text
stringlengths 9
5.77M
| timestamp
stringlengths 26
26
| url
stringlengths 32
32
|
---|---|---|
Q:
reinterpret casting to and from unsigned char* and char*
I'm wondering if it is necessary to reinterpret_cast in the function below. ITER_T might be a char*, unsigned char*, std::vector<unsigned char> iterator, or something else like that. It doesn't seem to hurt so far, but does the casting ever affect how the bytes are copied at all?
template<class ITER_T>
char *copy_binary(
unsigned char length,
const ITER_T& begin)
{
// alloc_storage() returns a char*
unsigned char* stg = reinterpret_cast<unsigned char*>(alloc_storage(length));
std::copy(begin, begin + length, stg);
return reinterpret_cast<char*>(stg);
}
A:
reinterpret_casts are used for low-level implementation defined casts. According to the standard, reinterpret_casts can be used for the following conversions (C++03 5.2.10):
Pointer to an integral type
Integral type to Pointer
A pointer to a function can be converted to a pointer to a function of a different type
A pointer to an object can be converted to a pointer to an object of different type
Pointer to member functions or pointer to data members can be converted to functions or objects of a different type. The result of such a pointer conversion is unspecified, except the pointer a converted back to its original type.
An expression of type A can be converted to a reference to type B if a pointer to type A can be explicitly converted to type B using a reinterpret_cast.
That said, using the reinterpret_cast is not a good solution in your case, since casting to different types are unspecified by the standard, though casting from char * to unsigned char * and back should work on most machines.
In your case I would think about using a static_cast or not casting at all by defining stg as type char *:
template<class ITER_T>
char *copy_binary(
unsigned char length,
const ITER_T& begin)
{
// alloc_storage() returns a char*
char* stg = alloc_storage(length);
std::copy(begin, begin + length, stg);
return stg;
}
| 2024-07-20T01:27:04.277712 | https://example.com/article/3657 |
If this is your first visit, be sure to
check out the FAQ by clicking the
link above. You may have to register
before you can post: click the register link above to proceed. To start viewing messages,
select the forum that you want to visit from the selection below.
You think a dog check up is bad, try a rabbit @ $230
yup that is right.. the lil fuzz ball came home with my daughter from university. I thought his eyes looked odd and then he was quite quiet. He immediately ran to me and put his head on my lap - instincts said right then, he is sick. NOPE she said he isnt. A wk goes by, he is still running to me and resting on my leg... nope I know he is, so I decided he should have a check up. YUP infected ears, eyes and being a longhaired guy is was matted quite a bit. meds, boarding for day, dematting totalled $230 and great he must go back in a wk for a check up.... on eyes. If they arent better, they a fungal test at another 55 on top of the 66 they will charge at the check up. Lets see that will be a grand total of$340! I needed that after a spay/hernia/teeth bill of 400 2 days earlier. $740 on this wks pets... that better be the end for this yr outside of flea/heartworm meds I need to buy in 2 wks @100.
Kodee's mom, I'm SO glad you took little bunny in for a checkup. I've had rabbits my whole life as pets. Our Baxter bunny is now 10 years old! Rabbits don't act odd or sick unless they are REALLY really ill...it's part of their protective mechanism to act as if everything is well until they really can't fake it anymore. It's imperative to act quickly. I'm so sorry for your bill, but you can be comforted to know that you did the right thing... -Natalie
My Chevy(bunny) is the most expense pet I have. Well I guess him and Doodles are running pretty even right now. But I got him when i was 16yrs old because my guinea pig died and I wanted a new pet. I went ot the local farm nad garden store and got him because he was the smallest and had bright red eyes. Well I toke him to the vet for a check up and found out my bunny has a over bite. His teeth dont line up. I spent the last five years bring him to the vet every two weeks to have his teeth trimmed at 35.00 a trim. Then about a year ago we moved to Colorado and got a new vet. He told us that we need to trim the molers to. Which our other vet had never talked about. Needless to say. That was 250.00 a pop and you have to do three trims like that back to back about a month apart Because usually then the teeth will come back into alignment and grind on themselves. Well it didnt work and That was 750.00. Then we were told to go back to the 35.00 trim every two weeks and keep watching him to see if he is in pain. When he is showing any sign of pain it is PTS for him sadly. The vet said we would probably have a couple of month after the last moler trim then it would be time. That was a year ago and he is still going strong! The money has been worth it because Chevy is still here and hopping
Nichole, Doodles and Kiwi
My Chevy(bunny) is the most expense pet I have. Well I guess him and Doodles are running pretty even right now. But I got him when i was 16yrs old because my guinea pig died and I wanted a new pet. I went ot the local farm nad garden store and got him because he was the smallest and had bright red eyes. Well I toke him to the vet for a check up and found out my bunny has a over bite. His teeth dont line up. I spent the last five years bring him to the vet every two weeks to have his teeth trimmed at 35.00 a trim. Then about a year ago we moved to Colorado and got a new vet. He told us that we need to trim the molers to. Which our other vet had never talked about. Needless to say. That was 250.00 a pop and you have to do three trims like that back to back about a month apart Because usually then the teeth will come back into alignment and grind on themselves. Well it didnt work and That was 750.00. Then we were told to go back to the 35.00 trim every two weeks and keep watching him to see if he is in pain. When he is showing any sign of pain it is PTS for him sadly. The vet said we would probably have a couple of month after the last moler trim then it would be time. That was a year ago and he is still going strong! The money has been worth it because Chevy is still here and hopping
Nichole, Doodles and Kiwi
Oh wow, that is hard in the pocket and pain department. The good thing the vet said is she has never seen a rabbit with perfect teeth like Kahlua! His weight is perfect, skin, breathing... its just these mats upkeep and ears I cant figure out. We have had 3 vets and all disagree - clean ears - dont. The dont ends up with infection and nice vet bills. I just found an ontario rabbit association with an online forum. I see quite a few area agoria fuzzy rabbits so maybe someone there can give suggestions. Really someone could start up quite the vet assistant business grooming rabbits!
Yeah teeth and ears can be tricky! I have never cleaned Chevys ears but he has short hair and other then his teeth everything else on him works perfectly! Bunnies can be a pain but they are cool creatures. I like them best out of all the small creatures. I have own hamsters, gerbils, guinea pigs, ect.
On the grooming issue. That is tough because shaving bunny is tough and so is brushing their skin is extremely thin. so it is easy to cut or break the skin. Good luck with Kahlua!
Nichole
good for you!!!! its almost always best to trust your gut when it comes to these little guys. my cousin adopted a rabbit from the humane society and his age was estimeated at 2 years old....he lived another 15 years!!!! we changed his name from thumper to energizer bunny after a while, heehee.
i would see if you can work out some MAJOR chores for your daughter to be doing for you soon since youre such a great bunny grandma! good luck with the bun-bun!
I am so glad that you took him in to the vet. I have a house bunny and I have to say that rabbits are so much like dogs...they are as smart and as affectionate, and also as humorous, as dogs! My Ebony (he is a mini lop) amazes me everyday, he is so sweet and such a friend...he will follow me all over the house, with the dogs....it's so sweet! And he is litterbox trained, Ebony is the love of my life. | 2023-09-03T01:27:04.277712 | https://example.com/article/8033 |
Featured
Highlights
Upper Material : Faux Leather
sole Material : PVC
Color : Multi
Toe Shape : Round Toe
Wearability : Daily
Product type : Flat
SKU Code : JDB023-Peach-JDB046 White-39
SUPC: SDL208014682
Description
An economical sandal combo with synthetic upper with intricate designing & detailing , Smooth footbed with stitched detail, has an overlay with branding on the heel region, Textured outsole with a slightly upraised heel
Terms & Conditions
The images represent actual product though color of the image and product may slightly differ. | 2024-02-06T01:27:04.277712 | https://example.com/article/4294 |
A small plane landed on Orange Avenue along the Long Beach-Signal Hill border around 10:30 a.m. today.
The single-engine aircraft, a Piper PA28, made it to the ground safely just outside Willow Springs Park, which is between Willow and Spring streets, according to authorities.
Signal Hill Police Chief Christopher Nunley said the pilot started having engine problems shortly after taking off from Long Beach Airport and initially tried to land on the 405 Freeway.
When there were too many cars there, he set down on Orange Avenue without hitting any vehicles or the many power lines in the area, “which is miraculous,” Nunley told camera crews at the scene.
The pilot was the only person aboard and was not injured. Even the plane suffered no damage, Nunley said.
The plane is registered to the Long Beach Flying Club and Flight Academy, according to the FAA. It was built in 1979.
The FAA will investigate, FAA spokesman Ian Gregor said.
The Los Angeles County Fire Department tweeted that the plane was not leaking anything and there was no danger to the public.
Staff writer Kelly Puente contributed to this report. | 2023-10-31T01:27:04.277712 | https://example.com/article/1147 |
Acetylcholinesterase liquid crystal biosensor based on modulated growth of gold nanoparticles for amplified detection of acetylcholine and inhibitor.
A novel acetylcholinesterase (AChE) liquid crystal (LC) biosensor based on enzymatic growth of gold nanoparticles (Au NPs) has been developed for amplified detection of acetylcholine (ACh) and AChE inhibitor. In this method, AChE mediates the hydrolysis of acetylthiocholine (ATCl) to form thiocholine, and the latter further reduces AuCl(4)(-) to Au NPs without Au nanoseeds. This process, termed biometallization, leads to a great enhancement in the optical signal of the LC biosensor due to the large size of Au NPs, which can greatly disrupt the orientational arrangement of LCs. On the other hand, the hydrolysis of ATCl is inhibited in the presence of ACh or organophosphate pesticides (OPs, a AChE inhibitor), which will decrease the catalytic growth of Au NPs and, as a result, reduce the orientational response of LCs. On the basis of such an inhibition mechanism, the AChE LC biosensor can be used as an effective way to realize the detection of ACh and AChE inhibitors. The results showed that the AChE LC biosensor was highly sensitive to ACh with a detection limit of 15 μmol/L and OPs with a detection limit of 0.3 nmol/L. This study provides a simple and sensitive AChE LC biosensing approach and offers effective signal enhanced strategies for the development of enzyme LC biosensors. | 2024-07-28T01:27:04.277712 | https://example.com/article/8370 |
---
title: Open Multilingual Wordnet
homepage: http://compling.hss.ntu.edu.sg/omw/
category: NaturalLanguage
description:
version:
keywords:
image:
temporal:
spatial:
access_level:
copyrights:
accrual_periodicity:
specification:
data_quality: false
data_dictionary:
language:
license:
publisher:
organization:
issued_time:
sources: []
| 2024-03-05T01:27:04.277712 | https://example.com/article/2057 |
All relevant data are within the paper and its Supporting Information files.
Introduction {#sec001}
============
The proliferation of online social media services such as Twitter is widely recognized as signifying a revolution in how we utilize information and understand the way our society communicates. It also presents an open opportunity for any interested party to utilize the massive data accrued from such services for understanding the world as well as ourselves \[[@pone.0124722.ref001], [@pone.0124722.ref002]\]. Among many attempts to harness the potential of online social media, a prominent one is to mine the opinions and sentiments of the public for a variety of purposes, either academic or commercial \[[@pone.0124722.ref003]--[@pone.0124722.ref006]\]. The use of social media for such purposes poses a potentially critical problem, however: Since online social media users constitute an uncontrolled, thus likely unfair, sample of the population unlike in well-designed opinion polls, it is unclear to what extent the online sphere accurately represents the offline world. User profiles collected by online social media and made available to researchers frequently fall short of giving a sufficiently accurate demographic information about the users, and the traditional polling techniques using questionnaires have to be used to augment them \[[@pone.0124722.ref007]\]. The ideal case would be that the demographics of online users were identical to that of the offline public at large, guaranteeing the agreement of the opinions mined from the online sphere and with traditional polls. A less ideal, but a manageable case would be when the online demographics are precisely known, allowing us to employ straightforward calibrations to find accurate results. But for a limited number of cases the demographic differences between online service users and non-users are not precisely known \[[@pone.0124722.ref008]\], and given the breadth of topics discussed online and the difficulty of accurately estimating the number of users it does not seem realistic that such a state can ever be reached.
To those looking to mine for information from social media as a proxy for conducting polling, the potential disparity between the online and the offline world due to the unknowable demographics raises serious doubts on the usefulness of online social media, particularly where the offline reality is essential such as politics. In such cases the lack of a systematic method by which to compare the online and the offline would make finding relevant, useful information from online data infeasible. When researchers study such problems, they could circumvent this issue by restricting the scope of their study to the online sphere so that by design the real-world public at large is of little concern. This may be appropriate when the issue being studied is pertinent only to the online world; for instance, when the issue affects the online sphere only, or when one declares that their only interest is in the opinions of the online sphere. While certain scientific discoveries can still be made this way since the data themselves are nonetheless novel and interesting, the inability to draw conclusions regarding many issues pertinent to the offline potentially cripples the potential of online social media.
In order to overcome such a problem, it is important to identify the discrepancies between the online and the offline quantitatively. One way of achieving that is to apply a common analytical and modeling framework to comparable data sets representing the online and the offline so that we can perform a cross-analysis of the patterns found therein. In this paper we demonstrate the process using as an example the landscape of political spectra (signifying the political leanings or positions) constructed from distinct online and offline data of the U.S. and South Korea, two nations with modern representative democracies. Specifically we study the political spectra of the legislators in each country, constructed in two ways. First, we construct a spectrum from the Twitter followership network, which we take as representing the online political landscape. There are some direct evidence that connection on social networks are biased towards those with similar political viewpoints. In a well-known study, Adamic and Glance showed a clear partisan divide on the blogosphere \[[@pone.0124722.ref009]\]. Regarding Twitter, Parmalee and Bichard showed that over 70% of those espousing strong conservative or liberal ideology completely avoided following political leaders who challenge their beliefs \[[@pone.0124722.ref010]\]. In the case of Korea (one of the two countries studied in this work), Chang found that both politicians and ordinary Twitter users exhibit a systematic relationship between their political choices and their position in the Twitter network \[[@pone.0124722.ref011]\]. Second, we construct a spectrum from the legislators' roll call (voting) records, which we take as representing the offline political landscape that more closely reflects the true public one, since the legislators' voting is likely to be influenced by the offline public. The cross-examination of the two spectra should then reveal the differences between the online and the offline.
Results {#sec002}
=======
Data {#sec003}
----
We utilized the following four data sets: (i) The Twitter followership network of the members of the 111th U.S. Senate; (ii) the roll call of the Senators on legislative bills; (iii) The Twitter followership network of the members of the 18th Korean National Assembly; and (iv) the roll call of the Assembly members between the years 2008 to 2010 (covering three quarters of the term). The Twitter data are current as of June 2011, and Twitter users who followed two or more legislators were included in the data. The data contain all legislators who owned an official Twitter account at the time of data collection and maintained their seat during the entire term considered. This resulted in 67 senators (out of 100), 698 roll calls, and 139 806 Twitter users for the U.S., and 194 assembly members (our of 299), 1 119 roll calls, and 124 341 Twitter users for Korea. Both countries have two-party systems, the Republican Party (GOP) and the Democratic Party (DEM) that account for 99% of the U.S. Senate, and the Grand National Party (GNP) and the Korean Democratic Party (DP) that account for 86% of the Korean National Assembly. \[[@pone.0124722.ref012]\]
The data were modeled as bipartite networks. See [Fig 1](#pone.0124722.g001){ref-type="fig"} for the schematic illustrations of the data.
![Schematic illustrations for the data employed in our study.\
(A) The legislators are included in two distinct bipartite networks. On the left is the legislator--Twitter user network, and on the right the legislator--legislative bill network. Of the two types of edges---a 'nay' vote and a 'yea' vote---we consider the 'nay', since they are believed to carry more information in determining the legislators' political spectra (see the [Method](#sec007){ref-type="sec"} section for more detail). The structure of each bipartite network can reveal differences in political positions of the legislators, which is the origin of the online-offline discrepancy. Here, for example, the upper two legislators occupy similar positions that are different from that of the the lower one since their follower sets are disjoint. The two groups' voting patterns may show less clear differences. In this study we use Multidimensional Scaling (MDS) and Kendall's ranking correlation coefficient to quantify the spectra and their discrepancies. (B) A sample of the U.S. senator--Twitter followership network consisting of ten legislators and their Twitter followers. The red squares are Republican (GOP) senators, and the blue squares are the Democratic (DEM) senators. All other nodes are Twitter users.](pone.0124722.g001){#pone.0124722.g001}
Online and offline political spectra {#sec004}
------------------------------------
The data introduced above can be modeled as bipartite networks on which the political spectra are constructed using matrix decomposition methods \[[@pone.0124722.ref013], [@pone.0124722.ref014]\]. In this study we use Classical Multidimensional Scaling (CMDS) \[[@pone.0124722.ref015], [@pone.0124722.ref016]\]. The method requires a dissimilarity function that act as the distance between two legislators. We use the Kulczynski dissimilarity \[[@pone.0124722.ref017]\]. In essence, CMDS regards the dissimilarity values as the Euclidean distances between legislators in 1-dimensional space and determines the coordinates of the legislators that most closely matches the given distances. We then interpret the coordinates as the political positions of the legislators. Once the spectra of the legislators are determined this way using the Twitter network, we can construct the spectra of the Twitter users by averaging the positions of the legislators that each user follows (see the [Methods](#sec007){ref-type="sec"} section for more details).
We consider the offline, roll call-based spectra as revealing the true political positions of the legislators as they results from their actual actions of voting. Furthermore, we accept the roll call-based spectra as more accurately reflecting true political positions of the offline public and the society, as the legislators' actions are likely to be heavily influenced by public interests.
The political spectra of the legislators thus constructed are shown in Fig [2A](#pone.0124722.g002){ref-type="fig"} and [2B](#pone.0124722.g002){ref-type="fig"} for the U.S., and in Fig [2C](#pone.0124722.g002){ref-type="fig"} and [2D](#pone.0124722.g002){ref-type="fig"} for Korea. The spectra of the Twitter users (the average of the positions of the legislators that they follow) are shown as the solid lines in Fig [2A](#pone.0124722.g002){ref-type="fig"} and [2C](#pone.0124722.g002){ref-type="fig"}.
![Political spectra determined from Twitter and roll call data.\
(A) The Twitter-based spectrum of the legislators, and the spectrum of Twitter users in the U.S.; (B) The roll call-based spectrum of the legislators in the U.S.; (C) The Twitter-based spectrum of the legislators, and the spectrum of Twitter users in Korea; (D) The roll call-based spectrum of the legislators in South Korea. The legislators are indicated by the shapes (one shape corresponds to one legislator) and the spectra of the Twitter users are indicated by solid lines. The party-line splits of the legislators are evident in both the Twitter- and the roll call-based spectra for both countries. The general Twitter public (solid lines in Fig 2A and C) show a majority-minority reversal, more people aligning themselves with the minority parties.](pone.0124722.g002){#pone.0124722.g002}
A close examination of these spectra can reveals the disparities between the online and the offline. First, we find a stark indication of the significance of the disparity between Twitter and the offline in the majority-minority reversal in both countries: The majority of Twitter users align themselves with the minority parties. The mean and the median positions, and the overall distribution of the spectra are shown in [Fig 2A](#pone.0124722.g002){ref-type="fig"} for U.S. and [Fig 2C](#pone.0124722.g002){ref-type="fig"} for Korea. We find that in the U.S., Republican Senators John McCain (the presidential candidate in 2008) and Jim DeMint (of the populist Tea Party movement) boasting a disproportionately large number of followers are primarily responsible for this behavior. In Korea, the DP (green) overwhelms the GNP (blue) in the Twitter sphere despite being outnumbered by a nearly two-to-one margin in the number of seats in the Assembly.
Second, the comparison between the roll call-based spectra of the legislators as the proxy for the offline public at large and the spectra of the Twitter users also reveals a similar disparity. Although we cannot directly compare the online and offline spectra on the same plot because of the differences in scale, the comparison of relative biases in the distribution is still valid. For the U.S., the spectrum of the Twitter users is heavily skewed towards GOP in sharp contrast to the DEMs who are favored in the spectrum of the offline public (Fig [2A](#pone.0124722.g002){ref-type="fig"} and [2B](#pone.0124722.g002){ref-type="fig"}). The trend is similar in the Korean spectra: the offline public favors GNP in contrast to the Twitter user who favor DP (Fig [2C](#pone.0124722.g002){ref-type="fig"} and [2D](#pone.0124722.g002){ref-type="fig"}).
Third, there also exists a discrepancy between the real political positions of the legislators and their positions constructed from the Twitter data. The party-line split in the positions of the legislators (indicated as solid shapes in the figures) is immediately noticeable for both nations, and accordingly the roll call-based spectra and the Twitter-based spectra of the legislators exhibit some degree of overall agreement (similarity) as measured by Kendall's *τ*-coefficient (1 means identity; 0 means independence), with 0.68 ± 0.02 for the U.S. and 0.48 ± 0.01 for Korea (see [Methods](#sec007){ref-type="sec"} section for more detail). When we consider each party separately, however, we find a weaker agreement---for the U.S. parties, the *τ* is 0.463 ± 0.003 for GOP and 0.291 ± 0.022 for DEM. For the Korean parties that is 0.029 ± 0.005 for GNP and 0.062 ± 0.051 for DP.
This indicates that Korean Twitter population is more noticeably impervious to the political positions of the legislators, resulting in the very low level of intra-party correlations between the Twitter based spectrum and the roll call based spectrum of the legislators. In U.S. the correlation is more sizable.
These disparities between the Twitter users and the offline public show the limits of Twitter as a source for fair and accurate opinion mining, especially pertaining to political or social issues. In fact, the majority-minority reversal shows us that Twitter may be functioning as a de facto "alternative media."
Quantifying partisanship of twitter users {#sec005}
-----------------------------------------
The spread structures of the Twitter users' spectra in Fig [2A](#pone.0124722.g002){ref-type="fig"} and [2C](#pone.0124722.g002){ref-type="fig"} imply that Twitter users are biased (show partisanship) in choosing which legislators to follow. We can quantify the strength of a user's bias by measuring the probability that a user follows certain parties, and comparing it with the random probability that a user becomes connected to a party if the connections were made at random. If a user is unbiased they must be identical, and deviations between the two probabilities signify the strength of the bias.
A widely-used measure for the discrepancy between two probability distributions is the Kullback-Leibler (KL) divergence *D*. It is non-negative, i.e. *D* ≥ 0, 0 when two distributions being compared are identical, and positive otherwise. To account for random fluctuations we calculate the *Z*-score of KL divergences (see [Methods](#sec007){ref-type="sec"} section for detail) *Z* ~*D*~ as a function of the number of politicians (degree) *k* that a user follows, shown in [Fig 3](#pone.0124722.g003){ref-type="fig"}. *Z* ~*D*~ ≳ 1 implies partisanship, while *Z* ~*D*~ ≲ −1 implies the opposite. The radius of the disc around each plot point is proportional to the the log of the number of users with the given degree *k*. The figure shows the widespread nature of partisanship on Twitter \[[@pone.0124722.ref009]\], with the exception of high-degree Twitter users who are more balanced in following each party (see [Methods](#sec007){ref-type="sec"} section for more detail).
![Z-score of the Kullback-Leibler (KL) divergence as a function of the number of legislators *k* that a Twitter user follows in the U.S. (A), and in Korea (B).\
The radius of each circle is proportional to the log of the number of Twitter users with given *k*. *Z* ~*D*~ ≳ 1 implies a statistically significant level of partisanship (political bias). We see that partisanship is widespread in both countries, except for high-degree Twitter users for whom *D* → 0.](pone.0124722.g003){#pone.0124722.g003}
Discussion {#sec006}
==========
In this paper we proposed a method to compare the political spectra of the online and offline public. We found significant discrepancies between the online and the offline, demanding caution when one tries to use online social media such as Twitter as source for fair and accurate opinion mining. A quantitative measurement of political biases found widespread partisanship among Twitter users.
While our work shows the potential limits of the correctness of online social media-based findings, it is still meaningful that were able to obtain the political spectra of Twitter users based on their behavior observed objectively. This enables us to overcome uncertainty in methods based on self-assessment of political positions \[[@pone.0124722.ref018]--[@pone.0124722.ref020]\] caused by the lack of objective, common measure of political positions agreed upon by people. In our method, however, a person's political position is determined from the objective behavior of all other people in the data, allowing us to construct global and objective political spectra.
Methods {#sec007}
=======
Classical multi-Dimensional scaling {#sec008}
-----------------------------------
CMDS is a method to embed a set of objects in a pre-defined *N*-dimensional space such that the distance between objects match given dissimilarities as much as possible. Specifically, CMDS aims to produce the coordinates of the objects that minimize a loss function called STRAIN \[[@pone.0124722.ref015]\]. In this paper we set *N* = 1 to produce a linear political spectrum that agrees with the common way of thinking of political polarization (e.g. left wing versus right wing).
CMDS is performed by the eigendecomposition of the matrix made from the dissimilarities. The quality of the resulting coordinates in reproducing the given dissimilarities is defined as the fraction of the first eigenvalue over the sum of all positive eigenvalues. The values are 0.297 for Korea and 0.872 for the U.S. with the roll call data, and 0.113 for Korea and 0.093 for the U.S. with the Twitter data. The noticeably high value for the U.S. roll call data may be due to the stable two-party system of the U.S.
While one could theoretically gain more information from higher-dimension CMDS, we could not observe meaningful patterns allowing straightforward political interpretation beyond the first. Our 1-dimensional solutions show clear separations of the legislators along party lines, thus justifying the political interpretation given.
We used the Kulczynski dissimilarity \[[@pone.0124722.ref017]\]. In Twitter data it is given between two legislators *i* and *j* as $$\begin{array}{r}
\left. \delta_{T}\left( i,j \right) = 1 - \frac{1}{2} \middle| \frac{F_{i} \cap F_{j}}{|F_{i}|} + \frac{F_{i} \cap F_{j}}{|F_{j}|} \middle| , \right. \\
\end{array}$$ where *F* ~*x*~ denotes the set of the followers of legislator *x*. The Kulczynski dissimilarity is recommended as an alternative to the commonly used Jaccard measure when the size of *F* ~*x*~ exhibits a wide range as in our Twitter data ([Fig 4](#pone.0124722.g004){ref-type="fig"}) \[[@pone.0124722.ref021]\].
![Degree distributions in the data.\
(A) The distribution of the number of Twitter followers for each legislator. (B) The distribution of the number of legislators that Twitter users follow. All distribtuions are heavy-tailed.](pone.0124722.g004){#pone.0124722.g004}
The dissimilarity between legislators *i* and *j* in the roll call data is, similarly, $$\begin{array}{r}
\left. \delta_{R}\left( i,j \right) = 1 - \frac{1}{2} \middle| \frac{V_{i} \cap V_{j}}{|V_{i}|} + \frac{V_{i} \cap V_{j}}{|V_{j}|} \middle| , \right. \\
\end{array}$$ where *V* ~*x*~ denotes the set of *nay* (opposition to a bill's passing) votes of legislator *x*. We ignore the *yea* votes here. The motivation for this is that most bills that pass are bipartisan, potentially limiting the discriminating power of the *yea* votes.
Notes on the spectrum of Twitter users {#sec009}
--------------------------------------
From the legislator-Twitter data we estimated the spectrum of the legislators first on their Twitter followership, and then used it to obtain the spectrum of Twitter users. A dual approach could have been employed where we perform CMDS on the Twitter users by defining the dissimilarities between the users based on the set of legislators that they follow, and determining the positions of the legislators based on the results. While there is no reason to object this approach in principle, its computational cost was prohibitive, requiring several tens of gigabytes of memory to store the dissimilarity matrix alone.
Kendall's *τ* rank correlation coefficient {#sec010}
------------------------------------------
Kendall's rank correlation *τ* quantifies the similarity between two orderings of objects. Letting (*x* ~1~, *x* ~2~, ⋯, *x* ~*n*~) and (*y* ~1~, *y* ~2~, ⋯, *y* ~*n*~) be the orderings we wish to compare, Kendall's *τ* rank correlation coefficient is defined as $$\begin{array}{r}
{\tau = \frac{2\left( C - D \right)}{n\left( n - 1 \right)}.} \\
\end{array}$$
In this definition *C* is the number of (*i*, *j*) pairs such that the (*i*, *j*) satisfies *x* ~*i*~ \> *x* ~*j*~ and *y* ~*i*~ \> *y* ~*j*~ or it satisfies *x* ~*i*~ \< *x* ~*j*~ and *y* ~*i*~ \< *y* ~*j*~. *D* is the number of (*i*, *j*) pairs such that the (*i*, *j*) satisfies *x* ~*i*~ \> *x* ~*j*~ and *y* ~*i*~ \< *y* ~*j*~ or it satisfies *x* ~*i*~ \< *x* ~*j*~ and *y* ~*i*~ \> *y* ~*j*~.
Errors in Kendall's *τ* were estimated through the jackknife method \[[@pone.0124722.ref022]\].
Z-score of the Kullback-Leibler divergence {#sec011}
------------------------------------------
Kullback-Leibler divergence (KL divergence) measures deviation of a probability distribution from a reference probability distribution. Here the reference probability distribution is the fractions of seats occupied by each party, i.e. the probability that a random user would follow a legislator from a given party.
Let *P* ~*i*~ be the fraction of the number of legislators from party *i* among the number of the legislators, and *p* ~*ij*~ be the fraction of the number of legislators from party *i* followed by Twitter user *j* among all legislators followed by *j*. Then the KL divergence *D* ~*j*~ of Twitter user *j* is $$\begin{array}{r}
{D_{j} = \sum\limits_{i = 1}^{N}p_{ij}\log\frac{p_{ij}}{P_{i}},} \\
\end{array}$$ where *N* is the number of parties. KL divergence is non-negative. A large *D* ~*j*~ means that user *j*'s followership pattern does not agree with the reference probability, i.e. favors one party disproportionately when in a two-party system.
While the average KL divergence ⟨*D*⟩~*k*~ of Twitter users who follow *k* legislators can be obtained easily from the empirical data, for statistical significance we use the *Z*-score $$\begin{array}{r}
{Z_{D}\left( k \right) = \frac{\left\langle D \right\rangle_{k} - \mu_{k}}{\sigma_{k}},} \\
\end{array}$$ where *μ* ~*k*~ and *σ* ~*k*~ are the expectation and standard deviation of the KL divergence when a user choose to follow a party according to the reference probability *P* ~*i*~. If we assume a Twitter user follows *k* legislators randomly with uniform distribution, then the probability of $\overrightarrow{n} = \left( n_{1},\cdots,n_{N} \right)$, the vector of the number of legislators in each party that the user follows, is given by the multinomial distribution $f\left( \overrightarrow{n};\overrightarrow{P} \right)$ where *n* ~1~+⋯+*n* ~*N*~ = *k* and $\overrightarrow{P} = \left( P_{1},\cdots,P_{N} \right)$. Then we have $$\begin{array}{r}
{\mu_{k} = \sum\limits_{n_{1} + \cdots + n_{N} = k}f\left( \overset{\rightarrow}{n};\overset{\rightarrow}{P} \right)\sum\limits_{i = 1}^{N}\frac{n_{i}}{k}\log\frac{n_{i}}{kP_{i}}} \\
\end{array}$$ and $$\begin{array}{r}
{\sigma_{k}^{2} = \sum\limits_{n_{1} + \cdots + n_{N} = k}f\left( \overset{\rightarrow}{n};\overset{\rightarrow}{P} \right)\left( \sum\limits_{i = 1}^{N}\frac{n_{i}}{k}\log\frac{n_{i}}{kP_{i}} \right)^{2} - \mu_{k}^{2}.} \\
\end{array}$$
*Z* ~*D*~(*k*) ≳ 1 indicates that Twitter users follow a biased set of legislators, and that the bias is larger than the typical random fluctuation. Similarly, *Z* ~*D*~(*k*) ≲ −1 means that Twitter users follow the parties in close agreement with the reference probability *P* ~*i*~. As *k* approaches the actual number of legislators *p* ~*i*,\ *j*~ converges to *P* ~*i*~, *Z* ~*D*~(*k*) becomes more negative (since *D* → 0).
Supporting Information {#sec012}
======================
###### List of the Korean legislators.
Each line is a record for a legislator. The first column is the Twitter ID, and the second column is the name. The last column is the party of the legislator. The file is encoded with UTF-8 for Korean characters.
(TXT)
######
Click here for additional data file.
###### Followership data for the Korean legislators.
Each line is a followee-follower relation. The first column is the Twitter ID of a legislator, and the second column is the Twitter ID of a follower of the legislator.
(ZIP)
######
Click here for additional data file.
###### Roll call votes data of the Korean legislators.
Each line is a record of a legislator. The first column is the name of the legislator, and the rest columns are votes. A vote is encoded as 1 for yea, 2 for nay, 3 for abstention, and 4 for absence. The file is encoded with UTF-8 for Korean characters.
(TXT)
######
Click here for additional data file.
###### List of the US legislators.
The format is the same with [S1 Dataset](#pone.0124722.s001){ref-type="supplementary-material"}.
(TXT)
######
Click here for additional data file.
###### Followership data for the US legislators.
The format is the same with [S2 Dataset](#pone.0124722.s002){ref-type="supplementary-material"}.
(ZIP)
######
Click here for additional data file.
###### Roll call votes data of the US legislators.
The format is the same with [S3 Dataset](#pone.0124722.s003){ref-type="supplementary-material"}.
(TXT)
######
Click here for additional data file.
We thank Z. Hyung, C. Han, and B. Kahng.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: DL KH SY JP. Analyzed the data: DL KH JP. Contributed reagents/materials/analysis tools: DL KH JP. Wrote the paper: DL KH SY JP.
| 2024-06-01T01:27:04.277712 | https://example.com/article/4740 |
1. Field of the Invention
The present invention relates generally a socket for connecting electrical devices having rows of contact pins, and in particular to a modular socket for receiving contact pins.
2. Description of the Related Art
Electronic devices, such as electronic modules, semiconductor chips and components, have contact pins for electrical connections between the circuitry within the device and circuitry, power supplies and the like outside the device. The contact pins may be soldered in to openings in circuit boards, or may be inserted into sockets where the pins are electrically and physically connected. Such sockets permit the electrical connections to be may quickly and permit exchange of the devices, such as by removal of the device from the socket and insertion of the pins of a different device into the socket.
Sockets are particularly useful on test benches and for burn in operations, where quick connection and disconnection to circuit devices is desired.
Sockets generally must be constructed with the same number and arrangement of sockets as the pins on the device to be connected to the socket. This custom sockets are required for each pin arrangement. | 2023-10-17T01:27:04.277712 | https://example.com/article/2696 |
American Indians, the Irish, and Government Schooling
A Comparative Study
Michael C. Coleman
Publication Year: 2007
For centuries American Indians and the Irish experienced assaults by powerful, expanding states, along with massive land loss and population collapse. In the early nineteenth century the U.S. government, acting through the Bureau of Indian Affairs (BIA), began a systematic campaign to assimilate Indians. Initially dependent on Christian missionary societies, the BIA later built and ran its own day schools and boarding schools for Indian children. At the same time, the British government established a nationwide elementary school system in Ireland, overseen by the commissioners of national education, to assimilate the Irish. By the 1920s, as these campaigns of cultural transformation were ending, roughly similar proportions of Indian and Irish children attended state-regulated schools.
In the first full comparison of American and British government attempts to assimilate “problem peoples” through mass elementary education, Michael C. Coleman presents a complex and fascinating portrait of imperialism at work in the two nations. Drawing on autobiographies, government records, elementary school curricula, and other historical documents, as well as photographs and maps, Coleman conveys a rich personal sense of what it was like to have been a pupil at a school where one’s language was not spoken and one’s local culture almost erased. In absolute terms the campaigns failed, yet the schools deeply changed Indian and Irish peoples in ways unpredictable both to them and to their educators.
Meticulously researched and engaging, American Indians, the Irish, and Government Schooling sets the agenda for a new era of comparative analyses in global indigenous studies.
Cover
TItle Page, Copyright, Dedication
Contents
Illustrations
Maps
Acknowledgments
My major debt is to the Academy of Finland for its generous Senior Research
Fellowship (varttuneen tieteenharjoittajan apuraha), which allowed me a full year
of research in the Irish archives (1996–97). I also wish to thank colleagues
and ex-colleagues in the Department of Languages (English) here at the
University of Jyväskylä for their encouragement and support of my research ...
Abbreviations
Introduction
As an Irishman specializing for over three decades in Native American studies,
I have long felt strong “resonances” between Indian and Irish histories.1
These “problem peoples” experienced centuries-long military and cultural
assaults by more powerful expanding states. They suffered massive land loss
and demographic collapse through disease, famine, population movement, ...
1. Education in Native America and Ireland to the 1820's
In 1812 the Commissioners for Inquiring into the State of all Schools, on
Charitable or Public Foundations, in Ireland admitted that while “the present
establishments for the instruction of the lower orders [are] extremely
numerous,” they were “inadequate as a system of general education.”1 More
commissions reported, and by 1824, according to the Commissioners of Irish ...
2. The School as Weapon of State
Until the nineteenth century, writes Colin Heywood, “the idea that the state
should intervene between parents and their children was almost unthinkable.”1 Earlier British and American colonial governments had sporadically
supported education to pacify and control subject peoples. Yet it was only in
the early 1800s that schooling became a systematically wielded weapon of the ...
3. The Local Community and the School
“The drive to mass elementary education,” writes David Vincent of nineteenth-
century efforts by European national states to school the people to
literacy, “was founded on a dismissal of all that the home could teach the
child.” Left to its parents, authorities believed, “the growing boy or girl would
gain the wrong lessons in conduct, and at best an undisciplined command ...
4. Regimentation
The first reminiscences of school, writes Susan Douglas Franzosa, “are retold
as a terrifying entry into an alien culture presided over by towering adults
who . . . expect their charges to act in incomprehensible ways.” The place is
often evoked “through meticulously sensuous detail, now familiar but distant,
then strange but clear.”1 If the experience can shock twentieth-century ...
5. Curriculum
“Missionary education was doing more than to purvey knowledge or teach
skills,” writes A. J. Ashley. “It was an important part of the missionary effort
to effect a transfer of pupils from one universe to the other.”1 Whereas in a
“normal” school the teachers attempt to indoctrinate pupils more deeply into
their own cultural universe (or an approved version of it), in an assimilative ...
6. School Staff
“It may be set down as an aphorism generally true,” declared CNEI head inspector
W. H. Newell in 1857, “that the teacher is the life or death of a school.”
Recent improvements in one Dublin model school, he believed, were in part
the result of his board appointing “zealous and effective teachers in the room
of careless and inefficient ones.”1 Those at the top of the CNEI and BIA bureaucracies ...
7. Peers and Mediation
“I remember the first day I went to school,” wrote Maurice O’Sullivan of his
experience in the Blasket Islands around 1908. “Peg de Róiste brought me,
holding me by the hand, and it was with great plámás [persuasive talk] she
coaxed me to go.” Later in class Peg sat beside O’Sullivan, explaining the
strange doings of the teacher. When offered sweets, he had “a drowning ...
8. Resistance and Rejection
Irish national school students devised crafty ways to fool their teacher and
get time off from the classroom. One group brought a stray donkey into the
schoolyard before the master arrived. He then asked for volunteers to return
the animal to its owner—and the culprits, according to a folklore informant,
would “spend most of the day on this mission.” Others connived with a local ...
9. Results
“It was of course the case,” writes David Vincent of nineteenth-century efforts
to use mass education to achieve mass literacy, “that parents and pupils
everywhere subverted the intentions of the official curriculum” and made
use of it in ways that “confirmed many of [the educators’] worst fears.”1 The
present study strongly reinforces recent work by historians of education who ...
Conclusions
These words could have been uttered by either a Native American or by an
Irishman or woman, surveying assimilationist schooling in the period under
review. Actually they were spoken by Albert Yava, the Tewa-Hopi quoted in
the previous chapter as an advocate of pragmatic compromise; the one who
realized that, ultimately, the greatest value is survival.1 The statement reinforces ...
Welcome to Project MUSE
Use the simple Search box at the top of the page or the Advanced Search linked from the top of the page to find book and journal content. Refine results with the filtering options on the left side of the Advanced Search page or on your search results page. Click the Browse box to see a selection of books and journals by: Research Area, Titles A-Z, Publisher, Books only, or Journals only. | 2024-02-23T01:27:04.277712 | https://example.com/article/4595 |
Characterization of hepatic tumors: value of contrast-enhanced coded phase-inversion harmonic angio.
Our purpose was to evaluate the value of contrast-enhanced coded phase-inversion harmonic imaging in showing the characteristic intranodular hemodynamics of hepatic tumors. SUBJECTS AND METHODS. Using a microbubble contrast agent we performed coded harmonic angio in 163 patients with 192 hepatic tumor nodules: 153 hepatocellular carcinomas, 13 metastases, 14 hemangiomas, eight dysplastic nodules, and four focal nodular hyperplasias. After injecting Levovist, we performed real-time scanning, interval-delay fast low-angle shot imaging, and sweep scanning in the early arterial phase, late vascular phase, and postvascular phase, respectively. On contrast-enhanced coded harmonic angio, the typical hemodynamic pattern of hepatocellular carcinomas was shown as abundant tumor vessels supplied from the periphery to the center of the tumor and dense parenchymal tumor staining with fast washout (sensitivity, 92.8%; specificity, 92.3%). The characteristic hemodynamic pattern of metastases was peripheral tumor vessels with a rim parenchymal stain in the vascular phase followed by a perfusion defect in the postvascular phase (sensitivity, 69.2%; specificity, 100%). Hemangiomas were hypovascular in the early arterial phase with gradual spotty or cotton-wool pooling continuing to the late vascular phase (sensitivity, 92.9%; specificity, 100%). Dysplastic nodules were shown as having no early arterial supply with isovascularity in the late vascular phase (sensitivity, 75%; specificity, 100%). Focal nodular hyperplasias were shown to have a spoked wheel pattern of blood vessels accompanied by dense staining in interval-delay scanning (sensitivity, 100%; specificity, 100%). Contrast-enhanced coded harmonic angio is a promising method to provide useful information for the differential diagnosis of hepatic tumors. | 2024-06-14T01:27:04.277712 | https://example.com/article/3557 |
.widget-block {
position: relative;
}
.widget-block.visible {
border: 1px dashed #ccc;
}
.cache-time-label {
cursor: pointer;
} | 2024-07-14T01:27:04.277712 | https://example.com/article/5782 |
ROLLINSFORD, New Hampshire — Officially, Sen. Jeff Merkley remains undecided on the prospect of a White House run. But his fourth visit this year to the state that holds the first presidential primary has the look and feel of a campaign swing.
As for 2020, Merkley would only say that he and his wife, Mary Sorteberg, would wait until after the November midterm elections to make a decision.
"We're going to wrestle with that right after the election, and we'll figure it out then and decide on what we're going to do," he said.
Merkley is one of the most progressive members of the Senate and was the only Democrat in the chamber to endorse Sen. Bernie Sander in the 2016 primary over the party's eventual nominee, Hillary Clinton. Sanders was in New Hampshire on Labor Day amid reports the Vermont independent is mulling a second straight White House bid.
Merkley said his decision won't be influenced by the possible candidacies of Sanders or Sen. Elizabeth Warren of Massachusetts.
"I've always fought battles I believe in, and right now I believe that we have to do everything we can to take our nation back," he said. "The decision to be in the campaign will be based on whether it's a fight that Mary and I decide that is the right moment and that I can really contribute to."
In a move that could position him for a presidential run in this crucial primary state, Merkley said that he's hiring some political staffers in New Hampshire through one of his PACs in the coming days to help local candidates running now.
"I'm not staffing up here, but what I am doing is helping to hire folks to help out with some of the New Hampshire campaigns. So, hopefully, in addition to providing some assistance with resources, I'll be able to provide some assistance with some people on the ground as organizers," he explained.
While Merkley's four-day trip sparked more 2020 speculation, it was officially about helping Granite State Democrats on the November ballot.
The senator met Friday afternoon with the University of New Hampshire Democrats. In the evening, he headlined the Strafford County Democrats' annual fall fundraising celebration, an event that Sanders keynoted last year.
In his speech, Merkley pointed to the record Democratic turnout days earlier during the New Hampshire primary. "I sense a difference between my last trip here and now," he said. "After this Tuesday primary and the huge turnout of Democrats, it is going to be a blue wave if we push right through November."
He also highlighted his push for a single-payer Medicare-for-all; single payer health care; debt-free higher education and refinancing college loans at lower rates; ending partisan gerrymandering; his push to battle the opioid epidemic; and his "Mission 100" goal of moving toward 100 percent renewable energy.
Sen. Jeff Merkley, speaking Friday in New Hampshire, says he won't decide on a White House run until after the midterms.
On the increasing divisive battle over Supreme Court nominee Brett Kavanaugh, Merkley called the process "a rigged system" and vowed to push back against President Donald Trump's pick "until the last moment."
And he discussed his trips to the U.S. border with Mexico, which inspired other Democrats to follow in his footsteps and helped spark national protests against Trump's "zero tolerance" immigration policy that separated children from their parents.
Merkley vowed to fight a Senate bill that currently has 35 co-sponsors that would establish internment camps for immigrant families awaiting a hearing. "It is not going to pass," he said. "It is not going to get to the Oval Office."
The senator's trip to New Hampshire comes a few days after he released documents indicating the transfer of nearly $10 million from the Federal Emergency Management Agency to U.S. Immigration and Customs Enforcement, the agency at the forefront of the border controversy.
Merkley's disclosure came during an interview on "The Rachel Maddow Show," one of three appearances he made this week on MSNBC.
"It's $10 million that the administration chose in June to take out of FEMA and send to build prison camps," he told The Oregonian/OregonLive on Friday.
"Why in the first month of hurricane season, after what we went through last year, would you take money out of FEMA?" he said.
Merkely noted that "the Trump team's reaction was to attack me personally, which is generally their reaction to any policy issue ... attack the messenger. But all I was doing was taking numbers from their publication that they apparently didn't want the public to see."
Also on Merkley's itinerary this weekend is a stop in Conway to open a county Democratic Party office, a house party in Concord and a fundraiser in Lee for an executive councilor's re-election, and plenty of meetings with Democratic officials, candidates and top activists. The Senate Foreign Relations Committee member closes out his trip on Monday morning with an address to the World Affairs Council of New Hampshire.
—Paul Steinhauser, for The Oregonian/OregonLive | 2023-11-24T01:27:04.277712 | https://example.com/article/6785 |
Today, a mainstream of computer architectures is a von Neumann type. In the von Neumann architecture, the operation thereof is defined by a program which is a sequential instruction sequence. The architecture has versatility, that is, it can be used for various purposes by changing the program. Not only a CPU (Central Processing Unit) which plays main roles of a computer, but also a computing device for particular uses such as a GPU (Graphics Processing Unit) employs the von Neumann architecture, and the basic operation thereof is sequential executions of instruction sequences.
In the past, the performance improvement of computers has mainly depended on the improvement of clock frequencies. Since the foundation of the von Neumann architectures is sequential execution of instruction sequences, performance improvement can be expected if the execution speed of instructions is increased. However, in general-purpose CPUs used in personal computers and servers, the improvement of clock frequencies has reached a ceiling at around 3 GHz in the early 2000s. Recently, in place of the clock frequency which has reached a ceiling, the measures which realize the performance improvement by multicore parallel processing have become mainstream.
In the multicore parallel processing, performance is improved by finding out parts that can be executed in parallel from sequential instruction sequences (extraction of parallelism) and executing them in parallel. However, it is not easy to extract parallelism from a program in which sequential algorithms are written as instruction sequences. ILP (Instruction Level Parallelism) which extracts parallelism in an instruction level has already reached a limit, and there is recently a tendency that parallelism having lower granularity such as TLP (Thread Level Parallelism) or DLP (Data Level Parallelism) is used.
In view of such circumstances, in order to improve the performance of computers in the future, there is a need to make a transition to intrinsically parallel information processing instead of being based on the conventional execution of the sequential instruction sequences. For this purpose, instead of the conventional problem description method by sequential instruction sequences, problem descriptions suitable for realizing the intrinsically parallel information processing are required.
As a candidate therefor, various physical phenomena and social phenomena can be expressed by interaction models. The interaction model is a model defined by a plurality of nodes constituting the model, interactions between the nodes and, if needed, bias of each node. Various models have been proposed in physics and social sciences, and each of them can be interpreted as one aspect of the interaction model. Moreover, as a characteristic of the interaction model, the influence between nodes is limited to the interaction between two nodes (interaction between two bodies). For example, if the mechanics of planets in the outer space is considered, this can be interpreted as one type of the interaction model in the point that there are interactions caused by universal gravitation among nodes such as planets. However, the influence among the planets is not limited to that between two planets, and three or more planets are mutually affected and exhibit complex behavior (causing a so-called 3-body problem or multi-body problem).
In the world of physics, typical examples of interaction models include an Ising model. The Ising model is a model of statistical mechanics for describing the behavior of magnetic bodies and is used in research of magnetic bodies. The Ising model is defined as interactions between sites (spins taking two values of +1 and −1). It is known that obtaining a ground state of an Ising model whose topology becomes a non-planar graph is an NP-hard problem. Since the Ising model expresses a problem by interaction coefficients spread in spatial directions, there is a possibility that information processing using intrinsic parallelism can be realized.
Incidentally, since obtaining the ground state of the Ising model is an NP-hard problem as described above, it is difficult in terms of calculation time to solve that by a von Neumann computer. An algorithm that increases the speed by introducing the heuristic has also been proposed. However, there has been proposed a method in which the ground state of the Ising model is obtained at high speed by the calculations using physical phenomena more directly, in other words, by an analog computer instead of the von Neumann computer. For example, a device described in International Publication No. 2012/118064 (Patent Document 1) has been known as such a device. | 2024-05-27T01:27:04.277712 | https://example.com/article/2456 |
package log
import (
"bytes"
"fmt"
"io"
"reflect"
"testing"
. "gopkg.in/check.v1"
)
func TestLog(t *testing.T) { TestingT(t) }
type LogSuite struct{}
var _ = Suite(&LogSuite{})
func (s *LogSuite) SetUpTest(c *C) {
// reset global loggers chain before every test
gl.loggers = []Logger{}
}
func (s *LogSuite) TestInit(c *C) {
Init(newTestLogger("log1"), newTestLogger("log2"))
c.Assert(len(gl.loggers), Equals, 2)
c.Assert(typeOf(gl.loggers[0]), Equals, "*log.testLogger")
c.Assert(typeOf(gl.loggers[1]), Equals, "*log.testLogger")
}
func (s *LogSuite) TestInitWithConfig(c *C) {
InitWithConfig(Config{Console, "info"}, Config{Syslog, "info"})
c.Assert(len(gl.loggers), Equals, 2)
c.Assert(typeOf(gl.loggers[0]), Equals, "*log.consoleLogger")
c.Assert(typeOf(gl.loggers[1]), Equals, "*log.sysLogger")
}
func (s *LogSuite) TestNewLogger(c *C) {
l, err := NewLogger(Config{Console, "info"})
c.Assert(err, IsNil)
c.Assert(typeOf(l), Equals, "*log.consoleLogger")
l, err = NewLogger(Config{Syslog, "warn"})
c.Assert(err, IsNil)
c.Assert(typeOf(l), Equals, "*log.sysLogger")
l, err = NewLogger(Config{UDPLog, "error"})
c.Assert(err, IsNil)
c.Assert(typeOf(l), Equals, "*log.udpLogger")
l, err = NewLogger(Config{"SuperDuperLogger", "info"})
c.Assert(err, NotNil)
c.Assert(l, IsNil)
}
func (s *LogSuite) TestDebugf(c *C) {
logger1 := newTestLogger("log1")
logger2 := newTestLogger("log2")
Init(logger1, logger2)
Debugf("hello %s", "world")
c.Assert(logger1.b.String(), Equals, "DEBUG hello world\n")
c.Assert(logger2.b.String(), Equals, "DEBUG hello world\n")
}
func (s *LogSuite) TestInfof(c *C) {
logger1 := newTestLogger("log1")
logger2 := newTestLogger("log2")
Init(logger1, logger2)
Infof("hello %s", "world")
c.Assert(logger1.b.String(), Equals, "INFO hello world\n")
c.Assert(logger2.b.String(), Equals, "INFO hello world\n")
}
func (s *LogSuite) TestWarningf(c *C) {
logger1 := newTestLogger("log1")
logger2 := newTestLogger("log2")
Init(logger1, logger2)
Warningf("hello %s", "world")
c.Assert(logger1.b.String(), Equals, "WARN hello world\n")
c.Assert(logger2.b.String(), Equals, "WARN hello world\n")
}
func (s *LogSuite) TestErrorf(c *C) {
logger1 := newTestLogger("log1")
logger2 := newTestLogger("log2")
Init(logger1, logger2)
Errorf("hello %s", "world")
c.Assert(logger1.b.String(), Equals, "ERROR hello world\n")
c.Assert(logger2.b.String(), Equals, "ERROR hello world\n")
}
func typeOf(o interface{}) string {
return reflect.TypeOf(o).String()
}
// testLogger helps in tests.
type testLogger struct {
id string
b *bytes.Buffer
sev Severity
}
func newTestLogger(id string) *testLogger {
return &testLogger{id, &bytes.Buffer{}, SeverityDebug}
}
func (l *testLogger) Writer(sev Severity) io.Writer {
return l.b
}
func (l *testLogger) SetSeverity(sev Severity) {
l.sev = sev
}
func (l *testLogger) GetSeverity() Severity {
return l.sev
}
func (l *testLogger) FormatMessage(sev Severity, caller *CallerInfo, format string, args ...interface{}) string {
return fmt.Sprintf("%s %s\n", sev, fmt.Sprintf(format, args...))
