden that General Electric is engaging in top-down control of the news because they tried to stop Keith Olbermann's attacks on Bill O'Reilly. The Post is right to be concerned about GE's control, but they haven't shown much interest in GE's network push for green investments and carbon trading that will line their own pockets. NBC: National Broadcasters Against Conservatives. On December 7, 2007, as the country solemnly remembered Pearl Harbor and the timeless sacrifices of soldiers long dead, one of our major television networks decided that running ads praising today's modern armed forces constituted a bridge too far. Some of the roots of media bias: Tracking Your Digital Trail. [Scroll down] Most people never realized that after World War II, the higher-ups among these various radical entities ventured forth to head educational institutions and media outlets. For example, Edward Barrett, who served as head of our government's overt psychological warfare program from 1950-52, became dean of Columbia University's Graduate School of Journalism. ... William Paley, an alumnus of the U.S. Army's Psychological Warfare Division went on to head CBS, and C.D. Jackson led Time/Life. GE Using CNBC, MSNBC to Promote Cap-and-Trade for Financial Gain? It has been something that there have been rumblings about, but no one has really put the x's and o's together entirely — that General Electric is using its media arm, NBC Universal to promote President Barack Obama's so-called progressive agenda for its own financial The Editor says... GE and Obama are both pushing for a "smart" electric power grid. Coincidence? GE dancing to the White House piper? General Electric, more intimately tied in with government than nearly any other company, rolled out a new intiative this week, called "healthymagination." That odd name draws a parallel to GE's 2005 initiative "ecomagination." Like ecomagination, healthymagination held its launch event not at corporate headquarters in Greenwich, Conn., but here in D.C. GE a corporate sponsor. For all of the carping liberals did for eight years about corporate cronyism in George W. Bush's White House, they seem to turn a blind eye to the same behavior in President Obama's. With plans in place for a major overhaul in the health-care industry, General Electric is positioning itself to become a major beneficiary of these health care reforms. Obama Staffers Attend Secret Dinners With Lefty Media. The Washington Post's Howard Kurtz has let the cat out of the bag in the Post's April 27 issue about a regularly scheduled secret media dinner attended by some of the top left-wing journalists in the country. ... The secret dinners for Obama staffers and his boosters in the Old Media have been going on for "more than a year" and are sponsored by David Bradley, the owner of the Atlantic. In attendance have been some of the most well known lefty journalists in Washington. Jake Tapper Isn't Letting Go. Jake Tapper isn't the easiest guy to interview. After all, when your interview subject is a competent journalist, he or she already knows all the tricks of the trade — the subtle flatteries, the ever-so-slightly leading questions — so Tapper isn't about to say any more than he has to about his personal politics or what goes on behind the scenes of his job as ABC News White House correspondent. Or it's possible Tapper doesn't want to talk about these things because he's one of the last remaining journalists in America who take the responsibilities of their jobs seriously, and thus place a premium on their credibility. 2008 liberal media awards: It's time for the 21st annual Media Research Center's awards for the most biased, manipulative or downright goofy quotes from liberals in the "mainstream" media. I'm honored to serve, once again, on MRC's distinguished panel of conservatively-biased judges. Being Watchdogs to Needing Watchdogs. The mainstream media, who forgot Felix Frankfurter's admonition that "freedom of the press is not an end in itself but a means to the end of a free society," long ago abdicated their role as government watchdog and now require a watchdog themselves. Never has that been clearer than in the 2008 presidential election, during which they are covering up rather than covering Barack Obama's shady past and alliances, his knee-deep involvement in corrupt practices threatening the very core of our democratic system, and his many policy misrepresentations. Why Reporters — and Judges and Professors — Are Biased. That the news media were biased in the 2008 presidential election is now acknowledged by fair-minded people, left or right. ... Given how obvious this bias is, the question is not whether liberals in the media tend to offer biased reporting. The question is why? Why can't liberal news people report the news without any slant? ... For most liberal news reporters ... the purpose of news reporting is not to report news as objectively as possible. The purpose of the media in general and of reporting specifically is to promote social justice and the social transformation of society. Mainstream Media Needs Rehab For Liberal Overdose. This bias from the small town markets to the industry's big guns creates an interesting dichotomy — because the majority of news organizations have swung so far to the left, other news outlets who don't follow suit appear "right." Or worse, the rosy glasses of the majority make leftist extremes appear normal. Yet, despite the mainstream media's best efforts, the majority of Americans remain conservative. soon to a lefty rag near you. In the months to come, we can expect all kinds of horror stories from the left about alleged Bush-Cheney atrocities. These will deflect attention from present-day problems and provide liberal thinkers with the intense indignation they so desperately need. In addition, the bevy of Bush-Cheney sins will supply the media and individual opportunists with "product." So, in order to get ahead of this inevitable situation, I will now predict some future headlines... Most Reliable Constituents: The Press. Surveys of journalists conducted over the past three decades show the media elite are extremely consistent in choosing Democratic candidates on Election Day. If only journalists were permitted to vote, we would never have had a President Reagan or a President Bush, but would have instead faced Presidents McGovern, Mondale, Dukakis and Kerry. It wouldn't have been close. As an "independent conservative," I'm expected to see liberal media bias lurking everywhere, but it's not just me — and it's not just conservatives. I know liberals, including newspaper editors, who think the "news" pendulum had swung dangerously far to the left. Beyond recent studies by the Pew Research Center and the Project for Excellence in Journalism, other research shows that the media has tilted to the left; indeed journalists themselves have openly admitted as much. Helen Thomas: Symbol of Media Decline. The gold standard for reportorial behavior is supposed to be "objectivity" and the appearance of impartiality. That does not apply to opinion journalists who are often ideologically oriented and whose very livelihood depends on a readership/listenership/viewership that is attracted to them precisely because of their punditry. We are talking about straight reporters who supposedly arrive at the table with no intent to weave an agenda into the story. It can be argued, as this writer has, that anyone who covers the bitterest gut-wrenching political battles of our time and claims to have no opinions is likely to be judged either a liar or a moron. The point is — Does he/she try to play it down the middle in a way that is credible to a public that simply wants unvarnished facts? Zogby Poll: Voters Believe Media Bias is Very Real. Nearly two-thirds of those online respondents who detected bias in the media (64%) said the media leans left, while slightly more than a quarter of respondents (28%) said they see a conservative bias on their TV sets and in their column inches. Exactly How Biased is the American Media? The average American voter is starting to come to grips with the fact that those who control the flow of their information, "the media," are neither independent nor unbiased. In a September 2007 Gallup survey of American voters, 45% said the media is too liberal, compared to only 18% who said the media is too conservative and 35% who said the media is about right. The results of that survey demonstrate how far left 18% of Americans are today, and how uninformed another 35% are. America's Second Wake-Up Call! In the last 40 years, there have been nine major surveys of editors and reporters who work for national media. The most they ever voted Republican in a national election was 14%; the more common range has been 4% to 7%. This is one reason why no matter who wins a political debate, the media almost en masse repeatedly tell you their man won. And most voters who don't pay close attention will believe them. It's called coordinated propaganda. Old Media News In The Tank. The old broadcast and print media outlets have abandoned any pretense of objectivity and impartiality in this year's general election, further eroding their credibility. It makes one wonder. Is the future of news already here, or are we transitioning toward something still over the horizon? Even Harvard Finds The Media Biased. The debate is over. A consensus has been reached. On global warming? No, on how Democrats are favored on television, radio and in the newspapers. Just like so many reports before it, a joint survey by the Project for Excellence in Journalism and Harvard's Joan Shorenstein Center on the Press, Politics and Public Policy — hardly a bastion of conservative orthodoxy — found that in covering the