}
func (s *LogSuite) TestCallerInfo(c *C) {
for severity, logFunc := range map[Severity]func(format string, args ...interface{}){
SeverityError: Errorf,
SeverityWarning: Warningf,
SeverityInfo: Infof,
SeverityDebug: Debugf,
} {
// Given
var l callerLogger
Init(&l)
// When
logFunc("blah")
// Then
c.Assert(l.b.String(), Equals, fmt.Sprintf(
"%s log_test.go[138] github.com/mailgun/log.(*LogSuite).TestCallerInfo", severity))
}
}
func (s *LogSuite) TestCallerInfoLogfmt(c *C) {
// Given
var l callerLogger
Init(&l)
// When
Logfmt(0, SeverityInfo, "blah")
// Then
c.Assert(l.b.String(), Equals, "INFO log_test.go[150] github.com/mailgun/log.(*LogSuite).TestCallerInfoLogfmt")
}
type callerLogger struct {
b bytes.Buffer
}
func (l *callerLogger) Writer(sev Severity) io.Writer {
return &l.b
}
func (l *callerLogger) SetSeverity(sev Severity) {
}
func (l *callerLogger) GetSeverity() Severity {
return SeverityInfo
}
func (l *callerLogger) FormatMessage(severity Severity, caller *CallerInfo, format string, args ...interface{}) string {
return fmt.Sprintf("%s %s[%d] %s", severity, caller.FileName, caller.LineNo, caller.FuncName)
}
| 2024-07-24T01:27:04.277712 | https://example.com/article/7007 |
The present invention relates to a power transmission wire heat dissipator wound around an aerial power transmission wire or other power transmission wire for dissipating the heat of the power transmission wire, a power transmission wire (line) equipped with a heat dissipator, and a method for attaching a heat dissipator on a power transmission wire.
It is desired to increase the power transmission capacity of an aerial line (wire).
When the power transmission capacity is increased, the current flowing through the line becomes heated. Therefore, a permissible upper limit is set on the current flowing through the aerial line.
Therefore, the general method of increasing the transmission capacity of an aerial line is use of an aerial line having a larger sectional area.
In the case of an already strung aerial line, the transmission capacity is increased by replacing it with another line having a larger sectional area.
However, a line having a large sectional area becomes heavier in the weight of the line per unit length, so the amount of sagging (sag or slack) becomes larger due to the line""s own weight. If the sag becomes larger, the distance to the ground etc. becomes shorter, so the towers must be made higher and must be made stronger in structure in some cases. Such replacement of towers is difficult in view of on-going operations, work, and costs in many cases. When replacing a tower with one having a higher height and greater strength or fabricating a higher and stronger tower in advance so that a power transmission wire having a larger sectional area will be able to be laid in the future, the problems of a rise of the manufacturing cost of the tower and a rise of the transmission cost are encountered. Also, when the transmission capacity is further increased, the above problem of an increase in the amount of heat generated in the aerial line is still encountered.
As one method of overcoming the problem of the increase of the sag, use has been made of aerial lines made of twisted steel-reinforced aluminum conductors (ACSR)xe2x80x94conductors reinforced by Invar steel wires having a small coefficient of linear expansion and known for low sag. When newly stringing an aerial line made of Invar-reinforced aluminum conductors, the problem of the height of the tower can be overcome since the sag of the ACSR aerial line is small. When trying to increase the transmission capacity of an aerial line made of Invar-reinforced aluminum conductors, however, the number of aluminum conductors has to be increased or the sectional area of the aluminum conductors has to be enlarged. The weight of the aerial line is therefore increased so an excessive load is applied to the tower, and the price of the aerial line becomes remarkably high. Accordingly, the above problem cannot be overcome just by using ACSR for the aerial line.
Further, as one method of overcoming the problem of the large heat generation explained above, use has been made of aerial lines made of thermo-resistant conductors able to withstand high temperature use. For example, if an aerial line made of steel-reinforced ultra thermo-resistant aluminum alloy conductors (UTACSR) is used, usage at a high temperature of 200xc2x0 C. or more is possible. Heating, however, causes the aerial line to elongate. In particular, the increase of the sag of the aerial line at the time of a high temperature cannot be ignored. Therefore, the problem of an increase of the sag is still encountered if just using UTACSR for the aerial line.
Japanese Unexamined Patent Publication (Kokai) No. 64-81110 and Japanese Unexamined Patent Publication (Kokai) No. 64-81111 disclose a technique of covering the outer circumference of the aerial line with a mesh belt so as to prevent the accumulation of snow from causing a tubular mass of snow (snow tubes) from depositing on the outer circumference of the aerial line, increasing the weight of the aerial line, causing sag and in turn breaking the aerial line. However, the technique disclosed in Japanese Unexamined Patent Publication (Kokai) No. 64-81110 and Japanese Unexamined Patent Publication (Kokai) No. 64-81111 is a technique considering only the prevention of tubular accumulation of snow, and not a technique for increasing the transmission capacity of the aerial line. Particularly, Japanese Unexamined Patent Publication (Kokai) No. 64-81110 and Japanese Unexamined Patent Publication (Kokai) No. 64-81111 do not disclose a technique for increasing the transmission capacity of an aerial line by improving the heat dissipation characteristic of the aerial line.
Japanese Unexamined Patent Publication (Kokai) No. 48-72688 (Japanese Unexamined Patent Publication (Kokoku) No. 52-4357) discloses a technique of preventing galloping, which frequently occurs when there is uniform accumulation of ice and snow along a longitudinal direction of the windward side of an aerial line by winding an S-twist and Z-twist helical shaped body having a predetermined length around the outer circumference of the aerial line so that the S-twist and the Z-twist are arranged repeatedly or at random. However, Japanese Unexamined Patent Publication (Kokai) 48-72688 also does not disclose a technique of increasing the transmission capacity of an aerial line by improving the heat dissipation characteristic of the aerial line.
Japanese Unexamined Patent Publication (Kokai) No. 49-101876 (Japanese Examined Patent Publication (Kokai) No. 53-14146) discloses a technique of reducing the noise due to wind pressure on the aerial line by setting the outer diameter of the strands and the outer diameter of the line of a low noise line comprised of strands wound helically or cross-wise and setting the winding pitch to within a predetermined range. However, Japanese Unexamined Patent Publication (Kokai) No. 49-101876 also does not disclose a technique of increasing the transmission capacity of an aerial line by improving the heat dissipation characteristic of the aerial line.
Japanese Unexamined Patent Publication (Kokai) No. 57-98907 (Japanese Examined Patent Publication (Kokoku) No. 58-38884) discloses an aerial line reducing the corona noise of the aerial line by providing a low noise line comprised of a line around the outer circumference of which strands are wound where a plurality of unit strands formed with minute unevenness on the surface of the wound strands are arranged in close contact. However, Japanese Unexamined Patent Publication (Kokai) No. 57-98907 also does not disclose a technique of increasing the transmission capacity of an aerial line by improving the heat dissipation characteristic of the aerial line.
Japanese Unexamined Patent Publication (Kokai) No. 6-302223 discloses reducing the noise due to wind pressure and, further, reducing an AN level by providing a low noise line in which part of the outermost layer of the aerial line is made to project out. However, Japanese Unexamined Patent Publication (Kokai) No. 6-302223 also does not disclose a technique of increasing the transmission capacity of an aerial line by improving the heat dissipation characteristic of the aerial line.
An object of the present invention is to provide a heat dissipator to be attached on a power transmission wire in order to enable an increase of the transmission capacity without an increase of the sectional area of the power transmission wire itself.
Another object of the present invention is to provide a heat dissipator to be attached on a power transmission wire in order to enable an increase of the transmission capacity without an increase of the sectional area of the power transmission wire itself and, further, to enable prevention of accumulation of snow, reduction of noise due to wind pressure, reduction of the corona noise, and prevention of galloping.
Still another object of the present invention is to provide a power transmission wire on which the heat dissipator is attached in order to enable an increase of the transmission capacity without an increase of the sectional area of the power transmission wire itself.
Still another object of the present invention is to provide a power transmission wire on which a heat dissipator is attached in order to enable an increase of the transmission capacity without an increase of the sectional area of the power transmission wire itself and, further, to enable prevention of accumulation of snow, reduction of noise due to wind pressure, reduction of the corona noise, and prevention of galloping.
Still another object of the present invention is to provide a method of attaching such a heat dissipator on a power transmission wire.
According to a first aspect of the present invention, there is provided a heat dissipator for a power transmission wire comprised of a conductive heat dissipation member having conductivity and having a surface heat dissipation rate of 0.7 or more spirally wound around the outer circumferential surface of the power transmission wire at a predetermined winding pitch in close contact thereto.
Preferably, the conductive heat dissipation member is treated to blacken its surface and delustered.
Further preferably, the surface of the conductive heat dissipation member is treated to make it hydrophilic.
Also, preferably, the conductive heat dissipation member has a surface which is artificially or naturally aged in advance.
Preferably, the conductive heat dissipation member is produced by aluminum or an aluminum alloy.
According to the first aspect, the conductive heat dissipation member of the heat dissipator for a power transmission wire has a braided heat conducting wire heat dissipating belt comprised of heat conducting metal strands braided in the form of a mesh belt, the braided heat conducting wire heat dissipating belt being spirally wound around the outer circumferential surface of the power transmission wire at a predetermined winding pitch.
In the first aspect, preferably, the braided heat conducting wire heat dissipating belt has a winding pitch giving a center angle xcex8 of the winding width on the circumference of the cross-section of the power transmission wire with the center of the power transmission wire defined by the following relation:
15xc2x0xe2x89xa6xcex8xe2x89xa6180xc2x0
In the first aspect, preferably, the winding pitch p of the braided heat conducting wire heat dissipating belt around the power transmission wire is set within the following range with respect to an outer diameter D of the power transmission wire:
10Dxe2x89xa6pxe2x89xa630D
In the first aspect, preferably, a spiral rod is wound on the braided heat conducting wire heat dissipating belt wound around the outer circumferential surface of the power transmission wire in a reverse direction to the winding direction of the braided heat conducting wire heat dissipating belt to secure the winding of the braided heat conducting wire heat dissipating belt.
In the first aspect, preferably, the heat conducting metal strand of the braided heat conducting wire heat dissipating belt is a wire made of aluminum or an aluminum alloy having a diameter of 0.3 mm to 3.0 mm.
In the first aspect, preferably, a plurality of the braided heat conducting wire heat dissipating belts are wound around the outer circumferential surface of the power transmission wire in the same direction or so as to cross.
In the first aspect, preferably, an end of the braided heat conducting wire heat dissipating belt wound around the outer circumferential surface of the power transmission wire is wound around a front end of an anchor clamp to secure it.
In the first aspect, preferably, a braided heat conducting wire heat dissipating belt comprised of a heat conducting metal strand braided in the form of a mesh belt is wound around the outer circumference of a jumper at a tension support of the power transmission wire, and the end of the braided belt member is wound around the front end of a jumper connection of the anchor clamp to secure it.
According to a second form of the first aspect of the present invention, the conductive heat dissipation member of the heat dissipator for a power transmission wire has a conductive, surface-blackened heat dissipating spiral rod having a surface heat dissipation rate of 0.7 or more spirally formed in the longitudinal direction so that it can be attached on the outer circumferential surface of the power transmission wire in close contact thereto and the spiral rod is spirally wound around the outer circumferential surface of the power transmission wire at a predetermined winding pitch.
In the second form of the first aspect of the present invention, preferably, the winding pitch p of the surface-blackened heat dissipating spiral rod is set within the following range with respect to the outer diameter D of the power transmission wire:
10Dxe2x89xa6pxe2x89xa630D
In the second form of the first aspect of the present invention, preferably, the surface-blackened heat dissipating spiral rod to wound around the outer circumferential surface of a jumper at the tension support of the power transmission wire.
According to a third form of the first aspect of the present invention, preferably, a conductive heat dissipation member of the heat dissipator for a power transmission wire has a surface-blackened conductive heat dissipation member which is flexible, electrically conductive, and has a surface heat dissipation rate of 0.7 or more to be attached on the outer circumferential surface of the power transmission wire in close contact thereto, and the conductive heat dissipation member is spirally wound around the outer circumferential surface of the power transmission wire at a predetermined winding pitch.
In the third form of the first aspect of the present invention, preferably, when the strand diameter of the outermost layer of the power transmission wire is dd, the outer diameter of the surface-blackened conductive heat dissipation member or the thickness in the diameter direction is DD, the pitch of the twist of the strand of the outer layer of the power transmission wire is pp, and the winding pitch of the conductive heat dissipation member around the outer circumferential surface of the power transmission wire is PP, the following relations stand:
0.8xe2x89xa6DD/ddxe2x89xa62.0,
and
0.8xe2x89xa6PP/ppxe2x89xa65.0
In the third form of the first aspect of the present invention, preferably, when the strand diameter of the outermost layer of the power transmission wire is dd, the outer diameter of the surface-blackened conductive heat dissipation member or the thickness of the diameter direction is DD, the pitch of the twist of the strand of the outer layer of the power transmission wire is pp, and the winding pitch of the conductive heat dissipation member around the outer circumferential surface of the power transmission wire is PP, the following relations stand:
1.0xe2x89xa6DD/ddxe2x89xa61.2,
and
1.0xe2x89xa6PP/ppxe2x89xa62.0
In the third form of the first aspect of the present invention, preferably, (1) the cross-section of the conductive heat dissipating member is circular, (2) the cross-section of the conductive heat dissipating member is a partially fan-like segment, (3) the cross-section of the conductive heat dissipating member is a hollow circle, or (4) the cross-section of the conductive heat dissipating member is a hollow oval.
In the third form of the first aspect of the present invention, preferably, a groove for suppressing the formation of drops of water is formed along the circumference of the conductive heat dissipating member having a circular cross-section.
In the third form of the first aspect of the present invention, preferably, the winding pitch p of the surface-blackened heat dissipating spiral rod around the power transmission wire is set to the following range with respect to the outer diameter D of the power transmission wire:
10Dxe2x89xa6pxe2x89xa630D
In the third form of the first aspect of the present invention, preferably, the surface-blackened heat dissipating spiral rod to wound around the outer circumferential surface of the jumper at a tension support of the power transmission wire.
According to a second aspect of the present invention, there is provided a power transmission wire having a heat dissipating means comprised of a conductive heat dissipation member having conductivity and a surface heat dissipation rate of 0.7 or more spirally wound around the outer circumferential surface at a predetermined winding pitch in close contact thereto.
Preferably, the conductive heat dissipation member is treated to blacken its surface and delustered.
Further, preferably, the surface of the conductive heat dissipation member is treated to make it hydrophilic.
Further, preferably, the conductive heat dissipation member has a surface which is artificially or naturally aged in advance.
Preferably, the conductive heat dissipation member is produced from aluminum or an aluminum alloy.
Preferably, the power transmission wire is produced from any of steel-reinforced aluminum conductors (ACSR), steel-reinforced ultra thermo-resistant aluminum alloy conductors (UTACSR), Invar-reinforced super or extra thermo-resistant aluminum alloy conductors (ZTACIR or XTACIR), and galvanized steel twisted wire.
Preferably, the conductive heat dissipation member is a braided heat conducting wire heat dissipating belt comprised of a heat conducting metal strand braided in the form of a mesh belt.
Preferably, a plurality of braided heat conducting wire heat dissipating-belts are wound around the outer circumferential surface of the power transmission wire in close contact thereto in the same direction or so as to cross.
Further, preferably, the conductive heat dissipation member is a conductive, surface-blackened heat dissipating spiral rod having a surface heat dissipation rate of 0.7 or more formed spirally in the longitudinal direction so that it can be attached to the outer circumferential surface of the power transmission wire in close contact thereto.
Further, preferably, the conductive heat dissipation member is a surface-blackened conductive heat dissipation member which is flexible, electrically conductive, and has a surface heat dissipation rate of 0.7 or more to be attached on the outer circumferential surface of the power transmission wire in close contact thereto.
According to a third aspect of the present invention, there provided a method of attaching a heat dissipator on a power transmission wire comprising spirally winding a heat dissipation member having conductivity and a surface heat dissipation rate of 0.7 or more around the outer circumferential surface of an aerial line in close contact thereto at a predetermined winding pitch.
Preferably, the attachment work is carried out while transmitting power through the power transmission wire.
Preferably, the conductive heat dissipation member is produced from aluminum or an aluminum alloy.
Preferably, the conductive heat dissipation member is a braided heat conducting wire heat dissipating belt comprised of a heat conducting metal strand braided in the form of a mesh belt.
Preferably, the braided heat conducting wire heat dissipating belt has a winding pitch giving a center angle xcex8 of the winding width on the circumference of the cross-section of the power transmission wire with the center of the power transmission wire defined by the following relation:
15xc2x0xe2x89xa6xcex8xe2x89xa6180xc2x0
Further, preferably, the winding pitch p of the braided heat conducting wire heat dissipating belt around the power transmission wire is set within the following range with respect to an outer diameter D of the power transmission wire:
10Dxe2x89xa6pxe2x89xa630D
Further, preferably, a plurality of the braided heat conducting wire heat dissipating belts are wound around the outer circumferential surface of the power transmission wire in the same direction or so as to cross.
Further, preferably, the conductive heat dissipation member is a conductive, surface-blackened heat dissipating spiral rod having a surface heat dissipation rate of 0.7 or more spirally formed in the longitudinal direction so that it can be attached to the outer circumferential surface of the power transmission wire in close contact thereto.
Preferably, the winding pitch p of the surface-blackened heat dissipating spiral rod around the power transmission wire is set to the following range with respect to the outer diameter D of the power transmission wire:
10Dxe2x89xa6pxe2x89xa630D
Further, preferably, the conductive heat dissipation member is a surfaoe-blackened heat dissipating spiral rod which is flexible, electrically conductive, and has a surface heat dissipation rate of 0.7 or more to be attached at the outer circumferential surface of the power transmission wire in close contact thereto.
Preferably, when the strand diameter of the outermost layer of the power transmission wire is dd, the outer diameter of the surface-blackened conductive heat dissipation member or the thickness of the diameter direction is DD, the pitch of the twist of the strand of the outer layer of the power transmission wire is pp, and the winding pitch of the conductive heat dissipation member around the outer circumferential surface of the power transmission wire is PP, the following relations stand:
0.8xe2x89xa6DD/ddxe2x89xa62.0,
and
0.8xe2x89xa6PP/ppxe2x89xa65.0
Further, preferably, when the strand diameter of the outermost layer of the power transmission wire is dd, the outer diameter of the surface-blackened conductive heat dissipation member or the thickness of the diameter direction is DD, the pitch of the twist of the strand of the outer layer of the power transmission wire is pp, and the winding pitch of the conductive heat dissipation member around the outer circumferential surface of the power transmission wire is PP, the following relations stand:
1.0xe2x89xa6DD/ddxe2x89xa61.2,
and
1.0xe2x89xa6PP/ppxe2x89xa62.0 | 2024-02-27T01:27:04.277712 | https://example.com/article/2568 |
Pentasubstituted ferrocene and dirhodium(II) tetracarboxylate as building blocks for discrete fullerene-like and extended supramolecular structures.
The synthesis of a penta(1-methylpyrazole)ferrocenyl phosphine oxide ligand (1) [Fe(C(5)(C(3)H(2)N(2)CH(3))(5))(C(5)H(4)PO(t-C(4)H(9))(2))] is reported together with its X-ray crystal structure. Its self-assembly behavior with a dirhodium(II) tetraoctanoate linker (2) [Rh(2)(O(2)CC(7)H(15))(4)] was investigated for construction of fullerene-like assemblies of composition [(ligand)(12)(linker)(30)]. Reaction between 1 and 2 in acetonitrile resulted in the formation of a light purple precipitate (3). Evidence for the ligand-to-linker ratio of 1:2.5 expected for a fullerene-like structure [Fe(C(5)(C(3)H(2)N(2)CH(3))(5))(C(5)H(4)PO(t-C(4)H(9))(2))](12)[Rh(2)(O(2)CC(7)H(15))(4)](30) was obtained from (1)H NMR and elemental analysis. IR and Raman studies confirmed the diaxially bound coordination environment of the dirhodium linker by comparing the stretching frequencies of the carboxylate group and the rhodium-rhodium bond with those in model compound (5), [Rh(2)(O(2)CC(7)H(15))(4)](C(3)H(3)N(2)CH(3))(2), the bis-adduct of linker 2 with 1-methylpyrazole. X-ray powder diffraction and molecular modeling studies provide additional support for the formation of a spherical molecule topologically identical to fullerene with a diameter of approximately 38 Å and a molecular formula of [(1)(12)(2)(30)]. Dissolution of 3 in tetrahydrofuran (THF) followed by layering with acetonitrile afforded purple crystals of [(1)(2)(2)](∞) (6) [Fe(C(5)(C(3)H(2)N(2)CH(3))(5))(C(5)H(4)PO(t-C(4)H(9))(2))][Rh(2)(O(2)CC(7)H(15))(4)](2) with a two-dimensional polymeric structure determined by X-ray crystallography. The dirhodium linkers link ferrocenyl units by coordination to the pyrazoles but only four of the five pyrazole moieties of the pentapyrazole ligand are coordinated. The ligand-to-linker ratio of 1:2 in 6 was confirmed by (1)H NMR spectroscopy and elemental analysis, while results from IR and Raman are in agreement with the diaxially coordinated environment of the linker observed in the solid state. | 2024-04-07T01:27:04.277712 | https://example.com/article/8467 |
Curve Digital is proud to announce that it’s working with independent studio Denki to bring their unique management sim Autonauts to PC this autumn.
Autonauts is the brainchild of the former DMA Design (Grand Theft Auto, Lemmings) creative director Gary Penn and offers players the chance to explore the universe and colonise procedurally-generated planets, utilising the help of fully programmable AI helpers.
Fresh from your spaceship you must harvest stick and stone and begin your colonisation efforts. Create rudimentary crafting items from blueprints and build dozens and dozens of different workerbots to make your new planet a fully functioning home. Teach AI helpers their duties by showing them what you’d like them to do step-by-step, be it cooking, farming, mining or construction, and then Autonaut’s variety of different helper bots will carry out their duties until they are complete or you can loop activities indefinitely.
In essence, players code A.I to do their bidding utilising a visual programming language which is powerful but easy to pick-up, with hundreds of different construction options to unlock.
In development since 2017 and downloaded over 300,000 times during Early Alpha, Autonauts screams personality from every poly and is designed to be a colourful and welcoming experience which invites players of all ages to explore, craft and automate. | 2024-07-26T01:27:04.277712 | https://example.com/article/7132 |
Share this Story
Life in College Matters for Life After College
by Julie Ray and Stephanie Kafka
New Gallup-Purdue study looks at links among college, work, and well-being
WASHINGTON, D.C. -- When it comes to being engaged at work and experiencing high well-being after graduation, a new Gallup-Purdue University study of college graduates shows that the type of institution they attended matters less than what they experienced there. Yet, just 3% of all the graduates studied had the types of experiences in college that Gallup finds strongly relate to great jobs and great lives afterward.
These results are based on the inaugural Gallup-Purdue Index, a joint-research effort with Purdue University and Lumina Foundation to study the relationship between the college experience and college graduates' lives. The Gallup-Purdue Index is a comprehensive, nationally representative study of U.S. college graduates with Internet access. According to a 2013 Census Bureau report, 90% of college graduates in the U.S. have access to the Internet. Gallup conducted the Web study Feb. 4-March 7, 2014, with nearly 30,000 U.S. adults who had completed at least a bachelor's degree.
Support in College, Experiences Tied to Workplace Engagement, Well-Being
The study found that the type of schools these college graduates attended -- public or private, small or large, very selective or less selective -- hardly matters at all to their workplace engagement and current well-being. Just as many graduates of public colleges as graduates of not-for-profit private colleges are engaged at work -- meaning they are deeply involved in, enthusiastic about, and committed to their work. And just as many graduates of public as not-for-profit private institutions are thriving -- which Gallup defines as strong, consistent, and progressing -- in all areas of their well-being.
Instead, the study found that support and experiences in college had more of a relationship to long-term outcomes for these college graduates. For example, if graduates recalled having a professor who cared about them as a person, made them excited about learning, and encouraged them to pursue their dreams, their odds of being engaged at work more than doubled, as did their odds of thriving in all aspects of their well-being. And if graduates had an internship or job in college where they were able to apply what they were learning in the classroom, were actively involved in extracurricular activities and organizations, and worked on projects that took a semester or more to complete, their odds of being engaged at work doubled as well.
Yet few college graduates that Gallup studied achieve the winning combination. Only 14% of graduates strongly agree they were supported by professors who cared, who made them excited about learning, and who encouraged their dreams. Further, just 6% of graduates strongly agree they had an internship or job that allowed them to apply what they were learning, worked on a long-term project, and were actively involved in extra-curricular activities. Those who strongly agree to having had all six of these experiences during their time in college are the rarest of all (3%).
Bottom Line
When a student is trying to decide between an elite Ivy League school, a large public university, or a small private college, what should he or she consider to help make the decision? When an employer is evaluating two recent graduates from different backgrounds and institutions, which educational background should distinguish one applicant over the other, and why? When colleges and universities are setting internal strategies, designing new programs and curricula, deciding what performance measures faculty should be compensated for, and working to attract future students, what are they to do?
The data in this study suggest that, as far as future worker engagement and well-being are concerned, the answers could lie as much in thinking about aspects that last longer than the selectivity of an institution or any of the traditional measures of college. Instead, the answers may lie in what students are doing in college and how they are experiencing it. Those elements -- more than many others measured -- have a profound relationship to a graduate's life and career. Yet too few are experiencing them.
Results for the Gallup-Purdue Index are based on Web surveys conducted Feb. 4-March 7, 2014, with a random sample of 29,560 respondents with a bachelor's degree or higher, aged 18 and older, with Internet access, living in all 50 U.S. states and the District of Columbia.
The Gallup-Purdue Index sample was compiled from two sources; the Gallup Panel and the Gallup Daily Tracking survey.
The Gallup Panel is a proprietary, probability-based longitudinal panel of U.S. adults that are selected using random-digit-dial (RDD) and address-based sampling methods. The Gallup Panel is not an opt-in panel. The Gallup Panel includes 60,000 individuals, Panel members can be surveyed by phone, mail, or Web. Gallup Panel members with a college degree, with access to the Internet were invited to take the Gallup-Purdue Index survey online.
The Gallup Daily tracking survey sample includes national adults with a minimum quota of 50% cellphone respondents and 50% landline respondents, with additional minimum quotas by time zone within region. Landline and cellular telephone numbers are selected using RDD methods. Landline respondents are chosen at random within each household on the basis of which member had the most recent birthday. Gallup Daily tracking respondents with a college degree, who agreed to future recontact, were invited to take the Gallup-Purdue Index survey online.
Gallup-Purdue Index interviews are conducted via the Web, in English only. Samples are weighted to correct for unequal selection probability and nonresponse. The data are weighted to match national demographics of gender, age, race, Hispanic ethnicity, education, and region. Demographic weighting targets are based on the most recent Current Population Survey figures for the aged 18 and older U.S. bachelor's degree or higher population.
All reported margins of sampling error include the computed design effects for weighting.
For results based on the total sample of bachelor's degree or higher respondents, the margin of sampling error is ±0.9 percentage points at the 95% confidence level.
For results based on employee engagement of bachelor's degree or higher respondents, the margin of sampling error is ±1.0 percentage points at the 95% confidence level.
In addition to sampling error, question wording and practical difficulties in conducting surveys can introduce error or bias into the findings of public opinion polls.
Slightly more Americans agree (52%) than disagree (45%) that the federal government is responsible for making sure all Americans have healthcare coverage. This balance of views is similar to last year.
Americans' daily self-reports of spending averaged $98 in November, up from $93 in October. The latest figure is the highest average recorded for the month of November since Gallup began tracking consumer spending in 2008. | 2023-10-14T01:27:04.277712 | https://example.com/article/4990 |
Navigate:
December 09, 2008
Categories:
David Axelrod denied earlier today that Obama had spoken to Blagojevich about the Senate seat, but not that the two men had spoken, and a reader points out that the last time they actually met is obvious -- Obama's visit to the National Governors Association last week.
The reader sends on the picture above from the event.
There's lots of chatter this evening about the relationship between the two men, with Obama's backers portraying it as frosty, his detractors potraying them as brothers in arms.
The reality of Obama's relationship with the Chicago Democratic machine is more nuanced, and has been widely explored. He certainly isn't a creature of the machine, wasn't born into it like Daley or married into it like Blagojevich. He came up in the reformist enclave of Hyde Park, but -- as is often the case with a strong machine and talented outsiders -- after he emerged, the organization's leaders saw his promise, and gave him some leeway, and he didn't mount a crusade against their transactional political system. To have refused, for instance, to support Blagojevich in 2006 would have been a major reformist statement; Obama didn't make it, and instead backed the incumbent governor. Obama's tighest inner circle -- Jarrett, Emanuel, Axelrod, Bill Daley -- is composed of people at least one degree closer in, and who each made millions in part off their various connections.
Perhaps the best way to see him is as a neutral in the (lopsided) battle between machine and reformers in Illinois. That's the stance he took in a defining battle, the 2006 contest for the presidency of the Cook County Board of Commissioners. Reformers fault him for failing to support their champion; but he didn't endorse the machine favorite either. He stayed on the sidelines, and kept his focus on the White House. You can accuse him of cowardice for that, or you can grant him that he had decided to devote himself to larger causes and ambitions than Illinois political reform.
Unlike many others, Obama has not enriched himself off the machine; the closest he came was accepting Tony Rezko's apparent help in buying a house. He backed ethics legislation that made the traditional ways a bit more inconvenient, though the fact that State Senate President Emil Jones, a leading machine soldier, backed it suggests it wasn't exactly revolutionary. And he kept himself apart from many of the transactions -- and other insiders, seeing his promise and not wanting to taint him -- kept him away from any taint.
This isn't really particularly mysterious; it's a fairly common pattern in urban politics, in which smart organization pols let a fair-haired boy (back in the day when they were all Irish) keep his hands clean, and he does keep his hands clean. But as Obama's degree closeness or distance from Blagojevich comes under intense scrutiny, it's worth keeping the broader structure in mind.
"and he does keep his hands clean"
This is all I care about as an American. I do not pretend Obama is perfect but as long as he has not broken any laws or played dirty, I do not care about Chicago. The GOP trolls will scream, yes, but Obama's clean on this one. And nothing they can whine about will change that Obama will be running this nation for at least four years. Claim he is not change (which is strange because he has already outlined plans), that he will be impeached (this does not make any sense whatsoever), that he has dirty connection (he is clean) but the man will be in charge. For America's sake, we desire a good President.
What a ****ing liar you are Ben. You said, "Obama has not enriched himself off the machine; the closest he came was accepting Tony Rezko's apparent help in buying a house." Did you forget the position the Michelle Obama received after Obama won the Senate seat? In January of 2005 Barack Obama became a freshman United States senator. In March of 2005 Mrs. Obama received a promotion at her place of employment, the not-for-profit University of Chicago Hospitals. Prior to the promotion, she was a hospital administrator earning $121,910 annually. Her promotion provided her with a title -- Vice-President for Community and External Affairs -- and a salary of $316,962.
There is no coincidence here. There is absolutely no doubt that Mrs. Obama received a salary increase of $195, 052 simply because her husband had become a senator. If one denies the causal relationship between the two events, then one has decided to allow their politics to cloud their judgment. The position of Vice-President for Community and External Affairs did not exist prior to the creation of the position for Mrs. Obama, and now that Mrs. Obama has resigned from the position in order to campaign for her husband, the hospital has not seen the need to fill the open position. To suggest that Mrs. Obama's work efforts had suddenly justified a weekly increase in pay of $3751 is ludicrous.
This whole point seems pretty worthless to me. Let us remember that Harry Truman himself was helped along and supported by the corrupt Kansas City machine and never did anything dirty. Sort of like Obama. I think the thing that they have in common is that neither endorsed nor denounced the practices of their peers. That may sound a bit gutless but they both owe some of their success to keeping quiet. Its the kind of calculation politicians, even clean ones, make all the time.
The University of Chicago is a private institution, not a city or state college. If Michelle got a promotion after Obama's election and it was connected to her husband, it's more likely that her raise was a push by the U of C to gain influence than it was the Obamas soliciting it. Either way, it's not quite the same thing as using a contact made on the job and then working for that contact after quitting government service - as Rahm Emmanuel and tons of other politicians have.
Describing Obama as neutral is accurate.
Lets be clear, the government has not implied in any way shape or form that Obama has anything to do with this PERIOD. What I don't get is why Obama didn't say something to the effect of, this is a terrible day for the state of Ill (which he did). While I do not believe myself of my staff to be involved in this investigation in any way shape or form, I will make the available to answer any questions the appropriate authorities may have. Instead he gave the categorical denial which has whipped up a part of the country into a frenzy trying to punch holes in it. Thoughts, anyone?
Ben, how many Governors was at this meeting? If you look at the video, you can hear PE Obama, say he wanted to shake everyone's hand. There is no way that anyone can put these two together unless you include all the other forty something Governors at the conference. The reader that sent that in to you didn't do anything but make you and he look more stupid than what you are. Are you sure you did not attend 4 or 5 colleges like palin to get your degree in journalism.
@ Elrod - you wrote,"Describing Obama as neutral is accurate." Bullcrap. Did you forget that once Michelle Obama was promoted he sought federal earmarks for his wife's hospital? "In among them was a request for $1 million in federal funding in 2006 for a new pavilion at the University of Chicago Hospitals, where his wife, Michelle Obama, was a vice president at the time"
It's all the Republican trolls know how to do, manufacture fake scandals. The country won't be distracted this time. Obama's clearly not involved, and there's 8 years of Bush's corruption & ineptitude to clean up. The Republicans here should go back to hyper-analyzing the kerning on Obama's birth certificate. The rest of us will continue living in the reality-based community.
@ Mike - you wrote - "I am sure that the Republicans will make a lot out of this,for they have nothing else. Of course,they will want to seek that America forgets to forget their own gross mess." Mike, did you forget that the Democrats have been in control of the House and Senate for the last two years? Did I miss where you discussed their mess of leadership or failures?
ARE YOU TRULY SAYING THAT OBAMA IS 'SORTA' LIKE TRUMAN ? LOL
HE HAS SO MANY CROOKED CONNECTIONS IN HIS PAST -- DON'T BELIEVE FOR A MINUTE THAT REZKO WOULDN'T EXPECT SOMETHING IN RETURN FOR ANYTHING ? AND WHAT ABOUT THE OTHER 'BILLIONAIRE' THAT WAS IN ON THE HOUSE DEAL... OBAMA HAS A REPUTATION FOR DOING ANYTHING FOR MONEY AND HE'S GOT A LOT OF FAVORS TO REPAY .... HE EVEN LIES FOR MONEY !!!! HE'S HAD A LOT OF EXPERIENCE -- THAT'S
WHY HE'S SO GOOD AT IT.....HE ONLY MADE $12.000 A YEAR WHEN HE WAS AN ORGANIZER (?) AND HE BUYS A HOUSE ASSESSED AT OVER $3 MILLION FOR ONLY $1.26 MILLION ... OF COURSE, WITH REZKO'S HELP AND ALSO THE BILLIONAIRE FROM IRAN.... IT JUST GOES ON AND ON ... TELL YOU WHAT ! I'D BELIEVE BLAGOJEVICH BEFORE I WOULD BELIEVE OBAMA.. THAT'S HOW HONEST I THINK HE IS !!!!!
@ Fred - You Obamabots are living in a alternate reality. Gov. Blagojevich is holding onto Obama's right hand with BOTH of his hands. Kind of hard to 'blowing past' him when you are looking at the man and physically attached. I guess now photographs lie to. Damn evil Republican cameras!
Libertarian,
I bet Fitzgerald told him not to comment lest it taint an ongoing case. Obama is, potentially, a witness in Blago's case. As such, it behooves the prosecutor to have potential witnesses not taint a potential jury pool. This is pretty standard stuff.
Bullcrap. Did you forget that once Michelle Obama was promoted he sought federal earmarks for his wife's hospital? "In among them was a request for $1 million in federal funding in 2006 for a new pavilion at the University of Chicago Hospitals, where his wife, Michelle Obama, was a vice president at the time"
I don't know who you are quoting here but there's no credible evidence out there that Obama sought an earmark for U of C hospital only after they promoted her.
U of C hospital is one of the biggest employers in Chicago - and certainly in Obama's old Senatorial district. If he'd seek an earmark anywhere, it would be the U of C hospital. His wife's employment is hardly necessary to justify an earmark to any pol from that district.
MICHELLE'S SALARY IS A GOOD POINT -
SINCE VALERIE JARRETT WAS HER BOSS AT THAT TIME -- WHAT DO YOU SUPPOSE OBAMA PROMISED HER IF SHE WOULD 'GO' ALONG WITH THINGS....HE 'S PAID HER BACK BIG TIME AND STILL IS...VALARIE WAS PICKED RIGHT OUT OF THAT JOB AND WENT TO WORK FOR OBAMA AND HIS CAMPAIGN .....WHAT ABOUT THE 4 STOOGES....RAINES, HOWARD, AND JOHNSON? THEY WALKED AWAY (WITH OVER 300 MILLION) FROM FANNNIE MAE, AND FREDDIE MAC AND WENT RIGHT TO WORK FOR OBAMA....HOW MANY CONNECTIONS DO YOU NEED....THERE IS MORE.... THE TWO COLLEGE ROOMATES FROM PAKISTAN ('81) THAT HE PUT IN CHARGE OF ALL THE
'SMALL' CONTRIBUTIONS (LOL) DURING HIS CAMPAIGN? BOY, I COULD WRITE A BOOK! YOU KNOW , PEOPLE WANT TO BELIEVE THE BEST OF EVERYTHING BUT THERE ARE TIMES (WHEN IT COMES TO YOUR COUNTRY) THAT YOU HAVE TO KNOW THERE ARE A LOT OF CROOKED PEOPLE OUT THERE ..
AND THEY DON'T WANT YOU TO KNOW IT...
To the poster to responded to me.
How long have the republicans controlled the white house? the past 8 years. How long have the republicans controlled the House before 2006? Oh that's right, the last 12 years.
To Law Student, You're side has produced so many fake scandals, that no one believes you.
It's all the Republican trolls know how to do, Scream, Cry out and manufacture fake scandals. The country won't be distracted this time. Obama's clearly not involved, and there's 8 years of Bush's corruption & ineptitude to clean up. The Republicans here should go back to hyper-analyzing the kerning on Obama's birth certificate. The rest of us will continue living in the reality-based community.
Maybe it''s time people start paying attention to investigative journalist Evelyn Pringle.
Curtain Time For Barack Obama
- Part II
By Evelyn Pringle
16 May, 2008
Countercurrents.org
Read Part I
US Attorney Patrick Fitzgerald does not make a habit of destroying pubic officials by listing them in indictments for no reason and the only two political candidates identified as receiving campaign money from Operation Board Games kickback schemes are Illinois Governor Rod Blagojevich and the US Senator from Illinois, Barack Obama.
Instead of referring to Board Games as the ?Rezko? case, before long the media will likely be calling it the ?Blagojevich? case. However, because the governor did not become the presidential candidate, when the scandal is recorded in the history books it will be the ?Barack Obama? case.
Curtain Time Part II will show that Obama was the inside guy in the Illinois senate as far as setting up the Health Facilities Planning Board to extort contributions from companies in exchange for the approval of applications to build medial facilities.
http://www.countercurrents.
org/pringle160508A.htm
Yes, Obama is a very shrewd politician. He works all the angles without getting himself dirty, and in the end he comes out on top. It's very wise in politics to work the game rather than play it. The only problem is Obama's pitch was that he was a reformer and not a typical politician. Now we hear that he has no real reform record, just a shrewd game. If he won't stand up for what's right or lie down with the dogs, then doesn't that mean his interests lie in just looking out for number one, albeit smartly?
@ Elrod - You do realize that your were pwned. You are just too proud or pig headed to admit that your savior - Obama (Praise Be His Name) is no better that the corrupt/un-American/terrorist crowd he calls friends. Rev. Wright, Ayers, Blagojevich, repeat lather rinse.
Law Student, I'll just brand you as a Far-right-fringe then. Maybe you can finally understand why you're side lost the election. No one cares about a washed out terrorist, except you. And Obama has been cleared by the US attorney prosecutor of any allegation to the complaint in regards to this. You've guys repededitly cry wolf, and it just so happens no one believes your side loony accusations and assertions. Go back to hyper-analyzing the kerning on Obama's birth certificate, while the rest of us live in Reality
"You do realize that your were pwned. You are just too proud or pig headed to admit that your savior - Obama (Praise Be His Name) is no better that the corrupt/un-American/terrorist crowd he calls friends. Rev. Wright, Ayers, Blagojevich, repeat lather rinse." - If there's anyone who got pwned it's you. But please continue your bigoted and far-right fringe assertions. You guys are you're own worse enemy, and are only proving our point.
Obama was a nobody until he lucked onto the Dem ticket in 2004 Senate. I don't mean that in a bad way, I mean literally that almost no one knew of him. His name was foreign, he wasn't on Chicago news, he wasn't on local talk shows, Oprah never mentioned him. Ryan (the one with the Star Trek wife and scandal, not the convict ex-gov) was a shoe in for the seat and the Machine figured it was lost--Obama got lucky with the Ryan divorce scandal and the rest is history. With that opening people took a look at for the first time and LOVED him. This is what people miss. The Machine didn't support him, he put himself in a position to get lucky...and he did. Obama has been too ambitious to compromise his reputation and the Machine never took him seriously because of his last name. We're all lucky it went down as it did.
What a mealy mouth statement from Obama. Where is the outrage, where is the opportunity to rail against corruption? It sure appears it was carefully worded to give him legal cover as this case unravels further. Anyone from Illinois knows the Chicago machine is crooked and Obama is a part of the machine. This is only the tip of the iceberg. The fish rots from the head down and soon the head of the country will be Obama.
Good 'ole Barry.... Mr. Clean, maintains his political viability by voting "Present" when given the opportunity to make a real stand against Chicago's currupt machine, but ya gotta give him points for throwing Blago under the bus at the first available opportunity, just like Tony rezko, Rev Wright, and his dear old Grandma........
Ben I think you should contact Rich Miller before writing articles such as this. Chicago politics is generally corrupt but Obama has managed to stay above the fray. As a student of Illinois politics I can tell you Illinois politics is very complicated and as you say "nuanced." As for the rest of commenters, Blagojevich has been seen like a plague to Democrats and Republicans alike for the past two years and the smart ones (Obama, Daley, Durbin and others) have avoided him like he is the plague. Sure they gave professional acknowledgements since Blagojerk wasn't under official indictment or arrest, but today everything has changed.
President-elect Barack Hussein Obama needs to explain fully why he is shaking Blagojevich's hand so firmly, and why both men are smiling. This is Barack Hussein Obama's responsibility to explain this and the country expects nothing less.
Obama is the most incorruptible president. He forged his way for years to become the president that the people wanted. He is too smart to tarnish his image with corruption.
Posted By: Keep it real | December 09, 2008 at 10:32 PM
ha ha ha The Dali Bama smokes ***s...
My sources tell me that Alan Keyes is already dropping hints about another run for the Senate if the Illinois State legislature calls a special election. If the Republicans gain a Senate seat behind this scandal Blago should get the electric chair!
So what are you idiots alleging against Obama? Do you need to wait until Rush tells you? Obama did what? He tried to bribe the Gov. of Illinois to get his pick for a 57th or 58th Senate seat? The President-Elect, who knows darn well Blago is a crook and under investigation decided to try to buy the seat for someone else???? Or maybe you think he wanted to make some money by splitting a pay out with his close friend Blago (whom he didn't ask to campaign for him, made sure he didn't speak at the DNC, didn't include in his campaign, didn't invite to Grant Park and hasn't spoken with in a 2 months)? Blago is a crook, Blago is from Illinois, Obama is from Illinois, ergo Obama is a crook???
My thought on Obama's statement is that he is an attorney. Harvard Law. So he knows very well that the wrong statement could sink any prosecution of this idiot governor. If he were to blast the guy then Blago could, with reason, eventually claim that inflammatory statements by the President of the USA prejudiced members of the jury pool against him. Obama is actually in a no-win situation. No doubt he'd like to comment and has, instead, to tread very carefully. Who would want this person to avoid trial because of something he said?
My sense is that everybody has known for years that this fellow is crooked and under investigation. No doubt he's been radioactive as far as Obama and his political team.
Finally, what is it with the governors of IL? The last one, GOP, is cooling his heels in the clink, also.
If you can't think of a reason why a President-Elect would try to bribe for someone else to replace his seat in the Senate, that's probably because it doesn't make any sense. This attempt to taint Obama with guilt by geographic assoication is pathic.
Why would Obama do this again?
Obama was going to split the money with Blago? Obama and Blago are best friends and Obama was just trying to do him a solid (even though he didn't campaign with the guy, allow him to speak at the DNC, invite to Grant Park or apparently speak with any time since his election).
I mean, seriously, if you're going to accuse someone of wrongdoing, at least accuse them with something.
The President-Elect, if he were corrupt, would have named Blago Attorney General or head of the FBI or at least Ambassador to France. Instead, we're supposed to believe he's corrupt so he's going to bribe for his old seat for a friend??
Or hey, maybe Obama might no someone with the power to pardon or commute or just stop a case federal case from going forward? Someone like maybe a President? If Obama were to know of a person like that, maybe, just maybe, Blago would be kissing his ass rather than shaking him down?
Maybe, just maybe, Blago knows Obama isn't dirty????? Couldn't be that my conspiratorial friends.
Wow, How breathtaking it is! Welcome to Obamaland or Obama's White House! Although all dems/liberals say with their brave face that Obama has nothing to hide from this tragic episode for Illinois politics. Our President-Elect also said today with brave face that he had no contact with the Governor Blagoojevich. Do you believe it with all faith? It sounds familiar to what President Clinton had said that "I have not have sex with that women"? Clinton also showed bave face when he declared it, but at the end of the day he was impeached becaused he lied! I wonder whether the next four years will become Clinton's White House-redux. Although the Prosecutor has not implicated Obama in this corruption yet, anyone with an IQ of 100 will be skeptical that Obama, or at least his advisors with his knowledges and authority, may not be implicated in some ways. Obama said many things during the campaign that turned out to be untrue; for example, that Ayers, that Tony, and that GD America? He disowned all of them when their associations looked bad to him. After Obama was elected, these people now all came out to call him a friend. I guess we should fasten our seat belts for a bumpy ride with Obama for the next four years.
Again, what are you accussing Obama of anyway? If Obama were a crook Blago would be kissing his ass or already have some cozy appointment. Instead the dittoheads go after Obama for mysterious non-crimes they suspect(nay know!) must have happened. What crimes, they cannot say...perhaps because people with more power don't bribe people with less power (like, I dunno, a President-Elect bribing a Gov. with a 13 pt approval percentage and widely known to be under federal investigation???)
Gee, republicans... if we're gonna talk about half-baked accusations and innuendo, why not discuss why Rove and Cheney saw the need to blow up 3 office towers and knock a plane-size hole in the pentagon?
I personally just find the timing of this arrest odd, perculiar, curious, premature and untimely. The Feds has been on Blagojevich's tail for 4-5 years, so why, all of a sudden, was all so eager to handcuff him, not for a publicly humiliating perp-walk, but in the quiet and privacy of the early morning? Keep in mind, Obama is not due to swear in for another 40 days, and Blagojevich was still dangling the bait of senator appointment for better offers and maximum bribes. Why wouldn't Patrick Fitzgerald wait for a little longer and let this thing played out before administering a coup de grace. Trust me, when you had a big bait such as a vacant senator seat dangled over the cesspool of Chicago dirty politics, there surely would have been more attempted bites from those political creatures. Again, why not casting a wider net and setting a deeper trap so the Feds would have a bigger catch. This inopportune arrest scared off at least a few more would-be perpetuators. Was Fitzgerald afraid that, had this shenanigan gotten dragged on further, there would have been more entanglement and implication that would have reached the inner circle of Obama, Jackson, Daley and whatnot's friends, aides and associates -past and present? It would have created an uncontrollable political wild fire that might burn and hurt a lot of people, especially the old power that be and the new administration. The cynical observation is that Fitzgerald, by shutting this thing down now, acted more like a fire marshall doing a preemptive burning, than a federal prosecutor bent on rounding every perp up and rooting out most, if not all the corruption in Chicago once and for all. I sincerely hope Fitzgerald had a better strategy and more indictments up in his sleeve to prove me wrong.
I'm still trying to figure out what I'm supposed to be denying. I'm a loyal Obama man, but it beats me. I mean, yeah I deny he's a crook--but why exactly is a denial needed? Still waiting on this very interesting criminal taint theory to materialize...he's guilty of knowing a corrupt politician at one point and then not having anything to do with them>? Is that a crime? Is it a crime to be from Illinois all of the sudden?
People here are being much too quick to assume the worst. Blagojevich does sound like a real jerk, but some of the things attributed to him sound almost like the sort of things that some creep at a cocktail party would say to get attention. Bragging about power and wrong doings are not quite the same thing as actually doing illegal things. They may be the same thing morally; but for sure they are not legally.
As long as the investigators are saying Obama isn't involved...why are people here at Politico assuming that he is?
I'm pretty sure that Obama is having an affair with Sarah Palin. I saw a picture of them standing together at the governor's meeting. The picture of the two of them talking at that meeting is all I need to know for a certainty that Obama is having an affair with her. It's true. Honest. Just look at the pictures of them together.
Politicians of Obama's political skill, temperament, intelligence and eloquence do not need to be corrupt to succeed! Why would somebody as smart and talented as Obama be so stupid as to play Blago's bizarre game? He was naive with Rezko and learned his lesson.
FDR and Truman did to NYC and KC machines like Obama did to the Chicago machine: Let it be for the greater good. If Obama attacks them, he'd go nowhere. If Obama plays their game, he gets taken down a la Blago. If he neither attacks nor plays, he becomes President. That's just pragmatic! That's just smart!
Average, run-of-the-mill nobodies like Blago need to be corrupt to succeed. Political juggernauts like Obama don't.
SpectCon - Let me explain Republican logic to you:
1. Blago had a 13% approval rating and was widely rumored to be under investigation.
2. Blago didn't speak at the convention nor was he involved in the campaign.
3. Obama's favored replacement pulled out of consideration within a week of the election.
4. Blago said Obama & Co. only offered "appreciation" and Blago in turn offered to "**** them"
5. Obama is evil.
Weight of the evidence!
Obama, who is usually good at selecting his words, should have been more careful and said he had "no contact" with Blago and "discussions on this issue." He omitted the last part, and the media is misreading his comments in assuming it meant there had been no call of congratulations, no handshake at the governors' meeting, no calls at all in the last six or so months. He needs to take a machete to scum like Blago, turning this case into a "teachable moment" like he did on Wright and race. Today was Hope for Hannity Day. But a guy that was able to shake off Wright can dispose of this crude hairball of ambition without much ado. But he should do something. This is an ugly reminder of political venality that is a sad reality in many places where it is practised with more sophistication. And Obama must not let this guy's mud tarnish him.
In a sequence of events that neatly captures the contradictions of Barack Obama’s rise through Illinois politics, a phone call he made three months ago to urge passage of a state ethics bill indirectly contributed to the downfall of a fellow Democrat he twice supported, Gov. Rod R. Blagojevich.
Mr. Obama placed the call to his political mentor, Emil Jones Jr., president of the Illinois Senate. Mr. Jones was a critic of the legislation, which sought to curb the influence of money in politics, as was Mr. Blagojevich, who had vetoed it. But after the call from Mr. Obama, the Senate overrode the veto, prompting the governor to press state contractors for campaign contributions before the law’s restrictions could take effect on Jan. 1, prosecutors say.
http://www.nytimes.com/2008/12/10/us/politics/10chicago.html?_r=2&hp
A special election is not the way to prevent Blago from naming a Senator. For one thing, even if the legislature passed a bill on Monday, Gov. Blago would have 60 days to sign or veto it. That gives him at least two months to use his appointment power.
The only way to ensure against a Blago appointment is described here at The Purple Center blog.
thepurplecenter.blogspot.com/2008/12/senators-should-announce-theyll-refuse.html
"insiders, seeing his promise and not wanting to taint him -- kept him away from any taint." Wrong. Just the opposite Ben -- they stayed away from Obama because he wouldn't play their dirty games. About 3 times a year for the 8 years Obama was in the IL senate, he was sponsoring some kind of ethics bill (21 in all -- 2 passed, one of them "the broadest ethics-reform legislation in 25 years"). He wasn't just trying to "keep his hands clean," he was trying to clean all of their hands.
Of course the vultures are out for blood! They forget that they have a present sitting president who has broken many laws, they forget about Ted Stevens! They forget that they all rallied to elect a vp who was in fact found guilty of abuse of power! They think corruption in gov is ok if it is a corrupt republican, but find one corrupt democrat and everyone who has ever been in the same room with him must be corrupt as well! Get over yourselves! The criminal complaint showed that Obama knew nothing about it and it was most likely the Union rep that was the person who was told of this Gov interest in getting paid for the choice, I believe the Union rep was also the one who turned it in after letting someone else know about what was going on! Obama is a graduate of Harvard Law, don't think for a minute that he would be stupid enough to screw up his political career with this petty crap!
Let me point out one thing that many of you vultures don't think about! In order for someone who is either of a race or a female to make it, they must walk a very fine line and stay far above the rest and that is only to be considered a somewhat equal to the most biased, yes that means you vultures out there! I have seen it many times over and watched as the highest of these achievers make it, then watched as they still had to prove their worth to fools like you vultures! Obama is clean in this mess and history will prove it! President elect Barack Obama is a good and honest man and he has proven that in his actions. I would like to see any one of you vultures try to walk in his shoes for even one day anrd see how well you would do? I bet you would fail at the first second! So to all you vultures out there, waiting for the moment to attack president elect Obama, go get a life and get over yourselves!
For those informed voters, such as myself, this is no surprise. We have known for a long time BO's ties to the "pay to play" politics of Illinois...how did MO get that highly paid job...how did MO get that board appointment...hey, I'm just talking about the wife's bennies, haven't even started on BO.
I'm loving it...nothing like live entertainment.
What's the big deal? Ted Kennedy is making deals to give his Senate seat to his wife. Joe Biden is working on a deal for his seat. There's no way Bill Clinton isn't getting something for Hillary's seat. The Senate has turned into the House of Lords except in true American fashion you can buy the title.
Nice work, Ben. In the end, desperate Republicans are going to try to make the guilt-by-association thing work, but the guy was a governor, so a lot of people knew Blagojevich. Obama broke no laws, no did he help anyone break any laws.
If Obama did nothing wrong, why did he tell such a bold faced lie "I had no contact with the governor or his office and so we were not, I was not aware of what was happening" when his campaign manager and photographic evidence suggest otherwise. The procecution has made no reference that Obama is involved, but I am curious as to why he was so quick to lie about it.
Actually, BO claimed that Ayers was just some guy in my neighborhood, and on and on. And now after the election, Ayers now freely says that the families were close friends.
You?ve got Rezko and his real estate deal. BO?s explanation? I was a bonehead. Hmmmmmm.
The question here is, despite anything that BO claims right now, why did Blago feel that BO owed him something when he was getting angry at BO?
If BO had nothing to do with Blago ever, and was never involved, why did Blago think that BO owed him anything at all?
There is your question.
What did Blago do for BO that Blago now felt BO owed him?
BO was involved in the sewer of Chicago politics. You don?t come out of the sewers of a h**l hole like Chicago without being dirty. (Sorry to those of you who still want to believe some kind of fantasy. But you are kidding yourselves.)
Aren?t you glad he moved his organization to Chicago? Ain?t Chicago great?
Beware. The narcissism of Blago and the arrogance is unbelievable. Someone who is beyond anything other than his own self centered survival.
If BO was involved with Blago, and Blago is going down, Blago will take anyone and everyone with him to spare his own sorry skin.
Blago will blame everyone and everything on someone else in order to save himself, and he will talk to anyone who will listen.
BO could be damaged in his first presidential term.
Watch for the Chicago democrat machine to try to bury their own dirt as quickly and as quietly as possible to prevent any damage to the BO administration. And then, the democrat machine in Washington will move fast to stifle the entire thing in order to protect BO.
The democrats, being saddled with Blago, their own Nixon type, will move to bury and silence everything so the players aren?t revealed.
BlagO and RezkO are gonna be singin a duet. . . . The next swearing in for Obama will be in a Chicago courtroom. . . . Obama wasn't aware? Wasn't aware of what, that he was being taped by the FBI too? . . . Meanwhile, Obama says he's gonna give a major speech in an Islamic capital, which for you members of Cult Obama, is in one of the 57 states.
Other governors have stepped aside for extra marital affairs (with men and women), and Blago is caught dead to rights on tape, and refuses to resign.
What kind of arrogance and self centered narcissism is that?
It is the narcissism born of someone who has dirt on other people.
He believed if he was a senator, he would have more protections from being indicted and arrested. This guy actually believed he would STILL run for PRESIDENT. (This guy is psychologically unbalanced.)
Until he was indicted, he was a pariah, no one wanted to go near him. Now that he has been indicted, he has some power now. (Not much, but some.). If he goes down, he will start naming names to save his own skin.
Look at the amazing chutzpah of this guy who refuses to get out of the chair! Caught on tape, in his own voice, and still refuses to leave.
The Right wing trolls have so completely lost it, it's quite remarkable. Obama has not be charged with any connection at all, The US attorney Prosecuter, who is a republican, has said it clear as day, Obama is clean in this complaint. You guys are grasping at straws. It's quite pathetic to see. It's like you're not even paying attention to reality.
OK class, can somebody tell me what is wrong with this sentence from the article above? . . .
"Unlike many others, Obama has not enriched himself off the machine; the closest he came was accepting Tony Rezko's apparent help in buying a house."
For those Obamabots now trying to distance Obama (Oh Praise Be His Name) from Blagojevich there are few stumbingling blocks for you in your mental gymnastics.
Both Obama and Blagojevich got extensive money and support from Chicago businessman Antoin "Tony" Rezko. At least one top aide to Obama, Michael Strautmanis, previously worked for Blagojevich.
Obama even campaigned/raised money for Blagojevich after the FBI started targeting him for corruption in 2003. It is all documented and their hundreds of photos of them together.
http://www.chinadaily.com.cn/world/images/attachement/jpg/site1/20081210/0022190fd3300aa95d6307.jpg
Oh boy! Something to take the slobbering haters minds off that contrived pesky birth certificate scandal. Another guilt by association scandal. Sigh. Give it up, desparatos! It's President Obama now. You can alleged all the "scandals" you want, he's still our president. Get over it, already! Sheesh!
It seems that the damage control mentality is still in order... I love when s-c-u-m-b-a-g journalists like Bennie and other say he is not a product of Chicago school. Indeed he was not born there, but what about married in??? His wife Michelle is native Chicagoan with close ties to Jackson and other Democratic operaives in the town. her father was a part of the Democratic political machinery in the town. So don't give me that c-r-a-p how Barry didn't see, didn't smell, didn't hear anything. He actively supported and worked on Blago's political campaigns in the past and they supported and endorsed each others' candidacies. But as I saw yesterday on CNN... Gloria Borger, John King, Martin "Angry" Roland, all registered Democrats.... doing damage control for Barry... No, this is not going to hurt him, he was never a part of the Chicago life etc. etc... So part of which or whose life was Barry??? Kripton? Honolulu? Seattle? Dudleyville??? he got his mansion by Rezko, who was a close friend of Blago and Barry. And of course MayBee pointed out a very good point: what about Michelle and her salary, which drastically went up after her hubby became prominent???
Everyone knows that Barry is corrupt. Only difference between Rezko, Blago, jackson and the rest of the gang and him is that he is more skillful at hidding his corruption. What of course is not that hard, considering 99% of the media is in the Monica position. So we have to do our homework. Which you Bennie are paid to do.
And now this lying clown will be in the White House... It is so sad that I had to laugh. Instead moving forward the next four years, we will be again vegetating for four years like during Carter's years...
Illinois Gov. Rod Blagojevich, Sen. Barack Obama and Chicago Mayor Richard M. Daley at a rally in Chicago on April 16, 2007, after the U.S. Olympic Committee announced Chicago as the U.S. 2016 Applicant City for the summer Olympics.
Isn?t it ironic that a 2 term Gov. is outed for being a sleazy crook and a Jr. Senator as bad or worse, was un vetted and was given a free ride to the white house, by the MSM.
Save your bleeding hearts liberals, you?ll need it to vomit your pity for Obama when and ?if? all the truth comes out.
I can see the spinning going on now in the hallowed halls of Chicago?s capital. The Gov. has known ties to the Poison Dwarf Rahm, to Rezko and Axelrod and the rest will come out, hopefully. Ha! This guy Blago, should have a lucrative future, if he keeps his mouth shut about his friend and political comrade, the illustrious Senator from the South Side of Chicago.
Well, I guess we know where some of those millions Obama took in will end up. The messiah stands on quick sand, this is just another dent in his armor that millions failed to admit existed. Just wait till you people who passionately wait for your free stuff discover it ?ain?t? coming!
I was struck by the video of Obama "greeting" Blago. He stopped to say a few words -- or at least gave eye contact -- to every Governor but Blago, whom he just blew right by.
If you actually look at the photo (which is presumably the best Ben could do), you'll see that Obama isn't even looking at Blago.
American Patrol Report Commentary -- December 10
Reconquista Villaraigosa Marches with SEIU
Yesterday the American Patrol Report focused on Barack Obama's links to the Service Employee International Union (SEIU). Within hours we learned that the SEIU was intimately involved in the Gov. Blagojevich's selling of Obama's Senate seat.
"Among the revelations contained in the complaint brought against Illinois Gov. Rod Blagojevich yesterday was the description of an official with the Service Employees International Union acting as an apparent intermediary between the governor and Barack Obama's camp in discussions over Obama's Senate seat."
Washington Post
The SEIU is a corrupt, dangerous, anti-American organization that will assume great powers under Obama.
Obama's corrupt Chicago gang's Little Red Book is Saul Alynski's "Rules for Radicals."
They are dedicated to opening the border with Mexico and turning the entire Western Hemisphere into a socialist monolith.
"If the Chief Justice of the United States doesn't have the courage to refuse to swear in the imposter Obama, the people of the United States must come together in unified resistance to save their nation," said Glenn Spencer of the American Patrol Report.
"Neutral"????
If Barack Obama was "neutral" he wouldn't have endorswed and campaigned for every sleazy member of the Daley machine including Blago himself.
Ben Smith you are a sham without an ounce of integrity.
Hey remember when the liberal media and Democrats were clamoring to see pics of Bush in the same room with Abramoff? We have several pics of Obama being chummy with Blago.
Come on folks - Obama said he had no contact with the Gov to discuss the Senate seat. Do you think they were discussing it there at the NGA meeting, in a big open room where Obama was shaking hands with 40 governors?
Sarah Palin was there, too. Why is she palling around with criminals like Blago?
Blago called Obama a pretty bad name and said that all he could get out of Obama would be "appreciation." Unless something else comes out here, there's no Obama corruption to be found in this generally sordid story.
Badger: how did Blago know that all he could get out of Obama was "appreciation"? For Obama claims he had absolutely no contact with Blago. Either Obama is lying or your claim that Obama declined to play Blago's dirty "pay to play" game is false. WHICH IS IT?
Badger: how did Blago know that all he could get out of Obama was "appreciation"? For Obama claims he had absolutely no contact with Blago. Either Obama is lying or your claim that Obama declined to play Blago's dirty "pay to play" game is false. WHICH IS IT?
Sorry but Something tells me that it is Obama's team that sold the wisp...The picture now allows me to see the persons behind the 'much ado' which was nothing without it...
If Axelrod said Obama is not in contact with Blago it's to me a kind of signal on what is happening against the man they are fighting at that time... He mispoke to sustain a strategy, what next now...
Finally!
people are starting to talk about the "Illinois Combine" and "Operation Board games". Where the hell was the media several months ago about this? I am stay-at-home mom that knew about all this stuff! Evelyn Pringle did a multipart article about all of this. It is a must read! http://www.opednews.com/author/author58.html
Finally!
people are starting to talk about the "Illinois Combine" and "Operation Board games". Where the hell was the media several months ago about this? I am stay-at-home mom that knew about all this stuff! Evelyn Pringle did a multipart article about all of this. It is a must read! http://www.opednews.com/author/author58.html
Ryan T: If you actually read the report, you'll see the governor's unnamed consultants told him Obama would not give him anything but appreciation; they did not say they had spoken with anyone in the administration. And if they had, so what? So a consultant or two talked to an Obama team member and they shut the consultant down. How does suggest, let alone prove, anything nefarious?
More nonsense people can't even make into an accusation of criminal activity on the part of Obama. He had every right to advocate for a candidate, and there isn't even indication he did. If you believe Blago he wouldn't give him anything *apparently just talking to Blago is a crime?
just wait. blago is going to sing like a canary and take everyone down with him. However, will the media report it? I would hope so, but they are currently so embarrassed they backed a guy who they knew nothing about and is now coming up with suspect credentials and now this!!
obama better be 'lawyering' up because he is going to need on. perhaps he can use those 3 law firms he hired and paid over 800K so that he doesn't have to show his certified birth certificate.
This is definitely going to be a popcorn event. get it ready
Obama may be clean (so far as we know) but I seriously doubt it has anything to do with any sort of virtue. Learn from the wisdom of Proverbs 29:27: "An unjust man is an abomination to the just: and he that is upright in the way is abomination to the wicked." Good guys put a damper on corrupt cultures, so the Chicago big wigs would have had Obama for dinner if he were going around being a saint. The fact that they were as supportive as they were of his carrer means there's something other than his potential that motivated them. Obama probably just didn't make his dealings in Illinois obvious...either that or he just played the good, non-threatening black guy until he could get to Washington.
Michelle Obama got a huge raise because Obama saw to it the hospital got a huge amount of money, sounds crooked to me. But who am I to judge, I am getting used to crooks in the government. Obama seems to be the biggest so far, he is actually buds with real crooks....Mr. President, go "f" yourself and your friends, you are not worthy to be anything in government. You have gotten away with far to much so far.
The issue is not as you morons state: Obama blew by Blago in the picture and the Republicans are making hay on it in as fake scandal.. GET REAL! Obama said he didn't speak with Blago and knows nothing about his senete seat? Well here is a picture that YES they did speak, about what? hmmm why did Blago call Obama a MotherF'er??
Federal investigations and/or trials of Ali Ata, Tony Resko, and now Rod Blagojevich all have something in common. Barack Obama. Is it at all possible that B.O. comes out of this smelling like a rose? Me thinks he is not the "teflon man" and it stinks of a rotting corps yet to be placed in the morgue for further evaluation. | 2024-05-17T01:27:04.277712 | https://example.com/article/5695 |
Q:
Showing tags (keys and values) when converting .osm to .shp?
I would like to use OSM data as shapefile so that I could do some computations. So far, I have successfully loaded the OSM file in ArcMap 10.3.1 using the ArcGIS Editor for OpenStreetMap. The attribute table only shows the primary physical features such as highway, building, natural, etc.
How do I show the other tags, like building:level, building:material, etc., in the attribute table?
A:
In the documentation of OpenStreetMap Toolbox, there is a detailed description on how to extract specific tags, and it mentioned that:
When you download data from OSM using the ArcGIS Editor for OSM tools,
you may find that certain information captured in the OSM tags is not
downloaded with the features. This is because only information that is
used for categorizing and symbolizing the data is downloaded
automatically; if all the tag information was downloaded, the result
would be an unwieldy attribute table with hundreds of columns, with
most of the values being 'Null'.
If in your workflows you are always interested in a specific tag
value, you should update the 'Download, Extract, and Symbolize OSM
Data' model to include that tag.
Therefore, specific tags should be specified before start downloading of OSM data.
| 2024-05-07T01:27:04.277712 | https://example.com/article/6556 |
A molecular description of the gelation mechanism of konjac mannan.
A molecular level description of the time course of the gelation of the polysaccharide konjac mannan (KM) is presented and the role of alkali addition is considered in detail. NMR relaxometry is utilized as a complementary methodology to mechanical spectroscopy in order to probe events occurring as a prelude to network formation, and high-resolution NMR is used to follow the deactetylation process. It is shown that the addition of alkali plays an important solubilizing role in addition to facilitating the deacetylation of the chain. Deacetylation is important both in reducing the inherent aqueous solubility of the polymer and in progressively negating the alkali-induced polyelectrolytic nature of the polysaccharide chain via reaction induced pH changes. It is proposed that observed induction periods following alkali addition (during which the elastic modulus does not rise) are not simply deacetylation delays but are related to the aggregation kinetics of the deacetylated material. | 2024-01-23T01:27:04.277712 | https://example.com/article/6949 |
As everyone knows, gas logging data is affected by many factors, such as geological factors and drilling factors, The factors cause difference of gas logging data in different regions, and improve the difficult of gas logging data processing. So, selecting the parameters of gas logging data is very important. Aiming at the RBF neural network algorithm manages the gas logging data has instable and other faults, this thesis presentsa normalizationmethod based on rough set theory, using this method improves the training speed of RBF neural network algorithm manages the gas logging data. In order to verify the feasibility of this method , this thesis uses the gas logging data from Liao he oil field. Throughing the experimental results, thismethod can effectively improve the RBF neural network algorithm to manages the gas logging dataspeed. | 2024-07-31T01:27:04.277712 | https://example.com/article/7550 |
Nation’s Top Recruit Leonard Fournette Commits To LSU
St. Augustine running back Leonard Fournette is the highest rated recruit in Louisiana, and according to many recruiting experts (like ESPN), the top recruit in the nation. A day after winning the Outback Bowl, the LSU Tigers won another game…the recruiting battle to land Fournette.
The 6’1, 232 pound RB verbally committed to LSU today, announcing his decision to a nationally televised audience on ESPN during the 4th quarter of the Under Armour All-America game. Alabama and Texas were considered players in the recruit process of Fournette, but the Tigers were the favorite.
Tiger fans certainly are breathing a sign of relief, considering several other recruits thought to be heading to LSU chose Alabama, Florida, and Texas A&M. Wide receiver Speedy Noil out of Edna Karr chose Texas A&M. His high school teammate, defensive tackle Gerald Willis, picked the Florida Gators, and Tony Brown, a cornerback out of Ozen High in Beaumont, TX. verbally committed to Nick Saban and Alabama. Tiger fans were hoping he’d join his track star sister at LSU, but she was saying, “Roll Tide!” on the ESPN broadcast after her brother made his announcement.
Frank Wilson, LSU’s running backs coach, is a long time friend of Fournette’s Father. Many sports analysts felt the relationship gave an edge of LSU in the recruit process of Fournette. In addition, the Tigers off Fournette a chance to step on the field an hour away from his hometown.
While Fournette has quick lateral movement, he’s more of a typical north/south runner. His ability to break tackles while also initiating contact make him a can’t miss college football prospect. His combination of speed and power already have Tiger fans drooling.
Signing day is Wednesday, February 5th. Until Fournette signs his letter of intent, he’s only a verbal commitment.
Welcome back to SPORTS RADIO ESPN 1420
It appears that you already have an account created within our VIP network of sites on . To keep your points and personal information safe, we need to verify that it's really you. To activate your account, please confirm your password. When you have confirmed your password, you will be able to log in through Facebook on both sites.
*Please note that your points, prizes and activities will not be shared between programs within our VIP network.
Welcome back to SPORTS RADIO ESPN 1420
It appears that you already have an account on this site associated with . To connect your existing account just click on the account activation button below. You will maintain your existing VIP profile. After you do this, you will be able to always log in to http://espn1420.com using your original account information. | 2024-03-13T01:27:04.277712 | https://example.com/article/7696 |
Q:
Specified method is not supported httpwebrequest - Silverlight
I am trying to use an HttpWebRequest object in Silverlight 2.0, to do a "POST".
Upon return from the BeginGetStream method I end up with the following error :
Message: "Specified method is not supported."
StackTrace: " at System.Net.BHWRAsyncResult.get_AsyncWaitHandle()"
Here's some sample code: Note I have used fiddler to see if anything is being sent across the wire and there is no network activity.
HttpWebRequest req = (HttpWebRequest)WebRequest.Create(new Uri("http://someurl"));
req.Method = "POST";
req.ContentType = "application/x-www-form-urlencoded";
req.Accept = "text/plain, */*";
req.Headers["X-Requested-With"] = "XMLHttpRequest";
AsyncCallback callBack = new AsyncCallback(streamResponse);
req.BeginGetRequestStream(callBack, null);
Thanks,
Dave
A:
I just found one solution for this problem. HTTP Client need to know Content-Length to fill the Content-Length HTTP header value. Client can'not start request before it length became known. When You get RequestStream WebRequest can'not know how much bytes you will send to server. You must Close stream to commit Content-Length and only after closing the RequestStream You can call BeginGetResponse. It is strange that this not done inside WebRequest.
Hope this helps,
Dmitry
| 2023-10-27T01:27:04.277712 | https://example.com/article/4176 |
Our extensive suite of innovative and helpful colour tools dulux trade colour chart specifically designed with your colour needs at their core, guiding you and supporting your business by ensuring you have the latest colours, up-to-date trend information, cutting-edge technologies and helpful advice at your fingertips.
All your dilux products It’s now easier to pick the dulux trade colour chart product duulux your project, browse through all of your favourite AkzoNobel products. Register or log in to order your complimentary fandeck here.
Pale tones offer a hint of colour for a light and airy feel, or can be used to gently lift ceilings and woodwork dulux trade colour chart deep or mid tones.
Flexibility The colours in Dulux Cokour can be mixed into a wide range of paint, suitable for walls, woodwork and even furniture, and in a variety of finishes, such as matt, eggshell or gloss for example.
Find a colour
These four colours ranges have been designed to improve problem areas, including dark, cold or and bright interiors. And just because you have a Victorian home there is no reason why you cannot decorate it using Georgian colours — Heritage by Dulux is ideal for those who want a beautiful home regardless of its age or style.
Get colour help We have colour tools to help make your business life easier Need help showing your colour schemes in context? With over colours our Plugin helps professionals like you design their project with precision – seamlessly integrating with your digital design software. Create the look you desire Originally created inDulux has relaunched the range to make it easier to build your colour scheme.
Originally created inDulux has relaunched the range to make it easier to build your colour scheme. Easier navigation Find colours with ease, thanks to dulux trade colour chart new intuitively designed fandeck.
View all colour tools. View our colour range.
Digital Colour Palette | Bring Colour to Life | Dulux Trade
The annual trends publication from AkzoNobel, Colour Futures is the result dulux trade colour chart research by an international team of dulux trade colour chart and colour experts. Inspired by colour Our colour tool with over 4, colours will help you find the perfect colour from your preferred brand. Bringing creative visions to life Access to every colour in the Digital Colour Palette.
The colours in Dulux Heritage can be mixed into a wide range of paint, suitable for walls, woodwork and even furniture, and in a variety of finishes, such as matt, eggshell or gloss for example. Happy to take phone orders! New and improved fandeck Any successful decorating project starts with choosing the right colour scheme.
Whatever the job, you’re sure to tade just what you need in no time – especially now it’s available to use online with our colour picker tool. How to choose The easiest way to use the chart is to pick one dominant colour, for your walls for example, and team it with the white at the bottom of the same column, for use on your skirting, door frames or accessories such as chairs.
ColourFutures TM The overarching theme for this year is A welcome dulux trade colour chartand comprises four trends. Heart Wood, along with its associated trends have been created to ensure daily environments can become places of calm, where the noise can be turned down and values can be nurtured.
S G Bailey Paints Ltd | Dulux Trade Woodcare opaque colour chart.
View CF collections here. Here we have brought together some cchart our most inspiring and useful collections: Whatever your project, we have the right colour specification tool for the job at hand. It’s now easier to pick the right product for your project, browse through all of your favourite AkzoNobel products. Click here to download from iTunes or Google Play or create a specification online. Colours now flow right across the spectrum, making it easy dulux trade colour chart locate the dulux trade colour chart you’re looking for.
You can also download a pdf of the book from www. Complementing Materials Seven beautiful collections of whites and off- whites, designed to work with a variety of interior building materials from timber and metal to stone and terracotta. Preview or search for colours from the new palette, select hues from an existing image, incorporate external imagery into trae, or use the interactive gallery for inspiration. The easiest way to use the chart is to pick one dominant colour, for dulux trade colour chart walls for example, and team it with the white at the bottom of the same column, for use on your skirting, door frames or accessories such as chairs.
Hundreds of new shades With ttade teals, more blues and a larger proportion of the increasingly popular neutrals, our new fandeck delivers dulux trade colour chart best breadth of colour yet.
Start your colour journey by picking what you are painting below. Create in Colour Your own bespoke palettes Build your client’s dulux trade colour chart colour scheme with a huge range of colours at your fingertips. The Heritage whites have been specially selected to coordinate with the other tones in the same column of colour, whether for your woodwork, walls or tradd.
The colours in the palette flow through the spectrum from left to right, while each column includes two pale, two mid and two deep tones, with the perfect white to complement them at the bottom. Dullux new, updated colour palette features our most comprehensive range of colours yet. You can even order A8 colour dulux trade colour chart direct from the app. Colour Palette has arrived More choice than ever Our new, dulux trade colour chart colour palette features our most comprehensive range of colours yet.
Seven beautiful collections coloour whites and off- whites, designed to work with a variety of interior building materials from timber and metal to stone and terracotta. | 2024-03-09T01:27:04.277712 | https://example.com/article/6739 |
Spectrum Dispatch
Lore
ID:
14087
Comments:
65
Date:
August 20th 2014
Observist Dark: Spider, Cathcart
Spider, Cathcart
Greetings, traveler, there are millions of sights to see in the universe. While the team at THEOBSERVIST is here to make sure you get the best traveling experience possible, the true traveler goes beyond the safe and secure into the wild and unpredictable edges of the universe. This is OBSERVISTDARK, chronicling the systems where safety is not guaranteed.
Today, we’re taking you to the ultimate den of thieves. The capital of crime. The nexus of the nefarious. That’s right, traveler, we’re heading to Cathcart system.
Adelaide Lorris discovered the jump point in the mid-25th century – at a time when she was a wanted fugitive. When she donated the jump data to the UNE, many speculated that she had been using the system to hide in and only revealed its location when other explorers were discovered scanning in the area. In a fascinating twist of events, she ended up naming the system after the highly reputed Marshal who would gun her down in 2464.
The UNE withheld claiming the system for some time due to the lack of … well … everything. Aside from some asteroids and smaller worldlets, the system boasts no planetary objects so there was nothing really to claim. The UNE didn’t really know what to do with the system and while the Navy initially proposed using it for an experimental inter-system long-range comm system, they ultimately abandoned the project.
For centuries, Cathcart slowly collected more and more garbage from the military, and then nearby corporations began using it as well. No one knows exactly when it happened, but also during that time, the system was slowly accruing something else: squatters.
In 2750, while tugging the fractured hull of a decommissioned ship, a young Navy pilot discovered something stunning. A manmade structure that’s known by one name throughout the Empire:
SPIDER
Built out of the bones of ships and old stations by fugitives, criminals and the impoverished, Spider can only be described as a mechanical world that is constantly changing and growing in both form and control. The groups that own and manage the landing zones on one visit might be replaced the next, but in this issue, we’re going to be talking about the only area where this intrepid explorer could gain access to.
NKZ
Probably the most mysterious of the landing zones in Spider. Whereas areas controlled by Fist & Nail and Dace Clan proudly wear their affiliation out in the open, no one really knows who controls NKZ, but the rules are made abundantly clear to whoever enters: leave your grudges on the landing bay. I would urge any would-be visitors not to test the locals’ resolve on this issue.
That’s right. NKZ is a place to do business if you don’t want to worry about getting shot through the back of your head. The peace is so well maintained that JOKERENTERPRISES even operates an ‘unofficial’ showroom here.
Landing in the hangar ominously named LIMBO, you could tell they were serious. Manned turrets will track your ship as it slowly descends and sets down on the landing pad. The attendant on duty won’t be particularly polite, but efficient as they transport your ship down to the temporary hangar.
Stepping into NKZ proper, you will be shocked at the variety of people inside. From Human to Xi’An, obviously wealthy to barely scraping by, it is a bizarre confluence of personalities. It won’t be that surprising that the largest gathering is at the local lounge. While the SPINWARDTOXINFARM sounds like the last place you would want to have a drink, the talented bar staff are quite the chemists when it comes to relaxing libations.
Before coming to NKZ, I had been told that a black market exists here, but sadly, I was unable to find it. Not to say that it doesn’t exist, though.
Again, it should be noted that traveling to Cathcart is, in itself, a dangerous proposition and travelers should take every precaution when attempting to visit Spider, but for those who still want to see a true marvel of Human innovation, no warning will deter. It’s one thing to hear me describe it; you really should observe it for yourself. | 2023-12-31T01:27:04.277712 | https://example.com/article/9163 |
Troy ancient city and Gallipoli Battlefield Tours are the two most popular touristical destinations of the area but however the guests has been offered with one of theese tours, Troy or Gallipoli. By organising this package we firstly plan to take you to troy where the first big battle of Dardanelles took place and then the next day to Gallipoli where the last big battle of the Dardanelles took place.
TOUR CODE
Troy-Gallipoli-Anzac Tours 2 Day
DEPART FROM
Guaranteed departure everyday from Istanbul
PICKUP LOCATION
Meet at hotel or Cruise Ship Port and Continue for the tour.Free pick-up just city center hotels
Day 106.00 - 06.30 Pick up from hotel in Taksim, Beşiktaş, Beyoğlu, Şişli, Ortaköy, Bebek
06.30 - 07:00 Pick up from hotel in Sultanahmet, Beyazıd, Sirkeci, Laleli, Aksaray
07.15 Pick up from hotel in Ataturk Airport Area
08.30 Have a stop for open buffet breakfast (Extra)
12.00 Arrive in Eceabat. Lunch on the roof of Grand Eceabat Hotel (Views Dardanelles)
12.45 Depart for Troy Tour
On our Troy tour you are going to hear about Helen and Paris love story Hector and Achilles duel and Trojan Horse story and then the archeological excavations then you will see the ancient site ruins of Troy.
On tour you will visit:On tour you will visit and hear about:The Trojan Horse which was used in the movie Troy-The Trojan Horse (Did it really exist ?)-Helen of Troy (Was she the real cause of the war ?)-The Trojan Wars-Battle between Achilles an Hector-The 3200 years old city walls of Troy VI and VII-The East gate of VI (VIP entrance of Troy VI)-The Temple of Athena-Walls of Troy II and Megaron House-Walls of Troy I (The oldest ruins of Troy)-The trench of Schliemann-The ramp of Troy II-The Scaean Gate-The Gate of Troy VI (Where possibly the tricky wooden horse was taken)-Sanctuary (Sacrificing Altars)-Roman Bath-Odeon (Music theatre)-South gate of Troy VI-Bouleuterion-Ruins of agora (Market place)17.00 End of the tour
17.30 Check in one of our hotelsMost of the travel agencies who organize tours to Gallipoli they only organize half day tours to see the Anzac sector but we plan to complete your pillgramage by showing north and the south sector. The south sector also known as cape helles region where mostly British French,Turks and some Anzac Soldiers Fought. Although the south Sector not much famous, most of the casualties during the Gallipoli Campaign occured here at the south sector. At the south sector beside the british French turkish graves you can also visit the forgotten Anzac Heroes Graves. So our aim to organize this tour to show equal respect to all the soldiers who lost their lives during the campaign.Day 207.30 Breakfast (Views Dardanelles)
08.30 Depart for Full Day Gallipoli tourDuring the Gallipoli Campaign, the aim of the soldiers were, after capturing the hills coming to narrows and getting the control of the castles and canon batteries. We starting our tour from the narrowiest point of Dardanelles, after having a quick look to get idea of the narrows we drive to landing beaches.
On tour you will visit:Kilitbahir Fortress-Turkish Canon Batteries-Achi Baba Hill (The main objective of British Forces)-Turkish Memorial-Morto Bay (S Beach)-French Cemetery-V Beach-V Beach Cemerey-Overlook to V Beach from Turkish Perspective-Cape Helles Memorial-Lancashire Landing Cemetery-Twelve Tree Copse Cemetery-Alcitepe Village-Gallipoli Epic Simulation Center-Back to the town Eceabat for the Lucnh. (Views Dardanelles)-Brighton Beach-Beach Cemetery-ANZAC Cove-Ariburnu Cemetery-ANZAC Commemorative Site-Mehmetcik Memorial Statue-Lone Pine Australian Memorial-Johnston's Jolly (Turkish and ANZAC trenches and tunnels)-Turkish 57. Infantry Regiment Cemetery-The Nek-Chunuk Bair New Zealand Memorial
17.30 End of the tour
18.00 Depart Back to Istanbul
20.30 Have a stop for break
23.00 Drop off to hotels in Istanbul | 2024-02-14T01:27:04.277712 | https://example.com/article/9619 |
Disclaimer:
I do not own any of the characters from Line of Fire. Copyright infringement
is definitely not my intention with the writing of this story.
Author's note:
This story is a one-shot that deals with only the FBI agents (sorry to all you
Malloy clan fans out there). Sampson and Van Doren are the stars of this little
ditty. Enjoy!
FBI Office (Morning)
Sampson rushed into the office, visibly frazzled by the hectic morning she'd
experienced at home.
"You okay?"
Van Doren asked as she approached her with a mug of hot coffee.
Smiling, she took
the mug. "One of those mornings. Hunter's home sick, says he has a stomach
ache but I'm not sure I believe him. Carl can't stay home with him and neither
can I so we ended up begging our neighbor to take him." Slumping down in
her chair, she breathed a heavy sigh.
"Remind me
not to have kids."
Shuffling some
papers on her desk, Sampson uncovered a manilla folder that contained the details
of a case she and Van Doren were working on. "We're going to talk to Mr.
McCarthy this morning, right?"
"You up for
it? I mean, if you want to chill out for a while I can go..."
"No. No. I'm
fine. Just give me ten minutes to clean up this shit-hole-of-a-desk and we'll
head out."
"Okay. I'll
be in the research room. There's a few things I want to check out. I'll meet
you outside in ten."
"Yup,"
Sampson replied without looking up.
Van Doren waited
out in the parking lot for Sampson, checking her watch periodically as she leaned
against their car.
Finally, Sampson
emerged from the building and was quickly walking towards her, cell phone to
her ear.
"No, I can't
and you know I can't. Carl! No! Listen, there's no discussing this right now
because there's nothing to discuss. I CANNOT leave. You'll have to call your
sister and have her watch him then." Van Doren climbed into the driver's
seat as Sampson climbed into the passenger's seat. "That's such bullshit.
Don't lay that kind of guilt on me because you know that's not true! Carl! Carl!
Geezuz!" Sampson turned the phone off and stuffed it into her pocket.
"More trouble
in paradise?" Van Doren asked hesitantly.
"I can't believe
he hung up on me." Sampson ran her hand through her hair as she tried to
calm down. "He basically said that I don't care about my own child because
I won't come home."
"Why does
he want you home?"
"The neighbor
had something come up and she can't watch Hunter now so Carl wants me to come
home. Heaven forbid HE come home to stay with him."
"Sounds like
a mess."
"Yeah, it
is. Carl keeps saying that I care more about my job than my family. He even
told me to just stay at work and don't come home."
"He said that?"
"I think we're
going to need marriage counseling pretty soon. It's getting to the point where
we're fighting all the time. I don't want my kids surrounded by that."
The remainder of
the ride was silent, both women lost in their own thoughts.
McCarthy Residence (Morning)
Van Doren pulled up to the curb in front of a house that was once white, dirt
and rot stained the wooden planks making it seem more like tan. The shutters
were falling off and some windows didn't have any at all. The yard was surrounded
by an equally dirty fence whos gate was swinging open and closed in the slight
wind.
The two women walked
up to the rickety porch and Sampson knocked on the door. When there was no answer
she knocked again. "Mr. McCarthy?"
The door slowly
opened and a middle-aged man appeared. "Can I help you?" His messy
appearance mocked the unkempt look of his home.
"I'm special
agent Van Doren and this is special agent Sampson, we're with the FBI. We'd
like to ask you a few questions about Lucy Henderson."
The man frowned.
"Who? I don't know who you're talking about."
"Can we discuss
this inside, sir?" Sampson asked.
McCarthy paused
for a moment as he contemplated his answer. "Fine. Fine," he said
as he backed away from the door.
Van Doren and Sampson
followed the man into the living room, neither wanted to sit because the furniture
was ripped and filthy.
"What's this
all about?" he asked as he sat down in his recliner chair.
"A little
girl named Lucy Henderson," Van Doren said as she handed him a small photo.
McCarthy looked
at the photo, squinting a bit. "I've never seen her before."
"Are you sure?"
Sampson asked. "Take another look."
"No, I'm sure
of it," he said, handing the photo back to Van Doren.
"Mr. McCarthy,
you worked for the Bennington Elementary School for almost ten years, is that
correct?" Sampson asked.
"Yes."
"And you were
let go in April of last year because you'd grabbed a little girl..."
"Now wait
a minute," he seethed as he stood up, "Those charges were dropped
because I did NOT touch that little girl."
"Right. It
just seems odd to me, Mr. McCarthy that the little girl who accused you is the
best friend of Lucy Henderson, and right now little Lucy is missing. You wouldn't
happen to know anything about that, would you?"
"This is ridiculous,"
McCarthy huffed as he blew past Sampson and Van Doren and headed to the kitchen.
"Get out of my house!"
They followed him
and watched as he opened the refrigerator door and reached in. Both kept a close
hand by their gun as he turned around, but in his hand was only a can of beer.
"I'm gonna
look around. Keep him busy," Van Doren whispered to Sampson. Moving away
from her, she looked at McCarthy. "I'll be right back, I just got paged
and need to make a phone call."
Before Sampson
could stop her, Van Doren disappeared down the hall.
McCarthy took another
swig of beer and looked at Sampson who stood in front of him, arms folded across
her chest. "Kenny.
Can I call you Kenny?"
"Sure."
"I know you
don't mean to hurt anyone, even Lucy, but..."
"I told you
I don't know her!"
Van Doren slowly
walked up the stairs, being careful not to let them creak too loudly. She
made her way to his bedroom and slipped inside.
Going through his
dresser, she found numerous photos of Lucy that had been taken from a distance
while she played at the school playground, played in her yard and rode her bike.
"Dammit," she swore under her breath as she kept looking for more
evidence, but before she could get any further she heard a gunshot from downstairs.
Then another. Then another. Her stomach dropped to her knees as she unholstered
her gun and ran downstairs. "Sampson!" she called out as she got to
the corner of the stairs, her heart beating against her chest like a jackhammer.
"McCarthy, wherever you are put your gun down NOW!"
Slowly, she eased
around the corner and checked the area. Finding it clear, she began walking
towards the kitchen. "McCarthy!" she called out again, but she was
met with only silence.
She got to the
doorway of the kitchen and took a deep breath before entering.
When she made her
entrance she wasn't prepared for the sight that greeted her. Sampson was lying
on the kitchen floor, unconscious, blood covered her lower torso and had begun
to pool around her on the tiled floor. In her right hand, she still clutched
her gun.
The back door was
wide open and had blood smears on it. Van Doren quickly raced over to it and
went out into the backyard to look for McCarthy.
Droplets of blood
stained the dirt indicating to her that Sampson had gotten a shot off before
he fled. The trail led to a gated fence and the gate was wide open. She took
note of the blood that covered the gate's handle.
McCarthy was long
gone.
Activating her
radio, Van Doren frantically went back inside to help her fallen friend. "This
is agent Van Doren. I have an agent down at 114 Maplewood Lane. I repeat, I
have an agent down at 114 Maplewood Lane, I need assistance and an ambulance
here YESTERDAY."
"Copy that
Van Doren. Paramedics have been dispatched and are on their way."
"Jennifer?"
she said softly as she knelt down beside her. Gasping at the sight of the blood
flowing from two bullet wounds in Sampson's abdomen, she called her name again.
"Jennifer, can you hear me?" Without hesitation, Van Doren placed
her hands over the wounds and applied pressure. Sampson let out a moan of pain
in her unconscious state and her face contorted. "Shhh, you're okay. You're
gonna be okay, just hold on. Help is coming." Van Doren had hoped to never
see this day, the day that she'd be tending to a wounded partner. She'd promised
herself she'd never let this day happen.
Erickson Memorial
Hospital - Emergency Room (Morning)
"Where is she?" Carl asked Lisa as he barged into the emergency room
waiting area.
"Carl, take
it easy, they're prepping her for surgery right now."
"Surgery?!?
What? What the hell happened?" Looking to his left, he saw Paige coming
through a set of doors. "Paige! What happened?" he asked, rushing
towards her. "Someone called me and said that Jennifer got hurt, Lisa's
telling me they're prepping her for surgery, what the hell is going on?!?"
Then he noticed the blood on her shirt. "Oh my God. Wh...what the..."
His head began to spin and he felt sick.
"Here, why
don't you sit." Van Doren helped him sit before he fainted.
"I'll get
him some water," Lisa said as she watched Van Doren take control of the
situation.
"Jennifer
and I were out interviewing a suspect today and she was shot." Van Doren
didn't feel the need to beat around the bush.
Carl felt a huge
lump lodge in his throat. "Sh-shot?" he stuttered with fear.
"They're doing
everything they can for her. She'll be okay."
Putting his head
in his hands, he began to cry. Van Doren did her best to comfort him while they
waited. Jennifer had never been shot before and he prayed every day she left
the house that she'd come home to him without a scratch. He hated her job and
today was yet another reason why.
Six hours had passed and a doctor approached the small group. "Family members
for Jennifer Sampson?"
"I...I'm her
husband," Carl said as he stood up. His legs felt like jelly and he did
his best not to let anyone notice what a nervous wreck he was.
"She's going
to be fine, but she's gonna have to take it easy for a while. One bullet penetrated
clean through her side, but the other bullet nicked her spleen. We had to remove
it. She's lost alot of blood and is very weak. We have her recovering in I.C.U.
and will probably keep her there through the night. You can see her if you'd
like, but only for a few minutes."
Carl looked at
Van Doren as if to get permission. She simply nodded that it was okay, giving
him the strength to follow the doctor.
The smell of the
medicines and cleaners turned Carl's stomach, but he focused his thoughts on
blocking the smells from his mind and turned his attention to the motionless
figure lying in the bed.
"Just a few
minutes," the doctor said softly as he held the door open for him.
Carl stepped in,
swallowing hard as he took in the sight. Jennifer was always tough-as-nails
and it never ceased to amaze him how she'd taken down criminals twice her size
with ease, and yet here she was, lying in a hospital bed, pale faced, two holes
in her stomach, one in her back, and wires and machines hooked up to her as
if she were robotic. This didn't look like his Jennifer.
Gently taking her
hand, he began to sob. "I'm sorry, Jen. I'm so sorry that I said those
things this morning. I don't blame you if you hate me, I deserve it."
He sat with her
for a few more minutes before the doctor poked his head in. "Mr. Sampson,
we better let her rest."
"Okay,"
he replied softly. He kissed her forehead and left the room. How was he going
to explain this to the kids when he couldn't even handle it for himself.
Erickson
Memorial Hospital - Sampson's Room (Morning)
The next morning, Sampson had been moved to her own room. Van Doren waited outside
as they got her settled. All night she'd thought of the various ways to apologize
but no words seemed to be enough.
The nurse came
out of the room. "You can go in now."
"Thank you."
Van Doren entered the room, taking a deep breath as she walked over to the side
of the bed.
"You okay?"
Sampson asked weakly in a barely audible voice.
"I...I'm fine."
She responded, a little surprised by the question.
"Good. Th-thought
maybe he....he got you too."
"I'm sorry
about leaving you alone with him. I never should have..."
"...'s okay."
Van Doren shook
her head because she felt at fault in every way.
The door opened
and Lisa stepped inside. "Van Doren?"
"Ma'am."
"Hi, Jennifer.
You okay?"
"Yeah,"
she replied softly.
Lisa turned her
attention back to Van Doren. "Can I see you outside?"
"Yes, Ma'am."
"I'll be right
back," Lisa said to Sampson as she followed Van Doren out into the hall.
Van Doren crossed
her arms over her chest, reading herself for the verbal assault.
"What the
hell are you doing? Did I not tell you yesterday that when Sampson woke up I
was the first one to talk to her? Do you not remember me telling you that?"
"I'm sorry,
Ma'am, but I just wanted to tell her I was sorry. I..."
"When I give
you an order you're to follow it, understand?"
"Yes, Ma'am."
"In order
to conduct a clean investigation I can't have you and Sampson talking about
the incident before I do."
"We didn't
discuss any of it."
Lisa put her hands
on her hips. "Okay. Why don't you go back to the office while we get Sampson's
statement."
"Yes, Ma'am."
Van Doren chose not to protest, it was useless to do so, especially with Lisa.
Lisa returned to
Sampson's room, smiling as she took a seat by the bed, pulling out her small,
black notebook. "I'm sorry to have to do this now, but we need to make
sure we have all the facts."
Sampson nodded
weakly as her eyes struggled to stay open. The pain medication clogged her mind
and she fought to cut through it.
"We'll take
it slow, okay? Just tell me what happened in McCarthy's kitchen after Van Doren
left to search the house."
Sampson swallowed
to coat her dry throat before speaking. "I tried to gain his trust...pretended
to understand him. He...he kept drinking beer after beer. Must have had about
four in about five minutes time." Sampson stopped speaking as a flash of
pain erupted in her belly.
"Sampson?
You okay?" Lisa got to her feet as a rush of panic washed consumed her.
"It'll pass,"
she answered through gritted teeth. Doing her best to take a deep breath, she
let it out slowly as the pain subsided.
"Sure you're
okay?"
Sampson nodded
as she bit her bottom lip. "I...I asked him to stop drinking. He got mad...said
it was none of my business. He started getting hostile. I asked him to sit down.
Next thing I knew, he had a gun. Pulled it out of a drawer." Sampson closed
her eyes and prepared herself to continue telling her story. "He shot me
before I could get my gun. I fell to the floor, felt it go all the way through.
Shot me again." She paused for a few moments to gather her strength. "I
pulled out my gun and shot him in the shoulder. He ran out the door. That's
all I remember."
Lisa scribbled
some notes in her notebook and then looked at Sampson who wore a slight grimace
of pain on her face. "Why did Van Doren decide to search the house alone?"
"Don't know."
"Did you discuss
it with her?"
"No. She told
me she was going to...when....when we were in the kitchen."
Lisa nodded. Van
Doren had told her the same thing in her statement but it didn't make it right.
"Okay. I think this is enough. Get some rest and feel better, okay?"
Sampson smiled,
"Yes, Ma'am."
"We'll catch
him, Jennifer. You can count on it."
"Thank you,"
she said softly as her eyelids closed and she drifted off to sleep.
Sampson
Residence (Morning)
The doorbell rang and Carl came to answer the door. "Paige."
"Hi, Carl."
"Listen, umm,
I'm actually on my way to the hospital. The kids are staying home today and
I'm taking them up with me."
"Sure. Sure,
I understand. I just wanted to come over and see if you needed anything."
Hunter ran across
the room and latched onto Carl's leg.
"Easy there,
buddy," Carl said to him as he patted his head.
"Hey, Hunter."
"Hi,"
he replied, clinging onto his father.
"I think we're
going to be okay," Carl said as he reached down and picked Hunter up.
"Please don't
hesitate to call me if you need anything."
"Thanks, Paige.
I appreciate it."
Paige smiled and
returned to her car.
Carl rounded the
kids up and grabbed a duffel bag full of Jennifer's clothes. "Okay, gang
let's get going." The kids ran out to the car and Carl trailed behind them.
Erickson
Memorial Hospital - Sampson's Room (Morning)
When they arrived at the hospital, Carl decided it was best if they all went
in together before he spoke to Jennifer alone. They entered the room and the
children immediately latched onto their father, scared at the sight of their
injured mother.
"Mom,"
Hunter sobbed as he clenched the fabric of Carl's pants.
Jennifer's eyes
opened slowly. Tears began to roll down her cheeks as she saw her children.
"My babies," she whispered, extending her hand towards them.
Carl walked them
closer, feeling them holding onto him tighter with each step. "It's okay
you guys, your Mom's gonna be fine."
Hunter reached
out for his mother's hand and attempted to get up onto the bed with her. "You
can't, sweetie. Mommie's hurt." Jennifer looked at Carl. "Did you
tell them?"
Carl looked down
towards the floor and shook his head.
"Carl."
"What happened,
Mom?" her daughter asked with a confused look on her face.
Jennifer stroked
Hunter's hair as he stood by her side. "A bad man hurt me. He shot me in
the stomach. That's why you can't get up here with me. Maybe in a few days,
okay?"
"Someone shot
you?" her daughter exclaimed.
"Mmmhmm."
Jennifer shifted to get comfortable and grimaced as the movement jarred her
wounds.
"Did they
catch him?"
"No. Not yet."
"Why not?
What if he comes back? What if he comes to the house?"
Carl hugged her
and brought her close. "Shh, that's not going to happen." Carl looked
at Jennifer. "See, that's why I didn't want to tell them. I didn't want
to frighten them."
"You can't
lie to them."
"Are you okay,
Mom?" Hunter asked.
"I'll be okay
in a while."
"When are
you coming home?"
"Not for a
little while I'm afraid."
"But I want
you to come home now. Why can't you come home now."
"Hunter, sweetie
I wish I could. But I need to stay here until my wounds heal up a little, then
I can come home."
"Come on,
you two. Let's let your mom rest. She and I need to talk for a few minutes so
I'll bring you out to the nurse's station. Okay?"
"Okay,"
they said in unison.
"I love you."
"We love you
too, Mom."
Carl brought the
kids out to the waiting area and had one of the nurses keep an eye on them.
He returned to the room and took a seat in the chair by the bed.
"What?"
she asked, trying to read the expression on his face.
"Why do they
insist on partnering you up with a rookie? She almost got you killed!"
In a way he was
right, Van Doren did have a habit of getting her in a few jams. "It was
a freak thing..."
"Bullshit,
Jen."
"There was
no way to know he had a gun." Jennifer's breathing began to quicken, causing
the heart monitor to beep a little faster. "I knew the risks when I took
this damn job." Sweat began to bead up on her forehead and her face started
turning red.
"Jen, calm
down. We shouldn't be talking about this now. I'm sorry for bringing it up."
"What's going
on in here?" a nurse yelled as she entered the room and rushed to Jennifer's
side to check her vitals.
"We were..."
"Out!"
she instructed him. "She's just had major surgery and she shouldn't be
all worked up like this. Out, now!"
"Honey, I'll
be back later to check on you." Carl left the room, kicking himself mentally.
The nurse injected
the I.V. bag with more medication. "Here, this should help you settle yourself
down. Lemme guess, husband?"
"Yeah."
"Figures,
they're all the same aren't they. Now you just relax and don't you worry about
anything other than getting better. Okay?"
Jennifer nodded
slowly as she felt the medication snaking it's way through her veins. Within
a few minutes she was fast asleep.
FBI Office
(Morning)
"Any leads on McCarthy's whereabouts?" Lisa asked as she approached
Van Doren's desk. She and Stevens were going over the case.
"Nothing yet.
We've got alerts out to the area hospitals. He's gonna have to get some help
somewhere."
"Sampson said
she hit him once, in the shoulder. Sweep some of our underground doctors too,
in case he makes an appearance there as well."
"Yes, Ma'am."
"Van Doren,
can I see you for a minute in my office?"
Van Doren looked
at Stevens and then looked back at Lisa. "Sure."
Van Doren closed
the door behind her and stood in front of Lisa's desk.
"Have a seat."
She sat down and
put her hands on her lap, trying to to show her nervousness.
"As you know,
I talked to Sampson this morning. She was unsure why you decided to go off on
your own. You mind explaining that to me?"
"Sampson and
I were talking to McCarthy in the kitchen, it appeared like everything was under
control. I said that I needed to go make a phone call and I slipped upstairs
to search his bedroom."
"But what
if he had someone hiding under the bed, ready to gun you down? What if he ended
up catching you going through his things? We had no warrant to search his home."
"I wouldn't
have found those photos if I hadn't gone up there."
"Obviously,
but the fact that you went up there without permission is what troubles me.
That and the fact you left your partner alone with a violent suspect."
"Neither one
of us knew that that would happen."
"Oh, so now
you're speaking for Sampson and how she feels?"
"No, Ma'am
I'm just saying that it didn't appear that he was a threat."
"Nothing is
EVER what it seems, Van Doren. You get that through your head right now. The
X-Files pinned it perfectly, trust no one. Even the little old lady on the corner
with a bag in her hand can't be assumed as innocent. For all we know she's got
a 9mm in there. It may seem outrageous to think that way, but we need to be
a little outrageous in this business."
"Yes, Ma'am."
"Now, we're
going to have to do a little cleaning up with this story in order to make it
not fall to shit. So, you found those photos after Sampson was shot. Because
he had attempted to murder an agent we had the right to search his place. That's
when you found the photos. Right?"
"Yes, Ma'am."
"It would
be in your best interest to keep this to yourself. Understood?"
"I understand."
"I thought
it over alot last night and this morning and I've decided to take you off this
case. I'm giving it to McArthur and Stevens."
"But..."
"You need
to sit this one out, for various reasons."
"If I may
ask, what reasons are those?"
"For starters,
your partner is lying in a hospital bed with two bullet wounds. Secondly, you
fucked up, to be perfectly blunt. Thirdly, because of reasons one and two, I
need your 100%, undivided attention on this one and I'm not convinced you can
give that to me right now."
"I beg to
differ, Ma'am."
"And you're
entitled to, but I've made my decision. Hand over your case files to Stevens
or McArthur when you return to your desk. That's all."
"Yes, Ma'am."
Van Doren stood up and left the office, feeling as if she'd been kicked in the
gut.
"Everything
okay?" Stevens asked as Van Doren returned to her desk and closed up her
files, handing them over to him.
"Looks like
you and McArthur are taking over. I'm on the side lines for this one."
"What?!?"
"Agent Cohen's
orders," she said as she walked away and headed for the parking lot.
Erickson Memorial Hospital - Sampson's Room (Afternoon)
Van Doren entered Sampson's room with a good-sized bouquet of flowers. "Hi,"
she said as she walked towards the nightstand, placing them by the edge.
"They're beautiful,
thank you."
"Feeling any
better?"
"A little,"
Sampson said with a sigh. "Just wish I could get the hell out of this place.
I hate hospitals."
"I know what
you mean, they kinda give me creeps too."
"Carl came
by with the kids this morning. He didn't tell them what happened to me."
Van Doren thought
for a moment, glad that she hadn't said anything in front of Hunter when she'd
seen him earlier. "Really?"
"I told him
not to lie to them. Of course he got mad. He just doesn't want to have anything
to do with my job anymore." Sampson absently rubbed her sore belly. "He
used to give me so much encouragement and now it's like he wants me to find
another job."
"Has he asked
you to quit?"
"No. It hasn't
come to that yet. He's implied it plenty of times though."
Silence hung in
the air for a few minutes while Van Doren pushed herself to tell Sampson about
the case. "Just, um so you hear it from me first, Lisa's taken me off the
case."
Sampson figured
as much but acted surprised. "What?"
"She gave
it to Stevens and McArthur."
"I'm sorry,
Paige."
"You're sorry?
You're the last person that needs to be sorry." Tears welled up in Van
Doren's eyes and rolled down her cheeks. "I didn't think before I acted
and because of it you're lying here. It was extremely selfish of me, in a way."
The ring of Van Doren's cell phone broke though the conversation. "Excuse
me one sec," she said as she answered the phone. "Van Doren. Yeah.
What? Why are you telling me this? Okay, okay. Thanks, I REALLY appreciate it."
She hung up and snapped the phone closed.
"Everything
okay?"
"Yeah. I gutta
go. I'm sorry to dump all this on you and then run, but I'll try and come back
tonight, okay?"
Sampson smiled
at her. "Okay."
"I'll see
ya."
728 Waterbury
Avenue (Afternoon)
Van Doren pulled
up to the residence behind Stevens and McArthur's car and quickly got out. Both
men were standing by the front walk, ready to approach the house.
"We thought
we'd wait for you," Stevens said to her.
"I hope Cohen
doesn't find out you two told me about this or she'll have all of our asses."
"I know all
too well what it's like to see your partner get shot, so the least I could do
is help you out." Amiel yanked on the lapel of his jacket and headed up
the walkway.