current presidential race, the media are sympathetic to Democrats and hostile to Republicans. Keeping the press honest: "If you look at the surveys, we've accomplished our primary mission, which is to educate the American people about the bias that exists," he [Brent Bozell III] says. "One survey in 1987 showed ... that only 25 percent of the people believed there was such a thing as media bias. Today, according to a recent survey, that figure is 79 percent." Reader responses overflow after story. When Politico editors John F. Harris and Jim VandeHei tackled the subject of media bias Tuesday [10/28/2008], they knew they were venturing into controversial territory. Still, they hadn't predicted the most intense reader response Politico has ever received, with hundreds of e-mails pouring into their inboxes within hours of the story hitting the web. Media Myths and the 2004 Campaign. The media's ability to shape opinion derives from its power to slant the news — the pervasive activism known as "media bias" — and also from its power to choose what is and is not reported. But 2004 marked a watershed in American political history. That was the year the old media lost control of our national conversation. Tim Russert Took Media Bias Seriously. In 2001, my first book, "Bias," came out. It was an insider's look at bias in the media. Not one network news correspondent would have anything to do with me. I couldn't get on any of their morning news shows to talk about the book (which was a national best seller), or their evening shows or their weekend shows or even their middle-of-the-night news shows. No one in network television wanted to discuss the issue, no matter how many Middle Americans thought it was important. Russert was the lone exception. The War Inside NBC: It was a black day for journalism in NBC: [Tim] Russert's death released one of the last brakes slowing NBC's descent into political activism and journalistic irrelevance. NBC was once the proud home of real journalists. People such as Chet Huntley and David Brinkley brought its standards to — and above — the level prevalent in most news organizations. But now, it's an asylum for people such as Chris Matthews and Keith Olbermann. Enough Already! I have just about had it with the conservative punditry and their plaintive wailings about the unfairness of the self-proclaimed "mainstream media" (I think the designation "Big Media" would be more appropriate as applied to the information service of the leftist elites, which is anything but mainstream). "Where is the outrage?" "Why does the mainstream media concentrate exclusively on the failings of the right while completely ignoring the failings of the left?" Inside the Disinformation Machine: If you think the media has a liberal bias today, wait until you see what the left has in store for America's future. Extremist billionaires, "netroots" activists, and nonprofit pressure groups are creating a new media network. Through blog journalism, they aim to discredit the media outposts of the right while remaking the Internet in their own image. in the news, but not in newsrooms. It's unclear exactly how many evangelicals work in newsrooms, and federal laws against religious discrimination prevent news managers from asking about a job candidate's beliefs. But the Pew Research Center for the People and the Press reported in 2007 that 8 percent of journalists surveyed at national media outlets said they attended church or synagogue weekly. The survey also found 29 percent never attend such services, with 39 percent reporting they go a few times a year. Shameful Week for the Press. I have always tended to think that conservative complaints about the media are a little exaggerated. There are occasionally obvious instances of bias and clear examples of a double standard, but most reporters don't want to fall into those and some conservatives are surely too sensitive to them. But this week has changed my view. I have never seen, and I admit that I could never have imagined, such shameful, out-of-control, frenzied, angry, condescending, and pathetic journalistic Academedia Bias: Too often we treat academic and media bias separately when their relationship is much more symbiotic. After all, not only are media elites trained in academia but they frequently return to school to teach and "give something back" to the educational system that spawned them. Democrats Trust Media More than Republicans Do. Harris released one of their latest polls on the 6th [3/6/2008] and it showed that less than half the general American public trusts the press. With the state of the media today, this should come as no surprise to anyone. But, the numbers are pretty amazing when it is realized that 54% of those responding said they did not trust the press while 46% admitted that they don't trust television news either. Indictment of Liberal Media Convinces, Says Zelnick. No one does a better job than L. Brent Bozell III and his Media Research Center in documenting the liberal bias of much of the mainstream news media. Some of their citations of my former colleagues' wisdom make me laugh out loud. Others make me furious. The Fall of the American Press? Many of the reasons given for the challenges facing the newspaper and the media in general are well known, but perhaps worth recounting. [For example] journalists are no longer seen as disinterested parties pursuing the truth, but as elites who themselves profit from pushing certain agendas. The revolving door between the halls of power and the news studios underscores this concern. CNN Staffer Joins Obama's Team, As Does ABC Vet; Revolving Door Up to Ten. Following the path of CNN Middle East correspondent Aneesh Raman and producer Kate Albright-Hanna, who both jumped aboard the Obama campaign last year, senior political producer Sasha Johnson this week announced she's leaving the network's Washington bureau to take the Press Secretary slot at the Department of Transportation. Media Lies: Plenty know by now that in 2004 the progressive Pew Foundation published an extensive poll exposing the five-to-one ratio of liberals to conservatives in the news-reporting media. Strangely, media outlets must believe that we have forgotten this because they continue marching forward just like the vain and gullible monarch penned by Hans Christian Andersen. Media bias impacts the news you hear and don't hear. Time for "Propagandist Buttons" to identify biased "journalists" on air. Canada Free Press (CFP) editors Judi McLeod and Arthur Weinreb advocate that [Gwen] Ifill and others of her ilk should be identified for what they are: propagandists not journalists; that "journalists" advocating for the election of Obama should be forced by the networks who hire them to wear buttons proclaiming them as "Propagandists". In short, in fairness to television viewers everywhere, the Katie Courics, Rachel Maddows et al should be forced to wear on-air the "Propagandist Button", a sort of Fairness Doctrine that really works. to probe its 'bias to the Left'. The move comes just five months after another internal BBC report claimed that the organisation was Left-leaning, out of touch with large swathes of the public and guilty of "unconscious self-censorship" on issues it found unpalatable. The Pulitzer Racket: Conservatives often ponder why more young conservatives don't go into journalism. Here's one easy reason: The path to prizes and prestige doesn't come from fierce investigative probing into liberal sacred cows or sharp-eyed conservative commentary. It comes from pleasing liberals with stories that advance their agenda. Hillary On The Hotseat: One need look no further than yesterday's Wall Street Journal to figure out why the Left has been so adamantly opposed to its sale to Rupert Murdoch. The Wall Street Journal has had the audacity, the effrontery, to challenge, actually challenge, one of the Left's most cherished shibboleths: Queen Hillary. Doing what 'mainstream' journalists have failed to do for, oh, the last ten years or so (except when a Republican is president), the WSJ put the 'investigate' back in 'investigative journalism.' "Scandals". Now that ABC News has the list of phone numbers given to them by the "Washington madam," the question is: Whose names will they publicize if they find out that there are public figures whose phone numbers are among those they have? Let us suppose, just for the sake of argument, that these names include Karl Rove and Ted Kennedy. Are both names equally likely to be revealed? All the news that fits. Only a dyed-in-the-wool leftist would think to label CNN, MSNBC, the New York Times, the Washington Post and the three major networks, as the mainstream media. Only liberals who are so delusional as to regard their politics as middle of the road could be that mistaken. Normal people are aware of the fact that these news outlets are not only not mainstream, but are clear out of the water and perched on the far left bank. However, those of the liberal persuasion have repeated that lie so often and for so long, I'm afraid they've actually come to take it as gospel. The blind leading the bias. What a splendid joke. If I'd wanted to prove the unconscious bias of the media, I would have picked exactly such a panel, and watched to see if anyone actually noticed the screaming absence of a single conservative voice. Al-Jazeera now biased, says leaving reporter. The most high-profile US journalist on al-Jazeera's English language service has left the channel, attacking its narrowing world view and increasingly anti-American editorial slant. Dave Marash, a former ABC correspondent, said that editorial input from Washington had "gotten smaller and smaller" and that the Qatar-based management were exerting control on the channel's overseas bureaux. Al Jazeera Hosts Party for a Terrorist. An Israeli official has accused the Arabic satellite television channel Al Jazeera of "unprofessional" behavior in hosting a party at its Beirut office for newly freed arch-terrorist Samir Kuntar. Kuntar was accused of killing four Israelis, including a four-year-old girl whose head he smashed with a rifle. CNN and Hillary Destabilize Pakistan. We can now understand why Musharraf's November 3 state-of-emergency decree took foreign news outlets like CNN off the air. Musharraf, who is one of the main targets of the al-Qaeda international terrorist organization, recognizes that the so-called "CNN effect" in global affairs can destabilize foreign governments, including his own. It's no wonder that he recently complained about being betrayed by the Western media. America is in Deep Trouble. Though most Americans are far more conservative than anyone living or working in Washington DC today, the conservative movement finds itself playing defense to a long list of socialist anti-American aggressors. No, not the Soviet block or Red China, but your friendly DNC Headquarters, their minions in the press, and your next door neighbors, many of whom are unaware of their socialist standing. Excerpts from How to Identify, Expose and Correct Liberal Media Bias: Tips for identifying and documenting bias in news stories. What can we do about media bias? The Associated Press is the 500-pound gorilla of media bias. They are the gatekeepers of our news and they're extremely powerful. The liberally biased AP is a monopoly when it comes to distributing news to our nation's newspapers. It's useless to complain to them though, because they don't care. Give 'em that liberal media bias. The Media Research Center has released its 19th Annual Awards for the Year's Worst Reporting in its ever-vigilant attempt to point out some of the greatest examples of left-tilting bias in the mainstream media. Next to Christmas, it is one of my favorite things about the month of December. I offer a small sampling of my favorites. bias in media is no secret, but now it's proven. Our American media machine is broken. Journalists can no longer be trusted. Many conservatives have seen years of evidence that the mainstream media is shifting further and further to the left. But this week a new study from the Center for Media and Public Affairs shows an unprecedented bias in the network news coverage. Times More Journalists Identify as Liberal Than Conservative. A survey conducted late last year and released Monday, by the Pew Research Center for the People and the Press, confirmed the obvious — that compared to the views of the public, conservatives are under-represented in national journalism while liberals are over-represented. Jennifer Harper of the Washington Times discovered the nugget buried deep in the annual "State of the Media" report from Pew's Project for Excellence in Journalism and FNC's Brit Hume on Tuesday night highlighted the findings from the survey of 222 journalists and news executives at national outlets: Only six percent said they considered themselves conservatives and only two percent said they were very conservative. a GOP liability. Although Spanish-language press is not monolithic, news coverage, and particularly political coverage, tends to focus on advocacy for its community, analysts said. It's new territory that Democrats have been quick to grasp, deploying Spanish-speaking lawmakers to make the party's case on education, national defense and, most recently, immigration. The Editor says... That's just a roundabout way of saying that the Hispanic press leans to the political left even more than the English-speaking press. Journalists dole out cash to politicians (quietly). MSNBC.com identified 144 journalists who made political contributions from 2004 through the start of the 2008 campaign, according to the public records of the Federal Election Commission. Most of the newsroom checkbooks leaned to the left: 125 journalists gave to Democrats and liberal causes. Only 17 gave to Republicans. Two gave to both parties. Finds Journos At Bottom Of 'Prestige' Jobs. Hang down your head, journalist — your fellow Americans don't think your career is much to be proud of. The annual Harris Poll measuring public perceptions of 23 professions and occupations came out Wednesday — and you can find journalists in the Bottom Ten. Hitting a New Low in Bias: The truth is, to be pro-life is to be anti-violence. No one who is truly pro-life could ever advocate or engage in violence, whether shooting an abortionist outside an abortion clinic or tearing an unborn child apart inside that clinic. But for the media, that truth doesn't fit their fiction of what "pro-life" means. So they ignore it. Waves Yellow Flag On Media Bias. At their best, the news media help promote our democracy. Like many Americans, though, I am increasingly concerned about a bias in the mainstream news media. To me, there is a significant liberal slant in news reporting that prevents the American people from getting facts about critical issues facing our country. Without facts, Americans cannot make informed decisions about issues, and our democracy is threatened. No Extreme Democrats for MSM? So, we have a "moderate" in Hoyer facing an extremist in Murtha in this fight for Party Majority leader. But, one would be hard pressed to see any MSM outlet presenting the facts in such a light. In fact, the MSM seems to want to present the story as a corruption issue instead of a war issue, even as they want to assume that the recent election is a vote by the electorate to get out of Iraq. MSNBC, Leaning Left And Getting Flak From Both Sides. MSNBC, which bills itself as "the place for politics," is being pummeled by political practitioners. "It's an organ of the Democratic National Committee," says Steve Schmidt, a senior strategist for John McCain's campaign. "It's a partisan advocacy organization that exists for the purpose of attacking John McCain." See Liberal Media Bias on TV News. By a 39% to 20% margin, American adults believe that the three major broadcast networks deliver news with a bias in favor of liberals. A Rasmussen Reports national telephone survey found that just 25% believe that ABC, CBS, and NBC deliver the news without any bias. New Evidence of Liberal Media Bias. This study found evidence that conservatives were more likely to perceive media bias than liberals, but that both conservatives and liberals detected bias in media outlets that leaned against their political perspectives. In the end, however, because conservatives were more critical of the media both in general and in response to specific outlets, the results seem most consistent with the claim that a liberal political bias exists in the mainstream news media. to Detect Bias in the News: At one time or other we all complain about "bias in the news." The fact is, despite the journalistic ideal of "objectivity," every news story is influenced by the attitudes and background of its interviewers, writers, photographers and editors. Not all bias is deliberate. But you can become a more aware news reader or viewer by watching for [these] journalistic techniques that allow bias to "creep in" to the news. Affirmative Action for Conservatives: Thomas Edsall, who served for many years as the top political journalist for the Washington Post, has told Hugh Hewitt on his radio show that Democrats outnumber Republicans in the national press corps by a margin of anywhere from 15 or 25 to 1. That is important personal testimony and evidence from someone who toiled in the mainstream media. are biased, admit the stars of BBC News. It was the day that a host of BBC executives and star presenters admitted what critics have been telling them for years: the BBC is dominated by trendy, Left-leaning liberals who are biased against Christianity and in favour of multiculturalism. Fair and Balanced? You Bet. I worked in newsrooms for most of 30 years, with a couple of breaks for grad school and political campaign work. I can say with confidence that I can count on one hand the conservatives I worked with during those years in mainstream news. They fall into two categories: those with whom I worked in the early 1970s who were relics of the days when you might actually find a conservative in a newsroom, and a couple in the 1990s who, like me, had made a gradual transition from left to right. truth on the altar of diversity. Houghton Mifflin's ploy was recently described by reporter Daniel Golden in a Wall Street Journal story on the lengths to which publishers go to get images of minorities and the disabled into grade-school textbooks. A Houghton Mifflin spokesman claimed that able-bodied models are presented as handicapped only as a last resort. But according to one of the company's regular photographers, the deception is the norm. At least three-fourths of the children portrayed as disabled in Houghton Mifflin textbooks actually aren't, she told Golden. Michael Moore and Bill Clinton: Birds of a Feather. The public has a right to know why Clinton didn't catch bin Laden and when "facts" in Moore's documentary aren't true. Moore and Clinton's reactions prod the public to view skepticism and balance as biased attack. Clinton even called it "a conservative hit job" and that the public questions about his role in not stopping bin Laden were there due to "a serious disinformation campaign to create that impression." Plenty of conservatives have been the benefactors of "liberal hit jobs" on NBC, ABC, and CBS but it happens so often, usually no one notices. Media Anarchy Has Its Downside. One can't exaggerate how large Fox looms in the liberal imagination. They see it as huge and