Stevens stood on
one side of the yard and Van Doren stood on the other, both looking into the
backyard to make sure no one escaped out the back.
McArthur rang the
doorbell and waited for someone to come to the door. Finally, an elderly gentleman
appeared. "Sir, I'm Agent McArthur with the FBI, I need to ask you some
questions about a Kenneth McCarthy."
The man frowned
for a moment as he got lost in thought, then he opened the door wider so McArthur
could enter. Van Doren and Stevens followed behind McArthur as they walked into
the home. Van Doren shook off the flashbacks of the previous day and focused
on her task.
"We had a
report of Mr. McCarthy having come here this morning, is that true?" McArthur
asked the man.
"Normally
I would say that I have no idea what you're talking about, but in this case
I'm going to help you, you're lucky. Follow me."
"Sir,"
McArthur said as he reached out and grabbed the man's arm, stopping him from
continuing. "Is he here right now?"
"Oh heavens
no. He left about an hour ago. Follow me."
They followed the
man into the basement where they saw the room in shambles. Medical supplies
were scattered and broken all over the floor. "That bastard came to me
for help, and I helped him, but then he did this. Then he hit me." The
man turned his head towards them so they could get a better look at the darkening
bruise by his eye.
"How did he
know to come here?" Stevens asked.
"A friend
of his told him to come here. I can't say who, of course. But he just showed
up here, unannounced, and held a gun to my head, forcing me to help him. If
it wasn't for the gun I would have told him to take a flying fuck for himself."
The man tried to pick up a few items from the floor to restore the order to
the room, but it seemed useless. "He's in alot of trouble isn't he?"
"He's wanted
for the attempted murder of a federal agent, my partner," Van Doren stated
flatly. "Do you know where he went?"
"Not sure,
I was just glad that he left." He sat down on a nearby stool, wiping his
brow with a handkerchief. "I'm too old for this shit."
Van Doren crouched
down in front of him. "I realize that you're just trying to help people
but what you're doing is illegal."
"I know. I
know. I never meant to break the law, I just feel bad when people are in pain
and if I know how to help them I can't refuse my help to them. They're almost
like company for me. Ever since my wife died a few years ago I've been alone.
I don't have any family left so I guess I welcomed the company."
Van Doren felt
sorry for the man even though she knew she shouldn't.
"Your partner,
is he going to be okay?"
"She. She's
going to be fine."
"Oh dear Lord,
he shot a woman!"
"She's a wife
and mother of two," Van Doren added, trying to buy more sympathy.
The man shook his
head and got up from his chair, fists clenched by his sides. "I'm going
to make a few phone calls and see if I can track him down. He shouldn't get
away with this, the little bastard. Would any of you like some coffee or a soda
while you wait?"
"No thank
you, sir," Stevens replied as they followed him back upstairs.
Erickson Memorial
Hospital - Sampson's Room (Night)
Van Doren entered
the room quietly in case Sampson was sleeping, but she found her staring out
the window, her right hand over her wounded side.
"Hey there."
"Hey,"
Sampson replied softly as she turned to look at her.
"Everything
okay? You in a lot of pain? Want me to get the nurse?"
"No, I'm fine,
just thinking."
"Uh oh, we
can't have that," Van Doren joked as she pulled up a chair and sat down.
"I've just
been thinking that maybe Carl's right. I mean, what if I died."
"Jennifer!
Don't talk like that."
"Seriously,
Paige, what if I get killed on the job. Who's gonna take care of my kids? Carl
can't do it alone, and I don't want another woman taking care of MY children."
Van Doren reached
over and rubbed Sampson's arm to comfort her. "I think the drugs they're
giving you are playing with your mind. You LOVE this job, and you know it. It's
something you were meant to do and you're damn good at it."
Sampson smiled.
"But..."
"This isn't
something you need to be worrying about right now. Please? Stop thinking about
it. You'll only drive yourself crazy."
"Yeah, I guess
you're right."
"Listen, I
think we're on the right track in finding McCarthy."
"Wait, I thought
you were off the case?"
"I am...sort
of. McArthur and Stevens have been keeping me in the loop. DON'T YOU DARE tell
Lisa or she'll have my ass. When I left earlier, I met up with them at a doctor's
house. He patched McCarthy up and McCarthy roughed him up and basically trashed
his set up. When I told him about you he helped us out by calling some of his
contacts. We have a couple of leads that we're following up on." Van Doren
glanced at her watch. "I'm on stake out in about a half hour."
"Don't do
this. Do it by the book. Let McArthur and Stevens handle it."
"I NEED to
do this. I need to make it right."
"Lisa's gonna
find out and you're gonna be on the unemployment line."
"Well, if
that's what it takes to nail the son-of-a-bitch that put you here then so be
it."
"I better
get going. I'll keep you posted. And we'll just keep this between you and me,
okay?"
"Okay,"
Sampson nodded.
"Sleep tight,"
Van Doren said as she exited the room.
"Be careful,"
Sampson whispered.
Star Motel (Night)
McCarthy went up
to his room, ignoring the sounds of crying children coming from the surrounding
rooms and domestic disputes being broadcast for the world to hear.
Closing the door
behind him, he set his case of beer down on the bed and sat down. Opening the
case, he took one out, cracked it open and began chugging it down.
Grabbing the remote,
he turned on the TV and listened to the newswoman reporting the local and national
news.
"In other
news tonight, an FBI agent is on the mend after being shot during the questioning
of a suspect yesterday on Maplewood Lane. Agent Jennifer Sampson was shot twice
in the abdomen by suspected child kidnapper Kenneth McCarthy. She was taken
to Erickson Memorial Hospital where she's listed in good condition."
"McCarthy
is wanted for the attempted murder of Agent Sampson and is wanted for questioning
in the kidnapping of Lucy Henderson. He's considered armed and dangerous. If
you see Mr. McCarthy, please contact the local authorities immediately."
McCarthy switched
off the TV and threw the remote across the room, angry that they'd shown his
photo on TV. "Dammit!" he mumbled, banging on the sides of his head
with his fists. "It wasn't supposed to be like this."
330 Park Way
(Night)
Van Doren sipped
her cold coffee, frowning at the taste. She'd been sitting in her car watching
the front door of a pool hall for almost three hours and it was beginning to
tire her.
Yawning, she looked
at her watch and tried to get comfortable for a long night ahead of her.
Star Motel (Night)
Stevens and McArthur
arrived at the motel as quickly as possible.
"Room 332,"
the desk clerk told them. They
both ran upstairs as if their pants were on fire.
They took their
positions on either side of the door. Stevens knocked lightly. "Hello?
Sir?"
"Go away!"
McCarthy yelled.
"Sir? Have
you seen my cat? My wife's nagging at me to ask the neighbors and she's not
gonna..."
"I haven't
seen your damn cat now shut the hell up and go away!"
Stevens shook his
head and shrugged his shoulders.
"Try again,"
McArthur whispered.
"Please, sir.
If I show you a picture maybe you've seen her?"
Silence on the
other side of the door made the two men wonder what he was up to.
"I'm kicking
it in," McArthur whispered as he stepped back and lunged at the door with
his foot. The door flew open and both men entered the room, guns drawn. "FBI!
Don't move!" But the room was empty and the window was wide open.
"Shit!"
Stevens swore as he walked over to the window. "Son-of-a-bitch!"
"Don't worry,
we'll get him. We're too close now."
Erickson Memorial
Hospital (Night)
Sampson slept the
night away, lost in the haze of pain medication that pumped through her veins.
But suddenly the pain in her stomach intensified, waking her up.
"Wake up!"
McCarthy whispered to her as he squeezed her injured side.
"Ugh!!"
Sampson attempted to scream before his other hand found it's way over her mouth,
muffling her cries.
"Shhh, we
don't want to cause some unnecessary attention, now do we? Not like the shit
that's all over the news about me!" Sampson wrapped her hands around his
wrist, trying to get his hand away from her side, but he was too strong for
her in her weakened state. "Tell your friends that they have the wrong
guy. You tell them to back off!"
"Mmmph,"
she cried as she felt the warm trickle of blood run down her side. His roughness
popped her stitches and allowed the wounds to bleed freely.
"Tell me you'll
tell them to back off!"
Sampson reached
under her blanket and felt around for the nurse's call button. Finding it, she
pressed it several times.
"I'm gonna
take my hand away..."
"What the
hell?" a nurse exclaimed as she rushed into the room.
"You bitch!"
he yelled as he looked at Sampson, figuring out what she had done. Reaching
behind his back, he pulled out a gun and put it to Sampson's head. "You,
over here," he said to the nurse who was now putting her hands in the air.
"Come over here, that's right."
Sampson struggled
to remain conscious as the pain began to eat away at her.
"Get over
here and get her dressed. We're leaving."
"You can't
take her out of here, she's..."
"Shut up!"
he snapped through a clenched jaw. "Get over here, now!"
The nurse walked
over to the side of the bed and got some clothes out of Sampson's duffle bag
and began getting her dressed. "Oh, sweetie," the nurse whispered
as she saw the blood that had seeped through her gown. "She's torn her
stitches. I can't..."
"Fix 'em!"
"I don't have
the supplies in here."
"Use what
you do have and let's go," McCarthy instructed as he waved the gun at her.
The nurse opened
a cabinet and pulled out a package of gauze and a roll of tape. She carefully
took off the old bandaging and pressed some clean gauze to the wounds. "Hold
that there for a minute, sweetie." Sampson clutched the wounds as she tried
to steady her breathing through the pain. After a moment, she moved Sampson's
hands away and took the gauze, throwing it in the trash can. She put on more
gauze and taped it in place. "There. That'll have to do."
"Okay. Okay,
enough of this shit, let's get going!"
The nurse finished
getting Sampson dressed. "What are you gonna do about her medications?"
"Too bad,
that's not my problem."
"The woman
is in pain, she NEEDS medication. Once I unhook her from this I.V. she'll be
in agony in about fifteen minutes."
McCarthy paced
back and forth trying to think. "You're coming with us then. Bring medication
with you."
"All I've
got is what's here. I don't have authorization to get more med..."
McCarthy pointed
the gun at the woman. "Fuck it then. Let's go!"
"We're gonna
need a wheelchair. There's one right outside the door."
"Then get
it. No funny business either! I'm watching you!"
The nurse opened
the door and retrieved the wheel chair, quickly wheeling it over to the bed.
"Okay, honey, easy does it." Sampson got to her feet with the nurse's
help, stifling her cries of pain as best as possible. "Let's get you seated...eeeeeasy."
With a grunt of pain Sampson shut her eyes as she sat down in the chair. The
nurse unhooked the I.V. bag from it's hook and put it in Sampson's lap.
"We ready
now for Chrisakes?"
The nurse began
wheeling Sampson out into the deserted hallway. "We need to go left and
take the freight elevator or else someone's gonna see us."
"You better
not pull any shit on me," McCarthy said as he got closer to the nurse,
digging the gun into her ribs.
"No tricks,
honest."
They walked to
the end of the hall and got into the elevator. "You doing okay there, honey?"
Sampson nodded
weakly, trying to keep from pitching forward.
The elevator came
to a stop. "You have a car?"
"Yeah."
"Good, that's
where we're going right now."
The nurse headed
to the parking garage and brought Sampson and McCarthy to her car.
"Gimmie the
keys!"
"I'm not giving
you the damn keys. I just bought this car and..."
"Give me the
fuckin' keys!" he screamed as he cocked the hammer back on the gun and
aimed it at her head.
"Alright!
Alright!" The nurse handed him the keys and he went around to the driver's
side.
"Get her in
the car and get out of here."
The nurse loaded
Sampson into the car and no sooner had she shut the car door McCarthy peeled
away. Without hesitation, she ran inside to call the police.
Van Doren's
Apartment (Morning)
The phone rang
and Van Doren huffed in frustration. She still hadn't gotten used to being on
call all of the time and hated getting phone calls in the middle of the night.
"Hello?"
"It's Stevens.
Meet me at the office as fast as you can get here. McCarthy's got Sampson."
"What?!?"
she exclaimed, now fully awake from the news.
"Just get
here!"
Hanging up the
phone, she raced to get dressed.
Unknown location
(Morning)
Sampson woke up
to a burning, throbbing pain that made her curl up in a ball. Hugging her midsection,
she desperately wanted the pain to stop.
"Aw, what's
the matter? Does it hurt?" McCarthy taunted.
Sampson rolled
her eyes over in the direction of the voice and saw him sitting in a chair drinking
beer. Beside him on the floor was a large burlap bag that was tied up with duct
tape.
"Have one
of these and the pain will melt away." Laughing, he threw a can of beer
at her, hitting her in the leg.
"What do you
want?" she asked. The words barely made it out, her throat was so dry.
"I just want
you to spend some time in my world. Just the three of us."
"Three?"
"Yep,"
he said, patting the bag next to him.
FBI Office (Morning)
"We've got
a hit!" Stevens yelled to Van Doren, McArthur and Cohen who were standing
by a map of the city. He rushed over to them with a slip of paper in his hand.
"The nurse had LoJack installed on her car. The police just traced it to
an old abandoned warehouse downtown."
"I have to
hand it to you. You and your partner were right. I did know Lucy." McCarthy
tossed the empty beer can at Sampson and grabbed another from the case lying
by his feet. "She was a beautiful girl, but a little stuck up. You know
those stuck up, prissy little girls who think they're so much better than everyone
else." He chugged some of the beer and wiped his mouth with the sleeve
of his shirt. "What am I saying? I bet you were probably one of those girls,
huh?"
Sampson's eyelids
felt like heavy cement. She wanted desperately to sleep, but she was too afraid
of what he might do.
He finished off
the beer and tossed the can at her. Standing up, he nearly fell over because
he was so drunk. She could smell the alcohol from where she lay.
Taking out his
gun, he aimed it at her, causing her to flinch. "Bang!" he yelled
and then laughed. "Bang!" he yelled again, but this time he mistakenly
pulled the trigger. The bullet hit the floor by Sampson's knee, just missing
her. "Oops."
"Put the gun
down," she asked, afraid he might not miss the next time around.
"Huh?"
"Put the gun
down," she asked a little louder.
"Honey, I
ain't doing shit. You barged into my home and said all these bad things about
me! You made...you made me feel bad about myself, and I HATE that! That's why
I shot you. You had to know that I didn't like what you said." He aimed
the gun at her again. "Then you shot me. You fuckin' SHOT ME!"
Just as he'd gotten
the last word out, Sampson closed her eyes just as a shot rang out. She waited
for the introduction of more pain but she didn't feel it. Opening her eyes slowly,
she saw McCarthy lying on the floor in a pool of blood and her fellow agents
rushing into the room.
Van Doren held
her gun on him as Stevens kicked the gun away from McCarthy's grasp. "Good
work, Van Doren," he said to her as he checked McCarthy for a pulse. Finding
none, he shook his head.
"Get the paramedics
in here now!" Lisa screamed across the room. "Sampson? Can you hear
me? We're gonna get you out of here, it's over, okay?"
Sampson nodded
and passed out.
"Ma'am,"
Stevens said to Lisa as he and McArthur had opened the burlap bag beside McCarthy's
chair.
"Aw, Geezus,"
she sighed as she looked at the body of Lucy Henderson.
Psychiatrist's
Office - Three weeks later (Afternoon)
Sampson sat in
the office, silent.
"It helps
if you talk to me, that's why you're here. I can't help you if you won't talk,"
the doctor pointed out to her.
"I know,"
she said as she put her head down for a moment. "It's just that I didn't
ask to come here, they're making me come here. I don't know what to say. I don't
know what to tell you. I don't know what you want to hear."
"I just want
to know how you feel. You were shot and kidnapped. That has to have some sort
of effect on you."
"I'm...I'm
fine. My physical therapy is going well and I'm going back to work on desk duty
next week, and..."
"I don't mean
how you're feeling physically, I mean emotionally."
Sampson paused
for a moment to gather her thoughts. "When I first got shot I immediately
thought of my kids, and that they were going to have to attend my funeral."
She laughed and shook her head. "I thought I was going to die. Just the
pain itself made me believe it was over, then when I saw the blood I got scared."
Wiping a tear from
her eye, she continued. "Laying in a hospital bed allows you alot of time
to think. At first I thought I was going to turn in my badge and gun and I'd
wash my hands of this job, but the more I thought about it the more I started
to change my mind. It may sound selfish to everyone around me, including my
husband, but I love this job. It's what I've always wanted to do and I'm damn
good at it. And I decided that I'm not quitting it for anyone. If someday down
the road I decide that I'VE had enough, then I'll quit. But I'm not gonna let
what happened to me stop me from doing what I love."
"So your husband
disagrees with you I take it?"
"That's a
light way of putting it. We're actually going through some marriage counseling.
He's having a hard time dealing with what happened to me and it's taken a toll
on our marriage."
"I see."
Sampson looked
at her watch. "Um, are we done? I need to get my son from school."
"Yes, of course.
Thank you for opening up. I hope it helped."
"Yes. Yes,
it did."
Sampson shook the
doctor's hand and left the office.
EPILOGUE
Van Doren had also
been asked to speak with a psychiatrist about the shooting. Even though she
hadn't taken a bullet, she was still dealing with her own demons from the incident.
Sampson returned
to work, trying her best to make it through desk duty. It took a while, but
eventually she made it back into the field where she belonged.
The author would like to thank you for your continued support. Your review has been posted. | 2023-11-26T01:27:04.277712 | https://example.com/article/8754 |
Samichlaus Classic
Doppelbock
Samichlaus Classic
The once strongest beer in the world is back ! Brewed only once a year on December 6. Samichlaus is aged for 10 months before bottling. This beer is perhaps the rarest in the world. Samichlaus may be aged for many years to come. Older vintages become more complex with a creamy warming finish. Serve with hardy robust dishes and desserts, particulary with chocolates, or as an after dinner drink by itself. Brewed under the exclusive licence of Feldschlösschen-Hürlimann-Holding, Switzerland. | 2024-05-08T01:27:04.277712 | https://example.com/article/8698 |
Pages
Saturday, September 26, 2015
Quiet Saturdays - Potatoes and Cauliflower Mash
I've heard that weekends alone are sad and well, lonely, but then I wouldn't be able to make dishes like this. Mushy leftover cauliflower turns into tender bits of garlicky contrast in mashed potatoes. The massive California drought (and the cost of air conditioning) encourages a reduction in the amount of water boiled. The combined result is simple, quick and delicious, with enough leftover for tomorrow. Substitute olive oil for butter to make this vegan. Enjoy your weekend!
Cauliflower
Inspired by my mother, who can handle 4 burners at once when making dinner 0.o
Ingredients
1 head cauliflower
1-2 cloves garlic
1-2 tbsp olive/cooking oil
1/2-1 cup water
1 tsp salt (to taste)
Directions
1. Mince the garlic finely and drop at the bottom of a large saucepan. Add the oil and turn the fire to low, stirring the garlic occasionally.
2. Split and chop the cauliflower into bite-sized pieces. When the garlic turns golden-brown, add the cauliflower pieces and toss to cover with oil.
3. When the cauliflower begins to brown, about 5 minutes later, add enough water to cover the bottom of the pan. Allow to steam until the cauliflower is tender, around 10 minutes. Enjoy it freshly cooked! This recipe works better with leftover cauliflower that's already a bit too soft, and only uses about a third* of the cauliflower anyway.
Potatoes
Inspired by being a cheap grad student...
Ingredients
2 Yukon gold or other potatoes for mashing**
1/2 - 1 cup water
About a third of the leftover cauliflower
1-2 tbsp butter (olive oil works well here, too)
1/2 tsp salt (to taste)
1/2 tsp black pepper (to taste)
Directions
1. Peel and chop the potatoes. Place them into a saucepan, adding just enough water to cover the potatoes. Boil for 15 minutes, or until the potatoes are soft. Poke them with a fork if uncertain.
2. Once the potatoes are done, add your leftover cauliflower and allow to boil again. As you stir, the potatoes will start to break down, essentially mashing themselves. I'm fond of the chunks, but I suppose you can puree them for smooth mashed potatoes.
3. Season with butter/olive oil, salt and pepper. Take a bowlful, sit by yourself, and enjoy quietly. Alternatively, serve and enjoy with family and friends! Either way, it's pretty great :)
* Why a third of the cauliflower? The first third was part of dinner for my roommate and me, the second third was devoured with baby carrots whilst reading webcomics and the third, well, it had become too mushy to eat plain... | 2023-11-10T01:27:04.277712 | https://example.com/article/8934 |
Molecular structure of the multifunctional fatty acid synthetase gene of Brevibacterium ammoniagenes: its sequence of catalytic domains is formally consistent with a head-to-tail fusion of the two yeast genes FAS1 and FAS2.
The Brevibacterium ammoniagenes fatty acid synthetase (FAS) gene was isolated from a series of overlapping clones by both immunological and plaque hybridization screening of two independent gene libraries. From the isolated DNA a contiguous segment of 10,549 bp was sequenced in both directions. The sequenced DNA contained a very long (9312 nucleotides) open reading frame coding for a protein of 3104 amino acids and with a molecular mass of 327,466 daltons. Based on characteristic sequence motifs known from other FAS systems, seven different FAS active centres were identified at distinct locations within the polypeptide chain. Only one component enzyme, the 3-hydroxydecanoyl beta, gamma-dehydratase, has not yet been localized definitively within the gene. Translation is presumed to start from a GUG triplet located 25 nucleotides downstream of the transcriptional initiation site. There is a canonical Shine-Dalgarno sequence just before this start codon. Comparison of the B. ammoniagenes FAS sequence with those of other known fatty acid synthetases revealed a particularly high degree of similarity to the products of the two yeast genes, FAS1 and FAS2 (30% identical and 46% identical plus closely related amino acids). This similarity extends over the entire length of the genes and involves not only the primary sequences of individual component enzymes but also their sequential order within the multifunctional proteins. These data, together with those on the structure of other fatty acid synthetases, are interpreted in terms of a contribution of both primary structure and subunit cooperation to a conserved topology of functional domains common to all type I FAS complexes. | 2024-02-02T01:27:04.277712 | https://example.com/article/4171 |
/****************************************************************************
**
** Copyright (C) 2012 Digia Plc and/or its subsidiary(-ies).
** Contact: http://www.qt-project.org/legal
**
** This file is part of Qt Creator.
**
** Commercial License Usage
** Licensees holding valid commercial Qt licenses may use this file in
** accordance with the commercial license agreement provided with the
** Software or, alternatively, in accordance with the terms contained in
** a written agreement between you and Digia. For licensing terms and
** conditions see http://qt.digia.com/licensing. For further information
** use the contact form at http://qt.digia.com/contact-us.
**
** GNU Lesser General Public License Usage
** Alternatively, this file may be used under the terms of the GNU Lesser
** General Public License version 2.1 as published by the Free Software
** Foundation and appearing in the file LICENSE.LGPL included in the
** packaging of this file. Please review the following information to
** ensure the GNU Lesser General Public License version 2.1 requirements
** will be met: http://www.gnu.org/licenses/old-licenses/lgpl-2.1.html.
**
** In addition, as a special exception, Digia gives you certain additional
** rights. These rights are described in the Digia Qt LGPL Exception
** version 1.1, included in the file LGPL_EXCEPTION.txt in this package.
**
****************************************************************************/
#include "abstractformeditortool.h"
#include "formeditorview.h"
#include "formeditorview.h"
#include <modelnodecontextmenu.h>
#include <coreplugin/editormanager/editormanager.h>
#include <QDebug>
#include <QGraphicsSceneDragDropEvent>
#include <nodemetainfo.h>
#include <nodeproperty.h>
namespace QmlDesigner {
AbstractFormEditorTool::AbstractFormEditorTool(FormEditorView *editorView) : m_view(editorView)
{
}
AbstractFormEditorTool::~AbstractFormEditorTool()
{
}
FormEditorView* AbstractFormEditorTool::view() const
{
return m_view;
}
FormEditorScene* AbstractFormEditorTool::scene() const
{
return view()->scene();
}
void AbstractFormEditorTool::setItems(const QList<FormEditorItem*> &itemList)
{
m_itemList = itemList;
selectedItemsChanged(m_itemList);
}
QList<FormEditorItem*> AbstractFormEditorTool::items() const
{
return m_itemList;
}
bool AbstractFormEditorTool::topItemIsMovable(const QList<QGraphicsItem*> & itemList)
{
QGraphicsItem *firstSelectableItem = topMovableGraphicsItem(itemList);
if (firstSelectableItem == 0)
return false;
FormEditorItem *formEditorItem = FormEditorItem::fromQGraphicsItem(firstSelectableItem);
QList<QmlItemNode> selectedNodes = view()->selectedQmlItemNodes();
if (formEditorItem != 0
&& selectedNodes.contains(formEditorItem->qmlItemNode()))
return true;
return false;
}
bool AbstractFormEditorTool::topSelectedItemIsMovable(const QList<QGraphicsItem*> &itemList)
{
QList<QmlItemNode> selectedNodes = view()->selectedQmlItemNodes();
foreach (QGraphicsItem *item, itemList) {
FormEditorItem *formEditorItem = FormEditorItem::fromQGraphicsItem(item);
if (formEditorItem
&& selectedNodes.contains(formEditorItem->qmlItemNode())
&& formEditorItem->qmlItemNode().instanceIsMovable()
&& !formEditorItem->qmlItemNode().instanceIsInPositioner()
&& (formEditorItem->qmlItemNode().hasShowContent()))
return true;
}
foreach (QGraphicsItem *item, itemList) {
FormEditorItem *formEditorItem = FormEditorItem::fromQGraphicsItem(item);
if (formEditorItem
&& formEditorItem->qmlItemNode().isValid()
&& formEditorItem->qmlItemNode().instanceIsMovable()
&& !formEditorItem->qmlItemNode().instanceIsInPositioner()
&& selectedNodes.contains(formEditorItem->qmlItemNode()))
return true;
}
return false;
}
bool AbstractFormEditorTool::topItemIsResizeHandle(const QList<QGraphicsItem*> &/*itemList*/)
{
return false;
}
QGraphicsItem *AbstractFormEditorTool::topMovableGraphicsItem(const QList<QGraphicsItem*> &itemList)
{
foreach (QGraphicsItem *item, itemList) {
if (item->flags().testFlag(QGraphicsItem::ItemIsMovable))
return item;
}
return 0;
}
FormEditorItem *AbstractFormEditorTool::topMovableFormEditorItem(const QList<QGraphicsItem*> &itemList)
{
foreach (QGraphicsItem *item, itemList) {
FormEditorItem *formEditorItem = FormEditorItem::fromQGraphicsItem(item);
if (formEditorItem
&& (formEditorItem->qmlItemNode().hasShowContent()))
return formEditorItem;
}
return 0;
}
FormEditorItem* AbstractFormEditorTool::topFormEditorItem(const QList<QGraphicsItem*> & itemList)
{
foreach (QGraphicsItem *item, itemList) {
FormEditorItem *formEditorItem = FormEditorItem::fromQGraphicsItem(item);
if (formEditorItem && !formEditorItem->qmlItemNode().isRootNode())
return formEditorItem;
}
return 0;
}
FormEditorItem* AbstractFormEditorTool::topFormEditorItemWithRootItem(const QList<QGraphicsItem*> & itemList)
{
foreach (QGraphicsItem *item, itemList) {
FormEditorItem *formEditorItem = FormEditorItem::fromQGraphicsItem(item);
if (formEditorItem)
return formEditorItem;
}
return 0;
}
void AbstractFormEditorTool::dropEvent(QGraphicsSceneDragDropEvent * /* event */)
{
}
void AbstractFormEditorTool::dragEnterEvent(QGraphicsSceneDragDropEvent * event)
{
if (event->mimeData()->hasFormat("application/vnd.bauhaus.itemlibraryinfo") ||
event->mimeData()->hasFormat("application/vnd.bauhaus.libraryresource")) {
event->accept();
view()->changeToDragTool();
view()->currentTool()->dragEnterEvent(event);
} else {
event->ignore();
}
}
static inline bool checkIfNodeIsAView(const ModelNode &node)
{
return node.metaInfo().isValid() &&
(node.metaInfo().isSubclassOf("QtQuick.ListView", -1, -1) ||
node.metaInfo().isSubclassOf("QtQuick.GridView", -1, -1) ||
node.metaInfo().isSubclassOf("QtQuick.PathView", -1, -1));
}
void AbstractFormEditorTool::mousePressEvent(const QList<QGraphicsItem*> & /*itemList*/, QGraphicsSceneMouseEvent *event)
{
if (event->button() == Qt::RightButton) {
event->accept();
}
}
void AbstractFormEditorTool::mouseReleaseEvent(const QList<QGraphicsItem*> & /*itemList*/, QGraphicsSceneMouseEvent *event)
{
if (event->button() == Qt::RightButton) {
showContextMenu(event);
event->accept();
}
}
void AbstractFormEditorTool::mouseDoubleClickEvent(const QList<QGraphicsItem*> &, QGraphicsSceneMouseEvent *)
{
}
void AbstractFormEditorTool::showContextMenu(QGraphicsSceneMouseEvent *event)
{
ModelNodeContextMenu::showContextMenu(view(), event->screenPos(), event->scenePos().toPoint(), true);
}
void AbstractFormEditorTool::clear()
{
m_itemList.clear();
}
}
| 2024-05-10T01:27:04.277712 | https://example.com/article/8529 |
# AUTOGENERATED FILE
FROM balenalib/ZE250-ubuntu:cosmic-build
# remove several traces of debian python
RUN apt-get purge -y python.*
# http://bugs.python.org/issue19846
# > At the moment, setting "LANG=C" on a Linux system *fundamentally breaks Python 3*, and that's not OK.
ENV LANG C.UTF-8
# key 63C7CC90: public key "Simon McVittie <smcv@pseudorandom.co.uk>" imported
# key 3372DCFA: public key "Donald Stufft (dstufft) <donald@stufft.io>" imported
RUN gpg --keyserver keyring.debian.org --recv-keys 4DE8FF2A63C7CC90 \
&& gpg --keyserver keyserver.ubuntu.com --recv-key 6E3CBCE93372DCFA \
&& gpg --keyserver keyserver.ubuntu.com --recv-keys 0x52a43a1e4b77b059
ENV PYTHON_VERSION 2.7.18
# if this is called "PIP_VERSION", pip explodes with "ValueError: invalid truth value '<VERSION>'"
ENV PYTHON_PIP_VERSION 20.1.1
ENV SETUPTOOLS_VERSION 49.1.0
RUN set -x \
&& curl -SLO "http://resin-packages.s3.amazonaws.com/python/v$PYTHON_VERSION/Python-$PYTHON_VERSION.linux-i386-openssl1.1.tar.gz" \
&& echo "60792453d1213e6957e7a1558d7c6e4777289b9b154814b03057efe852d38228 Python-$PYTHON_VERSION.linux-i386-openssl1.1.tar.gz" | sha256sum -c - \
&& tar -xzf "Python-$PYTHON_VERSION.linux-i386-openssl1.1.tar.gz" --strip-components=1 \
&& rm -rf "Python-$PYTHON_VERSION.linux-i386-openssl1.1.tar.gz" \
&& ldconfig \
&& if [ ! -e /usr/local/bin/pip ]; then : \
&& curl -SLO "https://raw.githubusercontent.com/pypa/get-pip/430ba37776ae2ad89f794c7a43b90dc23bac334c/get-pip.py" \
&& echo "19dae841a150c86e2a09d475b5eb0602861f2a5b7761ec268049a662dbd2bd0c get-pip.py" | sha256sum -c - \
&& python get-pip.py \
&& rm get-pip.py \
; fi \
&& pip install --no-cache-dir --upgrade --force-reinstall pip=="$PYTHON_PIP_VERSION" setuptools=="$SETUPTOOLS_VERSION" \
&& find /usr/local \
\( -type d -a -name test -o -name tests \) \
-o \( -type f -a -name '*.pyc' -o -name '*.pyo' \) \
-exec rm -rf '{}' + \
&& cd / \
&& rm -rf /usr/src/python ~/.cache
# install "virtualenv", since the vast majority of users of this image will want it
RUN pip install --no-cache-dir virtualenv
ENV PYTHON_DBUS_VERSION 1.2.8
# install dbus-python dependencies
RUN apt-get update && apt-get install -y --no-install-recommends \
libdbus-1-dev \
libdbus-glib-1-dev \
&& rm -rf /var/lib/apt/lists/* \
&& apt-get -y autoremove
# install dbus-python
RUN set -x \
&& mkdir -p /usr/src/dbus-python \
&& curl -SL "http://dbus.freedesktop.org/releases/dbus-python/dbus-python-$PYTHON_DBUS_VERSION.tar.gz" -o dbus-python.tar.gz \
&& curl -SL "http://dbus.freedesktop.org/releases/dbus-python/dbus-python-$PYTHON_DBUS_VERSION.tar.gz.asc" -o dbus-python.tar.gz.asc \
&& gpg --verify dbus-python.tar.gz.asc \
&& tar -xzC /usr/src/dbus-python --strip-components=1 -f dbus-python.tar.gz \
&& rm dbus-python.tar.gz* \
&& cd /usr/src/dbus-python \
&& PYTHON_VERSION=$(expr match "$PYTHON_VERSION" '\([0-9]*\.[0-9]*\)') ./configure \
&& make -j$(nproc) \
&& make install -j$(nproc) \
&& cd / \
&& rm -rf /usr/src/dbus-python
# https://github.com/docker-library/python/issues/147
ENV PYTHONIOENCODING UTF-8
# set PYTHONPATH to point to dist-packages
ENV PYTHONPATH /usr/lib/python2.7/dist-packages:/usr/lib/python2.7/site-packages:$PYTHONPATH
RUN [ ! -d /.balena/messages ] && mkdir -p /.balena/messages; echo 'As of January 1st, 2020, Python 2 was end-of-life, we will change the latest tag for Balenalib Python base image to Python 3.x and drop support for Python 2 soon. So after 1st July, 2020, all the balenalib Python latest tag will point to the latest Python 3 version and no changes, or fixes will be made to balenalib Python 2 base image. If you are using Python 2 for your application, please upgrade to Python 3 before 1st July.' > /.balena/messages/python-deprecation-warnin
CMD ["echo","'No CMD command was set in Dockerfile! Details about CMD command could be found in Dockerfile Guide section in our Docs. Here's the link: https://balena.io/docs"]
RUN curl -SLO "https://raw.githubusercontent.com/balena-io-library/base-images/8accad6af708fca7271c5c65f18a86782e19f877/scripts/assets/tests/test-stack@python.sh" \
&& echo "Running test-stack@python" \
&& chmod +x test-stack@python.sh \
&& bash test-stack@python.sh \
&& rm -rf test-stack@python.sh
RUN [ ! -d /.balena/messages ] && mkdir -p /.balena/messages; echo 'Here are a few details about this Docker image (For more information please visit https://www.balena.io/docs/reference/base-images/base-images/): \nArchitecture: Intel 32-bit (x86) for Intel Quark \nOS: Ubuntu cosmic \nVariant: build variant \nDefault variable(s): UDEV=off \nThe following software stack is preinstalled: \nPython v2.7.18, Pip v20.1.1, Setuptools v49.1.0 \nExtra features: \n- Easy way to install packages with `install_packages <package-name>` command \n- Run anywhere with cross-build feature (for ARM only) \n- Keep the container idling with `balena-idle` command \n- Show base image details with `balena-info` command' > /.balena/messages/image-info
RUN echo '#!/bin/sh.real\nbalena-info\nrm -f /bin/sh\ncp /bin/sh.real /bin/sh\n/bin/sh "$@"' > /bin/sh-shim \
&& chmod +x /bin/sh-shim \
&& cp /bin/sh /bin/sh.real \
&& mv /bin/sh-shim /bin/sh | 2024-07-05T01:27:04.277712 | https://example.com/article/8144 |
Ask HN: What tool makes you most productitive? - JoelMcCracken
I believe that learning certain tools can make a programmer much more productive. What knowledge about tools do you have that makes you more productive?<p>Aim your advice toward a competent *nix user who knows a little about everything, but doesn't know anything in any real depth.
======
yan
* Bash shortcuts. Learn ^l, ^r, ^a, ^e, ^w, the substitution syntax (^one^two), bang commands (!cmd, !!, !!:0, !!:1, etc)
* Learn a good text editor well. I use vim, but learn whatever you feel comfortable in. Just make sure it doesn't stand in your way.
* Learn the core unix commands and use them often (tail, sort, uniq, tee, pushd/popd, etc)
* Use a configuration management tool (I use puppet, some people like cfengine, there's also chef)
* The second you see yourself doing something for the third time, script it (It goes without saying: learn a decent scripting language well)! Keep typing same long command? Alias or macro it. I can't stress this enough.
* Automate builds, tests and all doc generation. Don't repeat yourself. Use your downtime to reduce repetition. See what can be scripted.
edit:
* Keep _everything_ in source control. Have a 'misc' repo and if you're starting to work on a script just to do some basic maintenance, add it to repo and keep it up to date. You never know when it will grow beyond a toy and you never know if you might break its functionality by messing with it.
edit2:
What really keeps me productive is liking the work I'm doing. Nothing else
comes close.
~~~
Mongoose
Not to shamelessly plug a YC-funded startup, but with regard to source
control, I've found Dropbox (<https://www.dropbox.com/>) a good solution.
Granted, it's more GUI-inclined than SVN, Git, et al. I've read there are CLI
interfaces with it, but haven't looked into any myself.
~~~
cmelbye
Does Dropbox have any sort of versioning?
~~~
joeycfan
Yes actually.
Also, after getting my laptop bricked by the Ubuntu 9.10 upgrade I recovered
my entire project from it.
~~~
jrockway
You have to go pretty far out of your way to have an OS update render your
user data inaccessible.
------
kunley
Emacs. Kudos to an univ professor who made jokes of anyone who was not using
it. He used to say we'll be using emacs for decades if we really invest some
time learning it. He was right.
A REPL for any language used atm. Cool if coupled with the above.
REPL/shell history with incremental search, like readline. This is the most
powerful single feature I use. Hitting Ctrl-R and typing usually 2-3 keys
gives me back the previously entered line I intended to find. If your REPL
doesn't have it embedded, use rlwrap. Look at -H option to control where your
history is saved exactly. Use big history size if you want to be reminded what
you typed months ago - having 10/100k of history entries doesn't hurt really
as it's still quick.
Tab completion is cool as well. For rlwrap you can pregenerate keywords for
completions (eg. your favorite libraries) and it will add completions for
terms entered during current session.
A good SCM for tracking changes even if working alone. I find centralized ones
annoying; hopefully we've got Darcs & Git, both awesome.
Using multiple desktops/workspaces to try new ideas in a space which doesn't
clutter your current visual, so you don't waste your time rearranging it.
Pen & paper. A habit of using it to get some distance. You can always scan a
sheet of paper if needed. I know not every boss is going to accept such scan
as a documentation ;), but preparing deliverable docs is something different
than making useful notes to yourself.
Lack of running IMs, MUAs, popup calendars and other disturbances during
coding. All that stuff can wait. The focus is everything. One exception is
when you do remote pair programming, then some VoIP app is handy. OTOH not
many people work this way.
A sign of a good tool is when you still enjoy using it after, say, ten years.
Most of the above apply here.
[edit: I meant MUAs not MTAs of course]
------
aerique
A bit of a cliché but: Emacs. (Or alternatively vi since that can be plugged
into most things as well.)
As a software developer on *nix I spend a lot of my time manipulating text:
code, e-mail, news, forums, documentation, etc.
I can do all this from Emacs which is its greatest strength for me. It might
not have the latest and greatest editor features but generally it'll quickly
pick them up (within weeks, months or a year someone will have written an
Emacs version and I've also written them myself).
So I don't have to suffer all kinds of different programs for doing the same
activity: manipulating text. Usually all those programs (web browsers, text
editors, word processors, news readers, e-mail clients, etc.) only contain a
subset of Emacs' powerful editing features.
It is also available for a lot of different platforms.
~~~
drhowarddrfine
emacs doesn't have the latest/greatest editor features?
~~~
aerique
It isn't always the first to have them. Sublime Text's high level navigation
took a couple of days to surface in Emacs.
~~~
capablanca
Hm, but it doesn't really do that.
------
Anon84
My brain.
It's amazing how much time you can save if you analyze the problem a bit more
deeply. It's much easier to use the correct algorithm/implementation if you
truly understand the problem.
~~~
panic
Pen and paper help, too.
~~~
_giu
agreed. a whiteboard helps, too!
~~~
eru
Or a blackboard. I love chalk!
------
jey
echo "127.0.0.1 news.ycombinator.com" >> /etc/hosts
------
gcv
Two things: Emacs and pen-paper (yes, the old-fashioned paper notebook and a
pen).
Eulogy follows:
Emacs has helped me eliminate software clutter. Seriously. Computer and
software maintenance is a major productivity killer for me. Install this
upgrade, update this app... I really hate that process, and even Mac OS does
not hide it behind the scenes.
Emacs and org-mode helped me get rid of my mess of "productivity" apps, which
also means less thinking about which app to use for what. It helps that Emacs
just helps me bend text files into my thought flow, and I don't have to adapt
to Productivity-App-Of-The-Day's model of anything. To-do lists go into an
org-mode file. Latest thoughts about work can go into a an org-mode file. I
can slice and dice them and write them as free-form or as organized as I want.
It's immensely liberating. It helps that I don't have to worry about a
proprietary file format biting the dust.
~~~
dirtyaura
I just tried Org-mode and it looks really promising. I've been Omnifocus user
for a while, but flexible, almost natural feel of Org-mode is amazing.
And it's telling that there's even iPhone app for it
<http://mobileorg.ncogni.to/> . Wow. RIP OmniFocus.
------
aw3c2
Linux/GNU/Unix (don't murder me, I do not know which one applies here):
grep, sed, awk, sort, uniq, shell scripts and pipes now do things in seconds
that took me hours if not days to do with Windows GUI tools. Of course my
experience plays a big part to that but I don't think that I would be were I
am without those.
------
Freebytes
I use Joe's Own Editor. You must configure it to prevent it from making backup
files (which are security risks) and to highlight based on your language, but
overall, it is excellent in terms of its speed and intuitive interface.
I use putty for my SSH connections. It is a nice way to remotely access your
server from a Windows client.
The programming language you use should fit the job so that is something that
is specific to the project.
Using subversion for version control is really one of the best tools
available. I would fear making changes in my code even if I had backups
because changing it might break functionality, and I would spend a long time
hunting for solutions of what I did. With any kind of version control system
(and subversion is very easy to use), you can make changes without worry, and
you can get old code you wanted to keep even though you were not using easily
(because commented code is evil). It encourages you to clean your code, remove
dead code, and to refactor your code because you know you can always go back.
You should learn vi in case you must use an archaic machine where you only
have remote access and do not want to try installing new apps. (Some very old
yet very stable telephone switches running with Solaris interfaces come to
mind.)
Grooveshark for listening to music. The site is fantastic, and I do not need
to waste time hunting for music that gets me in the mood to work.
Lastly, a notepad. I keep a notepad beside my bed. I find that it helps me
sleep. I will be thinking of code, and one idea leads to another as I relax.
So, instead of staying up for hours focusing on it (This has happened to me
hundreds of times.), you can write it down. My brain then relaxes because it
knows I do not need to remember it. Then, I can go to sleep. In the past, I
would not be able to actually fall asleep unless I got up, coded what I was
thinking about it, and then went back to sleep. Now I know I can put it off
until tomorrow and actually get a good sleep for the night.
~~~
kunley
You are right with the notepad near the bed.
Slight modification:
I practice a certain kind of meditation. It has side effect that many things,
including hacking solutions, come to mind during a session. I use a notepad to
quickly scratch one catch-phrase which will bring back whole idea later, and
let that idea go which is the purpose of this particular meditation. Often I'm
quite full of fresh ideas after such session. It's amazing and I'm very
thankful to the teacher who gave me this method.
~~~
hariis
What is the name? -thanks
~~~
kunley
<http://www.diamondway-teachings.org/>
------
r11t
Most frequently used zsh/bash Shortcut : Ctrl + r
Most frequently used Gnome Shortcut : Ctrl + Alt + Arrow Keys to switch
workspaces
Quicksilver like launcher for Linux with numerous plugins : Gnome-Do
Version Control : git
Text Editor : vim
Managing multiple remote ssh sessions : screen
------
txxxxd
A computer not connected to the Internet.
~~~
detcader
Absolutely, +1
------
imack
A locally running version instance of issue tracking software. Use whatever
you're comfortable with, but I go with JIRA; It costs $10 for a license for up
to 10 people.
It helps me keep track of side projects. For a long time I had trouble
remembering where to pick up a project and would get distracted by unimportant
parts. JIRA helps keep that to a minimum and makes me feel more serious about
them.
I even keep one project setup in it for personal stuff (renew passport, etc)
just to keep all the TODOs in one spot, but whenever you tell people that they
always make some wise-ass crack about using it to file a bug report about you
personally...
~~~
jimbokun
"but whenever you tell people that they always make some wise-ass crack about
using it to file a bug report about you personally..."
That could be an interesting way to learn more about yourself and how others
perceive you. Let people file bugs against you. How am I doing as a manager?
As a husband and father? Are any of the tickets being closed?
It would take a pretty strong personality, though, to welcome that level of
criticism.
~~~
aarongough
I actually really like that idea!
Although I would think it would be more useful in terms of filing bugs about
_yourself_. After all if we try to change ourselves to meet everyone else's
expectations then were not much more than a shell after a while...
------
aceofspades19
Git, or any distributed source control software. Even when you are working
solo, it helps to have something like git
------
nkohari
I don't mean to spam, and I'm admittedly very biased, but my product Zen
(<http://agilezen.com/>), helps me stay organized and makes me much more
productive and happy. I always have a million things to do, and Zen stops me
from being overwhelmed. (That's why I wrote it!)
On a less self-serving note, I'd also suggest (at least) two monitors, a good
keyboard, and a good desk chair. Fatigue, RSI, and task-switching are all very
real productivity drains.
------
gourneau
Ambient Music, mostly <http://www.hos.com>
~~~
tyrmored
I find that the best ambient music is often stuff you really like, but have
played so much you know every note by heart. The familiarity of it,
particularly if you play it loud enough that it's thoroughly immersive, is
really helpful for getting into the "zone".
I find Kraftwerk is gold for this. Try "Computer Love" or "Radioactivity".
There's more esoteric ambient stuff like Maeror Tri if you're curious enough
to hunt around a bit. Also try Ildjarn's ambient music. (Ignore his heavy
metal -- I like it, but it's certainly not for everyone.)
------
code_devil
\- Notepad++/Textpad/Emacs
\- Python [You can write quick programs on the command line or use it as a
calculator]
\- ToDo List/Notes App running on the background.
\- Multiple Desktop Windows(workspaces)
\- Dual Monitors.
------
sidsavara
RescueTime!
[http://sidsavara.com/product-reviews/review-of-rescuetime-
fr...](http://sidsavara.com/product-reviews/review-of-rescuetime-free-time-
tracking-software)
Of course if you're using Unix, you _can_ get the linux version (which I don't
believe is officially supported).
Just knowing where I am spending my time makes me more productive and less
likely to randomly web surf etc
------
natch
Knowing well how to do for loops on the command line of whatever shell I'm
using at the time.
Saving snippets of how I get things done.
Always saving command lines in shell scripts, sometimes with parameters,
instead of just trying to remember them. Bash history is great, but it isn't
available when changing systems, hosts, and jobs.
Always making a sandbox directory for every idea/project, under a directory
named for the current year. This includes my own ideas as well as stuff other
people did that I download to play with. When a new year rolls around, most of
the directories don't get carried over; they just stay in the old year
archived.
Tagging every new project with keywords.
Automating everything possible.
Most fantastic win ever: VMware images that are preconfigured to whatever
state they need to be in to debug whatever I'm working on. Could be Amazon
AMIs; I use VMware atm.
emacs, vi, sort, uniq, comm, find, ack, diff, patch, perl, perltidy, man, git
------
spudlyo
GNU Screen
My top level screen session is a list of hosts I log into. On each of those
hosts, I also run screen (screen within screen) to give me virtual windows on
that host. As a UNIX admin this makes my life a lot more productive, as I'm
often logged into 5-10 machines at once. Instead of hunting around for the
right window, I can jump to screens and/or subscreens by name, without taking
my hands off of home row. For me, one large multiplexed terminal window is
best. It also helps if your terminal program can go full screen (like iTerm)
for maximum old-school terminal concentration.
Emacs
Learning how to edit text without taking your hands off home row (control key
sequences) is invaluable. This skill will help you in your editor, at the bash
prompt, inside of any program you can run with rlwrap, and in OSX (or windows)
edit widgets. With a bit of work you can configure emacs keys in every GUI and
non-GUI application you use. For Windows users XKeymacs works well for this.
Linux users can configure GTK to support emacs style editing. Having fast and
universal controls for text editing makes me productive.
strace
Why wonder why the a program is misbehaving? See every system call it makes as
it makes them, complete with arguments and return codes. Even attach it to a
running process to find out what it is doing in real time. This tool has
allowed me to diagnose and solve more thorny problems than any other in my
arsenal. For example, you're trying to figure out what arguments that gcc is
using to invoke the linker in a Makefile, or which order that the linker looks
for libraries, strace can tell you all of this, when you'd be otherwise
scratching your head and guessing.
Regular Expressions
Knowing Regular expressions can make your life a lot easier. In your editor
they allow you do all kinds of advanced text manipulations, even some dumb
refactoring. Knowing them also allows you to do some great parsing in sed,
perl, grep (ack is a better grep btw), whatever. Once the regexp lightbulb has
turned on your productivity can go way up.
Server Side IMAP Email Filtering
Regular expressions reminded me of this, but if you have all your email
handling rules (filtering, organizing into folders etc) done on the IMAP
server side, it frees up your email clients to be stupid. They don't have to
do any of that. Your email inbox will look the same in Pine, Mutt, Mail.app,
Outlook, your phone, whatever. This is the promise of IMAP. I use maildrop on
my own IMAP server for this.
------
tyrmored
Familiarity with functional/declarative programming methods. I'm not a guru on
this at all but learning a different way of thinking about programming like
this has been terrifically helpful -- in some languages more than others. You
can write functionally to at least some extent in almost any language -- even
Perl has a level of support for it that surprises a lot of hackers.
So if you haven't already, learn a Lisp, or Haskell, or even JavaScript.
Something that lets you pass around functions as parameters, and does
closures.
It's superb for JavaScript, for example, once you realise it's basically a
slightly weird Scheme with C-ish syntax. Suddenly all that ranting about
closures and lazy evaluation will seem so much more relevant!
------
xcombinator
Vim, paper and good quality colors pens. Valgrind, grep, gdb, inkscape for
drawings...
~~~
tyrmored
I want to like Inkscape but I just find it too hard to use. Can you recommend
any resources for learning how to use it?
------
ScottWhigham
I was surprised to see no one mentioning calendar/reminder tools. Maybe it's
because this is Hacker News and more folks are focused on, well, hacking and
therefore when they hear the term "productive" they think about being a more
productive hacker - I don't know. I do know that I would be far less
productive without a tool to set reminders - the idea of "Set it and forget
it" leaves room in my brain for more. Oh sure I have lots of other tools for
productivity including programming-related tools but the most productive tool
I use is my calendar with reminders and tasks.
------
mquander
Habitually using Compiz workspace switching to get more working area on my
laptop, instead of trying to arrange windows carefully on a single desktop and
bring them forward with the taskbar.
~~~
Dav3xor
You've probably had 20 other people tell you about this; but switching to a
tiled window manager will remove that whole 'careful placement of windows'
thing from your life in a very positive way.
~~~
nuclear_eclipse
I've tried tiling window managers multiple times, and each time find issues
with them that frustrate me until I switch back to Gnome:
\- No simple way to keep a small IM status window open in the corner of a
workspace
\- Limited support for resolution-dependent windows, such as videos, games or
remote desktops
\- No notification bar for status apps to utilize, such as pidgin or network-
manager
\- No integration with modern desktop environment features or tools, such as
media keys for rhythmbox, launchers like gnome-do, network-manager, automatic
disk mounting, screen lock, etc
Gnome and compiz have solved a lot of problems that actually make a Linux
desktop _usable_ in modern contexts.
~~~
Dav3xor
Those are all very fair criticisms, but by simply running gnome-panel with
Xmonad, you get 80% of what you want.
Apologies for the evangelism. :)
------
blogimus
A notebook and a set of habits (my processes). A simple paper notebook which I
can write ideas down in meetings, which I can keep by my bedside and scribble
down my thoughts if I get a brainstorm when I'm sleeping. There have been a
number of discussions. All electronic tools I've used over the years
(languages, software, gadgets) change and evolve and I have to port from one
format to another. The consistent parts are the habits I've developed over
time. Habits on note taking, organizing, question asking.
------
misterbwong
Visual Studio, Launchy, Web Developer Toolbar, Firebug
~~~
tyrmored
Upvoted for Firebug. If you've been a web developer for any length of time and
you're not using this yet, start _now_. Prepare for the forehead slap when you
learn to use the console!
------
unalone
Fresh.app is the core of my activities online. I can't recommend it enough.
<http://www.ironicsoftware.com/fresh/index.html>
Most of my activities concern the most recent things I've moved with or played
with. Fresh lets me handle all of that without worrying about any other
workflow. Downloads/screenshots/etc all go through it.
~~~
aik
That's really cool. Wish it existed on windows or linux.
------
va_coder
REPL
~~~
jcapote
I have a semi-repl with autotest + ruby-debug and it's done wonders for my
productivity; I can't imagine going back to alert/printf style
debugging/development...
~~~
PStamatiou
I'd be interested in reading more about your workflow, I'm a RoR dev.
------
nathanwdavis
Graph paper and a pencil. Just pull it out and start drawing, jotting down
ideas, and organizing a strategy of executing on the project at hand.
Also, Excel (or other spreadsheet program). Not usually thought of as a tool,
but putting small functions in cells and passing inputs/results cell to cell
is a good way to start the actual implementation of a solution.
------
jonallanharper
Learning the ins and outs of regex is well worth it. I find myself doing regex
search/replace almost daily within textmate.