mighty and credit it with almost mythical powers. It is a propaganda channel whose mission it is to destroy the Democratic Party. That's part of why Clintons' performance had such salience. Finally he was standing up to an evil empire. Attacking the Messenger: The Left Unhinged by The Fox News Channel. Since the dawn of the information age, groups have tried to manipulate news organizations by going after their advertisers. [...] Even in the recent attacks on the Fox News Channel, groups have used Rupert Murdoch's relationship with cigarette maker Philip Morris and how that led to Murdoch's vast media empire ignoring stories about the negative effects of smoking. It isn't enough, however, to try to control the behavior of the American people by controlling the legal products they have access to in the marketplace. The left wants to control what you think and read by controlling your information sources. Prepping the '08 Media Battlefield: The left hates Fox because it reports things that ABC, NBC, CBS, the New York Times and the Washington Post would otherwise conceal from the public. The war on Fox will continue, because the libs know it's essential to prepare the battlefield for the 2008 election. If they can marginalize Fox — and even revive the old "fairness doctrine" to kill conservative talk radio — they could restore the left's monopoly on national news. So what are Republicans doing in response? Nothing. Crazy like a Fox (News). As Fox News celebrates its 10-year anniversary, media watchers should appreciate how Fox, which tilts right, has provided balance to major new operations such as CNN and the New York Times, which tilt left. Go to most newsrooms and you'll find a staff that overwhelmingly voted for John Kerry in 2004, while the rest keep their politics to themselves lest they be considered biased. A survey of the Washington press corps found that 89 percent voted for Bill Clinton in 1992. Media Allergic to American Values. Elite news editors shrug at their reporters' highly politicized activities — from AIDS fund-raisers to pro-abortion rallies, environmental propaganda and unhinged Bush-bashing (new case in point: New York Times reporter Linda Greenhouse's recent moonbatty screed at Harvard University assailing everything from Gitmo to the Mexican-U.S. border fence). But wear a flag pin? Heresy! Big Government Solutions Don't Work. Politics as usual is aided by the complicity of the media. Economic ignorance, bleeding heart emotionalism, and populist passion pervade our major networks and cable channels. ... In countries where everyone knows the media produces government propaganda, people remain wary of what they hear. In the United States the media are considered free and independent, thus the propaganda is accepted with less questioning. Meet the Real Katie Couric. On September 5, Katie Couric took the helm of the CBS Evening News, a program tainted by decades of Dan Rather's liberal bias. But a review of Couric's 15 years as co-host of NBC's Today finds that she brings her own liberal baggage, and she seems unlikely to challenge the biased approach that has eroded the credibility of CBS News and the rest of the media elite. New Network, Same Old Biased Katie. After more than two decades in which Dan Rather used his anchor desk to push a liberal agenda — culminating in the forged document scandal in 2004 — the CBS Evening News needed its new anchor to be the epitome of fair and balanced journalism. Instead, the CBS brass hired Katie Couric, who put her liberal fingerprints all over Today during her 15 years at NBC. and 'just plain rude'. Reporters have an obligation to maintain an objective approach to the stories they cover. That's not to say they don't have opinions, but if they are going to have credibility as reporters, they need to keep those opinions out of their stories. Instead, we've grown used to reporters becoming talking heads on television, where they speculate incessantly about the meaning of stories or the outcome of stories or the virtue of the people they write about. The database double standard. Here is the most insincere question a liberal TV news star can ask: How can President Bush turn around his poll numbers? [...] The media's crocodile tears are not even laughable, just nauseating. Pushing down the president's approval rating seems to be their daily task. bias on full display. The reason to point out that this military tribunal case was actually a 5-4 decision is because other 5-4 decisions get reported in a very different way. For example, when the court upheld the University of Michigan law school's use of race in admissions in a 5-4 decision, [one of the nation's most important and influential newspapers] called the ruling "deeply divided." You Can't Spell Pap Without the AP. Like many of its contributing entities, it is a mere shell of its formerly unbiased self. The Collapse of Network News: For the last decade or two, the Big Three network news ratings have declined and their once-iron grip on public opinion has loosened, prompting this debate: is this decline merely a sign of increasing 24-7 media availability (cable news, Internet sites) or is the liberal tilt of the networks driving conservative viewers away from these networks in favor of alternative outlets? The Media Adore Warren Buffett. Buffett targets people in general, not just a particular group. In a press release, [Rev. Thomas J.] Euteneuer took aim at almost every aspect of Buffett's agenda, saying that "Warren Buffett's philanthropy aims at killing pre-born children not curing childhood disease, eliminating the poor not poverty, and destroying the developing world not aiding development." That may seem harsh. But while [Bill] Gates is dedicated to "global health" issues, he, too, underwrites the pro-abortion agenda. 2006: The most outrageously biased liberal reporters of 2005. Pulitzers. The recent unveiling of the Pulitzer Prizes had more of the same politicized whiff that the Oscars oozed earlier this year. Merit is taking a back seat now to "edginess" in both the news and entertainment media. against an unethical media. To my fellow conservatives, Republicans, and even independents, who are so frustrated with some in the GOP for abandoning the principles of our party, that you plan to sit out this election, I implore you to change your mind. While I share your anger and disappointment, I am still eagerly going to vote on November 7th for one simple reason. To stop those in the mainstream media trying to hijack this election. Mainstream Media Go Racist. Imagine that when far-left California Rep. Maxine Waters was running for office, a number of Republicans didn't like her platform and so they called her "Aunt Jemima" or depicted her as a slave girl who took her marching orders from her "massa," Terry McAuliffe. This is exactly what happened — in articles and political cartoons — during the confirmation hearings of Condoleezza Rice as secretary of state. And how did the Mainstream Media cover this rank racism? Not by calling it by its name and not by condemning Sen. Robert Byrd, the former Grand Kleagle of the Ku Klux Klan, who led the Democratic pack in delaying Rice's ascendance to this august position. Instead, they were uniformly mute about the racist assaults and slavishly echoed Rice's critics. gets pranked. Young students in journalism school ought to be taught that "by their stories, you shall know them." The media reveal their opinions about the world not only in their endless pontificating verbiage, but in the topics they choose. The "news" becomes whatever floats their boat, whatever they urgently want the people to know. There is much more about this incident in News media issues related to the war. behind Rumsfeld grilling. An embedded reporter from the Chattanooga Times Free Press is claiming credit for the blunt questioning yesterday [10/8/2004] of Secretary of Defense Donald Rumsfeld by American soldiers in Kuwait. There is a difference between a journalist and an activist. A journalist tells the reader what's happening. An activist makes things happen (and then reports it). The reporter who supplied this question is evidently an anti-war activist and a troublemaker who was only there to make a name for himself. Bush-hatred is a threat to national security. Would newspapers in the midst of World War II have printed the fact that the United States had broken German and Japanese codes, enabling the enemy to secure its communications? Or revealed how and where Nazi spies were being interrogated? Nowadays, newspapers win Pulitzer Prizes for such disclosures. Give Back the Tainted Pulitzers. It's a shame and a tragedy when the nation's two major papers win Pulitzer Prizes for running stories harming national security that were clearly based on questionable sources with a partisan political agenda. BBC's commitment to bias is no laughing matter. It's high time the debate moved on from narrow notions of political bias. Far harder for the BBC to gainsay is that it has a liberal cultural bias, one that envelops pretty much all programmes, not just news and current affairs. If you want to find the most solid evidence of partiality, look at the BBC's entertainment output — its dramas, comedies and arts programmes. Clintonite who owns National Enquirer. What the tabloid's readers, in politics and out, may not know is that a key owner of the Enquirer is a prominent New York investment banker and one of Hillary Clinton's key backers, Roger Altman. Altman was an official in the first Clinton administration, and his name is often mentioned as a possible Clinton Treasury Secretary. news... It's always fascinating to return from travel overseas and step back into the alternative universe of America's media elites. [...] Coming back to Washington is a reminder of just how anti-American the American media elites really have become. AWOL in the War of Ideas. It's one thing to give the devil his due. It's another to do the devil's public relations. How else to explain a dispatch from the Associated Press referring to Osama bin Laden as "an exiled Saudi dissident"? Such spin may not be inaccurate but it's like calling Jeffery Dahmer an "eccentric gourmet." It rather misses the point, don't you think? The Decline of Mainstream Media: What common sense has comprehended for decades now finds support by yet another scholarly study: The media has a leftist bias. [...] As if to confirm that bias, over the past few months, the media have given this research scant coverage. [...] The researchers expected to find a left-leaning bias, but were astonished at just how behemoth this left-wing bias is. The Late Jeane Kirkpatrick Warned of Media's 'Unaccountable Power'. Jeane J. Kirkpatrick, who passed away Friday morning, adapted a 1983 speech on the influence of the news media, into the forward for the Media Research Center's 1990 book, And That's the Way It Isn't: A Reference Guide to Media Bias. She proposed: "Some people believe, and I am among them, that the power of the media today constitutes the most significant exercise of unaccountable power in our society." Simply Put, the US Mainstream Media Provides an Inferior Product. The prevailing opinion among the overwhelming majority of the American public is that there are some very big problems with the mainstream media. The most common problems noted are the unarguable existence of a political agenda and the elitist pose displayed toward the American public and those who govern. While I generally agree with both of these observations, I also believe, when all is said and done, that we are simply being offered an inferior product. journalism's founding fathers: People on the left and right fault contemporary journalism for (a) giving the Bush administration a free ride, or (b) extreme bias against all things Bush and Republican. Charges of media bias and the controversy over good vs. bad journalism are older than the nation, literally. Dow Jones Chairman on Media Power: We're Goliath, Not David. One of the most persistent tics of the passive-aggressive press is its denials of its power, that it doesn't run the country, or at least try to run the country. All that journalism-school boilerplate about how the media is merely a watchdog, or like it's the BASF of democracy, you know, it doesn't make everything, it just makes the secret ingredient that makes everything better? Baloney. Some of us signed up for the media-criticism business because the media want to pretend they're not major players in the The Fourth Estate and Public Opinion: Several studies to assess the political views of national reporters in the major press pools of Washington and New York find that those reporters overwhelmingly self-identify as "liberal" or "Democrat." A recent survey, in fact, determined that only eight percent of those reporters would vote for a Republican — no surprise to objective media analysts. Madness: Those who wonder why fewer and fewer Americans are buying newspapers or tuning into network "news" need only look at this week's coverage to see why. "Hard" news stories are harder to come by every day, and those events and issues that do get coverage carry more than just a "tinge" of bias, ignorance or both. New York Times: Less Communism = Bad News for Chinese People. Apparently, not even the communists are socialistic enough for the New York Times. Media Maelstrom Over Michael Brown. "Where do I go to get my reputation back?" Ray Donovan, President Reagan's Labor secretary, poignantly asked that question when, after the media had adjudged him guilty, he was acquitted in court of corruption charges. Former FEMA Director Michael Brown might ask the same question. media. Surveys galore have shown that somewhere around 90 percent of the writers, editors and other personnel in the news media are Democrats and only about 10 percent are Republicans. We depend on the news media for information about government and politics, foreign affairs and war, public policy and demographic trends — for a picture of the world around us. But the news comes from people 90 percent of whom are on one side of the political divide. Doesn't sound like an is swinging away from patriotism. When I was growing up, Veteran's Day, then called Armistice Day, was a great national holiday, with parades and expressions of gratitude to the military troops who kept this country free. Now it is hardly recognized. December 7, the anniversary of the attack on Pearl Harbor which started World War II, is barely mentioned in the news, but there is extensive coverage in the media on the anniversary of the first atomic attack on Hiroshima, and later, Nagasaki. New evidence of left-wing media bias. A new study from UCLA confirms that the media veers sharply to the left. Of 20 major news outlets studied, 18 tilt to the left. The Plot to Kill the President: Forty-two years to the day after President John F. Kennedy was assassinated in Dallas, an American Muslim was convicted of joining the terrorist organization Al Qaeda and plotting to assassinate President Bush. A lot of media attention was devoted to the former but not the latter. Could that be because the media loved Kennedy but hate Bush? edits out the word "terrorist". The BBC has re-edited some of its coverage of the London Underground and bus bombings to avoid labelling the perpetrators as "terrorists", it was disclosed yesterday. Early reporting of the attacks on the BBC's website spoke of terrorists but the same coverage was changed to describe the attackers simply as "bombers". Media Bias Is Real, Finds UCLA Political Scientist. While the editorial page of The Wall Street Journal is conservative, the newspaper's news pages are liberal, even more liberal than The New York Times. The Drudge Report may have a right-wing reputation, but it leans left. Coverage by public television and radio is conservative compared to the rest of the mainstream media. Meanwhile, almost all major media outlets tilt to the left. The Best Notable Quotables of 2005. The 18th annual awards for the year's worst reporting. Christmas Is Getting Less Merry Every Year. Just when you think you have it figured out, life kicks you in the back of the knee. Over my 30-year career in journalism, I have tried to resist generalizing about the media. You know, that it is rife with left-wing loons bent on imposing a secular society on the country. In the past, I would have never said that. But that was then, this is now. I have come to believe that the American press is so secular Karl Marx would be appalled. L.A. Times admits false claim about Falwell. A column by a rabbi published in the Los Angeles Times falsely asserted Rev. Jerry Falwell claimed lesbian actress Ellen DeGeneres played a role in the 9-11 attacks and Hurricane Katrina because she was the host of the Emmy Awards before both events. The Times ran a correction explaining the Baptist minister "made no such claim." The Leftward Course Of Human Events. [The managing editor of Human Events was forced to resign upon the insistence of the Southern Poverty Law Center.] How do you explain to your wife that you lost your job — not for some work-related grievance — but for exercising your first-amendment rights and, as a freelancer, expressing a point of view? Substitute Any Other Group and the Liberals Would Be Howling. The world's largest news service, the Associated Press, sent out a story today with an alarming headline that the appointment of Judge Samuel Alito to the Supreme Court would "tip" the Supreme Court to Catholics. The story went on to identify the religion of each member of the court and indicated Alito's appointment as another indication that "Catholics have become part of the nation's political mainstream." Wahington Post Goes After the Roberts' Children. If you can't come up with something disgusting about the actual nominee or his wife then rough-up the kids some and see what happens. Hutchison: Roberts line crossed. Citing "simple decency," Texas Sen. Kay Bailey Hutchison demanded Friday [8/5/2005] that journalists quit poking around for details on Supreme Court nominee John Roberts' adopted children. The People, the Press, and the Pulpit: The increasingly important role of religion in public life presents a challenge for the press. The media have particularly low credibility in this area — even journalists themselves have doubts about their ability to cover religious issues. Public and press concerns reflect a huge but familiar gap: on the one hand, the American public is one of the most religious in the West. At the same time, there are more than a few non-believers in the nation's newsrooms. Outlawing Thanksgiving Here and Abroad. Everybody had a good laugh on November 17 when President Bush pardoned two Thanksgiving turkeys named Biscuits and Gravy. The Washington Post noted that the event was covered by "dozens of international reporters, photographers and television cameramen." But the stories we saw in the Post, on CNN and elsewhere neglected to mention that the President went on to speak eloquently about the religious significance of Thanksgiving. The media are clearly uncomfortable with the topic. A petty, partisan press. It is hard to avoid the conclusion that the media are less concerned about the big picture today, or how all this will look in history, than with how the Bush administration's victory in Iraq will affect the 2004 elections. After all, studies have shown that nine out of ten journalists vote for Liberal whining about the media: In