~~~
tyrmored
Some people seem to find Jeff Atwood ranting about how fantastic regexes are
annoying. Every time I read another article like that, though, I just find
myself smiling and nodding.
Only thing that's kind of annoying is that the whole world hasn't moved to
Perl regexes yet (with which I'm most familiar and think most fluently). I
nearly punched the air when I learned Apache used PCRE for stuff like
mod_rewrite.
------
jamesbritt
* vim + numerous custom scripts and mappings
* JotBot (note: it's my own commercial app, but I use it every day)
* Todoist.com + a few custom apps that work with it
* Scores of little scripts to automate assorted tasks
* My G1, for notes and reminders
* git; almost everything gets a repo, so I more easily try things out while not risking losing previous work
Not at all related to 'nix, but most important:
* World's greatest wife
* Smart & good friends
------
iamwil
For me, just recognizing that something was painful and I was doing something
repetitive. It's easy to get lulled into a sense of 'this is how things are'.
When you're conscious of it, you can then start looking for features in the
tools you're already using, other tools, or build your own.
------
AhtiK
I'm somewhat biased being one of the TimeGT ( <http://timegt.com> ) developers
but after we finished it to a point that we were not that embarrassed to
publish it -- it has saved us time and made life much more productive.
------
raintrees
A good cup of orange pekoe. More often than not, a quiet time to meditate with
a warm cup in my hands gives me the greatest productivity breakthroughs.
I fear I have fallen to the monks of old: "First, boil water."
------
ekarisor
Vim and SlickRun (sorry Windows specific but certainly worth mentioning)
~~~
drhowarddrfine
Not worth mentioning since it's not remotely answering the question.
~~~
jrockway
Uh, what?
------
TomasSedovic
A web browser, actually. Plus that whole Internet thing.
------
fjabre
TextMate for mac
Django for framework
~~~
dkasper
+1 TextMate. Search Project and Go To File take it over the top for me when
working on more than one file at a time.
~~~
PStamatiou
have you tried Ack in Project? shift+cmd+a (once you have it installed)... i
do that many, many times a day
------
ludwig
Vim _and_ Emacs (yes, I'm schizophrenic).
~~~
jrockway
You should look into Viper. And if Emacs doesn't start quickly enough for you,
you should run it as "emacs --daemon" and then "start your editor" with
emacsclient -t (or emacsclient -c, if you want an X window).
Once you've gone the Way Of The Emacs, there is no reason to use vim... unless
you have some internal application written in vimscript, of course.
~~~
Locke1689
Straight vim is rarely very useable. I wouldn't be comfortable with out tags,
minibuf explorer, nerdtree, cscope, and taglist.
~~~
jrockway
Right, which is what Emacs is there for. I don't think there is any Vim
functionality (plugin or otherwise) that is not implemented in some Emacs
extension.
Viper just gets you insert-mode and command-mode. It's still Emacs.
~~~
Locke1689
What about the one where you don't use megabytes of disk space? ;)
~~~
jrockway
The OP says he uses both Emacs and Vim regularly. Emacs alone uses less disk
space than Emacs and Vim combined.
------
physcab
I do a lot of data mining using Hadoop. Hive has become one of my tools of
choice for SQL-ing large datasets.
------
plinkplonk
Increasingly, mathematics. Not sure if that would be considered a "tool" for
the purposes of this discussion.
------
fiaz
Netbeans, JRuby/Java, and some music
------
slackerIII
Valgrind. If you are writing c/c++ but not using valgrind all the time, you
are wasting time.
~~~
jrockway
s/ but not using valgrind all the time//.
~~~
Locke1689
Want to tell me what you develop your type I virtual machines in?
~~~
jrockway
Someone else already wrote that, so it's not my problem.
If you want to use C for your "type I virtual machines", great. But stop
writing music players and web browsers in it.
------
jlgosse
Definitely Eclipse. The debugger is basically the most valuable feature ever
developed. Ever.
------
mightybyte
GNU screen, vim, git, and Haskell
------
wlievens
Eclipse, oh god yes.
~~~
jimbokun
I'm an Emacs guy, but I cannot deny that Eclipse is the superior tool for Java
development. I have come to rely on the refactoring tools and would miss them
greatly if they were taken away from me.
SLIME in Emacs is comparable (better in some ways, worse than others) if
you're hacking in a Lisp. It is really nice to work with code at a higher
semantic level than just ASCII text, sometimes.
(I also hear that VC++ has similar or even better refactoring features, but I
haven't used it.)
------
pcestrada
Cygwin makes life bearable on Windows.
------
hariis
the key productivity enhancer:
Having a good reason why you are doing something
------
mistermann
LLBLGen Pro (ORM)
------
maglob
Jira
------
mailanay
textpad
------
vlisivka
1) bash/perl(regexps)/other command line tools;
2) trackers, task focusing software: GTD-free, Trac, Mylyn, pyroom, etc.;
3) blind typing (to type fast), workrave (to stop typing);
4) somebody else, which will review my work.
| 2024-01-28T01:27:04.277712 | https://example.com/article/2723 |
Here’s a quick quiz for you:
In the biblical story, what was Jonah swallowed by?
How many animals of each kind did Moses take on the Ark?
Did you answer “whale” to the first question and “two” to the second? Most people do … even though they’re well aware that it was Noah, not Moses who built the ark in the biblical story.
Psychologists like me call this phenomenon the Moses Illusion. It’s just one example of how people are very bad at picking up on factual errors in the world around them. Even when people know the correct information, they often fail to notice errors and will even go on to use that incorrect information in other situations.
Research from cognitive psychology shows that people are naturally poor fact-checkers and it is very difficult for us to compare things we read or hear to what we already know about a topic. In what’s been called an era of “fake news,” this reality has important implications for how people consume journalism, social media and other public information.
Failing to notice what you know is wrong
The Moses Illusion has been studied repeatedly since the 1980s. It occurs with a variety of questions and the key finding is that – even though people know the correct information – they don’t notice the error and proceed to answer the question.
In the original study, 80 percent of the participants failed to notice the error in the question despite later correctly answering the question “Who was it that took the animals on the Ark?” This failure occurred even though participants were warned that some of the questions would have something wrong with them and were given an example of an incorrect question.
The Moses Illusion demonstrates what psychologists call knowledge neglect – people have relevant knowledge, but they fail to use it.
One way my colleagues and I have studied this knowledge neglect is by having people read fictional stories that contain true and false information about the world. For example, one story is about a character’s summer job at a planetarium. Some information in the story is correct: “Lucky me, I had to wear some huge old space suit. I don’t know if I was supposed to be anyone in particular – maybe I was supposed to be Neil Armstrong, the first man on the moon.” Other information is incorrect: “First I had to go through all the regular astronomical facts, starting with how our solar system works, that Saturn is the largest planet, etc.”
Later, we give participants a trivia test with some new questions (Which precious gem is red?) and some questions that relate to the information from the story (What is the largest planet in the solar system?). We reliably find positive effects of reading the correct information within the story – participants are more likely to answer “Who was the first person to step foot on the moon?” correctly. We also see negative effects of reading the misinformation – participants are both less likely to recall that Jupiter is the largest planet and they are more likely to answer with Saturn.
These negative effects of reading false information occur even when the incorrect information directly contradicts people’s prior knowledge. In one study, my colleagues and I had people take a trivia test two weeks before reading the stories. Thus, we knew what information each person did and did not know. Participants still learned false information from the stories they later read. In fact, they were equally likely to pick up false information from the stories when it did and did not contradict their prior knowledge.
Can you improve at noticing incorrect info?
So people often fail to notice errors in what they read and will use those errors in later situations. But what can we do to prevent this influence of misinformation?
Expertise or greater knowledge seems to help, but it doesn’t solve the problem. Even biology graduate students will attempt to answer distorted questions such as “Water contains two atoms of helium and how many atoms of oxygen?” – though they are less likely to answer them than history graduate students. (The pattern reverses for history-related questions.)
Many of the interventions my colleagues and I have implemented to try to reduce people’s reliance on the misinformation have failed or even backfired. One initial thought was that participants would be more likely to notice the errors if they had more time to process the information. So, we presented the stories in a book-on-tape format and slowed down the presentation rate. But instead of using the extra time to detect and avoid the errors, participants were even more likely to produce the misinformation from the stories on a later trivia test.
Next, we tried highlighting the critical information in a red font. We told readers to pay particular attention to the information presented in red with the hope that paying special attention to the incorrect information would help them notice and avoid the errors. Instead, they paid additional attention to the errors and were thus more likely to repeat them on the later test.
The one thing that does seem to help is to act like a professional fact-checker. When participants are instructed to edit the story and highlight any inaccurate statements, they are less likely to learn misinformation from the story. Similar results occur when participants read the stories sentence by sentence and decide whether each sentence contains an error.
It’s important to note that even these “fact-checking” readers miss many of the errors and still learn false information from the stories. For example, in the sentence-by-sentence detection task participants caught about 30 percent of the errors. But given their prior knowledge they should have been able to detect at least 70 percent. So this type of careful reading does help, but readers still miss many errors and will use them on a later test.
Quirks of psychology make us miss mistakes
Why are human beings so bad at noticing errors and misinformation? Psychologists believe that there are at least two forces at work.
First, people have a general bias to believe that things are true. (After all, most things that we read or hear are true.) In fact, there’s some evidence that we initially process all statements as true and that it then takes cognitive effort to mentally mark them as false.
Second, people tend to accept information as long as it’s close enough to the correct information. Natural speech often includes errors, pauses and repeats. (“She was wearing a blue – um, I mean, a black, a black dress.”) One idea is that to maintain conversations we need to go with the flow – accept information that is “good enough” and just move on.
And people don’t fall for these illusions when the incorrect information is obviously wrong. For example, people don’t try and answer the question “How many animals of each kind did Nixon take on the Ark?” and people don’t believe that Pluto is the largest planet after reading it in a fictional story.
Detecting and correcting false information is difficult work and requires fighting against the ways our brains like to process information. Critical thinking alone won’t save us. Our psychological quirks put us at risk of falling for misinformation, disinformation and propaganda. Professional fact-checkers provide an essential service in hunting out incorrect information in the public view. As such, they are one of our best hopes for zeroing in on errors and correcting them, before the rest of us read or hear the false information and incorporate it into what we know of the world. | 2024-05-11T01:27:04.277712 | https://example.com/article/4219 |
Humans are known to have constant symbiosis with microorganisms. Non-pathogenic microbial associations participate in vital functions of a host macroorganism and in maintenance of homeostasis. There is some data that our microflora may negatively influence on host macroorganism. Gut flora metabolism of phosphatidylcholine may promote cardiovascular disease [1,2].However, Lactobacilli and products of their metabolism, being administered with a food, have positive impact on the cardiovascular system. Bioactive peptides produced during Lactobacillus fermentation are favorable for the treatment of hypertension. Probiotic bacteria have demonstrated the ability to reduce blood cholesterol by several mechanisms including assimilation of cholesterol. Metabolic products of lactobacilli may stimulate intracellular calcium signaling in cells of cardiovascular system. We should use complete potential of proteolytic activity of Lactobacilli, their ability to produce high concentration of favorable metabolites to receive unique pharmabiotic products for prophylaxis and probably for the treatment of life-threatening diseases.
Humans are known to have constant symbiosis with microorganisms (microbiota/microflora). Non-pathogenic microbial associations participate in vital functions of a host macroorganism and in maintenance of homeostasis. Actually, microbiota may be considered as an endocrine organ of a host macroorganism[3]. It has morphokinetic influence, participate in a metabolic activity and produce biologically active compounds, including important neuromediators regulating mental activity of human, such as glutamate and γ-aminobutyric acid [3].
The indigenous microflora including intestinal one, colonizing the sites of macroorganism and connecting to the external environment, is separated from the internal environment of a macroorganism by corresponding barriers. However, metabolic products of our microflora in gastrointestinal tract can rather easily penetrate into the blood, thereby influencing the macroorganism physiology.
There are some data that our microflora may negatively influence on host macroorganism. There is some evidence of microbe-induced human malignancies [4]. There is some interconnection of the gut violation and cardiac diseases[5].Recently it was shown that gut flora metabolism of phosphatidylcholine promotes cardiovascular disease. An increased plasma level of trimethylamine-N-oxide (TMAO), a product of the intestinal microbial metabolism of dietary phosphatidylcholine is associated with an increased rate of major adverse cardiovascular events. A major adverse cardiovascular event was defined as death, myocardial infarction, or stroke. Actually, fasting plasma TMAO levels predict the risk of incident major adverse cardiovascular events independently of traditional cardiovascular risk factors [1,2].However, there is no the mechanistic link between TMAO and cardiovascular risk, because of an efficient kidney excretion mechanism [2]. An association between infectious organisms and atherosclerosis has previously been postulated [6].However anti-microbial therapy in preventing disease progression has been disappointing [6,7].In their latest study, published in the New England Journal of Medicine,[2]suggested therapeutic modulation of microbiota with functional food containing probiotics [8]and with nonsystemic antibiotics reduction of TMAO producing microbes. However, potency of probiotic to reduce TMAO is strain dependent [8]. Additionally, macroorganism may have non-toxic bacteria involved in its microflora, which are able to reduce TMAO. For example, E-coli TMAO reduction was associated with an anaerobic respiration [9].
Authors [2] recommend avoiding excessive consumption of dietary phosphatidylcholine and choline. Choline intake can be reduced with a vegetarian or high-fibre diet, but choline is a semiessential nutrient, so should not be entirely eliminated from the diet [2].
I think that consumption of non-fat food fermented with Lactobacilli may be effectively used for prophylaxis of cardiovascular disease. Lactobacilli and products of their metabolism, being administered with a food, have positive impact on the cardiovascular system [10]. Lactobacilli are able to produce biologically active peptides inhibiting Angiotensin-Converting Enzyme (ACE). Hypertension arises from the conversion of Angiotensin-I to the potent vasoconstrictor Angiotensin-II by the ACE. Dairy products fermented with Lactobacilli contain bioactive peptides known to inhibit the activity of ACE and thus alleviate hypertension. Oral administration of Calpis sour milk to spontaneously hypertensive rats (SHR) was able to lower systolic blood pressure [11]. Similar results were seen with oral administration of milk fermented with L. helveticus CP790 [12].Studies in humans have shown that in persons who fed milk fermented with Lactobacilli a significant lowering of blood pressure was observed [13,14]. Thus, bioactive peptides produced during Lactobacillus fermentation are favorable for the treatment of hypertension. The ACE-inhibitory peptides produced during the fermentation of milk are already the basis for health claims associated with some fermented milk products on the market, such as Calpis (Calpis Co., Ltd., Japan) and Evolus® (Valio, Finland) [15].
Hypertension is often associated with hypercholesterolemia or lipid abnormality and obesity [16]. Hypercholesterolemia is another significant risk factor for cardiovascular disease. Cholesterol is depositing in the arteries restricting blood flow to the heart. Probiotic bacteria have demonstrated the ability to reduce blood cholesterol by several mechanisms including assimilation of cholesterol [17],binding cholesterol and bile acids to the cell surface thus inhibiting absorption from the small intestine [18],and suppression of bile acid absorption by deconjugation of bile salts by the bacterial bile salt hydrolase activity [19,20]and may reduce oxidized low-density lipoproteins [21],thereby reducing cardiovascular complications. Cholesterol-lowering effect of probiotics was observed in hyper-cholesterolemic hamsters [22]and in rat [23].In humans, hypercholesterolemic patients fed probiotics yogurt containing L. acidophilus and B. lactis were able to reduce their cholesterol levels compared to cohorts who consumed ordinary yogurt [24, 25].Nevertheless, some authors did not observe cholesterol-lowering effect of probiotics [15].
At last, administration of Probiotics and products of their metabolism improves gastrointestinal barrier, thereby reducing complications in patients with chronic heart insufficiency [5]. Administration of Probiotics in intensive care units improved the immunity state, decreased overall mortality, and reduced such symptoms as diarrhea and sepsis [26].
At the cellular level it was shown that some products of a bacterial fermentation and organic acids, such as lactate, acetate, propionate, and butyrate caused contraction of colon smooth muscle via calcium influx into the cells [27]. It was shown that a bacterial supernatant E. coli Nissle 1917 increases colon contraction via non-identified metabolites in addition to acetate [28].However, there is the data showing that acetate, propionate and butyrate do not increase intracellular calcium in colon smooth muscles [29].Recently, it was shown that Lactobacilli are able to increase intracellular calcium in cardiomyocytes, thereby increasing contractility of myocardium [30], in contrast to bacterial DNA and RNA of pathogenic microorganisms (S. aureusand E. coli) and LPS, which suppressed contractility of rat cardiomyocytes significantly [31]. In neurons probiotic metabolic products stimulated protein kinase-C activity and partly activated ryanodine receptors [32].In vascular smooth muscles probiotic metabolic products also stimulated protein kinase C [33], stimulated heart mitochondria respiration and exerted a mild uncoupling effect on electronic transport and oxidative phosphorylation in mitochondria [30].
Earlier it was shown that intravenous administration of the cultural milieu of lactic bacteria was able to protect myocardium from ischemia [34]. From the data provided it is clear that components of the cultural solution of Lactobacillus bulgaricus-51 cause hypotension, poorly influencing heart beating [34]. These data are in accordance with our experiments, in which lactobacilli can suppress considerably the thapsigargin-induced calcium influx in vascular smooth muscle cells [30]. In the conditions of sepsis, steady hypotension is observed and the agonist-induced calcium influx is considerably suppressed, which worsen the situation. Endotoxins also inhibit both phases of the calcium response considerably, namely, calcium release from intracellular stores and, to a great extent, agonist-induced calcium influx in endothelial cells of blood vessels [35]. Thus, during sepsis, when considerable bacterial translocation is observed, a large amount of lactic bacteria in the blood may aggravate a septic disease by increasing hypotension.
Despite the fact that lactic bacteria practically do not cause infectious diseases, nevertheless, there are some data where Lactobacilliare associated with cardiovascular infections [36]. Moreover, it was shown that after single intraperitoneal injection of the Lactobacillus caseicellular extract in mice, the inflammation of coronary arteries, similar to the Kawasaki disease, is developed [37]. In Europe, North America, and Japan the Kawasaki disease is considered to be the main reason of the acquired cardiovascular sickness in children [38].
However, various fermentative products of Lactobacilli have long save history of administration for thousands of years, in the form of fermented milk and vegetable products such as yogurt and pickles [39]. Such low fat fermented products may be used for the prophylaxis of some cardiovascular diseases, mentioned above. The problem is that yogurts at modern market generally contain high amount of carbohydrates. Consumption of the latter has been shown to increase the risk to develop CVD [40].Thus, positive effect of fermented probiotic products may be annihilated, if not more, by negative effect of carbohydrates.
Fermentation of food products is very promising method of receiving biologically active natural products, which have positive impact on the cardiovascular system. Such products contain metabolites of proteolytic activity of fermenting bacteria. There are huge fermentative products: Bulgarian yogurt, kefir, koumiss, Italian cheeses, Swedish and Finnish fermented milk, Russian ryazhenka and prostokvasha, Sour Cream, French Creme fraiche, etc. National food of Japan, New Zealand, Africa (cassava) and many othersmost fermented food products, such as yogurt, fermented beverages or juices and cheese, are taken only through the first stage of fermentation, intended simply to pre-digest or preserve the food (with organic acids, etc. produced by bacteria), while most organic matter remains in complex form. We should use complete potential of proteolytic activity of Lactobacilli, their ability to produce high concentration of favorable metabolites to receive unique pharmabiotic products for prophylaxis and, probably, for the treatment of life-threatening diseases. | 2024-04-09T01:27:04.277712 | https://example.com/article/5727 |
Electro-acupuncture Pretreatment at Zusanli (ST36) Acupoint Attenuates Lipopolysaccharide-Induced Inflammation in Rats by Inhibiting Ca2+ Influx Associated with Cannabinoid CB2 Receptors.
In this study, we aimed to investigate the effect of electro-acupuncture (EA) pretreatment at zusanli (ST36) acupoint on lipopolysaccharide (LPS)-induced endotoxemic rat model and explore the underlying molecular mechanisms. Rats were treated with EA at ST36 for 7 days before being subjected to LPS. Two hours post-LPS, samples such as serum, local acupoint tissues, and spleens were collected and processed for investigations including cytokine production, cytosolic calcium (Ca2+) concentration, Ca2+ influx, cannabinoid CB2 receptor (CB2R) expression, and TLR4/NF-κB signaling. Our results showed EA pretreatment significantly attenuated LPS-induced inflammatory cytokine production, such as TNF-α, IL-1β, and IL-6. EA also enhanced CB2R expression, inhibited Ca2+ influx, and inactivated TLR4/NF-κB signaling, subsequently resulting in a substantial reduction of Ca2+ concentration. Importantly, CB2R antagonist AM630 effectively abrogated the suppressive effect of EA at ST36 on the endotoxemic rats, suggesting CB2R was involved in the anti-inflammatory effect of EA. EA pretreatment could enhance CB2R expression, inhibit Ca2+ influx, and inactivate TLR4/NF-κB signaling, which contributes to the alleviation of LPS-induced inflammation in rats. | 2024-01-17T01:27:04.277712 | https://example.com/article/6324 |
bapoumba's blog
wubdepends, get Ubuntu packages for an off line machine
I ran into wubdepends in a UF thread.christhemonkey has written a utility in python that allows to download a package from the ubuntu repositories, along with all its dependencies.
Many people around the world have problems getting online at home, or have trouble setting up a connection, and I see requests to get packages off line quite often on UF. I have not tested wubdepends, but I really like the idea. There is a .exe for windows, interesting if the only internet access point is on a Windows machine.
7 thoughts on “wubdepends, get Ubuntu packages for an off line machine”
Wow! I happened to accidentally click on a link to here but I’m glad I did. Lol. I’ve been looking for something exactly like this for a while now. I have an Xubuntu machine that is off line. I’ve tried things like Apt-on-CD but taking packages from Ubuntu to Xubuntu doesn’t always work out too well. This is perfect! Thanks for writing a blog on this. Otherwise I probably would have never found out about this. ;)
I seem to have run into a bit of a problem. I downloaded the .tar.gz package and it appears to be a Python script. I made sure it was executable but when I tried to run it I got
./wubdepends3.py
: No such file or directory
I’m not exactly sure what it could mean. | 2023-09-05T01:27:04.277712 | https://example.com/article/4941 |
<template>
<g>
<path
d="M512 42.105263c259.368421 0 469.894737 210.526316 469.894737 469.894737S769.684211 980.210526 512 980.210526 42.105263 769.684211 42.105263 512 252.631579 42.105263 512 42.105263m0-42.105263C229.052632 0 0 229.052632 0 512s229.052632 512 512 512 512-229.052632 512-512S793.263158 0 512 0z"
fill="#EB2324"
p-id="9534"
></path>
<path
d="M512 431.157895C458.105263 308.210526 304.842105 336.842105 303.157895 480c0 77.473684 72.421053 107.789474 121.263158 138.105263C471.578947 648.421053 505.263158 690.526316 510.315789 707.368421c5.052632-16.842105 42.105263-60.631579 85.894737-90.947368 48.842105-33.684211 122.947368-60.631579 121.263158-138.105264 1.684211-143.157895-154.947368-165.052632-205.473684-47.157894z"
fill="#EB2324"
p-id="9535"
></path>
</g>
</template>
| 2023-08-04T01:27:04.277712 | https://example.com/article/7986 |
CAPE TOWN, South Africa – Prosecutors pushing for a murder conviction against Oscar Pistorius have filed papers at South Africa's Supreme Court of Appeal.
Court registrar Paul Myburgh said the papers were filed Monday, four days ahead of Pistorius' expected release from prison to be moved to house arrest.
Prosecutors want a panel of judges at the Supreme Court to overrule a decision by another judge to acquit the double-amputee Olympic athlete of murder for killing girlfriend Reva Steenkamp in 2013. Pistorius was found guilty of culpable homicide, or manslaughter, for shooting Steenkamp through a toilet cubicle door in his home.
He was sentenced to five years in jail.
Pistorius is expected to be released from prison Friday after serving 10 months of his culpable homicide sentence. He would serve the remainder under house arrest. | 2024-04-22T01:27:04.277712 | https://example.com/article/8488 |
Getting started
To play, all you need is a ssh or telnet client. On Windows, the built-in telnet.exe is adequate, though most prefer to use PuTTY. It may be worth mentioning that ssh, being more secure, may be the better choice, otherwise someone might find out your password by sniffing the net.
Providing the clients are installed, in Mac OS X, other UNIX-like systems, and Windows, typing the following commands in a command prompt will get you connected:
ssh nethack@alt.org
or
telnet nethack.alt.org
In case the standard telnet port is blocked, you can also try port 14321 by typing the following command:
telnet nethack.alt.org 14321
User interface tips
For those used to the tiles (GUI) port
Anyone accustomed to the Qt tiles port will sorely miss a separate message window. Instead, game messages are displayed one line at a time in the terminal's top line. Most meaningful actions generate several lines that each have to be scrolled by with space or escape. This is, of course, standard behaviour in the tty form of Nethack.
The best solution is to use the curses interface. Alternatively, you can configure the MSGTYPE option to suppress junk messages. You can't use both at the same time.
You might want to turn off rest-on-space and either use space to scroll through the messages, or skip all messages at once with ctrl + space, then use ctrl + p to read a screenful at a time. (In that case, you'll have to set a preference to have ctrl + p list messages on a full screen instead of line by line; it's also good to have a healthy large number, say 50, of past messages saved.)
For those using Terminal.app in Mac OS X
To enable extended characters, do the following:
In Terminal.app, choose "Preferences..." from the Terminal menu.
Click the "Encodings" tab at the top. Check the checkbox next to "Latin-US (DOS)"
Click the "Settings" at the top and create a new setting, probably titled "Nethack".
In the text tab, check "Use bright colors for bold fonts". You may wish to adjust the bright or dim colors to make them more distinct (e.g. make dim yellow look brown). Note that you can only adjust these options in OS X Lion or later.
In the new setting, click the "Advanced" tab and set "Character encoding" to "Latin-US (DOS)"
In the same tab, change "Declare terminal as" to "xterm-16color". (also OS X Lion or later)
Close the Settings window and open a new Nethack window from the Shell menu.
Also, NetHack has been compiled with autopickup exceptions, and several bugs have been fixed, including the Astral call bug, a bug that allowed predicting the random numbers, and a crash when dropping gold in certain situations. There are also several new hallucinatory monster names, random engravings, random gravestone epitaphs and T-shirt messages.
Several of NAO's interface improvements and bugfixes were borrowed from other variants - this is also documented in the above diff file.
As of August, NetHack 3.4.3 and NetHack 3.6.0 are no longer hosted on NAO. However, this version of NetHack 3.4.3 is also used in other public servers, such as Hardfought.
NAO players on Nethack Wiki
Members of the Nethack Wiki can include the template {{NAOplayer|NAO player account}} on their user's pages to link to their corresponding NAO's account and include links to their games, logs etc. Capitalization matters. | 2024-05-08T01:27:04.277712 | https://example.com/article/4598 |
The benefits of your baby having a massage
Just as being massaged during pregnancy can have positive physical and mental benefits for expectant mothers, you and your baby can also benefit from this activity after the baby has been born.
Baby massage can have many benefits for both mother and baby, helping you to bond through touch, to ease constipation, to aid sleep, and to increase relaxation in both mother and baby. It can also be a great communication tool for you both.
Touching is how babies communicate and learn the world around them, when they are first born. Before they can talk, they feel, often with their mouth. That’s one of the reasons why babies like to put everything in their mouth. We soothe newborn babies through touch, stroking their back, tickling them lightly, and holding them closely. Massaging your baby is an extension of this comforting touch.
You can start the practice from birth, although it is advisable to wait until premature babies reach their due date before massaging starts. You can do it at home in the early days, and baby classes often start at around 6 weeks old. By joining group classes, you can also meet other new parents and their babies, which is a great way to socialise with parents and find people to talk to, who are in a similar situation to you.
If your baby doesn’t enjoy it straight away, don’t give up. You can keep trying by creating different settings, perhaps using some calming music or low lighting, and trying different oils and creams.
This can help to create space that will facilitate relaxation, which is one of the biggest benefits of baby massages.
The soothing moves encourage the release of oxytocin, a ‘feel-good’ hormone that makes your baby and you relax. It can be beneficial if you’re struggling to breastfeed, by helping both mother and baby feel calmer.
The relaxation can also help your baby to sleep, which is something that we all crave during the first months of becoming a parent. Melatonin is also released during the massaging movements, which promotes better sleeping. A study by the University of Warwick in 2006 found that infants aged 6 months or under got better sleep after being massaged.
Teaching you partner or grandparents how to perform baby massage can also help them to bond with the baby, providing a time where they can spend some one-to-one time with the baby. The repetitive motions accompanied by soft soothing noises and sounds can help your baby to recognise voices and then faces.
There are some medical ailments common to young babies that can be eased through massaging certain areas of the body. Constipation can be eased through slow, light circular movements around the abdomen. This can make the baby more comfortable and make it easier to go to the toilet.
Studies have shown that continuing to massage your child, as they become a toddler and then move into older childhood, can be beneficial in helping them to develop their relationships with you and other people.
Lucy Mayhew runs a baby massage group every Monday click here for more details. | 2024-01-27T01:27:04.277712 | https://example.com/article/1259 |
Lisa Reed, MA, NCC, LPC, CAADC
Licensed Professional Counselor
Helping people with Eating Disorders involves getting the person to like themselves, building up their self esteem and self worth. Education is necessary to confront faulty beliefs and actions and learn about healthy lifestyles. I am empathetic and understanding, but do not like to see people deliberately harming their bodies through either denying food or eating then binging. It may take awhile, but through a good caring, client therapist rapport and relationship, and using person centered and cognitive behavioral approaches, one can recover from eating disorders and live a happy, healthy, and normal life. | 2024-07-27T01:27:04.277712 | https://example.com/article/3085 |
Introduction
============
Bacterial wilt caused by *Ralstonia solanacearum* is one of the most important diseases in potato, tomato, eggplant, tobacco, and other Solanaceae plants ([@b25-69_19059]). This bacterium invades the plant body through wounded skin layers of the roots, immigrates into the vascular system, and spreads into the wood tissue system. Due to pathogenicity-related factors, such as viscous polysaccharides, bacterial cells themselves, and various enzymes, the conduit part is occluded to reduce the water-passing ability, causing wilting symptoms ([@b49-69_19059], [@b65-69_19059]). *R. solanacearum* occurs around the world mainly in tropical, subtropical, and temperate regions, with more than 200 plant species recognized as hosts ([@b9-69_19059], [@b24-69_19059], [@b25-69_19059]). The bacterium is soil-borne, which renders its complete removal difficult after the onset of invasion in fields ([@b24-69_19059], [@b25-69_19059]).
*R. solanacearum* is characterized by diverse phenotypic and genetic variations. According to the host range and physiological traits, it has been classified into five races and six biovars ([@b3-69_19059], [@b23-69_19059]). The phylogenetic analysis mainly classified it into four phylotypes, depending on the geographical origin: phylotype I (Asia), II (Americas), III (Africa), and IV (Indonesia) ([@b11-69_19059], [@b29-69_19059]). In Japan, *R. solanacearum* phylotype I/biovar 4/race 1 and phylotype IV/biovar N2/race 3 are major causal pathogens of bacterial wilt ([@b27-69_19059], [@b28-69_19059], [@b33-69_19059]). The two phylotypes have been identified at different times and places in potato cultivation fields, with phylotype I being more virulent and mainly detected in the hot season, from September to October, in warm regions of Japan ([@b28-69_19059], [@b33-69_19059], [@b34-69_19059]). In culture media, phylotype IV can grow at lower temperatures compared with phylotype I, which may explain why these two phylotypes are detected at different seasons in the fields ([@b33-69_19059], [@b34-69_19059]).
[@b22-69_19059] described over 200 cultivated and wild potato species. A common potato (*Solanum tuberosum*) is tetraploid (2*n* = 4*x* = 48), whereas diploid (*S. phureja*) (2*n* = 2*x* = 24) to pentaploid (2*n* = 5*x* = 60) cultivated species are also known ([@b22-69_19059]). The wild potato species are mainly diploid (2*n* = 2*x* = 24). Tuber-bearing *Solanum* species are mostly self-incompatible, and *S. tuberosum* is highly heterozygous with tetrasomic inheritance, a segregation pattern more complex than disomic inheritance ([@b22-69_19059]).
Bacterial wilt is one of the most important diseases in potato ([@b15-69_19059]). Although soil disinfection by chemical pesticides is effective, development of resistant varieties has been the most efficient approach for controlling bacterial wilt ([@b10-69_19059], [@b40-69_19059]). The genetic resistance to bacterial wilt has been reported in various cultivated potato species (including *S. tuberosum* and *S. phureja*) and the closely related wild species (including *S. chacoense*) ([@b5-69_19059], [@b12-69_19059], [@b13-69_19059], [@b35-69_19059], [@b32-69_19059], [@b53-69_19059], [@b55-69_19059], [@b61-69_19059]). Quantitative trait locus (QTL) analyses of bacterial wilt resistance in Solanaceae crops were conducted in tomato ([@b4-69_19059], [@b65-69_19059], [@b66-69_19059]), eggplant ([@b41-69_19059]), and tobacco ([@b39-69_19059], [@b48-69_19059]). In potato, 109 *Solanum chacoense*-specific simple sequence repeat alleles in 44 somatic hybrids between *S. chacoense* and *S. tuberosum* were surveyed, in which three alleles on chromosomes 2 and 9 were significantly associated with the resistance to *R. solanacearum* (race 1, biovar 3) ([@b5-69_19059]). [@b70-69_19059] employed *S. phureja* to generate an F~1~ mapping population and performed the bulked segregant analysis using sequence related amplified polymorphism markers. Three linkage groups harboring resistance QTLs were identified, but their associated chromosomes are unknown. The heritability of the resistance in potato is low due to its tetraploid nature, and the mode of inheritance of the bacterial wilt resistance is not yet clearly understood ([@b10-69_19059]).
A tetraploid breeding clone Saikai 35 carries resistance genes to potato cyst nematode (*H1*) and *Potato virus Y* (*Ry~chc~*) and exhibits high level of bacterial wilt resistance ([@b42-69_19059]). In the present study, we used a diploid resistant clone induced from Saikai 35 to conduct QTL analysis of the bacterial wilt resistance. The use of a diploid potato for genetic analysis can be more efficient than that of tetraploid and requires smaller populations to detect recessive genes ([@b45-69_19059], [@b47-69_19059]). In addition, the genetic analysis of diploid potato can circumvent the effect of double reduction by tetrasomic inheritance, impeding the estimation of genetic map distance ([@b45-69_19059]). Dense genetic maps were first constructed for resistant and susceptible diploid parents using 4,139 single nucleotide polymorphism (SNP) markers, which were generated from a 12,808 potato SolCAP SNP array ([@b1-69_19059], [@b8-69_19059]). The present study is the first to detect and map potato QTLs associated with resistance to bacterial wilt by saturated linkage map of genome-wide markers.
Materials and Methods
=====================
Plant materials
---------------
To facilitate genetic analysis, we used a diploid potato population obtained by crossing a diploid resistant clone and a diploid susceptible clone. The diploid resistant clone was obtained from Saikai 35, a tetraploid breeding clone highly resistant to bacterial wilt ([@b42-69_19059]), through parthenogenesis by crossing with the pollen of a haploid inducer *S. phureja* 460 (=Ivp35) and named 10-03-30 ([Fig. 1](#f1-69_19059){ref-type="fig"}). This clone also showed high resistance to bacterial wilt in field evaluations conducted over three seasons in Japan and by *in vitro* inoculation tests. This resistant parent (hereafter, RP) was crossed as the female parent with the susceptible diploid clone F~1~-1 (hereafter, SP) as the male parent to generate 94 F~1~ plants grown *in vitro* on the Murashige and Skoog (MS) medium ([@b43-69_19059]).
Inoculation and disease resistance test
---------------------------------------
The *in vitro* inoculation test was used for resistance evaluation of the F~1~ plants because the test is simple and reproducible, and the results were highly correlated with those in the field tests ([@b19-69_19059]). The *in vitro* screening medium, containing 30 mL vermiculite and 20 mL MS liquid medium in a glass tube (40 mm × 130 mm), was sterilized by autoclaving. The *in vitro*-grown plantlets were cut at nodes below the third or fourth leaf from the apex. The cut stem tips were transplanted onto a screening medium and incubated in a growth chamber at 20°C for two weeks until the inoculation with *R. solanacearum* to promote rooting. The night-day cycle was 16 h light at 3000--4000 lux and 8 h dark. The *R. solanacearum* strain MAFF327001 (phylotype I/biovar 4/race 1) ([@b19-69_19059], [@b28-69_19059], [@b57-69_19059]) was used in this study for the inoculation test. Phylotype I is distributed widely in Asia ([@b11-69_19059]). This strain was isolated from potato cultivated in Nagasaki Prefecture, the area with the highest frequency of the bacterial wilt disease in Japan. The MAFF327001 strain was grown at 30°C on 2,3,5-triphenyltetrazolium chloride solid medium ([@b36-69_19059]). The white fluidal colonies were transferred into casamino acid-peptone-glucose medium ([@b26-69_19059]). The concentration of inoculum suspension was determined by measuring OD at 600 nm and adjusted to 10^8^ colony-forming units mL^−1^. One milliliter of bacterial suspension was poured into each screening medium. The incubation temperature after the inoculation was 28°C. Ten plantlets per genotype were treated as one replicate, and three replicates were prepared for the experiment.
The resistance level was represented by the disease index (DI) measured 20 days after inoculation using a 0--4 scale on the basis of the extent of stem wilting: 0 (no symptoms), 1 (up to 25%), 2 (26--50%), 3 (51--75%), and 4 (76--100% of the stem wilted) ([@b19-69_19059]) ([Fig. 2](#f2-69_19059){ref-type="fig"}).
SNP genotyping
--------------
Approximately 100 mg of fresh leaves were collected from *in vitro* plantlets of the F~1~ plants, and total DNA was extracted using CTAB-LiCl method ([@b58-69_19059]). DNA concentration was measured by the Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). One microgram of dried DNA from each sample was sent to GeneSeek (Neogen Corporation, Lincoln, NE, USA) to obtain data from the 12K potato V2 SNP array ([@b1-69_19059], [@b8-69_19059]). The obtained microarray intensity data were analyzed using GenomeStudio Polyploid Clustering Ver 1.0 (Illumina Inc., San Diego, CA, USA) with default parameters and cluster distance of −0.07. After the analysis, all genotype calls were manually checked for accuracy; inaccurate data were treated as missing data.
Linkage map construction
------------------------
The obtained 12K SNP data were filtered by excluding poor quality SNPs. Thus, the SNPs lacking parental genotypes were excluded, and those that segregated into two clusters of parental types were selected. In addition, SNPs with week signals (Norm R \< 0.2) or with \>20% missing data were also excluded. As both diploid parents were highly heterozygous, the segregating population was regarded as a two-way pseudo testcross population ([@b18-69_19059]). The two parental maps were constructed using Carthagene Ver 1.0 ([@b17-69_19059]) with logarithm of odds (LOD) score of 10 and the maximum genetic distance between markers of 100 cM, with the latter being calculated based on Kosambi function ([@b37-69_19059]). The two-way pseudo testcross strategy described in [@b31-69_19059] was employed for linkage analysis. During the mapping process, SNPs that were differently located from or unanchored in Potato pseudomolecules (PMs) v. 4.03 ([@b54-69_19059]) were excluded.
QTL analysis
------------
QTL analysis was conducted on a backcross design by regarding the F~1~ population as a backcross population in QTL Cartographer version 2.5 ([@b67-69_19059]) with backcross mode and using composite interval mapping, which is specifically designed to reduce background noise that can affect QTL detection. Parameters of the analysis were set for model 6 with window size of 2 cM, probability for "into" of 0.05, and probability for "out" of 0.05. A LOD threshold for QTL detection was calculated by permutation tests with 1,000 repetitions to control for genome-wide error rate of 5%. QTL analysis was separately performed for each of the two parental linkage maps. Linkage maps and QTL positions were drawn by MapChart 2.30 ([@b64-69_19059]).
Statistical analysis
--------------------
All statistical analyses, excluding QTL analysis, were done in Rcmdr package ([@b14-69_19059]) of R version 3.3.3. ([@b50-69_19059]). Analysis of variance (ANOVA) was used to assess the difference between each QTL, in which the data of the three replicates obtained from the *in vitro* tests were used as a responsive variable.
Results
=======
Evaluation of the resistance to bacterial wilt
----------------------------------------------
*In vitro* inoculation tests were conducted for 10 plantlets per genotype with three replications. ANOVA test confirmed no significant difference among the three replicates (*P* = 0.1797). Thus, the DIs of the triplicates could be averaged and used as a DI of each genotype. The DI of the RP was 0.60 and that of the SP was 2.77. The DI of F~1~ ranged from 0.17 to 3.63; it was lower in some F~1~ plants than in RP, but higher in other F~1~ plants than in SP (transgressive segregation). The F~1~ plants' DIs were distributed normally, and their mean value was 1.69 ([Fig. 3](#f3-69_19059){ref-type="fig"}).
Linkage map construction
------------------------
After filtering the 12,808 SNPs, we identified 4,139 SNPs that were polymorphic between RP and SP and used them to create genetic maps ([Table 1](#t1-69_19059){ref-type="table"}). In RP, 1,476 SNP loci were heterozygous (AB genotype), while these SNPs were homozygous (AA genotype) in SP and segregated among the F~1~ plants to AA (SP type) and AB (RP type) genotypes. In linkage analysis, these SNP loci were mapped to 422 positions, spanning over 12 RP chromosomes. This map is referred to as RP map hereafter. In SP, 2,663 SNP loci were heterozygous and segregated among the F~1~ plants; these SNP loci were homozygous in RP. These were mapped to 475 positions on 12 SP chromosomes; the map is denoted as SP map hereafter. The total length of the RP map was 948.2 cM, and that of the SP map was 828.4 cM. The average distance between SNPs was 0.6 cM in the RP map and 0.3 cM in the SP map, respectively. Distorted segregation was observed in the RP chromosome 12 and in the SP chromosomes 1, 2, 11, and 12 (data not shown).
QTL analysis
------------
QTL analysis was performed for the DIs of the F~1~ population using the RP and SP maps. According to the permutation tests with 1,000 repetitions, the LOD threshold at the 5% significance level was 2.87 for the RP map and 2.80 for the SP map. At these threshold levels, five QTLs (*qBWR-1*, *qBWR-2*, *qBWR-3*, *qBWR-4*, and *qBWR-5*) on chromosomes 1, 3, 7, 10, and 11 were detected using the composite interval mapping method ([Table 2](#t2-69_19059){ref-type="table"}, [Fig. 4](#f4-69_19059){ref-type="fig"}). The QTL with the highest effect was *qBWR-3*, identified using the RP map, and it explained 18.4% of the total variance. At the SNP locus (solcap_snp_c2_4555) nearest to the maximum LOD of *qBWR-3*, the mean DIs of the RP-type and SP-type genotypes were significantly different at 1.40 and 2.01, respectively. The other four QTLs were detected using the SP map. The maximum LOD score and explained variance of each of these QTLs ranged from 3.26 to 5.56 and from 9.3 to 15.6%, respectively, in the RP- and SP-type genotypes. The mean DIs among F~1~ plants with the RP-type genotype and those with the SP-type genotype at the SNP loci nearest to the maximum LODs were significantly different at 5% level, except for the SNP (solcap_snp_c2_37816) of *qBWR-1* ([Table 2](#t2-69_19059){ref-type="table"}). As expected, the RP-type genotypes were more resistant than the SP-type genotypes at *qBWR-2*, *qBWR-3*, and *qBWR-4*. However, at *qBWR-1* and *qBWR-5*, the SP-type genotype was more resistant than the RP-type genotype.
The ANOVA of all detected QTLs as factors indicated significant effects of each QTL, as well as of the interactions among *qBWR-1*, *qBWR-3*, and *qBWR-5* ([Table 3](#t3-69_19059){ref-type="table"}); that is, the resistance effect of *qBWR-1* was possible only if both *qBWR-5* and *qBWR-3* were resistant genotypes (*p* \< 0.10). If genotypes at either *qBWR-3* or *qBWR-5* were susceptible genotypes, *qBWR-1* did not show the resistant effect ([Table 4](#t4-69_19059){ref-type="table"}). Thus, an epistatic effect of *qBWR-1* to both *qBWR-3* and *qBWR-5* was disclosed.
In the F~1~ population, the mean DI decreased by increasing the number of resistant alleles at the five QTLs in a single individual: the mean DIs was 2.83 for F~1~ plants with no resistant QTL, 2.41 for those with one resistant QTL, 2.13 for those with two QTLs, 1.54 for those with three QTLs, 1.17 for those with four QTLs, and 0.43 for those with five QTLs ([Fig. 3](#f3-69_19059){ref-type="fig"}).
Discussion
==========
This study analyzed the segregating diploid population of potato obtained by crossing two heterozygous parental lines. In full-sib population from two heterozygous parents, segregations of two genotypes (AA:AB) to four genotypes (AC:AD:BC:BD) can be expected, which complicates genetic analysis. In this study, to simplify the genetic analysis, the population was treated as a "two-way pseudo-testcross" population ([@b18-69_19059]), by using only polymorphic loci that were heterozygous in one parent and homozygous in the other parent. The simple association between phenotype and allele revealed the regions associated with the bacterial wilt resistance by evaluating the segregation of two genotypic classes (AA vs. AB).
The RP 10-03-30 of F~1~ population is a diploid clone derived from a tetraploid clone Saikai 35 ([@b42-69_19059]), which was obtained by breeding *S. phureja* and *S tuberosum*, and the SP F~1~-1 is an interspecific hybrid between *S. chacoense* and *S. phureja* ([@b30-69_19059]). Some clones of both *S. chacoense* and *S. phureja* are popular sources of bacterial wilt resistance ([@b5-69_19059], [@b15-69_19059]). In addition, some cultivars of *S. tuberosum* were confirmed to be resistant to bacterial wilt ([@b32-69_19059], [@b35-69_19059]). The bacterial wilt resistant QTLs in F~1~ population likely originated from *S. chacoense*, *S. phureja*, and *S. tuberosum*.
As mentioned above, bacterial wilt resistance of potato is controlled by QTLs. It was assumed that *S. phureja* has three major resistance genes ([@b51-69_19059]), whereas the resistance of *S. tuberosum* is encoded by a recessive resistance gene ([@b35-69_19059]) and related to plant heat tolerance ([@b62-69_19059]). In contrast, bacterial wilt resistance in *S. phureja*, *S. chacoense*, and *S. tuberosum* has been reported to be affected by a specific strain of *R. solanacearum*, the potato genotype, and environment interaction ([@b63-69_19059], [@b69-69_19059]); thus, bacterial wilt resistance in potato is a complex genetic process ([@b46-69_19059]). The locus position of two genes responsible for resistance to *R. solanacearum* (race 1, biovar 3) was presumed to be on chromosomes 2 and 9 of *S. chacoense*, respectively ([@b5-69_19059]). It is hardly clarified in other gene locus positions.
The bacterial wilt resistance derived from RP and SP was quantitatively inherited to the F~1~ population ([Fig. 3](#f3-69_19059){ref-type="fig"}), which is in agreement with previous reports ([@b35-69_19059], [@b51-69_19059], [@b62-69_19059], [@b63-69_19059], [@b68-69_19059], [@b69-69_19059]). The QTL analysis using composite interval mapping detected five resistance QTLs ([Table 2](#t2-69_19059){ref-type="table"}, [Fig. 4](#f4-69_19059){ref-type="fig"}). In the F~1~ population, the RP-type genotypes were more resistant than the SP-type genotypes at *qBWR-2*, *qBWR-3*, and *qBWR-4*, whereas the SP-type genotypes were more resistant at *qBWR-1* and *qBWR-5*. These results suggest that RP was heterozygous with resistant allele and susceptible allele at *qBWR-3*, homozygous with a resistant allele at both *qBWR-2* and *qBWR-4*, and homozygous with a susceptible allele at both *qBWR-1* and *qBWR-5*, whereas SP was homozygous with a susceptible allele at *qBWR-3* and heterozygous at other QTLs. The two QTLs (*qBWR-2* and *qBWR-4*) were speculated to exhibit the possibility of recessive inheritance ([Table 2](#t2-69_19059){ref-type="table"}). The detected QTLs *qBWR-1* and *qBWR-5* (chromosome 1 and 11) in SP were derived either from one of its parents, *S. chacoense* 525-3 or *S. phureja* 1.22, or from both. In contrast, [@b5-69_19059] reported that the resistant genes derived from *S. chacoense* were on chromosomes 2 and 9. Because the *S. chacoense* genotype and the biovar of *R. solanacearum* used in the present study differ from those in previous studies, it is difficult to discuss which origin contributed to the resistance detected in our study. Alternatively, if we assume that the resistance reaction was fully derived from the RP, the RP had three QTLs promoting the resistance and two QTLs suppressing the resistance. However, considering that some of the F~1~ plants were more susceptible than the SP or more resistant than the RP ([Fig. 3](#f3-69_19059){ref-type="fig"}), the former explanation stating the presence of resistant genes in both parents would be more probable.
The detected QTLs explained 9.3--18.4% of the variance and no major QTL was detected. However, the tendency to improve the degree of individual resistance was confirmed as the number of QTLs increased---one F~1~ plant had five resistant alleles and DI of 0.43, and thus it was more resistant than the RP (DI = 0.60) ([Fig. 3](#f3-69_19059){ref-type="fig"}). Bacterial wilt resistance in potato population could be improved by accumulating the resistance of different origin ([@b62-69_19059]), which is evident in our study. In addition, the interaction between QTLs contributed to the higher resistance to bacterial wilt ([Tables 3](#t3-69_19059){ref-type="table"}, [4](#t4-69_19059){ref-type="table"}). [@b62-69_19059] proposed the possibility of combining ability (effect caused by the combination of mating parents) affecting resistance levels to bacterial wilt, which may be explained by the genetic interaction between QTLs suggested in this study.
A study on the resistance of the model plant *Arabidopsis thaliana* to bacterial wilt revealed that receptor protein kinase gene CLAVATA 1 (*CLV 1*) enhanced resistance to bacterial wilt ([@b21-69_19059]). *CLV 1* plays a crucial role in the regulation of stem cell homeostasis at the shoot ([@b6-69_19059], [@b7-69_19059]) and root apical meristems ([@b56-69_19059]). The SNP solcap_c2_50637 (Chromosome 3, 15.0 cM) closest to *qBWR-2* ([Fig. 4](#f4-69_19059){ref-type="fig"}) is included in *CLV 1* (PGSC0003DMG400016685), and it was assumed that *CLV 1* and *qBWR-2* were correlated. Tomato is a related crop species with almost identical chromosome synteny to that of potato ([@b60-69_19059]). In tomato, two major QTLs, *Bwr-6* on chromosome 6 and *Bwr-12* on chromosome 12, were identified for resistance to phylotype I and phylotype II strains of *R. solanacearum* ([@b66-69_19059]). The QTLs on chromosomes 1, 3, 7, 10, and 11, detected in the present study, were differently located from tomato QTLs. Five hot spots for resistance genes have been identified on potato and tomato chromosomes 5 (two hot spots), 9, 11, and 12 ([@b16-69_19059]). *qBWR-5* was identified in a region very close to or within the resistance cluster on chromosome 11, which also harbors the resistance genes to potato wart (*Sen1*; [@b44-69_19059]), *Potato virus Y* (*Ry~adg~*; [@b20-69_19059]), and white cyst nematode *Globodera pallida* (*GpaXI^1^~tar~*; [@b59-69_19059]). The other four QTLs were not specifically located within these resistance gene clusters. However, *qBWR-1* was located in the proximity of the potato wart resistance gene (*Rse-1b*; [@b44-69_19059]), and *qBWR-2* and *qBWR-3* were positioned in the vicinity of resistance QTLs to *Globodera rostochiensis* (*Gro1.4* and *Gro1*, respectively; [@b2-69_19059], [@b38-69_19059]). Because the genes resistant to various pests and diseases are also clustered in potato, new resistant genes may be located in the proximity of QTLs reported here. These results may facilitate the identification of other candidate genes and molecular functions of resistance QTLs.
In conclusion, we identified and mapped five novel QTLs for bacterial wilt resistance; our study is the first to conduct QTL analysis of the bacterial wilt resistance in potato by genome-wide markers. In general, there is a possibility that QTLs are linked to undesirable agronomic traits or they are difficult to transfer into cultivars ([@b9-69_19059]). The resistant parent used in the present study was 10-03-30, a diploid of Saikai 35. Saikai 35 is a breeding clone carrying potato cyst nematode resistance (*H1*) and *Potato virus Y* resistance (*Ry~chc~*) genes and bacterial wilt resistance ([@b42-69_19059]), and it has been used as breeding material. Recently, Saikai 35 was used as a female parent to breed a new variety, 'Nagasaki Kogane', which has *H1* and *Ry~chc~* genes and exhibits a high level of resistance to bacterial wilt ([@b52-69_19059]). 'Nagasaki Kogane' is equivalent to Saikai 35 in the mean tuber weight and marketable yield which are one of the most important traits in economical potato production. This cultivar has high starch content among cultivars implemented in double cropping practice and does not have a red tuber eyes possessed by Saikai 35, which is recognized to be a poor trait in regions with double cropping pattern ([@b42-69_19059], [@b52-69_19059]). This implies that the QTLs found in the present study are not linked with serious genetic defects. However, it is unknown whether the resistance of Saikai 35 can be fully explained by the five QTLs, and it is necessary to confirm whether these QTLs function similarly in the tetraploid genetic background. For potato breeding, a discovery of these novel QTLs is an important step toward development of molecular markers for bacterial wilt resistance.
We thank Dr. Kazuyoshi Hosaka, Obihiro University of Agriculture and Veterinary Medicine, for improving an earlier version of the manuscript. This research was funded by Nagasaki Prefecture.
**Author Contribution Statement**
IH designed and executed the study, prepared all tables and figures, and wrote the manuscript. KM completed the test design, supervised the experiments, and corrected the manuscript. TN supervised the test design. MY contributed to the test design and data analysis and corrected the manuscript. TH supervised the linkage analysis and QTL analysis.