its search for What Went Wrong, liberalism has decided to admit that it has a problem. Surprisingly, the problem is us — the news media. We went wrong, or rather, right. We went and became conservative. Part II: The question posed in my previous column — "Does a (still) largely liberal news media (still) exhibit a largely liberal bias?" — can be answered both as a matter of logic and as a matter of fact, and in both cases, the answer is: Sure. NBC News Blames Bush for Iranian Threat. Andrea Mitchell seemed extremely concerned that the new Iranian president may turn out to be one of those hostage-takers, and that his election may play into the hands of the Bush Administration. In other words, don't blame the Iranian government for the fact that it is run by terrorists who hate America. Blame Bush. bar: It seems the world of media — somewhat self-righteous at its worst — is in a bit of a philosophical pickle on this one. For starters, many of the supporters of the notion to protect anonymous sources are the same publishers, editors and broadcasters who helped make this the year of "open government" and "open records." How the Media Created Rovegate: It's clear, based on the notes of his discussion with Matt Cooper of Time, that Rove wasn't aware of the facts and didn't have access to classified information about Valerie Plame's service or status in the CIA. He said she "apparently" worked at the agency. In any case, it turns out she isn't covered under a law designed to protect the identities of secret CIA agents. What If Karl Rove Were A Democrat? The Center for Individual Freedom has provided an excellent list of cases involving Democratic officials possibly violating national security or using classified information that have been ignored or glossed over by the major media. It's hard not to conclude that the media are targeting Rove because he is a conservative Republican. Dems' obsession: The Democrats and the Old Media are getting as much mileage as they can out of President Bush's reportedly low approval ratings. But the smart money says they ought to be more concerned about their own problems. Conservatives vs. Unlabeled Liberals. Study shows there have been six times More "Conservative" than "Liberal" labels on network news since election day. A seminar in old media liberal bias: For an object lesson on Old Media liberal bias, read the transcript of the May 17 press briefing by White House Press Secretary Scott McClellan. One-Sided Campus Media: For the past sixteen months I have been a weekly opinion columnist for UCLA's newspaper, the Daily Bruin, and have seen exactly how media bias works. [...] From the high and mighty editor to the yeoman reporter, the newsroom is the liberals' private party. The conservatives in the newsroom are not welcome — and it's made certain they understand that. Joseph Goebbels award. Events of this past year have shown the need for a special award in journalism for those who think that the purpose of reporting news is to cause the public to adopt the political views of those who do the A Tsunami of Media Bias Hits America. The anti-Bush media bias that preceded the President's re-election was back in a big way at the end of the year when officials of the United Nations and some influential journalists started a campaign blaming the U.S. for being "stingy" and "slow" to respond to the Asian tsunami disaster. The purpose of the campaign was two-fold — to rehabilitate the U.N., making the organization look relevant in world affairs, and to damage Bush politically as he attempts badly needed legislative reforms of the Social Security, legal, and income tax systems. This Just In: Liberal Media Bias Comes to a Halt. Gone are the days when the Big Three networks, plus the New York Times and the Washington Post, decided what was newsworthy, usually with a liberal spin. Roberts: Journalists walk around with the knee-jerk assumption that they are the most essential forces of democracy, there to enrich the nation and its citizens. They truly see themselves as the conscience of the country, the First Amendment ideal in the flesh. bias briefing: Fleischer was impressive in the nearly impossible job of keeping the anti-Bush hounds of the press at bay. They were harsh in the first days, when they were bitter about not getting to suck up to President Gore. They were hostile in the last days, as John Kerry's chances slipped away. U.N. Covers Up Payments to Journalists. Ian Williams of The Nation magazine, has been on the United Nations payroll, writing articles for the world body and even coaching U.N. officials on how to deal with the press. [...] Accuracy in Media has learned that the U.N. has been paying journalists here and abroad to spread the U.N. message to an American and international audience. estate or fifth column. There are still people in the mainstream media who profess bewilderment that they are accused of being biased. But you need to look no further than reporting on the war in Iraq to see the bias staring you in the face, day after day, on the front page of the New York Times and in much of the rest of the media. Fred Barnes Calls Sheehan a "Crackpot," Rues Media Focus on Her. Barnes criticized both her and the media's treatment of her: "This woman wants to go in and tell the President that the war is about oil because the President wants to pay off his buddies. She's a crackpot, and yet the press treats her as some important protestor." Is Gone; Whining About Leftist Media Is Not. Mark it well — the media does lean left. News that comes our way is, for the most part, devoid of a perspective that reflects anything close to a Judeo-Christian, culturally- and Conservative as Defined by the Media. Obviously American notions of "liberal" and "conservative" don't translate well to the complicated muddle that is politics in the former Soviet Union. Yet that doesn't stop the American media from pretending as though they do. Why? Because to the establishment press, "liberal" and "conservative" aren't so much ideological descriptions as moral ones. "Liberal" is the literary equivalent of a white hat for the good guys, while "conservative" is a black hat for the bad. askew. Ideally, news should "slant" to the truth. Practically, the presentation of news usually skews towards sensationalism. As news consumers, we accept this, though too rarely compensate for it. Ted Turner Compares Fox's Popularity to Hitler. Ted Turner called Fox a propaganda tool of the Bush administration and indirectly compared Fox News Channel's popularity to Adolf Hitler's popular election to run Germany before World War II. Turner made those fiery comments in his first address at the National Association for Television Programming Executives' conference since he was ousted from Time Warner Inc. five years ago. Big-Media Dinosaurs Face Extinction. As the big-media Dinosaurs die off one by one — the catastrophic meteor to blame for their impending extinction is their own damning construct — their transparent liberal bias. That bias is now, and will continue to be the fossil fuel driving tomorrow's new media — a new media whose long awaited arrival, and much needed influence has already begun. leftism in the media: Most of the guilty insist they are mere mainstreamers, centrists – yet surely they know better. They betray themselves when they open their mouths. How Newt Gingrich Caused 9/11: George W. Bush's record of accomplishment doesn't sit well with the History Channel, which recently linked the ascendancy of Newt Gingrich to 9/11. The President's words shot in the face of the liberal establishment, and the History Channel's words seem to have been written by the liberal Washington Post Buys Slate.com Where Nearly All Voted for Kerry. In acquiring Microsoft's Slate.com, the Washington Post bought a Web magazine at which nearly every editor and reporter voted for Al Gore in 2000 and John Kerry in 2004. Slate.com headlined an October 26 article about a survey of their own staff: "At this magazine, it's Kerry by a landslide!" In 2000, 12 of the 13 in the top editorial positions voted for Gore, with the 13th going not for Bush but the libertarian. Senators to watch: After perusing the year-end issue of Newsweek, I defy any editor there to deny this magazine is a mouthpiece for the political Left. Their cover boy was Senator-Elect Barack Obama of Illinois, the "rising star," as the Democrats and so many admirers in the press have dubbed him. [...] Barack Obama is just another ultraliberal legislator from a blue state, another Teddy, another Hillary — another politician only the liberal media wants to usher into power. And "News"-week is leading the charge. The party of government. A Pew Research Center survey of journalists and media executives conducted earlier this year found journalists identify themselves as liberals as opposed to conservatives by a five-to-one margin. In a 1997 poll for the Center for Media & Public Affairs, 66 percent of respondents agreed that news media "favor a liberal point of view." A Freedom Forum survey found that 89 percent of the Washington press corps voted for Bill Clinton over George H.W. Bush and Ross Perot in 1992, while Clinton garnered only 43 percent of the popular vote. Was Worse Than Arafat. It might seem odd to compare and contrast two recent news stories — the resignation announcement of Attorney General John Ashcroft and the Paris death of Palestinian terrorist Yasser Arafat. But an examination of the two demonstrates the degree to which the "news" media's compass of objectivity is so terribly misaligned. To read the coverage, you'd think Ashcroft was the tyrant and Arafat the liberator. fourth estate rumbles for more privilege. Maybe you haven't noticed, but the mainstream media are