![The pedigree of the segregating F~1~ population.](69_19059_1){#f1-69_19059}
![Plants with the disease index score 0 (no symptom) and score 4 (76--100% wilted) in the *in vitro* potato resistance assay for *Ralstonia solanacearum*. Caps were removed for photography.](69_19059_2){#f2-69_19059}
![Distribution of the disease index (DI) after inoculation with *Ralstonia solanacearum* in a segregating population, which consisted of 94 genotypes from the cross between a resistant parent (RP) and a susceptible parent (SP). The number of resistant quantitative trait loci (QTLs) possessed by each F~1~ plant is represented by a color density in each bar. The numbers in the legend indicate the mean of disease index for each group.](69_19059_3){#f3-69_19059}
![Five quantitative trait loci (QTLs) detected on susceptible parent (SP) chromosome 1 (*qBWR-1*), SP chromosome 3 (*qBWR-2*), resistant parent (RP) chromosome 7 (*qBWR-3*), SP chromosome 10 (*qBWR-4*), and SP chromosome 11 (*qBWR-5*). The solid box and the loci of bold letters represent a QTL region. The order of the markers located at the same loci follows that of the physical position in Potato pseudomolecules v. 4.03 ([@b54-69_19059]).](69_19059_4){#f4-69_19059}
######
The number of segregating single nucleotide polymorphisms (SNPs) derived from a resistant parent (RP) and a susceptible parent (SP) and their number of mapped positions and map lengths
Chromosome Genetic map of RP Genetic map of SP Total number of SNPs Total number of map positions
------------ ------------------- ------------------- ---------------------- ------------------------------- ----- ------- ------ -----
1 239 47 110.5 381 57 80.2 620 104
2 50 20 50.0 324 44 78.4 374 64
3 95 26 83.6 309 39 88.8 404 65
4 135 35 90.2 163 42 69.1 298 77
5 91 28 73.7 217 37 69.6 308 65
6 107 41 73.0 186 35 59.9 293 76
7 121 34 79.3 191 39 81.0 312 73
8 118 27 70.8 111 29 50.5 229 56
9 200 65 85.0 108 38 69.4 308 103
10 77 28 77.0 179 35 62.0 256 63
11 136 36 68.9 238 30 58.8 374 66
12 107 35 86.2 256 50 60.7 363 85
Total 1476 422 948.2 2663 475 828.4 4139 897
######
Quantitative trait loci for bacterial wilt resistance detected in the F~1~ population of a resistant (RP) and a susceptible (SP) parent
QTL Chr. Map Position (cM) Max. LOD (cM) Max. LOD score Explained variance (%) Mean disease index (SE) at the SNP locus nearest to the max. LOD position
---------- ------ ----- --------------- --------------- ---------------- ------------------------ --------------------------------------------------------------------------- ------ ---------------- ------------------------ ------------------------ ---------
*qBWR-1* 1 SP 76.8--81.2 79.1 4.09 11.0 c2_37816 79.1 SP-type hetero 1.75 ± 0.09 (*n* = 50) 1.60 ± 0.12 (*n* = 42) 0.067
*qBWR-2* 3 SP 11.8--18.0 15.0 5.56 15.6 c2_50637 15.0 RP-type homo 1.49 ± 0.08 (*n* = 56) 1.98 ± 0.12 (*n* = 38) \<0.005
*qBWR-3* 7 RP 14.2--26.3 25.3 5.33 18.4 c2_4555 25.3 RP-type hetero 1.40 ± 0.11 (*n* = 46) 2.01 ± 0.11 (*n* = 45) \<0.001
*qBWR-4* 10 SP 6.6--11.9 8.8 5.54 15.5 c2_32779 8.8 RP-type homo 1.46 ± 0.08 (*n* = 47) 1.91 ± 0.12 (*n* = 45) 0.007
*qBWR-5* 11 SP 31.6--37.0 36.0 3.26 9.3 c2_12333 35.0 SP-type hetero 2.17 ± 0.15 (*n* = 20) 1.54 ± 0.08 (*n* = 72) \<0.001
The mean of disease indices and the number of individuals were calculated excluding individuals with at least one missing data at each SNP marker.
Mann-Whitney *U* test was performed on the mean of the disease indices between individuals of RP- and SP-type genotypes.
Chr., chromosome; SNP, single nucleotide polymorphism; LOD, logarithm of odds.
######
Analysis of variance representing a significant interaction among three quantitative trait loci (QTLs)
QTL Df F value *P* value
-------------------------------- ---- --------- -----------
*qBWR-1* 1 12.87 \<0.001
*qBWR-2* 1 22.88 \<0.001
*qBWR-3* 1 14.58 \<0.001
*qBWR-4* 1 20.01 \<0.001
*qBWR-5* 1 17.69 \<0.001
*qBWR-1* × *qBWR-3* × *qBWR-5* 1 3.97 \<0.047
######
Interaction among three quantitative trait loci (QTLs) (*qBWR-1*, *qBWR-3*, and *qBWR-5*)
*qBWR-3* (c2_4555) *qBWR-5* (c2_12333) *qBWR-1* (c2_37816)[a](#tfn4-69_19059){ref-type="table-fn"} *P* value[b](#tfn5-69_19059){ref-type="table-fn"}
----------------------- ----------------------- ------------------------------------------------------------- --------------------------------------------------- -------
RP type (resistant) SP type (resistant) 1.12 ± 0.10 (*n* = 15) 1.35 ± 0.11 (*n* = 21) 0.072
RP type (susceptible) 1.76 ± 0.16 (*n* = 5) 2.01 ± 0.26 (*n* = 3) 0.653
SP type (susceptible) SP type (resistant) 1.79 ± 0.24 (*n* = 14) 1.91 ± 0.09 (*n* = 18) 0.143
RP type (susceptible) 2.47 ± 0.32 (*n* = 6) 2.28 ± 0.35 (*n* = 6) 0.748
The mean of disease indices and the number of individuals were calculated excluding individuals with at least one missing data at each SNP marker.
Mann-Whitney *U* test was performed on the mean of the disease indices between individuals of the resistant parent (RP)-type and the susceptible parent (SP)-type genotypes.
[^1]: Communicated by Kenji Katayama
| 2023-11-12T01:27:04.277712 | https://example.com/article/8438 |
Q:
Motherboard Compatability
The amount of Video Cards a motherboard can support (if using powered risers) is only limited by the number of PCI-E slots, correct? I've found a board (MSI - B250 GAMING M3 ATX LGA1151 Motherboard) that has 2 PCI-E 16x and 4 PCI-E 1x. If I use powered risers there should be no issue right?
A:
Not necessarily correct, though it may be correct in your situation. It appears some people have issues with fully populating the PCI-e slots, though it's unclear whether a BIOS update or reconfiguration would have helped.
I also recently read something on a review site that was testing a motherboard for fun that supported a ridiculous number of PCI-e slots (pretty sure it was more than 10). However, it refused to work when fully populated with AMD cards. All slots were usable when a few nVidia cards were used. Not clear whether this was an OS or hardware limit. Speaking of which, you may also wish to consider OS limits. I seem to recall encountering instances of people running into walls with certain versions of Windows 8 and 5+ GPUs.
I can't say for certain that all motherboards can support as many GPUs as they have PCI-e slots, but I can say that some configurations may involve tofurkey sacrifices and head-banging.
P.S. I'm not endorsing (or discouraging) this particular setup, but you should be aware of things like the potential for fire when dealing with high-power setups and equipment of questionable repute (I'm looking at you, powered risers of unknown origin).
| 2024-07-21T01:27:04.277712 | https://example.com/article/1183 |
54-year-old artist also worked in Tokyo Kogakuin College of Technology's manga department
The wife of Ganbare Goemon manga artist Hiroshi Obi posted on his Twitter account on Sunday that he passed away on Sunday at 7:40 a.m. after being taken to the hospital on Saturday evening with a brain stem hemorrhage. He was 54.
Obi, who is from Hokkaido, debuted as a manga creator in 1982 in a special edition of Monthly Shonen Jump with the Hoshi no Ōji-sama manga. He began serializing the manga version of Konami's Ganbare Goemon video game franchise (known as Goemon or Mystical Ninja in English) in Kodansha's Comic Ponpon magazine in 1991, and continued to publish various Ganbare Goemon manga adaptations throughout the 1990s.
Obi had recently been working on a Yatterman remake manga titled Yatterman Dengeki Daisakusen! . He also recently worked on a refurbished edition of his Ganbare Goemon Yuki-hime Kyūshutsu Emaki manga, which Kodansha released last November.
Obi had also been working as a lecturer in the manga department of Tokyo Kogakuin College of Technology since 2007.
Sources: Tokyo Sports, J-Cast News, Asahi Shimbun via Yaraon! | 2023-08-11T01:27:04.277712 | https://example.com/article/4134 |
#!/usr/bin/env python3
# Copyright (c) Facebook, Inc. and its affiliates. All Rights Reserved
from unittest import TestCase
import torch
from pytext.metric_reporters.word_tagging_metric_reporter import (
MultiLabelSequenceTaggingMetricReporter,
)
from pytext.metrics import MultiLabelSoftClassificationMetrics
class TestMultiLabelSequenceTaggingMetricReporter(TestCase):
def test_calculate_metric(self):
metrics_reporter = MultiLabelSequenceTaggingMetricReporter(
label_names=["set1", "set2"],
pad_idx=[-1, -1],
channels=[],
label_vocabs=[["l1", "l2"], ["s1", "s2", "s3"]],
)
# shape of the tensors: bsz * turn
targets = (
torch.tensor([[0, 1, 0], [0, 1, 0], [1, -1, -1]]),
torch.tensor([[0, 2, 1], [0, 1, 2], [0, 1, -1]]),
)
preds = (
torch.tensor([[0, 0, 0], [0, 1, 0], [1, 1, 1]]),
torch.tensor([[0, 1, 1], [0, 1, 2], [1, 1, 2]]),
)
scores = (torch.rand(3, 3, 2), torch.rand(3, 3, 3))
metrics_reporter.add_batch_stats(
n_batches=1,
preds=preds,
targets=targets,
scores=scores,
loss=None,
# just to mock the batch size
m_input=([0, 0, 0],),
)
metrics_reporter.add_batch_stats(
n_batches=1,
preds=preds,
targets=targets,
scores=scores,
loss=None,
# just to mock the batch size
m_input=([0, 0, 0],),
)
self.assertEqual(len(metrics_reporter.all_preds), 6)
self.assertEqual(len(metrics_reporter.all_preds[0]), 2)
self.assertEqual(len(metrics_reporter.all_preds[0][1]), 3)
self.assertEqual(len(metrics_reporter.all_scores), 6, "should have 6 examples")
self.assertEqual(
len(metrics_reporter.all_scores[0]), 2, "example1 should have 2 sets"
)
self.assertEqual(
len(metrics_reporter.all_scores[0][0]),
3,
"example1 set1, should have 3 turns",
)
self.assertEqual(
len(metrics_reporter.all_scores[0][0][0]),
2,
"example1 set1, should have 2 scores (2 labels)",
)
self.assertEqual(
len(metrics_reporter.all_scores[0][1][0]),
3,
"example1 set2, should have 3 scores (3 labels)",
)
metrics = metrics_reporter.calculate_metric()
self.assertTrue(isinstance(metrics, MultiLabelSoftClassificationMetrics))
| 2024-04-25T01:27:04.277712 | https://example.com/article/1124 |
[A novel image processing and analysis system for medical images based on IDL language].
Medical image processing and analysis system, which is of great value in medical research and clinical diagnosis, has been a focal field in recent years. Interactive data language (IDL) has a vast library of built-in math, statistics, image analysis and information processing routines, therefore, it has become an ideal software for interactive analysis and visualization of two-dimensional and three-dimensional scientific datasets. The methodology is proposed to design a novel image processing and analysis system for medical images based on IDL. There are five functional modules in this system: Image Preprocessing, Image Segmentation, Image Reconstruction, Image Measurement and Image Management. Experimental results demonstrate that this system is effective and efficient, and it has the advantages of extensive applicability, friendly interaction, convenient extension and favorable transplantation. | 2024-07-20T01:27:04.277712 | https://example.com/article/2705 |
Land for Sale in Hawaii
Find Farms, Ranches, Acreage, and Country Homes for Sale
Recent internal data shows nearly $2 billion in farms, ranches and other land for sale in Hawaii. The combined size of land for sale in Hawaii is 37,223 acres. Of the 5 counties in the state, Hawaii County had the most rural property and land for sale. Hawaii ranks among the country's smallest states in terms of size, covering an area of 10,932 square miles (7 million acres). Of this area, 6,423 square miles (58.8 percent) is land, while the remaining 4,509 square miles (41.2 percent) is covered by water (defined as inland lakes, Great Lakes water, coastal waters or territorial waters). Lands of America research shows that 81 percent of land in Hawaii is privately owned. According to U.S. Census Bureau data, Hawaii has 7,000 farms totaling 1 million acres, placing the state at number 44 in the country in terms of the number of farms in the state; the state ranks 43rd given the size of its farming acreage (Hawaii ranks 41st when factoring total agriculture acreage as a proportion of the entire state). Hawaii is one of the country's smallest states in terms of size, covering an area of 10,932 square miles (7 million acres). In total, 6,423 square miles is land, while the remaining 4,509 square miles is made up of water.
LOOKING FOR A NEW HOME? This home is nearly brand new. This 2 bedroom plus den has GREAT VIEWS of the Ocean and the West Maui Mountains. Completely Remodeled including new electric, plumbing, windows,new walls and roof. High end finishes include bamboo floors, granite counters, new cabinetry, and stainless steel appliances. Don't miss this one. Your home has been appointed so that you will find it a comfortable new home. The bathrooms are remodeled with granite counter tops, new cabinetry, and porcelain tile. Wonderful upcountry breezes and Mountain and ocean views from your drive. Don't miss this huge value in Pukalani that is likely to sell very quickly. Lowest priced home available in Pukalani of anything it's size. This is such a deal
LOOKING FOR A NEW HOME? This home is nearly brand new. Completely Remodeled including new electric, plumbing, windows,new walls and roof. High end finishes include bamboo floors, granite counters, new cabinetry, and stainless steel appliances. Don't miss this one. Your home has been appointed so that you will find it a comfortable new home. The bathrooms are remodeled with granite counter tops, new cabinetry, and porcelain tile. Don't miss this huge value in Pukalani that is likely to sell very quickly. Wonderful upcountry breezes and Mountain and ocean views from your drive. Just over 10 minutes to Kahului. Lowest priced home available in Pukalani of anything it's size. This is such a deal, priced lower than un-remodeled units. This is a
LOOKING FOR A NEW HOME? This home is nearly brand new. GREAT VIEWS of the Ocean and the West Maui Mountains. Completely Remodeled including new electric, plumbing, windows,new walls and roof. High end finishes include bamboo floors, granite counters, new cabinetry, and stainless steel appliances. Don't miss this one. Your home has been appointed so that you will find it a comfortable new home. The bathrooms are remodeled with granite counter tops, new cabinetry, and porcelain tile. Wonderful upcountry breezes and Mountain and ocean views from your drive. Just over 10 minutes to Kahului. Don't miss this huge value in Pukalani that is likely to sell very quickly. Lowest priced home available in Pukalani of anything it's size. This is such a
LOOKING FOR A NEW HOME? LOWEST PRICED REMODELED HOME IN PUKALANI. Completely Remodeled including new electric, plumbing, windows,new walls and roof. High end finishes include bamboo floors, granite counters, new cabinetry, and stainless steel appliances. Don't miss this one. Your home has been appointed so that you will find it a comfortable new home. Wonderful upcountry breezes and Mountain and ocean views from your drive. The bathrooms are remodeled with granite counter tops, new cabinetry, and porcelain tile. Don't miss this huge value in Pukalani that is likely to sell very quickly. Lowest priced home available in Pukalani of anything it's size. This is such a deal, priced lower than un-remodeled units. This is a new developer offering
Waiting for your touches. This very large 4 bedroom 1 bath home sits on a large 10,000 sq ft lot with a brand new fence. For the lover of old plantation style homes, this home has a beautiful built in pantry area and the old fashion metal sink. You're sure to find some interesting features in your new home. Your home has its own private driveway and is part of a new developer offering. Wonderful upcountry breezes and Mountain and ocean views from your drive. Just over 10 minutes to Kahului. Don't miss this deal to come in and fix the home just the way that you would have it redone. Home has wonderful breezes. Near by amenities in the wonderful town of Pukalani include a pool, park, shopping (foodland, ace hardware, post office, dining) and
Waiting for your touches. This very large 4 bedroom 1 bath home sits on a large 10,000 sq ft lot with a brand new fence. For the lover of old plantation style homes, this home been refreshed and has newer carpet. You're sure to find some interesting features for this home. Your new home is part of a new developer offering. Just over 10 minutes to Kahului. Don't miss this deal to come in and fix the home just the way that you would have it redone. Home has wonderful breezes. Near by amenities in the wonderful town of Pukalani include a pool, park, shopping (foodland, ace hardware, post office, dining) and Golf.
Come home to Kula 200, one of Upcountrys premier neighborhoods. Enter this tranquil estate through a private gate and tree-lined driveway. The gracious 4 bedroom, 3 bathroom ranch-style home is over 4,200 sq. ft. under roof plus a 3-car garage. There's a large, gourmet kitchen with granite counter tops, lovely cabinetry, and eat-in dinning, along with a separate formal dining room. Take it easy in the family room or sit back and enjoy the fireplace in the formal living room. The remodeled, contemporary bathrooms are stunning. After a day of work or play, relax in the six-person hot tub in the huge recreation room, and enjoy al fresca dinning under the stars on the lanai. The stately cottage was built in 2005 with quality craftsmanship and l
Big Ocean views and quality finishes make this home a stand out in the price range. The home was remodeled from top to bottom in 2010 with additional work done in 2019. Imperial plaster walls, poured concrete counter tops, a monkeypod wood bar top, acid washed concrete floors, white washed vaulted ceilings and Moroccan tile accents are some of the features that distinguish this home. In addition to the two bedrooms, there is an enclosed porch area that would make a great office space. The home has big views of Kahului Harbor, The West Maui Mountains and Molokai. There is a great concrete deck area for taking in the ocean and mountain views. This is unit B of a three unit CPR. Contact your favorite Realtor to set up a showing.
LandsofHawaii.com is part of the Lands of America Network, the largest rural listing service in the Nation. The Network specializes in land for Sale which includes farms, ranches, mountain property, lake houses, river homes, beachfront homes, country homes, and residential homes in smaller towns across the country. These properties have many diverse uses including recreational and agricultural activities like hunting, fishing, camping, backpacking, horseback riding, four wheeling, grazing cattle, gardening, vineyards, cropland, raising horses, and other livestock. | 2024-05-24T01:27:04.277712 | https://example.com/article/4215 |
Introduction
============
Loss of vascular tone is an important factor in the development of severe sepsis, septic shock and multiple organ failure. Recent work by Wang and colleagues provided experimental evidence that kynurenine, a metabolite of the amino acid L-tryptophan, is a mediator of vasodilation and subsequent hypotension during murine endotoxemia \[[@B1]\]. In different mouse models of sepsis and additional in vitro experiments, they found that kynurenine acts as a novel endothelium-derived relaxing factor on resistance vessels by stimulating the activity of soluble guanylyl cyclase and adenylyl cyclase in smooth muscle cells. In addition the authors could show that injecting mice with bacterial lipopolysaccharide (LPS) specifically induces the rate-limiting enzyme for kynurenine production, namely indoleamine 2,3-dioxygenase 1 (IDO), in vascular endothelial cells \[[@B1]\]. Consistent with these findings, pharmacological blockade or genetic deletion of IDO increases survival in murine endotoxemia \[[@B2]\]. However, animal studies are potentially confounded by major inter-species differences in the sensitivity and immune response to various types of inflammatory stimuli \[[@B3]\]. The aim of this study was thus to correlate temporal changes in IDO activity (plasma kynurenine/L-tryptophan ratio) with the onset of hypotension in humans. Therefore, we re-measured plasma kynurenine and L-tryptophan, and calculated the IDO activity in serial samples from a well-defined human endotoxemia model \[[@B4],[@B5]\].
Materials and methods
=====================
Endotoxemia model
-----------------
Six healthy male subjects, aged 32 ± 4 years, were admitted to the research unit of our intensive care department. The local medical ethics committee (Medisch Ethische Toetsingsingscommissie, METc, of the University Medical Center Groningen, NL) approved the study and written informed consent was obtained from all subjects before enrolment. Subjects were admitted 15 h prior to endotoxin infusion. A radial artery catheter was placed for blood sampling and arterial blood pressure measurement. During the study, systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MAP) and pulse rate were measured continuously. At time point zero (0 h) the volunteers received a 1-min infusion of endotoxin (Escherichia coli LPS, batch EC-6, US Pharmacopeia, Twinbrook Parkway, Rockville, MD, USA) at a dose of 4 ng/kg body weight (10,000 endotoxin units/μg) via an indwelling venous catheter. Blood samples for marker analysis were obtained pre-dose and at several time points up to 24 h after endotoxin infusion. All samples were immediately placed on ice, centrifuged (1,500G, 15 min, 4°C) and stored at -70°C until analysis. Data from this study have been reported extensively elsewhere \[[@B4],[@B5]\].
Quantification of tryptophan, kynurenine, and soluble adhesion molecules
------------------------------------------------------------------------
Levels of tryptophan and kynurenine were determined using a liquid chromatography-tandem mass spectrometry (LC-MS/MS) method utilizing deuterated internal standards for both analytes. The method was adapted from de Jong et al. \[[@B6]\]. In short, plasma samples were prepared for analysis by protein precipitation with acetonitril. After centrifugation, the clear supernatant was stripped from the acetonitrile portion by vacuum centrifugation and the aqueous residue was injected into the LC-MS/MS system. Chromatographic separation was achieved on a porous graphitic carbon column with the dimensions 50 × 2 mm by a short step gradient (0.1% trifluoroacetic acid in water: acetonitrile 90:10, in 1 min to 50:50, 0.25 ml/min flow rate). Calibration ranges were 10-200 μmol/l for tryptophan and 0.5-10 μmol/l for kynurenine, respectively. Relative standard deviations were less than 5% for both substances at all quality control levels. IDO activity was calculated (IDO~c~) as the kynurenine to tryptophan ratio x 1000. Soluble E-Selectin (sEsel) and soluble vascular cell adhesion molecule-1 (sVCAM-1) levels were measured using *Fluorokine*® *MultiAnalyte Profiling* kits and a *Luminex*® Bioanalyzer (R&D Systems, Oxon, U.K.) according to the manufacturers' instructions and have been reported elsewhere \[[@B7]\].
Statistical analysis
--------------------
Continuous variables are expressed as means ± one standard deviation (SD). A repeated-measures one-way analysis of variance with Dunnett's test for multiple comparisons (two-sided) was used to demonstrate statistical changes in hemodynamic and laboratory variables after endotoxin infusion. Two-sided p-values \< 0.05 were considered statistically significant. The association between IDO~c~ activity and hemodynamic parameters measured repeatedly at various time points in the same person was examined in random effects linear regression models treating hemodynamic parameters as dependent variables and using maximum likelihood estimators. The association between adhesion molecules and IDO~c~ activity was assessed in a similar manner, treating IDO~c~ activity as dependent variable. To fulfil the assumptions needed for the analysis, logarithmic (ln) transformation of sEsel was performed. Results are shown as beta-coefficients that correspond to a one SD higher value of each of the independent variables in each regression.
Results
=======
LPS infusion elicited a significant laboratory and clinical inflammatory response with chills, headache, muscle pain, increased heart rate, and overt hypotension (Table [1](#T1){ref-type="table"}). In brief, SBP was 140 ± 14 mmHg at 0 h, minimal at 8 h (104 ± 11 mmHg) and remained below baseline until 20 h (Figure [1A](#F1){ref-type="fig"}). Details on additional hemodynamics are given in Table [1](#T1){ref-type="table"}. Two volunteers received 1000 mL of 0.9% saline i.v. due to a SBP below 70 mmHg. No vasopressors were needed. At 24 h, all volunteers were asymptomatic and all clinical parameters within the normal range. Consistent with maximal hypotension, IDO~c~activity significantly increased at 6.5 h and peaked at 8 h (44.0 ± 15.2 vs. 29.4 ± 6.8 at baseline, P\<0.0001, Figure [1A](#F1){ref-type="fig"}). In random effects linear regression models, IDO~c~ activity was significantly associated with the degree of hypotension (SBP: β = -9.948 (95% confidence interval \[CI\] -16.361 to -3.535), p = 0.002; DBP: β = -3.907 (95% CI -7.448 to -0.336), p = 0.031; MAP: β = -5.725 (95% CI -9.922 to -1.529), p = 0.007).
######
Time course after LPS infusion in healthy volunteers
**Time course after LPS infusion**
--------------------------- -------------- ------------- ------------------------------------ ------------- --------------- --------------- --------------- --------------- --------------- --------------- -------------
**Variables** **Pre-Dose** **1 h** **1.5 h** **2 h** **2.5 h** **3.5 h** **4.5 h** **6.5 h** **8 h** **24 h** **P-value**
**HEMODYNAMICS**
**SBP** (mmHg) 140 ± 14 139 ± 11 152 ± 11 158 ± 18\* 151 ± 18 142 ± 22 121 ± 18\* 107 ± 11\* 104 ± 11\* 131 ± 11 \<0.0001
**DBP** (mmHg) 74 ± 10 74 ± 7 80 ± 7 77 ± 12 65 ± 12 61 ± 14\* 54 ± 11\* 55 ± 8\* 55 ± 7\* 66 ± 7 \<0.0001
**MAP** (mmHg) 96 ± 11 96 ± 9 104 ±7 104 ± 13 94 ± 14 88 ± 16 77 ± 13\* 72 ± 8\* 71 ± 7\* 88 ± 7 \<0.0001
**Heart rate** (bpm) 61 ± 16 59 ± 11 78 ± 19 78 ± 18 92 ± 12 98 ± 8 101 ± 8 97 ± 11 96 ± 13 81 ± 16 \<0.0001
**HR/MAP index** 0.64 ± 0.11 0.62 ± 0.11 0.75 ± 0.17 0.76 ± 0.22 1.01 ± 0.22\* 1.15 ± 0.26\* 1.36 ± 0.32\* 1.36 ± 0.27\* 1.4 ± 0.22\* 0.92 ± 0.16\* \<0.0001
**TRYPTOPHAN METABOLISM**
**IDOc activity** 29.4 ± 6.8 30.5 ± 7.4 30.3 ± 6.2 30.2 ± 6.8 30.2 ± 6.4 28.2 ± 3.6 28.6 ± 7.2 38.1 ± 10.9\* 44.0 ± 15.2\* 36.3 ± 12.3\* \<0.0001
**ADHESION MOLECULES**
**sEsel** (ng/ml) 34 ± 16 38 ± 18 35 ± 16 40 ± 18 44 ± 24 82 ± 48 184 ± 90\* 289 ± 133\* 243 ± 95\* 208 ± 81\* \<0.0001
**sVCAM-1** (ng/ml) 307 ± 108 330 ± 120 315 ± 103 326 ± 100 319 ± 109 326 ± 122 403 ± 86\* 542 ± 92\* 550 ± 91\* 553 ± 130\* \<0.0001
A repeated-measures ANOVA with Dunnett's test for multiple comparison (two sided) was used to demonstrate statistical changes in clinical and laboratory variables during the time course after endotoxin infusion (n=6). Two-sided p-values \<0.05 were considered statistically significant. SBP -- systolic blood pressure; DBP -- diastolic blood pressure; MAP mean arterial blood pressure; HR/MAP index - heart rate/mean arterial pressure index; sEsel -- soluble E-selectin; sVCAM-1 -- soluble vascular cell adhesion molecule-1; IDO - Indoleamine 2,3-dioxygenase 1; \*statistically significant vs. Pre-Dose.
![**Time course of blood pressure, endothelial inflammation, and indoleamine 2,3-dioxygenase 1 activity during human endotoxemia.**Activity of Indoleamine 2,3-dioxygenase 1 (IDO), calculated as the kynurenine to tryptophan ratio x 1000, compared with **A**) systolic blood pressure (SBP) and diastolic blood pressure (DBP) and **B**) plasma levels of endothelial soluble adhesion molecules E-selectin (sEsel) and vascular-cellular adhesion molecule-1 (sVCAM-1) after endotoxin infusion in six healthy volunteers.](2040-7378-4-24-1){#F1}
Wang et al. \[[@B1]\] reported that IDO is specifically expressed induced in the inflamed endothelium of septic mice. Consistent with this notion, the increase in sVCAM-1 (P\<0.0001) and soluble E-Selectin (P\<0.0001), surrogates for endothelial inflammation, exhibited a kinetic profile similar to that of IDO~c~ in our human endotoxemia model (Figure [1B](#F1){ref-type="fig"}). IDO~c~ activity was tightly associated with plasma levels of sVCAM-1 (β = 5.07 (95% CI 3.25 to 6.9); p \< 0.0001) and sEsel (β = 3.62 (95% CI 1.86 to 5.38); p \< 0.0001) using random effects linear regression.
Discussion
==========
Here we show that, as in mice \[[@B1]\], LPS is a triggering factor for the induction of IDO in humans. Consistent with experimental findings by Wang and colleagues \[[@B1]\], we could show that IDO~c~ was associated with the extent of endothelial inflammation and correlated inversely with the development of hypotension. In support of our findings, Changsirivathanathamrong et al. \[[@B8]\] convincingly demonstrated in a clinical study, that IDO~c~ activity correlates with vasopressor requirement in patients with septic shock. Darcy et al. could show that IDO~c~ activity correlates with severity measures such as the Sequential Organ Failure Assessment (SOFA) score \[[@B9]\]. Zeden and colleagues demonstrated that septic shock coincidence with an exacerbation of kynurenine pathway activity \[[@B10]\]. Additionally, investigations revealed IDO activity to be an independent predictor of disease severity and case fatality in bacteremic patients \[[@B11]\]. Thus, our data add a further translation of previous experimental and clinical work, strengthening the concept that IDO is a novel mediator of arterial vessel relaxation and temporally coupled to the onset and severity of hypotension in human sepsis.
A possible limitation of the current study is that we cannot rule out loss of tryptophan and kynurenine due to deep-freeze storage for several years. However, values at baseline (i.e. before LPS infusion) match those of healthy controls from the literature. Furthermore, as the study is a re-analysis of blood samples from a placebo-controlled interventional trial on pharmacologic p38 MAP kinase inhibition in endotoxemia \[[@B4],[@B5]\], the intake of tryptophan was not standardized. Infusion of LPS in healthy volunteers may be regarded an insufficient model for severe sepsis/ septic shock. This model enabled us nonetheless to study the time course of IDO induction in humans for the first time. Another possible limitation might be the small number of participants. However, due to statistical analysis using advanced random effects linear regression models, in which the respective parameters are "correlated" with each other throughout the whole time course, a small number of study participants should not be crucial. Finally, we cannot exclude an impact of fluid administration (1000 ml saline 0.9% in two patients) on tryptophan and kynurenine levels. While the impact of fluid administration on the concentration of both substances cannot be excluded, calculation of IDO activity should not be affected, as a potential dilution would decrease both amino acids to the same extent.
Conclusions
===========
In conclusion, our findings support the concept that IDO, the rate-limiting enzyme for tryptophan catabolism, is a novel and previously unrecognized mediator of hypotension that might be particularly significant in human sepsis \[[@B12]\].
Abbreviations
=============
DBP: Diastolic blood pressure; IDO: Indoleamine 2,3-dioxygenase; LPS: Lipopolysaccharide; MAP: Mean arterial pressure; SBP: Systolic blood pressure; sEsel: Soluble E-selectin; sVCAM-1: Soluble vascular cell adhesion molecule-1.
Competing interests
===================
The authors declare that they have no competing interests.
Authors' contributions
======================
JP, JTK PK analysed the data and wrote the manuscript. CPK contributed to statistical analysis and critically revised the manuscript. JGZ collected the data and critically revised the manuscript; MM supervised the soluble ELISA measurements and critically revised the manuscript. JM and SMB carried out measurements of kynurenine and tryptophan and critically revised the manuscript. All authors read and approved the final manuscript.
Acknowledgements
================
We acknowledge support by the Open Access Publication Fund of the University of Münster.
| 2023-11-21T01:27:04.277712 | https://example.com/article/4411 |
Technology instruction to target women and minorities Julio Garcia & Patricia Backer Department of Aviation and Technology San Jose State University Goals Summarize key research on learning styles with women and minority students
Copyright Complaint Adult Content Flag as Inappropriate
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.
Summarize key research on learning styles with women and minority students
Discuss how technology instruction and curriculum could be adapted and developed to meet the learning styles of women and underrepresented minorities and to help students become more technologically literate
Demonstrate implementation of learning styles research into curriculum for electronics instruction
Kolb describes learning style within a two-factor model. The perceiving factor, which Kolb defines as how one takes in or processes experience, ranges from Concrete Experience (CE) to Abstract Conceptualization (AC). The second factor is how one processes information; this ranges from Active Experimentation (AE) to Reflective Observation (RO). A combination of scores on the CE-AC and AE-RO scales classifies the learner into one of four learning styles.
Accommodators focus on the question, “what would happen if I did this?” These learners learn well from hands-on experiences and rely more on feelings rather than logical analysis. This learning style is evidenced in “action-oriented careers such as marketing and sales.” Kolb (1999).
Assimilators like to answer the question, "what is there to know?" These learners can understand a wide range of information and put this information into a logical and organized form. This style is seen often in those who are in information and science-related careers (Kolb, 1999).
Convergers seek to find practical use for ideas and theories and prefer to work with technical tasks and problems rather than with interpersonal tasks. People in technology careers tend to have this learning style (Kolb, 1999).
Divergers are focused on the "why" of a situation. They tend to be very cognizant of their environment and like to gather information from a wide range of sources. Divergers are prevalent in the arts, entertainment, and service fields.
active/reflective--An active learner learns by trying things out and enjoys working in groups while a reflective learner learns by thinking things through and prefers to work alone or with a single individual.
sensing/intuitive--A sensing person is a concrete thinker, is practical, and oriented towards facts and procedures; and an intuitive person is an abstract thinker, innovative, and oriented toward theories and underlying meanings.
visual/verbal--A visual learner prefers visual representations such as diagrams, pictures and flow charts and a verbal learner prefers written and spoken explanations.
sequential/global--A sequential learner uses a linear thinking process and learns in small incremental steps while a global learner uses a holistic thinking process and learns in large leaps.
Felder and Spurlin (2005) summarized the data from ten student populations at six institutions (three at Ryerson, two at Tulane, and one each at Kingston, Iowa State, Limerick, Michigan, and Michigan Tech).
“Undergraduate engineering students at a variety of institutions are therefore more consistently more active than reflective and more sensing than intuitive, much more visual than verbal, and more sequential than global” (p. 109)
Is there a dominant learning style among Industrial Technology students at San Jose State University? and
What is the relationship between student achievement and learning style?
This research was focused on surveying students who had taken most if not all of their BSIT classes. All seniors in the Industrial Technology program at San Jose State University were surveyed in Spring 2002 using the Kolb Learning Style Inventory.
As the assimilator style is seen often in those who are in information and science-related careers (Kolb, 1999), this finding implies that BSIT majors do not have the learning style that would be expected from previous research at SJSU on Engineering students (Mourtos, 1996) that found that 40% were assimilators.
At SJSU, the Department of Technology and Aviation is located within the College of Engineering so these differences relative to student learning styles could have a greater effect.
Research suggests that ethnic minorities and women work best when students work in teams and have a high level of hands-on experimentation and problem-solving.
As Philbin et al (1995) found in their research on gender differences in learning styles, there are significant differences in learning styles between the genders. Using Kolb’s schema for learning styles, they found that the “learning style that seems to fit women the least is the Assimilator…this style best fits men.” They further observe that female students work best in hands-on and practical settings.
Hlawaty (2002, p. 8) also found gender differences in learning styles among 869 German adolescents. German women preferred to learn with more variety than did men, “they need more options regarding educational scenarios, including working independently, in pairs, with peers, in larger groups, and with teachers.”
In an international study of learning styles and gender, Honigsfeld and Dunn (2003) investigated gender differences of 1,637 adolescents from five countries (New Zealand, Sweden, Bermuda, Brunei, and Hungary). Although there were different gender differences found by country, three elements (self-motivation, persistence, and responsibility) were common to all countries.
McShannon and Derlin (2000) analyzed the learning styles of 515 undergraduate engineering students in three universities in New Mexico to see if there were any differences in how students perceive they learn best. In their research, they focus on students’ interaction styles rather than their learning styles.
McShannon and Derlin (2000) found that interactive learning styles differed among ethnic and gender subgroups. Student who traditionally are most successful in undergraduate engineering classes (white students and senior students), use the interactive learning style. That is, they most often learn by themselves. In contrast, “learning with other students contributed most highly to minority student success…”
Behm et al (1996), through the NSF-funded Pac-TECH project, conducted research with teachers from elementary to university level to analyze why “some students are uncomfortable with science, mathematics, engineering, and technology.” The researchers focused on four underrepresented groups in these fields: African Americans, Hispanics, Native Americans, and women.
The researchers proposed criteria or specifications that could be used in classrooms and gave examples of how teachers can apply these criteria to their classrooms.
Presenting the world as a dynamic system of interconnections and discovery
A solution allows a discovery process and acknowledges uncertainty in acquiring knowledge.
A solution includes open ended problems
A solution insures subjects are alive and holistic. The systems view looks at the world in terms of relationships and integration. Example: Hale-Benson (1986) found that the African American culture has a more relational style of learning—person-centered, expressive, affective, and valuing the unique rather than the regular.
A solution explores technology’s role in society
A solution promotes social interaction and human interconnections. Integrate cooperative experiences into the existing curriculum (Institute for Responsive Education, 1986).
A solution develops a comfortable classroom environment. Example: Developing a curriculum that focuses on real-world problems may be useful in recruiting women into STEM careers. Using everyday household items makes science and technology appear to be less intimidating (Travis, 1993) .
A solution that supports a cooperative learning environment. Several underrepresented groups in STEM including Hispanics and other students of color and women, areas motivated by affiliation and cooperation rather than competition (Delpit, 1995; Grossman, 1984).
A solution vitalizes physical space. Example: An exciting technology classroom can be created by hanging bicycle parts on the walls. Then, one can add posters, ads, information as to how bicycles are used throughout the world.
Integrates family and community. Mexican Americans consider family and personal relationships as important and are more comfortable with broad concepts than with component facts and specifics (Guild, 1994, p. 17; Vasquez, 1991).
Encourages the use of original resources such as scientific reports, fiction, non-fiction, etc.
Instead of giving students the lab experiments in a cookie recipe format, students were given statements that forced them to work in groups, come up with different approaches to solve the statements, simulate their alternatives using the computer simulation programs Multisim 7 and/or LabVIEW 7, and then choose the best alternative.
Build a circuit that converts resistance changes to voltage changes. We need to drive a 50 load and we have only a single supply of 10 V. One of the resistances is an RTD that has a nominal resistance of 150 at 25 C. Due to product specs two resistances should have 220 and 470 .
Build a closed-loop system indicating all the required stages and feedback. This is an open design in that you need to provide what you want to control and its limits. Based on what you need to control then design the appropriate system. | 2023-12-05T01:27:04.277712 | https://example.com/article/9448 |
Introduction {#h0.0}
============
*Pseudomonas aeruginosa* is a Gram-negative bacterium capable of thriving in diverse environmental niches. It is also an important opportunistic human pathogen and major contributor to chronic lung infections in patients with cystic fibrosis (CF). The ability of this organism to successfully colonize these different environments is often multifactorial. One survival strategy used by *P. aeruginosa* in the CF lung is to overproduce the exopolysaccharide alginate, which gives colonies a distinctive mucoid phenotype and is also a harbinger of increased morbidity and mortality for these patients ([@B1]). The alginate barrier in mucoid *P. aeruginosa* has been shown to provide protection against many common antibiotics ([@B2]) and to confer increased resistance to phagocytic killing and antibody-dependent bactericidal mechanisms ([@B3]--[@B5]). The ability of *P. aeruginosa* to form biofilms is another important factor in establishing chronic infections in the lungs of CF patients ([@B6], [@B7]). Mucoid *P. aeruginosa* in a biofilm is more resistant to killing by human leukocytes in the presence of gamma interferon than is its isogenic nonmucoid form, suggesting that alginate plays an important role in protecting mucoid *P. aeruginosa* biofilm bacteria from the human immune system ([@B3]).
The master regulator for alginate production in mucoid *P. aeruginosa* is the extracytoplasmic functioning (ECF) sigma factor, σ^22^ ([@B8], [@B9]). This 22-kDa alternative sigma factor, encoded by *algT* (also known as *algU*), is essential for expression of the *algD* promoter (P*algD*), which controls the expression of the 12-gene alginate biosynthetic operon (*algD-alg8-alg44-algKEGXLIJFA*) ([@B10]--[@B12]). Three additional positive regulatory proteins under σ^22^ control are required for P*algD* expression: the two-component response regulators AlgB and AlgR ([@B13]--[@B15]) and a small ribbon-helix-helix family DNA-binding protein, AmrZ ([@B16]).
σ^22^ is encoded by the *algT/U-mucABCD* operon along with posttranslational regulatory proteins ([Fig. 1A](#fig1){ref-type="fig"}). MucA is an anti-sigma factor and primary inhibitor of σ^22^ activity; it acts by sequestering the sigma factor at the cytoplasmic membrane. Mutations in *mucA* are the most common cause of the constitutive expression of alginate observed in CF isolates of mucoid *P. aeruginosa* ([@B17]). MucA spans the inner membrane with the N-terminal cytoplasmic domain binding σ^22^ and the C-terminal periplasmic domain binding MucB ([@B18], [@B19]) ([Fig. 1B](#fig1){ref-type="fig"}). The formation of this macromolecular membrane complex results in diminished expression of σ^22^-regulated genes. The *mucD* gene encodes an HtrA/DegP-like periplasmic protease that apparently degrades peptide signals that lead to σ^22^ release and thus helps maintain the integrity of the σ^22^-MucAB complex. The *mucD* gene is also under the control of an internal promoter within *mucC*, a gene of unknown function ([@B20]).
![(A) Map of the *algT*/*U* operon. Arrows indicate promoters. (B) Model for the "activation" of σ^22^ activity by regulated intramembrane proteolytic (RIP) degradation of the anti-sigma factor MucA. Under nonstress conditions, σ^22^ activity is low due to its sequestration at the inner membrane by the MucA-MucB complex. In response to cell wall stress (e.g., [d]{.smallcaps}-cycloserine), AlgW cleaves MucA in the C terminus and then RseP (YaeL) and ClpXP cleave the MucA N-terminal region, releasing σ^22^ from posttranslational repression. This allows σ^22^ to complex with core RNA polymerase, thus increasing transcription of target promoters in the σ^22^ stimulon, which includes P*algD* of the alginate biosynthetic operon. Abbreviations: OM, outer membrane; PG, peptidoglycan; IM, inner membrane.](mbo0031212740001){#fig1}
Liberation of σ^22^ from the inner membrane complex and the resultant increase in σ^22^-mediated transcription occur by regulated intramembrane proteolytic (RIP) destruction of MucA ([Fig. 1B](#fig1){ref-type="fig"}). Cell wall stress triggers the activation of this process, such as by exposure to cell wall-active antibiotics (e.g., [d]{.smallcaps}-cycloserine) or compounds that disrupt biological membranes (e.g., Tween and triclosan) or by overproduction of certain outer membrane proteins (e.g., MucE) ([@B19], [@B21], [@B22]). AlgW is an inner membrane endoserine protease that senses envelope stress conditions by binding sequence-specific polypeptide signal molecules at its PDZ domain, which relieves steric inhibition of the catalytic domain and allows AlgW to cleave MucA in the periplasmic domain ([@B18]). The initiating AlgW-dependent cleavage of MucA is followed by further degradation of the truncated anti-sigma polypeptide through the actions of RseP (YaeL) protease and several cytoplasmic ClpXP proteases, resulting in the ultimate release of σ^22^ so that it can complex with core RNA polymerase and direct transcription of its target genes ([@B18], [@B21]--[@B23]).
We have analyzed the transcriptional profiles of genes upregulated by σ^22^ activation in response to cell wall stress ([@B19]). Exposing *P. aeruginosa* PAO1 to [d]{.smallcaps}-cycloserine, which directly targets peptidoglycan synthesis, results in the increased expression of 293 genes that are dependent on σ^22^ deregulation. Among those upregulated are the genes for alginate biosynthesis and its regulation. Other members of the σ^22^ stimulon include genes involved in peptidoglycan biosynthesis (*mdoH*, *mrcB*, and *mpl*), lipopolysaccharide (LPS) biosynthesis (*wzz*, *rmlD*, *wbpH*, and *wbpD*), and genes encoding proteins with known adaptive or protective functions, such as bacitracin resistance protein (BacA), chloroperoxidase (Cpo), and two mechanosensitive channels encoded by PA4394 and PA4614 ([@B19]). A number of lipoproteins that are σ^22^ dependent have predicted roles in outer membrane repair and/or maintenance. However, the large majority of genes in the σ^22^ stimulon encode hypothetical or conserved hypothetical proteins for which limited biological information is known. It has also been shown that a mutation in *algT/algU*, which disrupts the whole σ^22^ stimulon of 293 genes, also results in less robust (i.e., less shear-resistant) biofilms ([@B24]). However, it is unknown which genes of the stimulon are involved with biofilm formation.
In this study, we sought to better understand the σ^22^-mediated stress response by characterizing mutants with defects in specific σ^22^-dependent genes for potential roles in maintaining cell envelope integrity. This analysis revealed that several gene products play a role in envelope homeostasis and thus affect the stress response system itself. Further study revealed that some of these genes demonstrate this effect only in either the planktonic (free-swimming) or the sessile (biofilm) mode of growth.
RESULTS {#h1}
=======
Construction of σ^22^ stress stimulon mutants. {#h1.1}
----------------------------------------------
There are 293 known genes in the σ^22^ stress stimulon of strain PAO1 as determined by a transcriptome analysis of planktonically grown bacteria subjected to cell wall stress with [d]{.smallcaps}-cycloserine ([@B19]). In this study, we selected a set of undercharacterized genes within the σ^22^ stress stimulon ([Table 1](#tab1){ref-type="table"}) for a mutant analysis to shed light on the output of this complex stress response system. These genes can be under the direct or indirect control of σ^22^; previous studies show that at least two of them (PA0059 and PA3819) have promoter regions with the σ^22^ consensus sequence ([@B25]). Transposon insertion mutants of PAO1 with sequence-defined insertions in genes of the σ^22^ stress stimulon were obtained from the University of Washington Genomics Resource Center (WGRC). To ensure a consistent PAO1 strain background, which is known to show some diversity among laboratory strains ([@B26]), each WGRC transposon-mutated allele was transduced into this laboratory's reference PAO1 isolate (also known as PDO1). In all, 27 transduced transposon insertions were constructed for study and are shown in [Table 1](#tab1){ref-type="table"} along with their stress induction values from the microarray analyses ([@B19]). Each was tested by PCR to verify that the transposon was in the correct gene (see Materials and Methods).
######
Verification that selected genes were σ^22^ dependent by using a *lacZ* fusion analysis of each promoter in *algT* (σ^22^-deficient) and *mucA* (anti-sigma-factor-deficient) backgrounds
Gene Gene product description*^[a](#ngtab1.1)^* Stress induction (15/60 min)*^[b](#ngtab1.2)^* P-*lacZ* WT:*algT*:*mucA* activity*^[c](#ngtab1.3)^*
-------------------------- ------------------------------------------------- ------------------------------------------------ ------------------------------------------------------
PA0059 OsmC, redox protein, osmotically induced 9.9/8.9 156:15:450
PA0062 Hypothetical, predicted type II lipoprotein 11.4/10.5 ND
PA0460 Hypothetical, predicted periplasmic 18.9/7.7 1,569:116:5,161
PA0567*^[d](#ngtab1.4)^* Proteolipid homolog, membrane integrity 6.0/6.2 220:142:976
PA0854 FumC2, fumarate hydrase 4.7/10.7 ND
PA0919 Hypothetical, predicted secretion usher 3.0/\<2 Operon
PA0920*^[d](#ngtab1.4)^* Aminoacyl-phosphatidylglycerol synthase 3.0/\<2 3,264:2,825:5,239
PA1243 Predicted transcriptional regulator, PAS domain 2.0/\<2 87:30:307
PA1323 Hypothetical, DUF883 family 19.8/15.9 269:13:1,278
PA1324 Predicted to bind/transport polysaccharides 19.1/14.3 Operon
PA2167 Hypothetical, unclassified \<2/20.7 72:21:470
PA2176 Hypothetical, unclassified \<2/7.0 76:19:296
PA2177*^[d](#ngtab1.4)^* Predicted sensor response hybrid, PAS domain 2.2/\<2 99:101:244
PA2717 Cpo, chloroperoxidase \<2/14.4 ND
PA3040*^[d](#ngtab1.4)^* Hypothetical, DUF883 family 7.1/6.2 1,352:1,073:4,148
PA3459*^[d](#ngtab1.4)^* Predicted glutamine amidotransferase 4.4/\<2 402:415:839
PA3691 Hypothetical, predicted lipoprotein 15.7/17.8 608:13:2,216
PA3795*^[d](#ngtab1.4)^* Predicted oxidoreductase 5.2/8.8 707:605:1,593
PA3819 SlyB homolog, outer membrane protein 10.3/8.2 1,221:568:3,351
PA4311 Predicted glycosyltransferase 4.0/6.9 ND
PA4394 Predicted mechanosensitive channel, McsS 3.0/4.0 130:15:797
PA4717*^[d](#ngtab1.4)^* Predicted periplasmic metalloprotease 5.3/6.3 1,404:1,101:3,215
PA5107 Lipocalin Blc, outer membrane protein 8.1/4.4 Operon
PA5108 Hypothetical, predicted lipoprotein 7.5/3.0 714:387:3,732
PA5178 Hypothetical, LysM domain 9.6/7.1 452:284:2,532
PA5212 Hypothetical, unclassified 15.9/7.8 1,555:44:5,758
PA5424*^[d](#ngtab1.4)^* Hypothetical, predicted inner membrane protein 8.3/7.4 807:660:3,904
PAO1 gene names and descriptions were obtained from the *Pseudomonas* Genome Database ([@B33]) and are listed numerically. Sequence-defined transposon insertions in each gene were purchased from the University of Washington Genome Center. All were transduced into the PAO1/PDO1 reference isolate and verified by PCR analysis.
Stress induction shows data previously described (19) for the fold increase of the genes' transcriptional activity expressed from the PAO1 chromosome when treated with [d]{.smallcaps}-cycloserine (400 µg/ml) for 15 or 60 min as determined by microarray analysis.
PAO1 (wild type \[WT\]), PDO-LS586 (*algT*), and PDO351 (*mucA*) strains containing each *lacZ* fusion plasmid were grown in L broth at 37°C with aeration, collected during logarithmic growth, and assayed for β-galactosidase activity. Data show each gene's promoter activity (Miller units) when fused to *lacZ* (P-*lacZ*) when expressed in the wild type or in an *algT* or *mucA* mutant. "Operon" indicates that the gene is in an operon of a gene already tested. ND, not determined.
The mutant did not show the predicted σ^22^ stimulon phenotype until tested under cell wall stress conditions (see [Table 2](#tab2){ref-type="table"}).
Verification of membership in the σ^22^ stress stimulon. {#h1.2}
--------------------------------------------------------
To verify that the genes in [Table 1](#tab1){ref-type="table"} were indeed upregulated by σ^22^ activation, plasmids that contained each gene's upstream promoter region transcriptionally fused to *lacZ* using broad-host-range vector pSS269 were constructed ([@B27]). All the reporter plasmids showed β-galactosidase activity in wild-type PAO1 ([Table 1](#tab1){ref-type="table"}), indicating that their promoters had been cloned to form *lacZ* fusions. Compared to PAO1, the promoter activity of σ^22^ regulon members should show reduced expression in an *algT* mutant (PDO-LS586) devoid of σ^22^ and high expression in a *mucA* mutant (PDO351) lacking the anti-sigma factor for σ^22^. In general, these genes' promoter reporters (P-*lacZ*) showed this predicted expression pattern, indicating that they were directly or indirectly under the control of σ^22^ ([Table 1](#tab1){ref-type="table"}).
Many of the promoters fused to *lacZ* (P-*lacZ*) showed a dramatic reduction in β-galactosidase activity in the *algT* mutant (i.e., devoid of σ^22^) as expected, but some had only a modest reduction or none in the *algT* mutant (i.e., PA0567, PA0920, PA2177, PA3040, PA3459, PA3795, PA4717, and PA5424) ([Table 1](#tab1){ref-type="table"}). Thus, their P-*lacZ* reporters were examined under conditions of cell wall stress in wild-type PAO1 and in an *algT* (PDO-LS586) mutant ([Table 2](#tab2){ref-type="table"}). The results showed that all but one (PA0567) had a ≥5-fold increase in β-galactosidase activity in PAO1 as a result of exposure to [d]{.smallcaps}-cycloserine, which as predicted was not observed in the *algT* mutant. With PA0567-*lacZ*, β-galactosidase activity rose by only 2.3-fold following cell wall stress and then activity actually increased instead of decreasing in the *algT* mutant, suggesting that the regulation of PA0567 is more complex. Nevertheless, we kept this gene in our study because PA0567-*lacZ* transcriptional activity was markedly elevated in the *mucA* mutant ([Table 1](#tab1){ref-type="table"}), indicating that this gene was under σ^22^ control.