suffering from the perception that they're just the teeniest bit arrogant. Oh, who am I kidding? They behave like they're nobles or a priestly class. Dan Rather, Brian Williams and Peter Jennings might as well wear flowing ermine robes. From their palaces in midtown Manhattan they determine what the peasants see Clergy Denounces "Racial Motivated Attacks" on Condoleezza Rice. A coalition of black clergy Friday [11/19/2004] denounced recent "racial motivated attacks" by three editorial cartoonists, the Washington Post and the New York Times upon National Security Adviser Dr. Condoleezza Rice, who was recently nominated by President Bush to serve as the next secretary of state. fever: Here are a few mainstream media rules of thumb: Minority Democrats in public office are inspirational role models. Minority Republicans in public office are embarrassing sellouts. Minority Democrat politicians are principled. Minority Republican politicians are misguided. Minority Democrat politicians represent the hopes and dreams of all Americans. Minority Republican politicians are traitors to their "communities." These rules are unwritten, of course, but the minority politician double standard is glaringly obvious in the national media fawning over newly elected U.S. Sen. Barack Obama, Illinois Democrat. Gordon Sauter, president of CBS News 25 years ago, on CBS News one thing, it has no credibility. And no audience, no morale, no long-term emblematic anchorman, and no cohesive management structure. Outside those annoyances, it shouldn't be that hard to fix. [...] I stopped watching it some time ago. The unremitting liberal orientation finally became too much for me." didn't teach in Journalism school: In [the] Wall Street Journal, Fred Barnes writes about a GOP official asking a group of twenty or so journalists how many knew personally an evangelical Christian. Only a couple of hands went up. Then the offical asked how many knew a homosexual and every hand went up. Although conservative Christians make up 40% of the population and homosexuals make up under 5%, elite journalists don't know any Christians. That shows up whenever they try to report on Christians or Christianity. The Media Elite: Where do they stand? Robert and Linda Richter, of the Center for Media and Public Affairs, surveyed 104 of the "most influential television writers, producers, and executives" to find out where they stood on the issues. Their results are as follows: • 93% seldom or never attend religious services. • 75% describe themselves as left of center politically, compared to only 14% who place themselves to the right of center. • 97% believe that "a woman has the right to decide for herself" whether to have an abortion. • 80% do not regard homosexual relations as wrong. • 86% support the right of homosexuals to teach in public schools. • 51% do not regard adultery as wrong. • Only 17% strongly agree that extramarital affairs are wrong. What Liberalism Hides Behind Bylines? The Dan Rather/CBS fiasco, together with its arrogant, delayed, pathetic and mostly unbelievable attempts at justification, introduces a more subtle, and perhaps more inimical, subject. What militant liberalism lies hidden beneath the bylines of so many reporters who write news, or alleged news, for the print media? media bias: here's the proof. Folks know what Liberal Media Bias is. Even those who deny it have to know what the rest of us are talking about. Anybody can read it between the lines, see it on CBS (also ABC and NBC), hear it on NPR, and almost feel it, it's so thick at times. Like an oil slick over the news, LMB permeates American journalism's elite. But defining Liberal Media Bias isn't easy. Excuse me, sir, your bias is showing. An article in the most recent issue of American Journalism Review reveals another layer of bias in broadcast journalism. According to the article, network journalists routinely lobby politicians they cover for favorable votes on broadcast regulation. The article tells how politicians whose votes benefit broadcasters receive awards from the industry. Legislators who do not vote the way the networks want get threatened with negative coverage on the evening news. According to AJR, "We need to see the media business for what it truly has turned into: a huge economic special interest." Media Critic Has Sharp Words for Media's "Radical" Style of News Reporting. One of the nation's leading media watchdogs says there is a powerful element of the media today that has gone beyond mere "liberalism" and has moved into "sheer radicalism." bias? Larry Elder cites several examples of blatant political bias in network television news coverage. Liberal Media: Every poll shows journalists are more liberal than the American public — and the public knows it. Leading journalists may deny their bias, but every survey over the past 25 years shows journalists do not think or vote like the American public. Reporters overwhelmingly vote for Democrats, their views on issues such as abortion and gay rights are well to the left of most Americans, and large majorities want big government even more involved in the economy. truth" abortion: Many in the media resent any suggestion that they are either politically biased or that journalists' personal views stop them from doing a good professional job of accurately reporting the news. The way the issue of partial birth abortion has been reported — or not reported — gives the lie to such protests. and the Media: The press treatment of George W. Bush is motivated by hate, spite and a vicious disregard for the truth and the national interest. What the media is doing to Bush is unprecedented — worse than what was done to Nixon because it lacks journalistic virtuosity. What the media is doing to Bush is inexcusable because, unlike in the case of Watergate, there is no smoking gun, precisely because there was no crime. Newsroom conservatives are a rare breed. If you'd like to check out an endangered species, don't bother with a trip to the zoo. Just drop by the newsroom of your favorite newspaper or TV station and ask to see the conservatives. media? I'm shocked! A new survey by the Pew Research Center says journalists have political and ideological leanings more liberal than those of the general public. Or, as a sensible headline might have put it: "Researchers ferret out the obvious yet again." More Stuff the Left Has Gotten Away With Lately: The partisan mainstream media hates it when the Right points out their bias. But sometimes we just can't help it. Here are three recent comments by well known liberal senators that received little comment in the Big Media. Thankfully, conservative sources will not let things like these Media Bias in Australia. The taxpayer-funded Australian Broadcasting Corporation (ABC) occupies a position in Australia similar to that enjoyed by the BBC in the United Kingdom. ... No Australian commercial network approaches the ABC in terms of reach and, arguably, influence. It is well-funded, amply staffed and under more or less constant criticism for projecting a left-wing take on just about every aspect of Australian life that it touches. Rupert and Hillary: News Corp. CEO Rupert Murdoch's fundraising for Hillary Clinton was treated as a man-bites-dog shocking news story. Keith Olbermann's little-watched MSNBC program went crazy with the news. It has been assumed that Murdoch, whose $60 billion media empire includes the Fox News Channel (FNC), the Weekly Standard magazine and the New York Post, is a conservative who wouldn't be caught dead supporting a left-wing Democrat like Hillary. In truth, Murdoch is an opportunist who plays both sides of the Foreign Assassination. Christian Coalition founder Pat Robertson prompted a firestorm of media outrage after he suggested that the Bush administration should assassinate a foreign leader who posed a threat to the U.S. But when senior Clinton advisor George Stephanopoulos publicly argued for the same kind of assassination policy in 1997, the press voiced no objection at all. Kennedy and McCain: This Is Media Balance? Conservatives and media watchdog groups are aghast at a longstanding radio debate program that has Sen. John McCain "pitted against" Sen. Ted Kennedy — "a discussion between the Democrats' favorite Democrat and the Democrats' favorite Republican." Central's "That's My Bush" Targets First Lady Couldn't Get Dubya, So Now They're After Jenna Liberal media show their stripes every day. Media bias determines which stories make it to the front page and which ones don't. For truth in journalism: Do the people have a right to know the biases of the people from whom they get almost all their information about politics, politicians, candidates and causes? Seems to me that an honest journalist has to answer yes. Tom Brokaw vs. conservative "jihad": In an interview with Jane Hall in the most recent Columbia Journalism Review, Brokaw suggests there is no such thing as liberal media bias … and then asserts that liberal bias is an "obligation" of journalism. A Lesson in Dallas: Hitting the street and answering that leftist rant is one way even a small group of conservatives can force their message to stand next to the radicals in the so-called mainstream press. Just don't expect much coverage from the press. speech from the left: In December 1994 I wrote the first of what would become a yearly series of columns on the subject of liberal hate speech. I had noticed that when a prominent Republican or conservative said something offensive about liberals, it typically set off a storm of media condemnation, while an anti-conservative smear voiced by a liberal or a Democrat rarely drew any protest. The Communist Party And The American Media Elite: Is America's left-wing media elite