######
Confirmation of σ^22^-dependent gene expression during cell wall stress for selected promoters
Promoter-*lacZ* fusion*^[a](#ngtab2.1)^* Fold increase in β-galactosidase activity due to [d]{.smallcaps}-cycloserine treatment
------------------------------------------ ---------------------------------------------------------------------------------------- ------
PA0567-*lacZ* 2.3 10.9
PA0920-*lacZ* 5.6 2.6
PA2177-*lacZ* 14.2 2.3
PA3040-*lacZ* 10.0 2.2
PA3459-*lacZ* 9.0 2.4
PA3795-*lacZ* 11.4 3.3
PA4717-*lacZ* 8.8 2.8
PA5424-*lacZ* 19.2 1.7
Listed are promoter-*lacZ* fusions from [Table 1](#tab1){ref-type="table"} that did not yield the predicted phenotypes under unstressed conditions in *algT* and/or *mucA* mutant backgrounds. Here they were compared for β-galactosidase activity under cell wall stress conditions in PAO1 and an *algT* mutant by exposure to [d]{.smallcaps}-cycloserine. Bacteria were grown under routine lab conditions (L broth with aeration at 37°C) to an OD~600~ of 0.3 and treated with a sub-MIC level (400 µg/ml) of [d]{.smallcaps}-cycloserine for 60 min. The fold increase in β-galactosidase activity (Miller units) shown is a comparison to that of untreated control cultures. In PAO1 containing functional σ^22^, all 8 promoter fusions above showed an increase in transcriptional activity when exposed to [d]{.smallcaps}-cycloserine. None of these promoters, except PA0567-*lacZ*, showed high induction in the σ^22^ knockout, PAO1*algT*, indicating their dependence on σ^22^ for increased expression during cell wall stress.
Phenotypes of σ^22^ stimulon mutants. {#h1.3}
-------------------------------------
Because the genes of the σ^22^ stress stimulon were discovered by their upregulation following peptidoglycan damage, we looked at the mutants for changes in sensitivity to cell wall-inhibiting antibiotics (i.e., [d]{.smallcaps}-cycloserine, fosfomycin, and carbenicillin \[Cb\]); however, none showed an altered zone of inhibition compared to parent strain PAO1 in a standard disk diffusion assay (data not shown). Sensitivity to elevated growth temperatures is also a common phenotype of mutants defective in the ability to recover from stress, but the pattern of growth at 43°C in L broth with aeration showed no change from that of wild-type PAO1 (data not shown). However, when the growth temperature was raised to 45°C, the PA0062 and PA1324 mutants did show slightly lower growth rates than did PAO1 ([Fig. 2](#fig2){ref-type="fig"}). Because previous studies indicate a link between the σ^22^ stimulon and the regulation of biofilm formation ([@B24]), we looked for biofilm defects in the mutants with knockouts in genes of the σ^22^ stimulon. We examined microbial adherence to the walls of polystyrene tubes (24-h incubation at 37°C) and at the ability to form air-to-medium interface flocculation in statically grown culture (over 12 days at 25°C) using methods previously described ([@B28]). However, no obvious alteration from the wild-type PAO1 biofilm phenotypes could be observed with any of the mutants (data not shown).
![Demonstration of a temperature-sensitive (Ts) growth phenotype. Mutants with Tn*5*-related (Tc^r^) insertions in genes of the σ^22^ stimulon were examined for growth defects compared to the parental strain, PAO1, in L broth at 45°C in a shaking water bath incubator. Among the 27 mutants examined, mutations in PA0062 or PA1324 caused a modest temperature-sensitive growth defect at 45°C. Shown is one of three experiments, all of which showed comparable results.](mbo0031212740002){#fig2}
The σ^22^ stress stimulon genes are coregulated with those for alginate production, so we examined the possibility that some of the mutants might be altered in envelope homeostasis that would activate AlgW protease sufficiently to cause alginate biosynthesis. However, none showed a mucoid phenotype on agar plates, nor was production of alginate measurably above background PAO1 levels (data not shown). To determine if any of these mutations might cause a block in alginate production, the gene-specific transposon insertions (Tc^r^) were transduced into the chromosome of an isogenic mucoid strain, PDO351 (*mucA*::Gm^r^). However, all of these double mutants retained the mucoid phenotype and produced levels of alginate similar to that produced by PDO351 (data not shown), indicating that none of the genes under study was required for high-level alginate production.
Effect of mutations in the σ^22^ stimulon on P*algD* induction in planktonic or sessile culture. {#h1.4}
------------------------------------------------------------------------------------------------
To determine whether any of the selected genes in the σ^22^ stress stimulon have a role in envelope homeostasis, we examined the mutants for effects on σ^22^ activation, which responds with high sensitivity to disturbances in the cell wall. Expression of P*algD*, a well-characterized σ^22^-dependent promoter for an important virulence factor, was examined using a *lacZ* transcriptional fusion (P*algD-lacZ*) as an indicator of the σ^22^ activity level under unstressed and stressed conditions. When wild-type PAO1 carried a P*algD*-*lacZ* reporter plasmid (pLW149a) and was grown under planktonic conditions (i.e., L broth with aeration), it produced only a low level of β-galactosidase (13 ± 7 Miller units), but when stressed by exposure to [d]{.smallcaps}-cycloserine at a sub-MIC for 60 min, expression increased \~100-fold (1,161 ± 231 Miller units). Thus, when normalized to 100%, the planktonic P*algD-lacZ* untreated/treated ratio of expression in PAO1 was typically \~1:100 ([Table 3](#tab3){ref-type="table"}). This 1:100 ratio was then compared to the expression of P*algD-lacZ* in the mutants of the σ^22^ stress stimulon under the same conditions.
######
Comparison of P*algD* induction in mutants of the σ^22^ stimulon when in the planktonic and sessile states of growth
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Phenotype Strain/\ Activity\ Sessile P*algD-cat*\ Putative role\
mutation of untreated planktonic\ treated\ of gene product
P*algD-lacZ*:activity\ with [d]{.smallcaps}-cycloserine*^[b](#ngtab3.2)^*
of that treated\
with [d]{.smallcaps}-cycloserine*^[a](#ngtab3.1)^*
---------------------------------- ---------- ---------------------------------------------------- ---------------------------------------------------- ---------------------------------
Wild type PAO1 1:100 Ring
Alterations in stressed\ \ \ \ \
P*algD* expression PA3459 1:67 Weaker ring Osmoprotectant
PA5424 1:52 Weaker ring Membrane protein
PA1243 1:153 Ring Sensor/regulator
PA5107 1:134 Ring Lipocalin
Growth-independent alterations\ \ \ \ \
in unstressed P*algD* expression PA0062 6:131 (Ts) Lawn Lipoprotein
PA1324 1.7:151 (Ts) Lawn Polysaccharide binding
Planktonic growth-specific\ PA5178 7:215 Ring LysM, BON domains
alterations in unstressed\
P*algD* expression
Sessile growth-specific\ \ \ \ \
alterations in unstressed\ \ \ \ \
P*algD* expression PA0567 1:100 Lawn UPF0057 domain
PA3040 1:100 Lawn DUF883 family
PA2717 1:142 Lawn Chloroperoxidase
PA0920 1:55 Lawn A-PG synthase*^[c](#ngtab3.3)^*
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
P*algD-lacZ* Miller units of β-galactosidase in PAO1 strains were 13 (±7) if untreated and 1,161 (±231) if treated with [d]{.smallcaps}-cycloserine. To be significant in the fold change, the ratio needed to be \<0.5 or \>1.5 for untreated cultures and \<80 or \>120 for treated cultures. When maximum activity was normalized to 100%, the untreated/treated ratio of P*algD-lacZ* expression in PAO1 was typically 1:100. Ts indicates a temperature-sensitive growth defect at 45°C.
P*algD-cat* activity in PAO1 strains was estimated on L agar plates containing chloramphenicol to prevent growth unless the *cat* fusion was activated by [d]{.smallcaps}-cycloserine placed in the center of the plate, which resulted in a ring of growth. In some mutants, a weaker ring of growth was observed. A lawn of growth indicated constitutive P*algD-lacZ* expression under such sessile conditions.
A-PG, aminoacyl-phosphatidyl glycerol.
We also employed another tool for measuring P*algD* induction, but under sessile conditions using a plate bioassay ([@B22]). Here, a low-copy-number reporter plasmid (pLW117, Gm^r^) has the *algD* promoter fused to a promoterless *cat* gene (P*algD-cat*) such that growth occurs in the presence of chloramphenicol (Cm) when P*algD* is activated. When a culture of PAO1(pLW117) was spread onto an L agar plate containing Cm (50 µg/ml) and [d]{.smallcaps}-cycloserine was spotted in the center of the plate, a ring of growth formed around the antibiotic due to the activation of the P*algD-cat* fusion ([Fig. 3](#fig3){ref-type="fig"}, PAO1). When the P*algD-cat* fusion was tested in a *mucA* mutant (PDO351), a lawn of growth on the Cm plate was observed because σ^22^ is constitutively active ([Fig. 3](#fig3){ref-type="fig"}, *mucA*); this lawn phenotype did not require stress for induction (data not shown). These P*algD-cat* phenotypes allowed us to test σ^22^ activity under sessile (i.e., biofilm-like) conditions for comparison to the above P*algD-lacZ* phenotypes under planktonic culture conditions.
![Sessile growth assay for observing the effects of mutations in genes of the σ^22^ stimulon on the activation of the σ^22^-dependent promoter, P*algD*. Shown are pictures of plates of L agar plus chloramphenicol (Cm) coated with mutant derivatives of PAO1 that hosted pLW117, a plasmid containing P*algD-cat*, which confers Cm^r^ and thus growth when activated. A 5-mm filter disk impregnated with [d]{.smallcaps}-cycloserine was placed in the center of the plate. With PAO1, exposure to [d]{.smallcaps}-cycloserine (10 µg) in the center of the plate produced a ring of Cm^r^ growth after 3 days at 25°C. A *mucA* mutant (devoid of the σ^22^ anti-sigma factor) is shown as an example of σ^22^ derepression. The other plates show a lawn of growth with the mutants indicated, which occurred with or without [d]{.smallcaps}-cycloserine and indicated constitutive activation of P*algD*-*cat* due to the mutation.](mbo0031212740003){#fig3}
The P*algD*-*lacZ* and P*algD-cat* reporter plasmids (pLW149a and pLW117, respectively) were transferred to each of the mutant strains for comparison of the effects of planktonic and sessile conditions. When grown under the same planktonic conditions, most of them produced β-galactosidase at the same \~1:100 untreated/treated ratios, similar to the wild type. Likewise, in the sessile state of growth, most showed the same ring of growth as did the wild type upon exposure to [d]{.smallcaps}-cycloserine. However, there were 11 mutants that showed distinguishing phenotypes compared to the wild type and are presented in [Table 3](#tab3){ref-type="table"}. Four mutants showed wild-type levels of P*algD-lacZ* activity under nonstressed conditions but showed alterations in the response to cell wall stress. Two (PA3459 and PA5424) showed reduced responsiveness to stress in the planktonic assay; in the sessile assay, they also displayed a consistently weaker ring of growth (data not shown). Two other mutants (PA1243 and PA5107) showed an increased response to stress when in planktonic culture, although a normal ring of growth was seen in the plate assay rather than an enlarged ring, which might have been predicted.
Three mutants (PA0062, PA1324, and PA5178) had activity higher than that of the wild-type P*algD-lacZ* under planktonic and unstressed conditions ([Table 3](#tab3){ref-type="table"}), indicating that loss of this gene product caused σ^22^ activation even without stress. This suggests that the loss of these gene products affected envelope homeostasis such that AlgW-mediated degradation of MucA is increased. Two of these (PA0062 and PA1324) showed the same results under sessile-biofilm conditions when carrying P*algD-cat* and produced a lawn ([Fig. 3](#fig3){ref-type="fig"}), which was consistent with elevated σ^22^ activation in the absence of stress. Both of these mutants also showed a temperature-sensitive phenotype at 45°C ([Fig. 2](#fig2){ref-type="fig"}). Interestingly, the PA5178 mutant produced a wild-type ring of growth when P*algD-cat* was induced by [d]{.smallcaps}-cycloserine, rather than a lawn, indicating that its role in envelope homeostasis was observable only under planktonic conditions.
There were four other mutants (PA0567, PA3040, PA2717, and PA0920) with elevated σ^22^ activity that grew as a lawn when expressing *algD-cat* ([Fig. 3](#fig3){ref-type="fig"}), indicating constitutive P*algD-cat* expression under unstressed sessile conditions. However, all showed normal P*algD-lacZ* activity under unstressed planktonic conditions ([Table 3](#tab3){ref-type="table"}). Thus, the roles of these σ^22^ stimulon gene products in maintaining envelope homeostasis were dependent on the sessile-biofilm state of growth.
DISCUSSION {#h2}
==========
The σ^22^ stimulon is a large stress response system in *P. aeruginosa* that includes the genes for the production of alginate, an important virulence factor; however, most of the gene products in the stimulon have undefined functions ([@B19]). Here we sought to better understand the σ^22^ stress response system by examining the expression of 27 undercharacterized genes of this stimulon and the phenotypes resulting from their mutations. Interestingly, none of the mutations of this stress response stimulon had a major effect on typical stress-related phenotypes like growth rate, temperature sensitivity, or alginate production.
We considered the recent observation that a mutation in *algT/U*, which disrupts the whole σ^22^ stimulon, results in less robust (i.e., less shear-resistant) biofilms ([@B24]). Biofilm growth of *P. aeruginosa* occurs on natural surfaces in the environment and during human infections, such as in the lungs of CF patients, causing chronic bronchopneumonia ([@B6], [@B7]). The development of a biofilm is initiated by planktonic (freely moving) bacteria that attach to a surface (become sessile) and form microcolonies that produce a polymeric matrix and become increasingly tolerant to antibiotics ([@B29]). When we compared the 293 genes in the σ^22^ stimulon ([@B19]) to those activated during biofilm development ([@B30]), we found that 59% of the σ^22^ stimulon genes were in common. Among the genes selected in our study, all but one (PA0919) are upregulated in PAO1 biofilms as determined by cluster analysis of whole-genome expression profiles of PAO1 transcriptomes derived from planktonic cultures that developed into mature biofilms ([@B30]). In addition, a recent screen of a strain PA14 transposon insertion library for biofilm defects revealed that mutants in 3 of the genes studied here (PA0854, PA1243, and PA4394) exhibit reduced biofilm formation as observed by microscopic analysis ([@B31]). Given this link between the σ^22^ stimulon and biofilm formation, we examined our σ^22^ stimulon mutants for biofilm defects. However, no obvious alteration from the wild-type biofilm phenotypes was observed using simple biofilm models. Instead, our studies focused on potential effects that the mutations might have on envelope homeostasis, as measured by σ^22^ activity on the alginate operon promoter, P*algD*, during planktonic and sessile growth conditions.
We expected that many of the genes in the σ^22^ stimulon would contribute to cell envelope homeostasis because their expression was upregulated during extracytoplasmic stress induced by exposure to [d]{.smallcaps}-cycloserine. This is an antibiotic that directly causes disruption of the peptidoglycan cell wall. Disruption of envelope homeostasis results in the activation of σ^22^, which can be measured by the expression of a σ^22^ promoter. One such σ^22^ promoter is P*algD*, the promoter of the alginate operon. Like other characterized ECF sigma factors, such as σ^E^ in *Escherichia coli* ([@B32]), σ^22^ is known to be activated by stress conditions via signal RIP degradation of the anti-sigma factor that normally sequesters the sigma factor, thus releasing or "activating" sigma factor activity ([Fig. 1](#fig1){ref-type="fig"}). We have previously shown that in *P. aeruginosa* PAO1, σ^22^ activation is highly responsive to cell wall stress ([@B19], [@B22]). Indeed, our mutant analysis of 27 genes of the σ^22^ stimulon revealed that over one-third of them (i.e., 11 of 27) had effects on σ^22^ activation under conditions of stress or nonstress.
Four mutants that altered the ability of *P. aeruginosa* to respond to cell wall stress with σ^22^ activation were found. Mutations in PA3459 and PA5424 reduced P*algD* responsiveness to cell wall stress under planktonic and sessile conditions. This suggests that their gene products are required for full activation of the stress response system involved in σ^22^ control. PA3459 is the first gene of a three-gene operon ([@B33]) that putatively encodes functions involved in the synthesis of a cytoplasmic osmoprotectant, *N*-acetyl-glutaminyl-glutamine amide (NAGGN) and is upregulated in response to osmotic stress ([@B34]). Thus, loss of this osmoprotectant resulted in a reduced ability to respond to cell wall stress in both planktonic and sessile states of growth. PA5424 encodes a small (81-amino-acid) conserved hypothetical protein predicted to contain 3 transmembrane helices and to localize to the inner membrane. Its closest homolog is the hypothetical protein YeaQ in *E. coli*, sharing 61% similarity, but for which little else is known.
Mutants with defects in PA1243 and PA5107 showed elevated expression during cell wall stress that could be measured during planktonic growth. PA1243 is predicted to encode a sensor/response regulator hybrid protein, located in the cytoplasmic membrane. It contains both a histidine kinase domain and a sensory domain (with a PAS motif). Thus, PA1243 may directly control a subset of genes in the σ^22^ stimulon under conditions recognized by its sensor domain. Interestingly, it was reported that a transposon insertion in PA1243 of strain PA14 exhibits reduced biofilm formation ([@B31]). PA5107 is predicted to encode a bacterial lipocalin (Blc), which is an outer membrane lipoprotein. Blc in *E. coli* is known to be expressed under cell envelope stress conditions caused by high osmolarity ([@B35]). Recent reports indicate that *E. coli* Blc is a dimer with a binding preference for lysophospholipids, which suggests a role for this protein in the storage/transport of lipids important for membrane biogenesis and repair ([@B36]).
Of particular interest to this study were the 7 mutants that demonstrated elevated σ^22^ activation even in the absence of stress: PA0062, PA1324, PA5178, PA2717, PA0567, PA3040, and PA0920. This suggests that these gene products are important for maintaining envelope homeostasis and/or preventing AlgW from spontaneously activating the σ^22^ stress response ([Fig. 4](#fig4){ref-type="fig"}). Mutations in PA0062 and PA1324 caused higher expression of P*algD* with and without stress induction, and this was observed under planktonic and sessile conditions. Interestingly, mutations in PA0062 or PA1324 also caused mild temperature-sensitive growth defects at 45°C. PA0062 encodes a hypothetical uncharacterized protein that is probably a lipoprotein. The PA1324 open reading frame (ORF) is classified in the *Pseudomonas* Genome Database ([@B33]) as an unknown hypothetical protein with a predicted type II lipoprotein signal. Recently, a nuclear magnetic resonance (NMR) structure of the PA1324 protein predicted a pre-albumin-like fold, and based on ligand screening studies, it is postulated to be involved in the binding and/or transport of polysaccharides ([@B37]).
![Illustration of the roles of specific gene products in the σ^22^ stimulon on the "activation" of σ^22^ activity (i.e., by release from the MucA-MucB inhibitory complex). This was determined by examining the effect of mutations on envelope homeostasis, which leads to activation of P*algD*. Mutations showed their effects when *P. aeruginosa* grew in the planktonic state of growth (left), the sessile/biofilm mode (right), or both (center).](mbo0031212740004){#fig4}
The PA5178 mutant showed higher constitutive and induced expression of P*algD* only during planktonic growth, while induced and uninduced P*algD* expression appeared normal under sessile conditions. Thus, PA5178 plays a role in envelope homeostasis primarily during the planktonic mode of growth. PA5178 encodes an unclassified hypothetical protein that is predicted to contain one LysM domain, which is a widely distributed peptidoglycan-binding domain ([@B38]), suggesting that it acts directly on the cell wall. It also has a BON domain, which is a putative phospholipid-binding region ([@B39]). A proteomic analysis of *P. aeruginosa* outer membranes shows that the cellular concentration of this protein is increased with increasing resistance to several antibiotics, including ampicillin ([@B40]).
The rest of the mutants (PA0920, PA0567, PA3040, and PA2717) showed defects in unstressed envelope homeostasis that could be observed only in the sessile state of growth ([Fig. 4](#fig4){ref-type="fig"}). Mutations in PA0567 and PA3040 had no effect on P*algD* expression and induction during planktonic growth but caused constitutive P*algD* expression under sessile growth. Thus, the effects due to the loss of these gene products were severe enough to trigger the σ^22^ stress response only in adherent cultures. PA0567 encodes a small, 52-amino-acid, hydrophobic peptide with 2 predicted transmembrane helices. It shares 78% similarity with the proteolipid YqaE of *E. coli*, and both are members of the Pfam domain UPF0057. UPF0057 proteolipids have been characterized in yeast and plants as stress-responsive proteins that help maintain membrane integrity under environmental conditions of high salinity and low temperatures ([@B41]). PA3040 encodes an ortholog of the DUF883 family of membrane proteins. It is the first gene of a three-gene operon expressing hypothetical proteins. Interestingly, another member of the DUF883 protein family is PA1323, which was also included in this study of σ^22^ stimulon members, although its inactivation did not lead to any apparent alteration in σ^22^ activity.
PA2717 is predicted to encode a cytoplasmic chloroperoxidase (Cpo). The PA2717 mutant was normal for unstressed P*algD* activity under planktonic conditions, but elevated P*algD* expression was seen under planktonic stressed conditions. It formed a lawn in the plate assay, indicating constitutive P*algD* activity under sessile conditions, suggesting that it normally attenuates σ^22^ activation in the absence of stress.
The mutation in PA0920 was especially interesting in that under planktonic conditions P*algD* expression was normal if unstressed but showed lower responsiveness (i.e., \~50% P*algD-lacZ* activity) upon cell wall stress. However, the PA0920 mutation had the opposite effect under sessile growth and caused constitutive P*algD* expression. PA0920 has recently been shown to encode an integral inner membrane enzyme required for the production of 2′-alanyl-phosphatidylglycerol in *P. aeruginosa* membranes ([@B42]). A PA0920 mutant analysis showed that alanyl-phosphatidylglycerol in *P. aeruginosa* PAO1 membranes confers increased resistance to the toxic effects of the heavy metal Cr^3+^, the osmolyte sodium lactate, the cationic peptide protamine sulfate, and cefsulodin, a β-lactam that impedes cross-linking of peptidoglycan. PA0920 is induced under acidic growth conditions, and here we show that it is also induced 5-fold by [d]{.smallcaps}-cycloserine as part of the σ^22^ stimulon. Changing the amount of alanyl-phosphatidylglycerol in *P. aeruginosa* membranes is a mechanism to control the fluidity and permeability of the cellular membranes, which are essential to maintaining envelope homeostasis ([@B42]). Here we also observed that loss of alanyl-phosphatidylglycerol in PAO1 membranes resulted in a disruption of envelope homeostasis leading to σ^22^ activation, but only under sessile/biofilm conditions.
In conclusion, we have found σ^22^-dependent genes whose loss resulted in altered stress responsiveness or constitutive activation of the σ^22^ sensory system that monitors cell envelope homeostasis. The effects were often dependent upon whether *P. aeruginosa* was in a planktonic or a sessile state of growth, suggesting an overlap with biofilm control mechanisms. Continued studies on the role of σ^22^ stimulon genes may reveal other links to the biofilm mode of growth and potential solutions for disrupting biofilms that often lead to antibiotic tolerance and persistence during infection.
MATERIALS AND METHODS {#h3}
=====================
Bacterial strains and growth conditions. {#h3.1}
----------------------------------------
Strains of *P. aeruginosa* used in this study are shown in [Table 4](#tab4){ref-type="table"}. The PAO1 parent strain used in this study, also known as PDO1 ([@B22]), is a spontaneous Cm^s^ isolate of the original Cm^r^ PAO1 strain obtained from B. W. Holloway ([@B43]). *E. coli* DH5α was used for routine plasmid manipulations. Bacteria were routinely cultured in L broth (10 g tryptone, 5 g yeast extract, and 5 g NaCl each per liter) or on L agar. LPIA plates were a 1:1 mix of L agar and *Pseudomonas* isolation agar (Difco) and were used to counterselect against *E. coli* following conjugal plasmid transfers to *P. aeruginosa*. Antibiotics (Sigma) were used at the concentrations indicated: gentamicin (Gm), 20 µg/ml and 100 µg/ml for *E. coli* and *P. aeruginosa*, respectively; tetracycline (Tc), 20 µg/ml and 60 µg/ml for *E. coli* and *P. aeruginosa*, respectively; kanamycin (Km), 30 µg/ml, and ampicillin (Ap), 100 µg/ml, both for *E. coli*; and carbenicillin (Cb), 100 µg/ml for *P. aeruginosa.*
######
*P. aeruginosa* strains and plasmids used in this study*^[a](#ngtab4.1)^*
Strain or plasmid Genotype/phenotype Source or reference
------------------- ---------------------------------------- ---------------------
*P. aeruginosa*
PAO1/PDO1 Wild type, Cm^s^ This laboratory
PDO-LS586 *algT*::*aacC*I 47
PDO351 *mucA*::*aacC*I (Gm^r^) Alg^+^ 22
PDO358 *algW*::*aacC*IΩ 22
PDO-PA0059 PDO1, PA0059::Tn (Tc^r^) (transduced) This study
PDO-PA0062 PDO1, PA0062::Tn (Tc^r^) (transduced) This study
PDO-PA0460 PDO1, PA0460::Tn (Tc^r^) (transduced) This study
PDO-PA0567 PDO1, PA0567::Tn (Tc^r^) (transduced) This study
PDO-PA0854 PDO1, PA0854::Tn (Tc^r^) (transduced) This study
PDO-PA0919 PDO1, PA0919::Tn (Tc^r^) (transduced) This study
PDO-PA0920 PDO1, PA0920::Tn (Tc^r^) (transduced) This study
PDO-PA1243 PDO1, PA1243::Tn (Tc^r^) (transduced) This study
PDO-PA1323 PDO1, PA1323::Tn (Tc^r^) (transduced) This study
PDO-PA1324 PDO1, PA1324::Tn (Tc^r^) (transduced) This study
PDO-PA2167 PDO1, PA2167::Tn (Tc^r^) (transduced) This study
PDO-PA2176 PDO1, PA2176::Tn (Tc^r^) (transduced) This study
PDO-PA2177 PDO1, PA2177::Tn (Tc^r^) (transduced) This study
PDO-PA2717 PDO1, PA2717::Tn (Tc^r^) (transduced) This study
PDO-PA3040 PDO1, PA3040::Tn (Tc^r^) (transduced) This study
PDO-PA3459 PDO1, PA3459::Tn (Tc^r^) (transduced) This study
PDO-PA3691 PDO1, PA3691::Tn (Tc^r^) (transduced) This study
PDO-PA3795 PDO1, PA3795::Tn (Tc^r^) (transduced) This study
PDO-PA3819 PDO1, PA3819::Tn (Tc^r^) (transduced) This study
PDO-PA4311 PDO1, PA4311::Tn (Tc^r^) (transduced) This study
PDO-PA4394 PDO1, PA4394::Tn (Tc^r^) (transduced) This study
PDO-PA4717 PDO1, PA4717::Tn (Tc^r^) (transduced) This study
PDO-PA5107 PDO1, PA5107::Tn (Tc^r^) (transduced) This study
PDO-PA5108 PDO1, PA5108::Tn (Tc^r^) (transduced) This study
PDO-PA5178 PDO1, PA5178::Tn (Tc^r^) (transduced) This study
PDO-PA5212 PDO1, PA5212::Tn (Tc^r^) (transduced) This study
PDO-PA5424 PDO1, PA5424::Tn (Tc^r^) (transduced) This study
Plasmids
pKK61 pCP19 (*oriV*~RK2~, Tc^r^) P*algD-cat* 22
pLW117 pKK61 *aacC1*(Gm^r^) P*algD-cat* This study
pLW127 pSS269, PA0059*osmC*(−239/+50)-*lacZ* 19
pLW148 pSS269, PA5178(−501/+50)-*lacZ* This study
pLW149a pSS269, PA3540 *algD*(−925/+50)-*lacZ* 19
pLW150 pSS269, PA4394(−255/+60)-*lacZ* This study
pLW152 pSS269, PA3819(−660/+70)-*lacZ* This study
pLW155 pSS269, PA3691(−372/+59)-*lacZ* 19
pLW166 pSS269, PA5108(−163/+70)-*lacZ* 19
pLW168 pSS269, PA4717(−1130/+50)-*lacZ* 19
pLW179 pSS269, PA1323(−450/+50)-*lacZ* This study
pLW182 pSS269, PA2176(−450/+50)-*lacZ* This study
pLW183 pSS269, PA2177(−450/+50)-*lacZ* This study
pLW185 pSS269, PA2167(−500/+50)-*lacZ* This study
pLW186 pSS269, PA0460(−500/+50)-*lacZ* This study
pLW187 pSS269, PA0567(−500/+50)-*lacZ* This study
pLW188 pSS269, PA0920(−500/+50)-*lacZ* This study
pLW189 pSS269, PA3040(−500/+50)-*lacZ* This study
pLW190 pSS269, PA3459(−500/+50)-*lacZ* This study
pLW191 pSS269, PA3795(−500/+50)-*lacZ* This study
pLW194 pSS269, PA5212(−500/+50)-*lacZ* This study
pLW195 pSS269, PA5424(−500/+50)-*lacZ* This study
pRK2013 ColE1-Tra(RK2)^+^ Km^r^ 48
pSS269 pSS223 *lacZ* SF Ap^r^ 27
All *P. aeruginosa* strains were derived from PDO1, a spontaneous Cm^r^ isolate of strain PAO1 previously described ([@B28]). Abbreviations: Gm^r^, *aacC*I-encoded gentamicin resistance; Ap^r^, ampicillin/carbenicillin resistance; Km^r^, kanamycin resistance; Alg^+^, mucoid due to alginate overproduction; *lacZ*, β-galactosidase reporter in transcriptional fusions; SF, stabilization fragment for replication in *P. aeruginosa*. Numbers in parentheses before *lacZ* indicate the promoter region in base pairs relative to the start of translation (+1) of the open reading frame used to make the transcriptional reporter.
Mutant strain construction. {#h3.2}
---------------------------
Mutants of *P. aeruginosa* PAO1 with sequence-defined transposon (Tn*5*-derived, Tc^r^) insertions of Tn*5*-*lacZ* or Tn*5*-*phoA* were purchased from the University of Washington Genomics Resource Center (WGRC, <http://www.gs.washington.edu/labs/manoil/libraryindex.htm>). Such Tn*5*-marked alleles were transduced into this laboratory's PAO1 reference isolate (PDO1) with selection for tetracycline resistance (Tc^r^). Plate lysates with the generalized transducing phage F116L ([@B43]) were made with each WGRC mutant by incubating 10 ml F116L lysate at various 1:10 dilutions with 0.1 ml of an overnight L broth culture containing 10 mM MgSO~4~ and 5 mM CaCl~2~, which was then incubated at room temperature for 10 min to permit adsorption. Molten top agar at 50°C (3 ml L broth with 0.7% agar) was added to each tube and immediately poured onto the surface of an L agar plate. After 24 h at 37°C, 3 ml of L broth was added to a plate showing confluent plaques, the top agar was extracted with a sterile spreader, and the mix was centrifuged to remove the agar and bacterial cells. The supernatant was passed through a 0.45-µm filter to remove any residual bacteria. For transductions, 0.1 ml of a transducing lysate was mixed with 0.2 ml of the *P. aeruginosa* host strain grown overnight in L broth, which was incubated at room temperature for 15 min and was then shaken at 225 rpm at 37°C for 1 h; the culture was then plated onto L agar containing selective antibiotics and incubated at 37°C until colonies were observed. All transduced transposon insertions were examined by PCR to verify that each insertion was in the correct gene. For this, primers specific for Tn5-*lacZ* (LacZ148, GGGTAACGCCAGGGTTTTCC) or Tn5-*phoA* (PhoA138, CGGGTGCAGTAATATCGCCCT) and primers specific for the 5′ and 3′ ends of the gene of interest using sequences obtained from the *Pseudomonas* Genome Database ([@B33]) were used in standard PCRs with *Taq* polymerase; the products were observed using agarose gel electrophoresis for size analysis. To examine the effect of such mutations on the mucoid phenotype, Tn*5* (Tc^r^)-mutated alleles were transduced into PDO351 (i.e., *mucA*::Gm). There were some F116L lysates of WGRC Tn*5* mutants (i.e., PA0062, PA567, PA920, PA1323, PA1324, PA2717, PA3040, PA3819, PA4717, PA5107, and PA5424) where transductants were rare, in which case the *mucA*::*aacC*I (Gm^r^) allele from PDO351 was transduced into verified PAO1/PDO1::Tn*5* (Tc^r^) mutants instead. Information on domains in proteins of interest was found in the *Pseudomonas* Genome Database ([@B33]) found at <http://www.pseudomonas.com>.
Disk diffusion assay. {#h3.3}
---------------------
The relative level of resistance to antibiotics by mutants was compared to that of the wild type by a standard disk diffusion assay. A sample (0.1 ml) of culture in the early logarithmic phase was spread onto an L agar plate, and then a 5-mm paper disk impregnated with the antibiotic was placed in the center to permit radial diffusion. After 24 h of incubation at 37°C, the diameter of the ring of growth inhibition was measured.
Assay for alginate. {#h3.4}
-------------------
*P. aeruginosa* strains were grown on L agar plates at 37°C for 48 h, and then the growth was resuspended in saline. Bacterial cells were removed by centrifugation, and then the supernatant was tested for alginate (which is composed of two uronic acids) using the carbazole-spectrophotometric method for the assay of uronic acids described by Knutson and Jeanes ([@B44]). Alginic acid from *Macrocystis pyrifera* (Sigma) was used as the standard.
Promoter-*lacZ* reporter plasmids. {#h3.5}
----------------------------------
High-fidelity *Pfu* Turbo (Stratagene) was used to amplify DNA by PCR with all primers custom synthesized by Eurofins MWG Operon using sequences available in the *Pseudomonas* Genome Database ([@B33]). Promoter regions obtained by PCR amplification included DNA \~0.5 kb upstream of each selected ORF, which was cloned into the broad-host-range transcriptional *lacZ* reporter pSS269 ([@B27]). Reporter plasmids were transferred from *E. coli* to *P. aeruginosa* strains by triparental mating as described elsewhere ([@B27]) using helper plasmid pRK2013 to mobilize the *oriT*-containing plasmids to *P. aeruginosa* with selection on LPIA plates containing an appropriate selective antibiotic. It was observed that reporter plasmids in some Tn*5* mutants (i.e., PA0062, PA0920, PA1243, PA1324, PA2177, and PA3819) were somewhat unstable, and so fresh conjugations of reporter plasmids into these mutants were followed immediately by β-galactosidase assays in order to obtain consistent results. Transcriptional activity of reporter constructs was determined by measuring β-galactosidase activity, reported in Miller units, from promoter-*lacZ* fusions. For assays verifying σ^22^ dependence, strains were grown in L broth to an optical density at 600 nm (OD~600~) of 1.0, at which time 0.1-ml aliquots were assayed. To determine promoter activation in response to cell wall stress induced by [d]{.smallcaps}-cycloserine, strains were grown in 25 ml L broth at 37°C to an OD~600~ of 0.3; cultures were split in half, [d]{.smallcaps}-cycloserine was added to one half (400 µg/ml), and then both were incubated for an additional 60 min, at which time 0.1-ml samples of untreated and treated cultures were assayed for β-galactosidase activity.
Bioassay for P*algD* induction on a solid substrate. {#h3.6}
----------------------------------------------------
Plasmid pKK61 with an *algD-cat* fusion in low-copy-number vector pLAFR1 (Tc^r^) was previously described ([@B45]). Because the mutants in this study were Tc^r^ due to the transposon insertions, a Gm^r^ derivative of pKK61 named pLW117 was constructed to permit selection of the plasmid transferred to the mutant strains. pLW117 was constructed by cloning an *aacC*IΩ (Gm^r^) cartridge ([@B46]) into the HindIII site of pKK61. Bioassays of PAO1/PDO1::Tn strains (Cm^s^) carrying pLW117 were performed as previously described ([@B22]). Briefly, expression of *algD-cat* was tested by incubating cultures to an OD~600~ of 1.2, at which time a 1.5-ml sample was centrifuged, and the bacterial cell pellet was resuspended in 10 mM MgSO~4~ to an OD~600~ of 0.2. A 25-µl sample of this cell suspension was spread onto an L agar plate containing chloramphenicol at 50 µg/ml. A 5-mm filter disk impregnated with 1 mg [d]{.smallcaps}-cycloserine (i.e., 10 µl of a 100-mg/ml stock solution) was placed in the center of the plate. The test plates were then incubated at 25°C for 3 days and examined for a ring of Cm^r^ growth around the disk, indicating induced expression of *algD-cat*.
Biofilm assays. {#h3.7}
---------------
Static L broth cultures of PAO1 and mutant derivatives were compared for their abilities to adhere to the walls of polystyrene tubes after a 24-h incubation at 37°C as previously described ([@B28]). Also, the ability to form an air-to-medium interface flocculation during static-growth culture at 25°C was performed as previously described ([@B28]), and the flocculation was examined daily over a 12-day period.
**Citation**Wood LF, Ohman DE. 2012. Identification of genes in the σ^22^ regulon of *Pseudomonas aeruginosa* required for cell envelope homeostasis in either the planktonic or the sessile mode of growth. mBio 3(3):e00094-12. doi:10.1128/mBio.00094-12.
We gratefully acknowledge the VCU Nucleic Acids Core Facility for assistance in the microarray analyses.
This work was supported by Public Health Service grant AI-19146 from the National Institute of Allergy and Infectious Diseases (D.E.O.) and in part by Veterans Administration medical research grant I01BX000477 (D.E.O.).
[^1]: **Editor** Gerald Pier, Harvard Medical School
| 2024-07-03T01:27:04.277712 | https://example.com/article/9434 |
Penetration of different molecule sizes upon ultrasound combined with microbubbles in a superficial tumour model.
Ultrasound combined with microbubbles (USMB) has been extensively applied to enhance drug and gene targeting delivery. However, the accumulation and distribution of particle size in the range of 5-30 nm (nano drug) to the tumour and the effects of intratumoral vascular density on permeability have been rarely reported. This study investigated Evans blue (EB) and fluorescein isothiocyanate-labelled dextran (FITC-dextran) distribution in tumour tissue upon USMB with various molecular sizes (3.7 nm and 30.6 nm). USMB increased the penetration of molecules with sizes of 5-20 nm in the whole tumour tissue, especially on the rim. For a molecule with sizes of 30.6 nm, USMB only increased penetration around the rim of the tumour with minimal improvement in the central of tumour. USMB enhanced the permeability of tumour tissue and increased tumour cells dose exposure without affecting tumour blood perfusion or microvessel density. The current study served as the foundation of parameter preference for therapeutic USMB drug delivery. | 2024-01-18T01:27:04.277712 | https://example.com/article/2631 |
Idiopathic differentiated histiocytosis.
Eighty-nine cases variously diagnosed as histiocytosis X, eosinophilic granuloma, Hand-Schuller-Christian disease, Letterer-Siwe disease, or malignant histiocytosis from one institution were reviewed. Follow-up data were obtained for all patients. On the basis of clinicopathologic correlation, the following distinct groups were identified. 1. Disseminated histiocytosis (12 patients) with involvement of more than two organ systems at the time of recognition of the disease, affecting children less than 3 years of age (the patient's general condition is poor and hepatosplenomegaly is common. The patients do poorly, and all the patients in this group of the present study died. 2. Histiocytosis confined to bone, whether monostotic (36 patients) or polyostotic (eight patients). This type is self-healing, does not disseminate, and does not require intensive therapy. Clinically the patients are older and in good general condition during the course of the disease. Histologically histiocytes in these two groups are cytologically benign, and the whole process is inflammatory rather than neoplastic. Presence of giant cells, eosinophils, and necrosis are usually associated with better prognosis. Many neoplastic diseases and infectious processes manifest as histiocytosis. More than a third of the cases of this study diagnosed as histiocytosis proved to be other processes. This confusion contributes to differences of various reports and difficulty of interpretation of findings. | 2023-11-13T01:27:04.277712 | https://example.com/article/3894 |
import bmesh
from ..arch import fill_arch, create_arch, add_arch_depth
from ..fill import fill_bar, fill_louver, fill_glass_panes, FillUser
from ..frame import add_frame_depth
from ..generic import clamp_count
from ...utils import (
clamp,
FaceMap,
validate,
arc_edge,
local_xyz,
valid_ngon,
sort_faces,
sort_edges,
extrude_face,
ngon_to_quad,
get_top_edges,
get_top_faces,
map_new_faces,
calc_edge_median,
get_bottom_faces,
add_faces_to_map,
extrude_face_region,
calc_face_dimensions,
filter_vertical_edges,
add_facemap_for_groups,
filter_horizontal_edges,
subdivide_face_vertically,
subdivide_face_horizontally,
)
def create_window(bm, faces, prop):
"""Generate a window
"""
for face in faces:
face.select = False
if not valid_ngon(face):
ngon_to_quad(bm, face)
clamp_count(calc_face_dimensions(face)[0], prop.frame_thickness * 2, prop)
array_faces = subdivide_face_horizontally(bm, face, widths=[prop.size_offset.size.x]*prop.count)
for aface in array_faces:
face = create_window_split(bm, aface, prop.size_offset.size, prop.size_offset.offset)
window, arch = create_window_frame(bm, face, prop)
if prop.type == "RECTANGULAR":
fill_window_face(bm, window, prop)
if prop.add_arch:
fill_arch(bm, arch, prop)
bmesh.ops.remove_doubles(bm, verts=bm.verts, dist=0.0001)
return True
@map_new_faces(FaceMap.WALLS)
def create_window_split(bm, face, size, offset):
"""Use properties from SplitOffset to subdivide face into regular quads
"""
wall_w, wall_h = calc_face_dimensions(face)
# horizontal split
h_widths = [wall_w/2 + offset.x - size.x/2, size.x, wall_w/2 - offset.x - size.x/2]
h_faces = subdivide_face_horizontally(bm, face, h_widths)
# vertical split
v_width = [wall_h/2 + offset.y - size.y/2, size.y, wall_h/2 - offset.y - size.y/2]
v_faces = subdivide_face_vertically(bm, h_faces[1], v_width)
return v_faces[1]
def create_window_frame(bm, face, prop):
"""Create extrude and inset around a face to make window frame
"""
if prop.type == "CIRCULAR":
return create_circular_frame(bm, face, prop)
return create_rectangular_frame(bm, face, prop)
def create_circular_frame(bm, face, prop):
""" Create extrude and inset around circular face
"""
if prop.frame_depth != 0.0:
face, _ = extrude_face(bm, face, -prop.frame_depth)
xyz = local_xyz(face)
width, length = calc_face_dimensions(face)
prop.frame_thickness = min(prop.frame_thickness, min(length, width) / 2)
# -- subdivide the face along the shortest side
func = [subdivide_face_vertically, subdivide_face_horizontally][width > length]
sections = [[length / 2] * 3, [width / 2] * 3][width > length]
faces = func(bm, face, sections)
# -- get edges that will be used to make circle
mid = sort_faces(faces, xyz[0] if width > length else xyz[1])[1]
func = [filter_horizontal_edges, filter_vertical_edges][width > length]
edges = func(mid.edges)
# -- move the edges towards each other
median = mid.calc_center_median()
end, start = sort_edges(edges, xyz[0] if width > length else xyz[1])
for e in edges:
bmesh.ops.translate(bm, verts=list(e.verts), vec=median - calc_edge_median(e))
# -- arch the edges
res = prop.resolution // 2
radius = min(length, width) / 2
arc_edge(bm, start, res, radius, xyz)
arc_edge(bm, end, res, -radius, xyz)
# -- inset for frame thicknes
bmesh.ops.remove_doubles(bm, verts=bm.verts, dist=0.0001)
res = bmesh.ops.inset_region(
bm, faces=[mid], use_even_offset=True, thickness=prop.frame_thickness
)
# -- add window depth
win, frames = add_window_depth(bm, mid, prop.window_depth, xyz[2])
add_faces_to_map(bm, [win], FaceMap.WINDOW)
add_faces_to_map(bm, res.get("faces", []) + frames, FaceMap.FRAME)
return win, None
def create_rectangular_frame(bm, face, prop):
"""Create extrude and inset around a face to make rectangular window frame
"""
normal = face.normal.copy()
# XXX Frame thickness should not exceed size of window
min_frame_size = min(calc_face_dimensions(face)) / 2
prop.frame_thickness = clamp(prop.frame_thickness, 0.01, min_frame_size - 0.001)
window_face, frame_faces = make_window_inset(bm, face, prop.size_offset.size, prop.frame_thickness)
arch_face = None
# create arch
if prop.add_arch:
frame_faces.remove(get_top_faces(frame_faces).pop()) # remove top face from frame_faces
top_edges = get_top_edges({e for f in get_bottom_faces(frame_faces, n=3)[1:] for e in f.edges}, n=2)
arch_face, arch_frame_faces = create_arch(bm, top_edges, frame_faces, prop.arch, prop.frame_thickness, local_xyz(face))
frame_faces += arch_frame_faces
bmesh.ops.recalc_face_normals(bm, faces=list(bm.faces))
# add depths
if prop.add_arch:
_, [window_face], [arch_face], frame_faces = add_frame_depth(bm, [], [window_face], [arch_face], frame_faces, prop.frame_depth, normal)
arch_face, new_frame_faces = add_arch_depth(bm, arch_face, prop.arch.depth, normal)
frame_faces += new_frame_faces
else:
_, [window_face], _, frame_faces = add_frame_depth(bm, [], [window_face], [], frame_faces, prop.frame_depth, normal)
window_face, new_frame_faces = add_window_depth(bm, window_face, prop.window_depth, normal)
frame_faces += new_frame_faces
# add face maps
add_faces_to_map(bm, [window_face], FaceMap.WINDOW)
add_faces_to_map(bm, validate(frame_faces), FaceMap.FRAME)
if prop.add_arch:
add_faces_to_map(bm, [arch_face], FaceMap.WINDOW)
return window_face, arch_face
def add_window_depth(bm, window, depth, normal):
if depth > 0.0:
window_faces, frame_faces = extrude_face_region(bm, [window], -depth, normal)
return window_faces[0], frame_faces
else:
return window, []
def make_window_inset(bm, face, size, frame_thickness):
""" Make two horizontal cuts and two vertical cuts
"""
window_width = size.x - frame_thickness * 2
window_height = size.y - frame_thickness * 2
# horizontal cuts
h_widths = [frame_thickness, window_width, frame_thickness]
h_faces = subdivide_face_horizontally(bm, face, h_widths)
# vertical cuts
v_widths = [frame_thickness, window_height, frame_thickness]
v_faces = subdivide_face_vertically(bm, h_faces[1], v_widths)
return v_faces[1], h_faces[::2] + v_faces[::2]
def fill_window_face(bm, face, prop):
"""Create extra elements on face
"""
validate_fill_props(prop)
if prop.fill_type == "GLASS_PANES":
add_facemap_for_groups(FaceMap.WINDOW_PANES)
fill_glass_panes(bm, face, prop.glass_fill, user=FillUser.WINDOW)
elif prop.fill_type == "BAR":
add_facemap_for_groups(FaceMap.WINDOW_BARS)
fill_bar(bm, face, prop.bar_fill)
elif prop.fill_type == "LOUVER":
add_facemap_for_groups(FaceMap.WINDOW_LOUVERS)
fill_louver(bm, face, prop.louver_fill, user=FillUser.WINDOW)
def validate_fill_props(prop):
if prop.fill_type == "BAR":
# XXX keep bar depth smaller than window depth
fill = prop.bar_fill
fill.bar_depth = min(fill.bar_depth, prop.window_depth)
elif prop.fill_type == "LOUVER":
# XXX keep louver depth less than window depth
fill = prop.louver_fill
depth = getattr(prop, "door_depth", getattr(prop, "dw_depth", 1e10))
fill.louver_depth = min(fill.louver_depth, depth)
| 2024-01-25T01:27:04.277712 | https://example.com/article/7775 |
Last Updated on January 15, 2018
The Story of Krista Sepp
Midland is a small Ontario town located on the shores of Georgian Bay. It has a population of almost 17,000 people and quite frankly, not much goes on in this sleepy little town. Midland was incorporated in 1890 and you can count on your hand the number of murders that have occurred there, but on the night of February 3, 1989 a murder occurred that would put this small Ontario town in the news.
During my career as a police officer patrolling the streets of Midland, this case was one that I can honestly say shouldn’t have happened. The twenty-one year old victim in this case was Krista Sepp who was employed by Child and Family Services as a social worker. Krista was working her first night shift at a group home and one of the residents of the home was Joyanne Beeson.
Beeson was a sixteen year old troubled youth that was sent to the group home for trying to stab her mother and step-father in a small town north of Midland. One of the greatest tragedies of this story is neither Krista nor the police had any idea why Beeson was a resident of the house. Had this piece of information been made available Krista Sepp may very well still be alive today.
During her stay at the group home Beeson began a relationship with an eighteen year old male from town named James Tobin. Tobin was known to police as a kid who was known to prowl the streets looking for things to steal or places to break into. The staff at the group home was aware of Tobin’s feelings for Beeson and they did their best to stop the two of them from getting together. Even though it was never confirmed there was a strong belief that Beeson would slip out of the house at various times and meet up with Tobin.
On the night of the murder Tobin attended outside the group home and met up with Beeson. Beeson decided she had had enough of life at the group home and wanted Tobin to do something about it. Beeson talked about wanting to be a modern day version of “Bonnie and Clyde” living a life of crime. Tobin and Beeson entered the group home and Tobin ripped the phone out of the wall so Krista could not call the authorities. The pair met Krista in the upstairs hallway and Tobin produced a knife. As Krista was begging for her life Tobin stabbed her nineteen times killing her instantly.
Tobin and Beeson took off from the group home and stole a car to facilitate their getaway. The couple headed north and were subsequently arrested a short time later. Tobin was convicted of second degree murder and was eligible for parole after twelve years. Beeson was convicted of manslaughter and sentenced to six years. She was released in 1995.
Krista’s murder was the second tragedy the Sepp family had to deal with as her brother, who was a recovering drug addict, was stabbed to death in 1983 in Sault Ste Marie, Ontario. Two former drug acquaintances were convicted in his murder.
At the time Krista’s murder, she was the first social worker to be killed in the line of duty. There have been numerous changes to the way Child and Family Services staff group homes now and client information is much more available to the staff members involved. This is a direct result of the unfortunate and needless murder of Krista Sepp. | 2024-03-07T01:27:04.277712 | https://example.com/article/5262 |
Phosphorylation of proteoglycans from human articular cartilage.
Previous studies have shown that sulfated proteoglycans from human articular and epiphyseal cartilage were phosphorylated. These macromolecules contribute to the stiffness and resiliency of this tissue. We demonstrate here that the phosphate moieties are an integral part of proteoglycan subunits. Specifically, evidence is presented which indicates that proteoglycan monomers contain 3 to 4 phosphate moieties per core protein and that these appear to exist as phosphoserine residues. Furthermore, the data illustrate that human articular cartilage also contains more than 20 different phosphoproteins, some of which are closely associated with proteoglycan aggregates. Proteoglycan subunits were purified from extracts of articular cartilage or from media fractions which had been used to label tissue specimens with 32P-orthophosphate. Chemical and radiographic analyses revealed that the phosphate concentration with respect to sulfate and uronic acid content remained constant when purified proteoglycan monomers were subjected to equilibrium ultracentrifugation and size-exclusion chromatography. That the phosphate moieties were bound to proteoglycan monomers via monoester linkages was indicated by the release of 32P-orthophosphate from proteoglycan subunits incubated under mild alkaline conditions or reacted with acid or alkaline phosphatases. Identification of serine residues in the core protein as the sites of phosphorylation was made by autoradiography of thin layer plates on which hydrolyzed samples of purified 32P-proteoglycan subunits had been subjected to 2-dimensional electrophoresis/chromatography. Quantification of 3 to 4 phosphate moieties per core protein of 200,000 daltons was made by chemical analysis of inorganic phosphate released from proteoglycans by acid hydrolysis. | 2024-06-02T01:27:04.277712 | https://example.com/article/4726 |
The Australian Mission
March 2017
What a wonderful visit we had by our Lord through Vassula’s visit to Melbourne and Sydney. Through her visit, many lives were impacted. We sensed a great move of God through the Holy Spirit in the Great South Land.
It was by divine appointment that the Lord sent Vassula on this trip accompanied by Fr. Joseph Iannuzzi, a doctoral alumnus of the Gregorian Pontifical University and noted theologian. Their mission was twofold: to participate in the third True Life in God (TLIG) Australian retreat and to hold a public meeting in Sydney.
TLIG Retreat in Melbourne, March 17-19
The retreat was held in the Mantra hotel in Preston, Melbourne, themed Tender Father.
The theme of the retreat was Tender Father. This picture was used on the front of the program booklet.
Main Retreat Image
Vassula and Fr. Iannuzzi arrived a day before the retreat and were invited by friends for dinner. During the dinner there was mention of a lady who was in the hospital with not much time to live. Vassula offered to pray for this lady in the hospital. When we arrived, the lady was surrounded by her children and other relatives who were very sad for her condition. Fr. Iannuzzi administered the Sacrament of the Anointing of the Sick and anointed her with oil. Vassula prayed, holding the crucifix for the lady who was filled with hope to see her. They concluded by praying a blessing on the relatives surrounding her.
On Friday, the delegates started to arrive at the hotel. Some needed to be picked up from Melbourne airport. Imagine how delighted and surprised they were to find Vassula waiting for them in the passenger seat with the driver who came to collect them. Everyone present was enjoying her sense of humor and chatting with her on their way to the hotel.
Friday Night, March 17
It was a very joyful occasion for friends from all over Australia, with some from New Zealand, Solomon Islands and Malaysia, who came together once again for a TLIG retreat. This retreat was significant as it was the first time we had Vassula as our guest of honor. There were six clergy present from different denominations.
Some of the priests and international guests at dinner with Vassula
Fr. Iannuzzi began with a talk about the TLIG messages from a Canon Law perspective, explaining how he first heard about the messages in 1989. He delighted the listeners with his down-to-earth sense of humor and very valuable information to empower the whole Body of Christ. He gave us factual information about the position of the Church towards Vassula and the TLIG messages, encouraging us to spread the message boldly as it has received the two seals of Imprimatur and Nihil Obstat. To paraphrase his words on the Catholic Church's stance towards the TLIG messages, 'Christians must not set themselves up as their own judge in deciding whether these messages are authentic and must abstain from publicly condemning them, when the Magisterium has granted these seals of approval.'