about to suffer the fate of the Communist Party of the old Soviet Union? I ask this question because my weekend reading raised some interesting parallels between the Soviet leadership and the current structure of the US news media. media bias, part I: Bernard Goldberg, author of the bestselling "Bias" says, "If the media elites don't take the wake-up call, ...I think they're going to become the journalistic equivalent of the leisure suit — harmless enough, but hopelessly out of date." media bias, part II: Journalists somehow think that they are the only species on the planet who can keep their biases in check because they're professionals. Well, I don't think that's true. Media Bias, part III: The problem there and the problem far more responsible for the public's losing trust is when the New York Times rams ideology down your throat in every part of the newspaper, not simply the editorial page. Give Public Broadcasting its Freedom — Now. Philanthropist Joan Kroc's recent gift of $200 million to National Public Radio adds to the millions of dollars in tax-deductible donations from corporate underwriters and private citizens that pour into public broadcasting coffers each year. In light of the Kroc gift, and with growing evidence that public broadcasting has been almost totally commercialized, isn't it time to wean public radio and television from the millions of dollars it receives from national, state and local governments? Does the media give soft-glove treatment to Democratic gaffes? Critics of President George W. Bush derive great pleasure from his inability to pronounce the word "nuclear." As a candidate, they ridiculed Bush for not knowing the heads of Pakistan, Chechnya and India. But what of the gaffes made by various liberal politicians? Journalists' liberal bias: Why it matters, how it hurts. Liberal bias matters. This bias affects consumers of "news" in subtle and not-so-subtle ways. We Distort, You Figure It Out. This, of course, is no longer journalism. It may be entertainment. But it is not responsible information upon which we can any longer rely. liberal denials of bias: The suggestion …that the news media do not tilt to the left, is just not serious thinking. Or, if it's coming from those who would consider themselves serious thinkers, it's just not intellectually honest. in denial: What is it about many liberals that blinds them to their true nature? What makes them think that they are unbiased, objective, open-minded, tolerant and free of "hate"? Why are they so often in denial — even about their Media suffer from acute denial syndrome. The derision the big media holds for all things conservative, especially when that conservatism has a religious component, is beyond debate. media bias? Denials of media bias seem to have become more frequent or more vehement lately. Some in the media try to dismiss the accusation as old stuff. But the only real question is whether it is true, because the truth doesn't wear out with the passage of time. about radio and TV. Liberals are especially uncomfortable with people who worship God and not the state. Most broadcast programming and reporting in big newspapers reflect these biases. Bias Matches UNESCO Intolerance: Popularizing the anti-Christian principles of the UN Declaration on Tolerance. Bias on Media Bias: One of the incredible feats of media journalists is denying that there is media bias by equating it with conspiracy theories. When people share the same bias, they don't need a conspiracy. The harm comes from the fact that most of the public gets to see only that part of reality which has been filtered through the same preconceptions shared by 90 percent of those in the media. Will a new left-wing TV network rescue the despondent Dems? Only the looniest leftist could nourish the notion that today's broadcast or cable-TV networks shortchange or suppress liberal views. Media Bias Basics: This study shows the political composition of the media — voting patterns, political affiliations and beliefs — as expressed to researchers by the reporters themselves. This is followed by a review of public opinion on liberal media bias, and what members of the media have said about liberal media bias, and a guide to how to identify liberal media bias. Quoting from "Media Bias Basics": Seventy million Americans rely on broadcast television for their news. They form opinions based on what they hear and see and to a lesser extent, read. Since citizens cannot cast informed votes or make knowledgeable decisions on matters of public policy if the information on which they depend is distorted, it is vital to American democracy that television news and other media be fair and unbiased. Media bias: can they still deny it? Why does it matter, the way the media frames issues and uses certain terms or expressions? Ronald Reagan, for example, called his anti-ballistic-missile defense shield the Strategic Defense Initiative, or SDI. But many in the media use the term "Star Wars," an expression that Reagan loathed. Media Donations to People for the American Way: Perhaps it's past time that we stopped calling these entities "news" organizations and called them what they really are: liberal propaganda machines. Profiles In Bias: from the Media Research Center. Clever Is the Word for a Biased Media: The professional news readers are very smooth, very clever — so clever, in fact, that they can slant stories to their liberal bias often without a ripple of suspicion. Ethics and Morality Training for the Media? Although we don't yet know what the facts are, the mainstream media has seized this story and is using it, to the great glee of the far left in this country, to indict the entire U.S. war effort in Iraq. While our combat troops undergo this ethics training (which is already a standard part of their training), it might be a good idea if the mainstream media put its journalists and executives through "ethics training" to highlight the importance of adhering to legal, moral and ethical standards in their reporting, writing and broadcasting. Small-Time Crooks: The pattern is clear. The current scandal frenzy is not a campaign against fraud — it's a campaign against business and capitalism. The people leading the hysteria about "corporate crime" are eager to expose and condemn fraud by a private businessman — but they ignore or excuse it when the lies are told by Media Fraud: Media bias is no longer news. Poll after poll has shown that the vast majority of journalists vote for Democrats, even though the country as a whole is pretty evenly split between the two major parties. By itself, there is nothing wrong with this. It becomes a problem when media bias becomes media fraud. Media bias in editorials and columns is one thing. Media fraud in reporting "facts" in news stories is something else. Out-FOXing the Media: Fox News is on the side of the United States; it is the network for the Red states. When columnists refer to the Red states and the Blue states, they are making reference to this map which shows the county-by-county results of the 2000 presidential election. News That Fits: How the media color their coverage. Serving Al Gore. "We now have incontrovertible front-page evidence. The New York Times is eager to run stories that are harmful to conservatives and they sit on stories that are harmful to Democrats." New York Times on the Defensive: Publisher Arthur Sulzberger Jr. comments on the newspaper's pro-homosexual bias. The "myth" of media bias: "Journalists have to admit that their bias leads to slanted reporting. ... It is also time for people to stop demanding the mythical unbiased reporting that has never existed. An objective reporter is not one that takes no stand in covering a story, but one who in search of the truth reports what the truth Media Reality Check: A weekly report on major news stories distorted or ignored by the mainstream media. Is 'Dim and Perverse', in a remarkable departure from any pretense to objectivity. Big Battle: Media Bias. Bill Clinton "fulfills a campaign promise," but when President Bush does likewise, the mainstream media give a stunningly different spin. Back to the top of the page News media critics Dallas Morning News Watch: Here is the place to get an objective media bias analysis of the news coverage in the Dallas Morning News, and other media as well. Comment is encouraged from Dallas Morning News journalists and editors, as well as readers regarding our critique of news bias. Web Critics Take Aim at Old-Style Publishers: A small but growing contingent of amateur and semi-professional media critics are taking aim at newspapers and periodicals, picking up where those papers' ombudsmen (if they have them) leave off. One of the first to appear was SmarterTimes.com, a site that painstakingly points out flaws in The New York Times. Since then, similar sights have cropped up that skewer the Los Angeles Times (LAExaminer.com) and the San Francisco Chronicle (Chronwatch.com). Back to the top of the page Links to other internet resources Bias Videos: See for yourself! Suppressed News dot com National Anxiety Center: Information to refute the "crisis" news you often see in the national news media. Parents Television Council: "A nonprofit organization dedicated to improving the quality of prime time television, restoring positive values, and making TV a socially responsible medium." Truth In Broadcasting: provides visitors with direct links to RealAudio Internet broadcasts that discuss modern-day political, economic, and religious issues. Each web-cast is archived and reports all the news that the controlled media never does. TV–B–Gone: A one-button remote control that sends the power-off code for every known make and model of television. Back to the Home page