Fr. Iannuzzi encouraged the attendees to confidently witness the TLIG message explaining the ‘Seals of Approval’.
Following Fr. Iannuzzi's introduction, Vassula was welcomed by enthusiastic applause. Many were very appreciative that Vassula traveled the distance to be with us, since it is a challenge for many to travel overseas from our distant country. Vassula spoke of her recent travels to the Middle East. Prior to her visiting us, her travels to witness about the messages had been constant for several months, which highlighted how urgent God’s warning is to the world. How incredible that the Lord sent her to Syria and Lebanon, despite all the dangers, to meet the Muslim imams: Sunni, Shiite and Druze! Through the report of her recent mission, it was evident to us that the love of God is reaching out to all people and Vassula is His instrument of love and peace to all humanity.
Saturday, March 18
It was an early start to the day with the Sacrament of Confession and Reconciliation followed by Holy Mass and Adoration, with some of the faithful leading in heavenly song.
A time of Adoration; the Monstrance held high by Fr. Bernard, with Fr. Iannuzzi (right)
This was followed by a rich meal of talks from Vassula and Fr. Iannuzzi. After the talks, Vassula and all the priests prayed by laying hands on most of those who attended, around 200. After these prayers, there was a book signing of Heaven is Real, But so is Hell and other items from the bookstall.
Around 200 guests attended the Melbourne retreat; a group photo outside the hotel.
In the evening during dinnertime, we listened to testimonies from individuals who have been converted and healed through the TLIG messages. One man, who could hardly walk, needing support when he arrived at the retreat, was able to stand and walk up to the stage after he received the healing prayer earlier that day. One lady spoke of how she saw Jesus walk alongside Vassula on her visit to Adelaide many years ago. Another lady gave her testimony on how the Lord saved her life and freed her from drug addiction. There were several other inspiring testimonies. It touched our hearts to hear how Our Lord searches for the lost with so much tenderness. We also heard from Fr. Bernard, a Benedictine priest from Sydney, who attended the whole retreat and gave a wonderful talk. There was a sense of peace, beauty and majesty on this day, as we ended the evening joining hands in song and dance to the hymn Thoxa, Thoxa!
Sunday, March 19
Again, as the previous day, we began the day early with Confession, Reconciliation and Holy Mass. The clergy celebrated the Eucharist around one table, as God the Father desires. Fr. Bernard presided and gave a beautiful homily.
Following Holy Mass, Fr. John, an Anglican priest from the Solomon Islands, gave an emotional talk of the miracles which had allowed him and his two compatriots to attend the retreat only at the last minute. In the words of one of the delegates, upon reflection of Fr. John's talk:
"The Sunday short speech given by the Anglican minister from the Solomon Islands was a decided highlight because it imbued one of the major themes of the TLIG messages: the humility of this minister, with tears running down his cheeks, exposing a heart full of love for his people, full of love and gratitude for Vassula and God’s messages, and in particular the call for Christian unity. It struck me that his profound humility, his open love-filled heart, and simplicity and sincerity of heart, together with his conviction to work towards Christian unity, is what our Lord is asking of us all. His few simple and sincere words moved me mightily!!! Listening to this Anglican minister from the Solomon Islands reminded me yet again of our tendency to overcomplicate God and His Messages!!! What does God want most of all--a simple, sincere contrite heart with a humble spirit."
Towards the end of the retreat, Vassula reminded the participants that God wants them to do whatever they could to spread the messages. She gave the analogy that some people have a big glass (i.e., many talents), while some people have only a small glass (i.e., not as many talents). God wants us to have our glass full as a measure of our contribution to His work. No matter whether our glass is big or small, we should do our best. Vassula acknowledged the hard work of the organizers of the retreat and urged others to be more proactive in the evangelization and organization for events for TLIG.
Vassula was then approached by a young married couple who have been trying, but unable to conceive, who felt that there was a demonic influence causing this problem. After they received healing prayers, they were filled with so much hope and joy. We also learned that the husband was the grandson of the lady who had received prayers in the hospital. With much gladness, they received news that their grandmother had recovered and her blood count was miraculously back to normal. Praise be to the Lord Jesus!
TLIG Public Meeting, Sydney, March 20
On Monday evening a public meeting was held, with many new people attending. It began with songs of praise, then Fr. Iannuzzi followed by introducing Vassula and the messages. People were so in awe when they listened to Vassula's speech, one could hear a pin drop in the hall. The meeting was streamed-live and many who had attended the retreat from other cities did not miss-out on watching it. This meeting is still available to watch on YouTube.
Vassula addresses the crowd at the Sydney meeting on Monday.
Vassula addresses the crowd at the Sydney meeting on Monday.
As the meeting drew to a close, Vassula lifted the small crucifix and prayed for the people collectively, with Fr. Iannuzzi praying beside her. Several people reported seeing three flashes of supernatural light while they prayed. After the meeting, the bookstall was very busy. For the first time after a scheduled public meeting, the designated True Life in God phone did not stop ringing with follow-up phone calls from people who had previously never heard about the messages and who were grateful that God called them to this meeting.
Tuesday, March 21
On our final day together, Vassula and Fr. Iannuzzi spent a day of fellowship and relaxation with some of the organizers who prepared for her visit. We walked from St. Mary’s Cathedral down to the Sydney Opera House, and had lunch at Sydney Tower, while enjoying its panoramic views. Following lunch, some of the group took Father and Vassula to see some of our Australian wildlife at the Sydney Aquarium in Darling Harbour.
Fr Iannuzzi enjoying The Lord’s creature: a kangaroo
The timing was amazing, as after we finished our walk in the city it started to rain heavily. We spent the final evening together not wanting to say goodbye. Fr. Iannuzzi bade farewell to each one of us, exhorting us as apostles of the End of Times, leaving us with feelings of elation to be serving our Lord in His Australian vineyard. Vassula and Fr. Iannuzzi left on the following day for their next mission to the Philippines.
True Life in God Australia would like to thank Vassula for visiting Australia and so generously spending her time with us to share God’s Love Hymn to humanity. Our warmest thanks also to Fr. Iannuzzi for his efforts to be with and encourage us here down under. All glory, praise and honor to the Blessed Trinity! | 2024-06-10T01:27:04.277712 | https://example.com/article/9303 |
Q:
Using algolia (php website) - Looking for the best update/delete method?
I have looked into how I could specify objectID when initially indexing objects, but this doesn't seem possible. As the system has no knowledge of Algolia auto-generated objectID's - what is the best way to deal with update/delete actions?
A:
It is possible to specify your ObjectID.
Quoting from the docs:
Every object is uniquely identified by an objectID. If you don’t provide one, Algolia will generate one automatically. However, it will be easier to remove or update records if you have stored a unique identifier in the objectID attribute.
| 2024-05-14T01:27:04.277712 | https://example.com/article/4422 |
Just because you are gluten-free, doesn’t mean that you can’t have gravy with your mashed potatoes, a rich cheese sauce with your macaroni and cheese, a lovely alfredo sauce with your pasta, or a roux with your gumbo. Many people use corn starch as an thickening alternative to flour, but I find it leaves a weird aftertaste sometimes. I prefer arrowroot powder or flour. It is much smoother and creates a nice white sauce which you see above. Make a cheese sauce with this béchameland use it with your fondue pot. Perfect for Valentine’s day! | 2023-08-04T01:27:04.277712 | https://example.com/article/1526 |
A goal of many modern long haul optical transport systems is to provide for the efficient transmission of large volumes of voice traffic and data traffic over trans-continental distances at low costs. Various methods of achieving these goals include time division multiplexing (TDM) and wavelength division multiplexing (WDM). In time division multiplexed systems, data streams comprised of short pulses of light are interleaved in the time domain to achieve high spectral efficiency, high data rate transport. In wavelength division multiplexed systems, data streams comprised of short pulses of light of different carrier frequencies, or equivalently wavelength, are co-propagate in the same fiber to achieve high spectral efficiency, high data rate transport.
The transmission medium of these systems is typically optical fiber. In addition there is a transmitter and a receiver. The transmitter typically includes a semiconductor diode laser, and supporting electronics. The laser may be directly modulated with a data train with an advantage of low cost, and a disadvantage of low reach and capacity performance. After binary modulation, a high bit may be transmitted as an optical signal level with more power than the optical signal level in a low bit: Often, the optical signal level in a low bit is engineered to be equal to, or approximately equal to zero. In addition to binary modulation, the data can be transmitted with multiple levels, although in current optical transport systems, a two level binary modulation scheme is predominantly employed.
Typical long haul optical transport dense wavelength division multiplexed (DWDM) systems transmit 40 to 80 channels of 10 Gbps (gigabit per second) across distances of 3000 to 6000 km in a single 30 nm spectral band. A duplex optical transport system is one in which traffic is both transmitted and received between parties at opposite end of the link. In current DWDM long haul transport systems transmitters different channels operating at distinct carrier frequencies are multiplexed using a multiplexer. Such multiplexers may be implemented using array waveguide grating (AWG) technology or thin film technology, or a variety of other technologies. After multiplexing, the optical signals are coupled into the transport fiber for transmission to the receiving end of the link.
At the receiving end of the link, the optical channels are de-multiplexed using a de-multiplexer. Such de-multiplexers may be implemented using AWG technology or thin film technology, or a variety of other technologies. Each channel is then optically coupled to separate optical receivers. The optical receiver is typically comprised of a semiconductor photodetector and accompanying electronics.
The total link distance may in today's optical transport systems be two different cities separated by continental distances, from 1000 km to 6000 km, for example. To successfully bridge these distances with sufficient optical signal power relative to noise, the total fiber distance is separated into fiber spans, and the optical signal is periodically amplified using an in line optical amplifier after each fiber span. Typical fiber span distances between optical amplifiers are 50-100 km. Thus, for example, 30 100 km spans would be used to transmit optical signals between points 3000 km apart. Examples of inline optical amplifiers include erbium doped fiber amplifiers (EDFAs) and semiconductor optical amplifiers (SOAs).
Alternatively, a Raman optical amplifier may be used to boost the optical signal power. Most Raman optical amplifiers comprise at least one high power pump laser that is launched into the fiber span. Through the nonlinear optical process of stimulated Raman scattering in the SiO2 of the glass of the fiber span, this pump signal provides gain to the optical signal power. A Raman amplifier may be co-propagating or counter-propagating to the optical signal, and a common configuration is to counter-propagate the Raman pump. A Raman amplifier may be used alone, or in combination with an alternate example of an inline optical amplifier, such as an EDFA. For example, a Raman amplifier may be used in conjunction with an inline optical amplifier to accommodate high loss spans and to bring the net span loss within an allowable system dynamic range.
When a plurality of high power Raman pump lasers are used it is desirable to control the gain. An example of Raman amplifier gain control in the current art is to measure the input signal power and output signal power and to compare these measurements. In a Raman amplifier that uses the fiber span, this control method is slow because of the large distance between the input and the output of the fiber span. Consequently there is a need for a fast Raman gain control method, and in particular a Raman gain control method that is based on power measurements on only one end of the transmission fiber span.
In another Raman amplifier gain control method currently practiced, the gain was controlled with a probe wavelength. This method is not optimal, however, because extra hardware is required, and the additional optical signal limits the reach and capacity of the optical transport system. Consequently there is a need for a Raman gain control method that does not employ a probe wavelength. | 2023-12-21T01:27:04.277712 | https://example.com/article/5426 |
# Translation of Odoo Server.
# This file contains the translation of the following modules:
# * report_qweb_signer
#
# Translators:
# OCA Transbot <transbot@odoo-community.org>, 2017
msgid ""
msgstr ""
"Project-Id-Version: Odoo Server 10.0\n"
"Report-Msgid-Bugs-To: \n"
"POT-Creation-Date: 2017-08-17 02:52+0000\n"
"PO-Revision-Date: 2017-08-17 02:52+0000\n"
"Last-Translator: OCA Transbot <transbot@odoo-community.org>, 2017\n"
"Language-Team: Spanish (Dominican Republic) (https://www.transifex.com/oca/"
"teams/23907/es_DO/)\n"
"Language: es_DO\n"
"MIME-Version: 1.0\n"
"Content-Type: text/plain; charset=UTF-8\n"
"Content-Transfer-Encoding: \n"
"Plural-Forms: nplurals=2; plural=(n != 1);\n"
#. module: report_qweb_signer
#: model_terms:ir.ui.view,arch_db:report_qweb_signer.report_partner_demo_document
msgid "<span>This is a sample report for testing PDF certificates.</span>"
msgstr ""
#. module: report_qweb_signer
#: model_terms:ir.ui.view,arch_db:report_qweb_signer.report_partner_demo_document
msgid "<strong>Partner:</strong>"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__allow_only_one
msgid "Allow only one document"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__path
msgid "Certificate file path"
msgstr ""
#. module: report_qweb_signer
#: model_terms:ir.ui.view,arch_db:report_qweb_signer.view_company_form
msgid "Certificates (PDF signing)"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model,name:report_qweb_signer.model_res_company
msgid "Companies"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__company_id
msgid "Company"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__create_uid
msgid "Created by"
msgstr "Creado por"
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__create_date
msgid "Created on"
msgstr "Creado en"
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__display_name
msgid "Display Name"
msgstr "Nombre mostrado"
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__domain
msgid "Domain"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,help:report_qweb_signer.field_report_certificate__domain
msgid "Domain for filtering if sign or not the document"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,help:report_qweb_signer.field_report_certificate__attachment
msgid ""
"Filename used to store signed document as attachment. Keep empty to not save "
"signed document."
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__id
msgid "ID"
msgstr "ID"
#. module: report_qweb_signer
#: model:ir.model.fields,help:report_qweb_signer.field_report_certificate__allow_only_one
msgid ""
"If True, this certificate can not be useb to sign a PDF from several "
"documents."
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate____last_update
msgid "Last Modified on"
msgstr "Última modificación en"
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__write_uid
msgid "Last Updated by"
msgstr "Última actualización de"
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__write_date
msgid "Last Updated on"
msgstr "Última actualización en"
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__model_id
msgid "Model"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,help:report_qweb_signer.field_report_certificate__model_id
msgid "Model where apply this certificate"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__name
msgid "Name"
msgstr "Nombre"
#. module: report_qweb_signer
#: model:ir.actions.act_window,name:report_qweb_signer.action_report_certificate
#: model:ir.ui.menu,name:report_qweb_signer.menu_report_certificate
msgid "PDF certificates"
msgstr ""
#. module: report_qweb_signer
#: model_terms:ir.ui.view,arch_db:report_qweb_signer.view_report_certificate_form
msgid "PDF report certificate"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_res_company__report_certificate_ids
#: model_terms:ir.ui.view,arch_db:report_qweb_signer.view_report_certificate_tree
msgid "PDF report certificates"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__password_file
msgid "Password file path"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,help:report_qweb_signer.field_report_certificate__path
msgid "Path to PKCS#12 certificate file"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,help:report_qweb_signer.field_report_certificate__password_file
msgid "Path to certificate password file"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model,name:report_qweb_signer.model_ir_actions_report
msgid "Report Action"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model,name:report_qweb_signer.model_report_certificate
msgid "Report Certificate"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__attachment
msgid "Save as attachment"
msgstr ""
#. module: report_qweb_signer
#: code:addons/report_qweb_signer/models/ir_actions_report.py:104
#, python-format
msgid ""
"Saving signed report (PDF): You do not have enough access rights to save "
"attachments"
msgstr ""
#. module: report_qweb_signer
#: model:ir.model.fields,field_description:report_qweb_signer.field_report_certificate__sequence
msgid "Sequence"
msgstr "Secuencia"
#. module: report_qweb_signer
#: code:addons/report_qweb_signer/models/ir_actions_report.py:122
#, python-format
msgid "Signing report (PDF): Certificate or password file not found"
msgstr ""
#. module: report_qweb_signer
#: code:addons/report_qweb_signer/models/ir_actions_report.py:131
#, python-format
msgid ""
"Signing report (PDF): jPdfSign failed (error code: %s). Message: %s. Output: "
"%s"
msgstr ""
#. module: report_qweb_signer
#: model:ir.actions.report,name:report_qweb_signer.partner_demo_report
msgid "Test PDF certificate"
msgstr ""
| 2023-09-01T01:27:04.277712 | https://example.com/article/8730 |
Over the last 20 years many neuroregulators have been identified and significant progress has been made in identifying the molecular basis of neurotransmission. The in vivo dynamics of several neurochemical events have been monitored using amperometric microelectrodes, but this approach is hindered by the relatively poor selectivity of these electrodes. In the proposed project, electrodes with excellent selectivities will be developed by incorporating a thin layer of immobilized enzyme and other protective coatings into the microelectrode. Such electrodes would allow the in vivo determination of non-electroactive species for the first time. Initially, an electrode for the determination of the potent neuroexitatory amino acid, glutamate, will developed, since it has been identified in many neuronal pathways and is normally present in fairly high concentrations. The spacial, temporal and analytical characteristics of the electrodes will be improved, and microelectrodes for other compounds important in neuroregulation will be developed in Phase II. | 2023-12-17T01:27:04.277712 | https://example.com/article/7454 |
# Configuration of Academic
# Documentation: https://sourcethemes.com/academic/
#
# This file is formatted using TOML syntax - learn more at https://learnxinyminutes.com/docs/toml/
# Each configuration section is defined by a name in square brackets (e.g. `[outputs]`).
# Title of your site
title = "Introduction to Machine Learning in the Tidyverse"
# The URL of your site.
# End your URL with a `/` trailing slash, e.g. `https://example.com/`.
baseurl = "/"
# Enter a copyright notice to display in the site footer.
# To display a copyright symbol, type `©`. For current year, type `{year}`.
copyright = ""
############################
## Advanced options below ##
############################
# Name of Academic theme folder in `themes/`.
theme = "hugo-academic"
# Get last modified date for content from Git?
enableGitInfo = false
# Default language to use (if you setup multilingual support)
defaultContentLanguage = "en"
hasCJKLanguage = false # Set `true` for Chinese/Japanese/Korean languages.
defaultContentLanguageInSubdir = false
removePathAccents = true # Workaround for https://github.com/gohugoio/hugo/issues/5687
paginate = 10 # Number of items per page in paginated lists.
enableEmoji = true
footnotereturnlinkcontents = "<sup>^</sup>"
ignoreFiles = ["\\.ipynb$", ".ipynb_checkpoints$", "\\.Rmd$", "\\.Rmarkdown$", "_files$", "_cache$"]
[outputs]
home = [ "HTML", "RSS", "JSON", "WebAppManifest" ]
section = [ "HTML", "RSS" ]
[mediaTypes."application/manifest+json"]
suffixes = ["webmanifest"]
[outputFormats.WebAppManifest]
mediaType = "application/manifest+json"
rel = "manifest"
[markup]
defaultMarkdownHandler = "goldmark"
[markup.goldmark]
[markup.goldmark.renderer]
unsafe = true # Enable user to embed HTML snippets in Markdown content.
[markup.highlight]
codeFences = false # Disable Hugo's code highlighter as it conflicts with Academic's highligher.
[markup.tableOfContents]
startLevel = 2
endLevel = 3
[imaging]
resampleFilter = "lanczos"
quality = 90
anchor = "smart" # Anchor for cropping. Options include Smart and Center.
# Taxonomies.
[taxonomies]
tag = "tags"
category = "categories"
publication_type = "publication_types"
author = "authors"
| 2023-11-15T01:27:04.277712 | https://example.com/article/6068 |
Women Helping Women: Study Shows Promoting One Woman Helps Many More
In the midst of intense national scrutiny of gender equality and sexual harassment in the workplace, one University of Virginia economist’s work offers a glimpse of a solution.
Economics professor Amalia Miller and her co-author, Astrid Kunze, used some of the most robust workplace data available to prove that increased female representation in companies’ upper echelons significantly improves women’s promotion rates across the board, closing a persistent gender gap.
Their paper, “Women Helping Women? Evidence from Private Sector Data on Workplace Hierarchies,” was published this month in the Review of Economics and Statistics journal. It used data on white-collar workers at more than 4,000 private employers in Norway from 1987 to 1997 – about half a million workers in total. Miller and Kunze were able to measure both promotions within a company and promotions that resulted from job changes, creating an unusually widespread dataset.
Their findings provide statistical support to efforts promoting gender parity in the workplace at a time when women face a 15 percent wage gap among the 35 high-income countries included in the Organization for Economic Cooperation and Development. Additionally, as Harvey Weinstein and the #MeToo movement reminds us, women often face sexual harassment in the workplace as well.
Miller explains more about how increasing female representation is helping women – and one instance when it isn’t – in the Q&A below.
Q. Why did you choose to conduct your study in Norway?
A. Norway has administrative data on every worker in the country, and from 1987 to 1997 – the time of our study – employers used the same job codes to assign workers to one of seven hierarchical ranks. Those codes allowed us to standardize how we measured promotions across different companies and to provide more robust data than other studies, which often focus only on one large company.
More generally, Norway is also at the frontier of gender equality in business. Shortly after we stopped gathering data, it became the first country in the world to impose a mandatory gender quota requiring that at least 40 percent of corporate board members be female.
Q. What did you observe about overall promotion rates of women relative to their male colleagues?
A. On average, women were 52 percent less likely than men to be promoted, even when we controlled for rank, years of schooling, tenure and other variables. That gap held true across all ranks, not just the lower ranks.
We also studied differences between workers with and without children and, among those with children, those with children age 17 or under and those with children under age 7. We found that having children had no effect on men’s promotion rate. However, having young children lowered women’s promotion rate, even when we controlled for those who worked part-time.
Q. You collected this data mostly in the 1990s. Do you have any concerns about how the results might have changed since then?
A. I believe it is still relevant. Obviously, the quota that Norway imposed after our study will make a difference in female representation at the very highest levels of an organization. However, that quota only affects corporate boards. Our study extended across every rank in an organization.
Additionally, I believe the data is relevant well beyond Norway, as many studies show a worldwide gender gap in both rank and pay.
Q. According to your data, how did the presence of more highly ranked women affect the promotion gap across the board?
A. We found that having more women in higher ranks narrowed the gap not just at that rank, but also in lower ranks, suggesting that increased female leadership can have “spillover” benefits for women in lower ranks. This could be because there are more female mentors, role models and advocates available.
Q. Did increased female leadership have a significant effect on the promotion rate for male workers?
A. No. While having more women at higher ranks increased the promotion rate for female workers, it did not appear to have any significant effect on promotion rate for male workers.
Q. In a seeming contradiction, both your study and a study on the U.S. Army found that having more female workers in the same rank actually increased the gender gap for promotions at that rank. Why?
A. That was a bit of a surprise. We found that having more women in peer ranks – as opposed to higher ranks – increased the promotion rate for male workers and therefore widened the gender gap in promotions. So, having more women in the rank above you increases your chance for a promotion, but having more women in the same rank hurts it. Interestingly, a study on the U.S. Army, authored by Pinar Karaca-Mandic, Nicole Maestas and David Powell, found a similar effect in a very different setting.
It could be because of lingering tokenism in the workplace – more women competing for just a few spots given to women – or because female mentorship is spread thin when there are more women around. As more women ascend to managerial ranks, I suspect this effect will lessen.
Q. We are in the midst of a major national discussion about sexual harassment. How might having more women in higher ranks affect sexual harassment in the workplace?
A. Though our data did not directly study sexual harassment in the workplace, I believe that problem could be related to a lack of women in leadership positions. Women can also be perpetrators, but the majority of cases we have heard about recently involve men in positions of power harassing lower-ranking women. Having more women in positions of power – both at the executive level and in middle management – could reduce the frequency of those incidents, and ideally help victims feel more comfortable reporting abuse and seeking some resolution.
The University of Virginia will celebrate the inauguration of its ninth president, James E. Ryan, with a series of public events on Oct. 19 and 20, including a research symposium, a 5K run/walk, a live storytelling series and more. | 2023-12-05T01:27:04.277712 | https://example.com/article/4283 |
Q:
Stop "?" from being added to URL
I currently have an Angular 2 app where the user can submit a form to create a new item. When the submit button is clicked, it calls a function that sends the data to the server and navigates to a new page when the server confirms that the data has been saved successfully.
My problem comes because the form submission appends the form parameters to the URL. So for example if I had an input named title and submission took me to the route mytitle which is the input for the title field, Angular (or whatever injects the GET parameters) would try to navigate to mysite.com/mytitle?title=mytitle instead of just mysite.com/mytitle. Even adding [ngModelOptions]="{standalone: true}" to all of my inputs still leaves a question mark with no parameters after it.
This is a problem because it causes Angular to reload the app because the given route does not match any routes in my route definitions. Is there a way to disable the GET parameters being injected into the URL entirely? POST doesn't work either because I have nowhere to post to, and my next URL uses data from the form itself.
A:
I found an answer to my question, the "Submit" button defaulted to being of type "submit", so changing it to type "button" removed the GET parameters injection behavior.
| 2024-06-02T01:27:04.277712 | https://example.com/article/8622 |
Q:
Opencv is not working in Qt5.13. App is always crashing in windows
I have installed Qt5.13 and linked opencv version 4.0 . But application is crashing when I am trying to use opencv library; otherwise it will work
.pro file
INCLUDEPATH += C:\opencv\build\include
LIBS += -L"C:\\opencv\\build\\x64\\vc15\\lib" \
-lopencv_world410
Mainwindow.cpp
#include "mainwindow.h"
#include "ui_mainwindow.h"
#include "opencv2/opencv.hpp"
MainWindow::MainWindow(QWidget *parent)
: QMainWindow(parent)
, ui(new Ui::MainWindow)
{
ui->setupUi(this);
cv::Mat img = cv::imread("qq.jpg");
cv::imshow("ee",img);
cv::waitKey(0);
}
MainWindow::~MainWindow()
{
delete ui;
}
Every solution is appreciated.
A:
opencv path was missing in "path" environment variable
| 2024-02-18T01:27:04.277712 | https://example.com/article/6396 |
For indispensable reporting on the coronavirus crisis, the election, and more, subscribe to the Mother Jones Daily newsletter.
This story first appeared on the The Atlantic Cities and is reproduced here as part of the Climate Desk collaboration.
From a behavioral perspective, the hardest thing about adapting to the slow process of climate change is creating a sense of urgency. After a close call with Hurricane Irene a couple years back, and a horrible clash with Hurricane Sandy this past fall, New York is beginning to accept the fact that when it comes to weather patterns along its coasts, there’s a terrifying new normal.
Late last week, just two months after Sandy, a state commission released a massive, 200-plus page blueprint on ways to develop resilience in the face of tomorrow’s environment [PDF]. The NYS 2100 Commission—one of several formed by Governor Andrew Cuomo following Sandy—evaluated the state’s critical infrastructure systems and recommended a gradient of goals, from broad to specific, to reduce their vulnerability.
“There is no doubt that building resilience will require investment, but it will also reduce the economic damage and costs of responding to future storms and events, while improving the everyday operations of our critical systems,” write commission co-chairs Judith Rodin of the Rockefeller Foundation and Felix Rohatyn of Lazard in a foreword.
While the commission offered statewide suggestions, its emphasis fell naturally on the New York City metro area—especially coastal parts of Manhattan, Brooklyn, and Long Island—where Sandy hit hardest.
The report’s recommendations were based on five characteristics of resiliency: spare capacity (e.g. establishing backup systems, such as alternative transportation routes), flexibility (favoring “soft” solutions that can be modified over time, like improved hazard maps and evacuation plans), limited failure (designing infrastructure networks, especially power grids, to shutdown in pieces instead of wholes), rapid rebounds (initiating preemptive response strategies, like creating fleets of portable generators), and constantly learning.
Ideas produced by this model of resiliency cross a number of infrastructure sectors. Some of the broadest ones touch on the insurance and financial sides of resilience. The commission recommends considering ways to pre-fund disaster recovery, for instance, and also the establishment of an infrastructure bank to coordinate and maximize the investments bound to occur in coming years. A general strengthening of the energy grid, especially securing critical systems, is also suggested.
Many of the recommendations specific to New York City fall in the category of land use. The former includes a host of “green infrastructure” initiatives. These take the form of restoring wetlands and oyster reefs in New York Harbor to break up storm surges, or building an archipelago of small islands in front of the harbor, or dumping old subway cars into the sea to form barrier reefs. (As Sarah Goodyear recently pointed out, even green infrastructure is subject to destruction during major storms.) The commission also suggests a comprehensive assessment of a true storm surge barrier on the harbor, estimating the cost between $7 billion and $29 billion.
Even more city-relevant recommendations focus on solidifying the transportation network (which, it should be said, recovered rather well post-Sandy). The commission encourages measures to limit subway flooding, including waterproof roll-down doors at the foot of subway entrances, mechanical vent closures, and inflatable plugs or bladders for the tunnels themselves. It also suggests a general increase in pump capacity and upgrades of infrastructure subject to seawater erosion. More resilient airports—featuring raised runways, better drainage valves, and more emergency fuel storage—also get mentioned.
The biggest transportation suggestion is what the commission calls “redundancy.” Here the commission’s idea is to create so many overlapping routes into and out of the city that if one fails the others can continue to function. Recommendations include expanded intercity rail networks, more surface transit, additional ferry service, and continued support of non-motorized travel modes like biking.
There are a few particular projects endorsed by the commission to meet this redundancy goal. Some are the usual suspects: a new transit tunnel across the Hudson, expanded Long Island Railroad service, and Metro North commuter rail access at Penn Station on the west side (instead of only Grand Central on the east). The most novel idea is the establishment of a vast bus rapid transit network—beginning perhaps with a “BRT task force” created this year—to complement the rail system and fortify inter-borough corridors.
The New York Times, reporting last week on a draft of the report that seems similar to the final version, wondered if the recommendations weren’t too sprawling and vague. The Times also pointed out that a “disaster preparedness commission” already exists under state law, making the present one rather superfluous. Last, the paper notes that commissions and reports mean little if they aren’t followed by political action.
All these critiques of the NYS 2100 Commission are well taken. Still we shouldn’t forget that climate adaptation policy remains pretty uncharted territory. These problems are very new, the solutions largely untested. At some point quite soon New York (and other vulnerable cities) will have to select and implement adaptation measures. For now it’s at least a partial sign of urgency that we’re building consensus around the best ones. | 2024-05-26T01:27:04.277712 | https://example.com/article/9578 |
Dose-finding and pharmacokinetic study of orally administered indibulin (D-24851) to patients with advanced solid tumors.
Indibulin (ZIO-301/D-24851) is an orally applied small molecule with antitumor activity based upon destabilization of microtubule polymerization. The purpose of this phase I study was to determine the maximum tolerated dose (MTD) as well as the dose limiting toxicity (DLT), the pharmacokinetics, safety and tolerability of orally administered indibulin as capsule formulation in patients with advanced solid tumors. Patients received a single dose of indibulin. Seven dose-levels were evaluated: 100 mg, 150 mg, 250 mg, 350 mg and 600 mg once daily (QD), 450 mg and 600 mg twice daily (BID). After a washout period, patients received indibulin at the pre-defined daily dose for 14 days every 3 weeks (multiple dose part). A total of 28 patients entered the study. Indibulin administered as capsules was generally well tolerated. The MTD was not reached. There was a disproportionate increase of the area under the plasma concentration-time curve (AUC) with dose, with declining AUC corrected for dose starting at the 250 mg dose-level. There was no significant difference in AUC of indibulin after multiple dosing (day 1-14) compared to single administration (day-4). Inter-patient variability in AUC (102% CV) was high. A plateau in drug exposure was observed prior to reaching the MTD. Continued dose-escalation was unlikely to yield any increase in exposure of indibulin. The formulation needs optimization to increase the systemic exposure upon oral administration. | 2024-05-21T01:27:04.277712 | https://example.com/article/1396 |
Video Transcript
Renaming Captions.
So in order to rename any of the captions, you need to go to the caption menu for that caption field and select Rename Caption. The Renaming a Field dialogue box appears. So in this instance, I'm going to rename dialogue as the British spelling with a UE at the end and click okay. And as you can see it's changed here in the Panel View and that applies to every panel even if you select different panels in the thumbnail view. And if you're sure you would like to keep this spelling of dialog throughout all your projects, you can go to the top menu and select Caption > Save Caption Layout as Default. | 2024-01-03T01:27:04.277712 | https://example.com/article/4808 |
The Dallas Cowboys and Detroit Lions are led by two quarterbacks who play eerily similar football:
Matthew Stafford vs. Tony Romo '13
Player
Yards
Touchdowns
Interceptions
Completion percentage
Matthew Stafford
2,129
15
4
61.4
Tony Romo
2,010
15
5
68.3
ESPN, through Week 7.
Both Tony Romo and Matthew Stafford have elite weapons to utilize. The former gets to throw to one of the NFL's best receivers in Dez Bryant and a startling rookie in Terrance Williams, while the latter throws to the NFL's best in Calvin Johnson and has an explosive back by the name of Reggie Bush.
So, yes, this one is going to come down to the defenses. Both units rank in the bottom five of the NFL, but Dallas actually has talent in the secondary. Cornerback Brandon Carr is ranked No. 13 at his position in the league, according Pro Football Focus (subscription required). Detroit's top four corners come in at 47 or worse, with the final three at 85, 94 and 99 on a list of 107.
Romo and company will be able to pull away in spite of an underperforming defense thanks to Detroit's own issues.
It's no secret the Denver Broncos are an offensive juggernaut. Peyton Manning and company average 469.3 yards per game, and Manning leads the league in touchdowns (25), yards (2,565) and rating (123.3). Denver's featured back, Knowshon Moreno, leads the NFL with eight touchdowns.
Last week, Washington managed 45 points in a win against Chicago and the team posted over 200 rushing yards, helped by 95 from quarterback Robert Griffin III.
While the numbers are impressive, the Redskins will not find a way to run on the NFL's No. 1 rush defense.
Even worse, Washington may be without both starting safeties. Brandon Meriweather is suspended for illegal hits, per NFL.com'sChris Wesseling. Meanwhile, Reed Doughty was concussed last week and may miss the contest, as he joked with the media per Redskins beat reporter Grant Paulsen: | 2023-09-10T01:27:04.277712 | https://example.com/article/1063 |
Signal transduction pathways leading to spore differentiation in Dictyostelium discoideum.
Cells that overexpress PKA as a consequence of carrying multiple copies of the gene encoding the catalytic subunit can be induced to sporulate when developing as single cells. A peptide phosphorylated by PKA, termed SDF-1, has recently been shown to stimulate this process (Anjard et al., 1997). Several genes have been implicated in a signal transduction pathway by which prestalk cells induce encapsulation of prespore cells during terminal differentiation including a prestalk-specific putative membrane protease (TagC) and a two-component system consisting of a receptor-histidine kinase (DhkA) and a response regulator with cAMP phosphodiesterase activity (RegA). To determine whether SDF-1 uses this pathway, strains carrying null mutations in the pertinent genes were transformed with a pkaC plasmid such that they can overexpress PKA. Since these mutant strains all sporulated efficiently when SDF-1 was added, it appears that other gene products mediate the response. However, we found that regA- mutant cells release a distinct factor, SDF-2, that rapidly induces encapsulation of test cells overexpressing pkaC. Since cells in which tagC is disrupted do not form SDF-2 and cells in which dhkA is disrupted do not respond to SDF-2, this peptide appears to use the two-component system that regulates PKA activity. SDF-2 is a small peptide released by prestalk cells in a manner dependent on TagC. It appears to act on prespore cells through the DhkA receptor to inhibit the cAMP phosphodiesterase of RegA, thereby activating PKA via cAMP. The process of induction by SDF-2 can be shown to be distinct from that by SDF-1. SDF-2 appears to stimulate prestalk cells to release additional SDF-2 by acting through a signal transduction pathway that also involves DhkA, RegA, and PKA. Based on these results we present a model for the signal transduction cascade regulating spore differentiation. | 2023-08-10T01:27:04.277712 | https://example.com/article/6176 |
RFID systems typically include RFID tags and RFID readers (the latter are also known as RFID reader/writers or RFID interrogators). RFID systems can be used in many ways for locating and identifying objects to which the tags are attached. RFID systems are particularly useful in product-related and service-related industries for tracking large numbers of objects being processed, inventoried, or handled. In such cases, an RFID tag is usually attached to an individual item, or to its package.
In principle, RFID techniques entail using an RFID reader to interrogate one or more RFID tags. The reader transmitting a Radio Frequency (“RF”) wave performs the interrogation. A tag that senses the interrogating RF wave responds by transmitting back another RF wave. The tag generates the transmitted back RF wave either originally, or by reflecting back a portion of the interrogating RF wave in a process known as backscatter. Backscatter may take place in a number of ways.
The reflected back RF wave may further encode data stored internally in the tag, such as a number. The response is demodulated and decoded by the reader, which thereby identifies, counts, or otherwise interacts with the associated item. The decoded data can denote a serial number, a price, a date, a destination, other attribute(s), any combination of attributes, and so on.
An RFID tag typically includes an antenna system, a power management section, a radio section, and frequently a logical section, a memory, or both. In earlier RFID tags, the power management section included a power storage device, such as a battery. RFID tags with a power storage device are known as active tags. Advances in semiconductor technology have miniaturized the electronics so much that an RFID tag can be powered solely by the RF signal it receives. Such RFID tags do not include a power storage device, and are called passive tags. Passive tags include at least one of rectifier circuits and charge pump circuits for harvesting usable power from the RF signal received via the antenna system. In operation, an alternating RF wave received by the antenna system is converted by the rectifier circuits and charge pump circuits into usable direct current (“DC”) voltage that can be used to power the operation of the passive RFID tag.
Harvesting sufficient power from the RF wave can be difficult since the voltage of the RF signal is in the range of approximately 200 millivolts, and a typical supply voltage for circuits of the RFID tag is one volt. Additionally, for relatively high-voltage operations in the RFID tag, such as for programming and erasing non-volatile memory in the RFID tag, a boosted voltage as high as 12 volts may be needed. Complicating matters is that the RF wave received by the RFID tag is not constantly provided, and can cease to be transmitted by the RFID reader without any notice. Thus, operation of passive RFID tags converting the low-level RF waveform to a usable voltage requires rectifiers and charge pump circuits that can generate usable voltage quickly and efficiently. | 2024-01-17T01:27:04.277712 | https://example.com/article/8249 |
The selective inhibition of serotonin-induced contractions of rabbit cerebral vascular smooth muscle by calcium-antagonistic dihydropyridines. An investigation of the mechanism of action of nimodipine.
I studied the role of calcium in the activation of isolated rings of saphenous and basilar arteries of the rabbit by comparing the effect of calcium withdrawal with the effect of the calcium antagonist nimodipine [isopropyl(2-methoxyethyl)-1,4-dihydro-2,6-dimethyl-4-(3-nitrophenyl)-3,5-pyridinedicarboxylate]. Serotonin-induced contractions of both vessels were inhibited quickly by incubation in calcium-free solution, showing the contractions of both vessels to be dependent on extracellular calcium. Potassium-induced contractions of both vessels were inhibited markedly by nimodipine (basilar: ID50 = 1.7 X 10(-10) mol/liter; saphenous: ID50 = 2.6 X 10(-10) mol/liter), showing depolarization-induced calcium influx (probably through "potential sensitive channels", PSCs) to be sensitive to nimodipine. In the basilar artery the sustained, tonic phase of serotonin-induced contractions (probably through "receptor operated channels," ROCs) was potently inhibited (ID50 = 7.3 X 10(-10) mol/liter) by nimodipine. However, the initial short-lived phase of this contraction of the basilar artery was relatively unaffected (ID50 = 2 X 10(-6) mol/liter), indicating that the inhibitory action of nimodipine on tonic contractions of the basilar artery was not due to antagonism at the serotonin receptor level. In contrast, in the saphenous artery the serotonin-induced contractions were unaffected by nimodipine in doses up to 2.4 X 10(-5) mol/liter. It is postulated that the selective inhibition of the sustained tonic contraction of the basilar artery is due to a selective inhibition by nimodipine of calcium movement through ROCs in this vessel. Agonist-induced activation of ROCs in peripheral blood vessels does not seem to be affected by calcium antagonists. | 2024-07-12T01:27:04.277712 | https://example.com/article/1678 |
Junker Jørgensen
Junker Jørgensen (17 May 1946 – 8 January 1989) was a Danish cyclist. He competed in the team time trial at the 1972 Summer Olympics.
References
Category:1946 births
Category:1989 deaths
Category:Danish male cyclists
Category:Olympic cyclists of Denmark
Category:Cyclists at the 1972 Summer Olympics
Category:People from Roskilde | 2024-06-10T01:27:04.277712 | https://example.com/article/4859 |
Werner Maihofer
Werner Maihofer (20 October 1918 – 6 October 2009) was a German jurist and legal philosopher. He served as Germany's Federal Minister of the Interior from 1974–1978 until he resigned after a scandal involving an illegal wiretapping of Klaus Traube.
Biography
An avid speed skater in his youth, Maihofer was a member of the German national team at the 1936 Winter Olympics in Garmisch-Partenkirchen. Maihofer served in the Wehrmacht in World War II. He studied law at the University of Freiburg, and received his Doctor of Laws degree in 1950. Maihofer gained his habilitation in 1953 and eventually obtained a professorship at the University of Saarbrücken.
Maihofer did not join the Free Democratic Party until 1969. One of the leaders of thought of social liberalism in Germany, he co-authored the Freiburg theses alongside Karl-Hermann Flach and Walter Scheel in 1971. In 1974, he succeeded Hans-Dietrich Genscher as Federal Ministry of the Interior, and—during the German Autumn—had to back several restraints of civil liberty.
Illegal wiretapping
During the German Autumn the Red Army Fraction increased their activities. Suspected contacts were monitored in the hope of gaining information that might lead to the capture of the militants. Klaus Traube, a nuclear industrialist, was sympathetic to groups opposed to nuclear power. He was suspected of passing secret information to left-wing radicals. In 1975, in a covert operation called "Operation Müll" ("operation trash"), the BND, under the supervision of Maihofer planted a number of wiretaps in Traube's home. They also later informed his employer who, as a result, dismissed him. This illegal operation was uncovered in 1977 by the magazine Der Spiegel. Maihofer resigned from his office in 1978, after taking responsibility for the illegal wiretapping. Maihofer returned to his chair at the University of Bielefeld which he held since 1970.
Death
Maihofer died on 6 October 2009; he was the oldest German Federal Minister at the time of this death. He was buried in Frankfurt am Main.
References
Category:1918 births
Category:2009 deaths
Category:People from Konstanz
Category:Free Democratic Party (Germany) politicians
Category:German jurists
Category:University of Freiburg alumni
Category:Members of the Bundestag for North Rhine-Westphalia
Category:Interior ministers of Germany
Category:German male speed skaters
Category:Bielefeld University faculty
Category:Saarland University faculty
Category:Grand Crosses with Star and Sash of the Order of Merit of the Federal Republic of Germany | 2024-01-28T01:27:04.277712 | https://example.com/article/3988 |
On the resolution of ECG acquisition systems for the reliable analysis of the P-wave.
The analysis of the P-wave on surface ECG is widely used to assess the risk of atrial arrhythmias. In order to provide reliable results, the automatic analysis of the P-wave must be precise and reliable and must take into account technical aspects, one of those being the resolution of the acquisition system. The aim of this note is to investigate the effects of the amplitude resolution of ECG acquisition systems on the P-wave analysis. Starting from ECG recorded by an acquisition system with a less significant bit (LSB) of 31 nV (24 bit on an input range of 524 mVpp), we reproduced an ECG signal as acquired by systems with lower resolution (16, 15, 14, 13 and 12 bit). We found that, when the LSB is of the order of 128 µV (12 bit), a single P-wave is not recognizable on ECG. However, when averaging is applied, a P-wave template can be extracted, apparently suitable for the P-wave analysis. Results obtained in terms of P-wave duration and morphology revealed that the analysis of ECG at lowest resolutions (from 12 to 14 bit, LSB higher than 30 µV) could lead to misleading results. However, the resolution used nowadays in modern electrocardiographs (15 and 16 bit, LSB <10 µV) is sufficient for the reliable analysis of the P-wave. | 2024-02-25T01:27:04.277712 | https://example.com/article/7349 |
The Modern Neighbours of Tutankhamun: History, Life and Work in the Villages of the Theban West Bank
Description
Until their recent demolition, the colorful mud-brick hamlets of al-Qurna village, situated among the Noble Tombs of the Theban Necropolis on the Luxor West Bank, were home to a vibrant community.
Inhabiting a place of intensive Egyptological research for over two centuries, it was inevitable that Qurnawis should become part of the history of Egyptology and the development of archaeological practice in the Theban Necropolis. But they have mostly been regarded as laborers for the excavation teams or dealers in the illicit antiquities trade. The modern people inhabiting the ancient burial grounds have themselves rarely been considered.
By demonstrating the multiplicity of economic activities that are carried out in al-Qurna, this study counters the villagers' stereotypical representation as tomb robbers, and restores an understanding of who they are as people living their lives in the shadow of valued cultural heritage. | 2023-10-29T01:27:04.277712 | https://example.com/article/9796 |
e c, given that l(c) = 0.
-15, -1, 1, 15
Factor 114 + 13*a + 252 + 4*a**2 + 371*a + 14.
4*(a + 1)*(a + 95)
Let y be 0 - 171/(-1) - 1. Determine s so that -78*s**3 - 86*s**3 + y*s**3 - 4*s**2 - 2*s = 0.
-1/3, 0, 1
Let a(r) be the third derivative of -2*r**2 - 265/84*r**4 - 32 + 67/35*r**5 + 44/21*r**3 + 0*r - 3/140*r**6. Factor a(s).
-2*(s - 44)*(3*s - 1)**2/7
Let 0 - 69/4*h**4 + 0*h**2 + 3/4*h**5 + 0*h + 33/2*h**3 = 0. What is h?
0, 1, 22
Let w(c) be the third derivative of -c**7/105 + c**6/5 - 9*c**5/10 - 116*c**2 + 5. Factor w(j).
-2*j**2*(j - 9)*(j - 3)
Suppose 62*b**2 + 0 - 901/2*b**3 - 2*b + 210*b**4 = 0. Calculate b.
0, 1/20, 2/21, 2
Let s be (1/2)/((-3)/(-18)). Suppose u - 8 = -s*u. Factor -3/5*t + 1/5*t**u + 0.
t*(t - 3)/5
Let l(f) be the second derivative of f**5/60 + 703*f**4/12 + 494209*f**3/6 + 347428927*f**2/6 + 121*f + 3. Factor l(u).
(u + 703)**3/3
Let j be (-1)/(-7) + -82*(-4)/56. Solve -26*q**2 - 24*q**3 - j*q**2 + 3*q**5 - 3*q**5 + 2*q**5 = 0.
-2, 0, 4
Let b(s) be the second derivative of s**6/1620 + 13*s**5/540 + s**4/9 + 65*s**3/6 - 99*s. Let f(j) be the second derivative of b(j). Solve f(h) = 0.
-12, -1
Let f = 8/140995 + 1525001864/986965. Factor 416/7*b - 4/7*b**2 - f.
-4*(b - 52)**2/7
Let p(r) be the second derivative of 0 + 103*r - 10*r**2 + 22/3*r**3 - 2*r**4. Determine q so that p(q) = 0.
5/6, 1
Let x = -1240 - -1245. Let y(m) be the third derivative of -1/1512*m**8 + 0 + 0*m**6 + 2/135*m**x + 0*m**4 + 15*m**2 - 1/315*m**7 + 0*m**3 + 0*m. Factor y(q).
-2*q**2*(q - 1)*(q + 2)**2/9
Let k(g) be the third derivative of g**6/840 + 11*g**5/84 + 13*g**4/14 + 5127*g**2. Factor k(n).
n*(n + 3)*(n + 52)/7
Let j(n) = 33*n**3 + 155*n**2 + 585*n + 398. Let p(m) = 5*m**3 + 26*m**2 + 97*m + 66. Let q(k) = 6*j(k) - 39*p(k). Factor q(f).
3*(f - 31)*(f + 1)*(f + 2)
Suppose -24*k + 5*i = -29*k + 3040, 0 = -3*k + 2*i + 1839. Let d = -611 + k. Factor d + 5/4*a**2 + 0*a - 1/4*a**3.
-a**2*(a - 5)/4
Let x(h) be the second derivative of h**7/210 - h**6/30 - h**5/30 + h**4/2 + h**3/3 + h + 6. Let o(j) be the second derivative of x(j). Factor o(z).
4*(z - 3)*(z - 1)*(z + 1)
Let a(f) be the first derivative of -f**6/30 - 4*f**5/15 - 2*f**4/3 + 133*f**2/2 + 31. Let m(l) be the second derivative of a(l). What is b in m(b) = 0?
-2, 0
Let o(s) be the third derivative of -s**8/112 + 13*s**7/35 + 147*s**6/40 + 61*s**5/5 + 31*s**4/2 + 692*s**2. Find r such that o(r) = 0.
-2, -1, 0, 31
Let f be 495/(-7 + (-136)/(-16)). Determine r, given that f*r - 160*r**2 - 530*r**2 + 50*r**3 - 22 + 198*r - 82 = 0.
2/5, 13
Suppose -l = -102 + 131. Let y be 22/8 - l/(-58). Find b, given that 0 - 3/4*b**3 - 3/2*b + y*b**2 = 0.
0, 1, 2
Let n(f) be the second derivative of f**4/4 - 35*f**3/2 + 324*f**2 + 1385*f. Factor n(s).
3*(s - 27)*(s - 8)
Let i(h) be the second derivative of 18*h - 2 - 12*h**2 + 11/3*h**3 + 1/30*h**5 - 5/9*h**4. What is m in i(m) = 0?
3, 4
Let g(m) be the first derivative of m**6/30 - 4*m**5/15 + m**4/6 + 4*m**3 - 47*m**2/2 + 34. Let u(f) be the second derivative of g(f). Factor u(i).
4*(i - 3)*(i - 2)*(i + 1)
Let j(n) = 12*n**3 + 1694*n**2 + 3403*n. Let c(v) = -22*v**3 - 3388*v**2 - 6805*v. Let r(k) = 7*c(k) + 13*j(k). Factor r(h).
2*h*(h - 849)*(h + 2)
Suppose 97596 = 55236*x - 55127*x + 10396. Find v, given that 5/2*v**3 + 2000 + x*v - 95*v**2 = 0.
-2, 20
Let o(u) be the first derivative of -u**7/21 + 7*u**6/15 + 4*u**5/5 - 180*u + 111. Let r(s) be the first derivative of o(s). Suppose r(z) = 0. What is z?
-1, 0, 8
Let l(g) be the first derivative of -3*g**4/20 - 576*g**3/5 + 1731*g**2/10 + 3780. Factor l(t).
-3*t*(t - 1)*(t + 577)/5
Let g(z) = 14*z - 29. Let p be g(6). Let v = p + -50. Factor 18*x**2 - 26*x**2 - x**5 + 5*x**v - 4*x**3 + 8*x**4.
4*x**2*(x - 1)*(x + 1)*(x + 2)
Let l(o) = 112*o + 451. Let j be l(-4). Let k(x) be the second derivative of 7/12*x**4 - 3/20*x**5 - 14*x + 0 + 4*x**2 + j*x**3. Factor k(w).
-(w - 4)*(w + 1)*(3*w + 2)
Let w be (1 - 1) + -1*(-1 + -1). Solve -16*k - 47 + 10 + 16 - 11 - 2*k**w = 0.
-4
Let x(l) be the second derivative of l**6/90 - l**5/2 - 179*l**4/36 + 20*l**3/3 + 350*l**2/3 + 5498*l. Determine k, given that x(k) = 0.
-5, -2, 2, 35
Let f(z) be the third derivative of 0*z**3 + 2/21*z**7 + 1/84*z**8 + 1/6*z**6 - 1/3*z**5 + 82*z**2 + 0 + 0*z - z**4. Solve f(k) = 0 for k.
-3, -2, -1, 0, 1
Determine m so that 2/9*m**2 - 32/3*m + 94/9 = 0.
1, 47
Let j(m) be the first derivative of -20 - 26/3*m**3 - 7/4*m**4 - 13/2*m**2 + 6*m. Let j(n) = 0. Calculate n.
-3, -1, 2/7
Let r(b) be the first derivative of -1/3*b**4 - 1/40*b**5 - 22 + 25/2*b**2 - 5/12*b**3 - 11*b. Let f(z) be the first derivative of r(z). Solve f(h) = 0.
-5, 2
Let h(y) be the first derivative of 0*y**3 + 44 - 37/2*y**2 - 1/5*y**4 + 0*y - 1/100*y**5. Let i(m) be the second derivative of h(m). Factor i(l).
-3*l*(l + 8)/5
Let v(o) be the second derivative of -11 + 7/225*o**6 - 1/315*o**7 - 16/45*o**3 + 2*o - 19/150*o**5 + 5/18*o**4 + 4/15*o**2. Solve v(y) = 0 for y.
1, 2
Let x(z) be the second derivative of -64*z**6/15 - 6936*z**5/5 - 1730*z**4 - 2593*z**3/3 - 216*z**2 - 3293*z. What is k in x(k) = 0?
-216, -1/4
Let f(n) be the second derivative of -n**7/21 + 3*n**6/5 + 61*n**5/10 + 119*n**4/6 + 32*n**3 + 28*n**2 + 309*n - 1. Suppose f(p) = 0. What is p?
-2, -1, 14
Let p(d) = -2*d**5 - 2*d**4 - d**2. Let j(x) = 25*x**5 + 90*x**4 + 251*x**3 + 383*x**2 + 228*x + 40. Let z(v) = 2*j(v) + 18*p(v). Determine t so that z(t) = 0.
-5, -2, -1, -2/7
Let z(w) be the second derivative of w**6/10 - 3*w**5/10 - 3*w**4/4 + 2*w**3 + 6*w**2 - 589*w + 4. Determine s, given that z(s) = 0.
-1, 2
Let 3857296/5 - 3924/5*z**2 - 2/5*z**3 - 1920792/5*z = 0. What is z?
-982, 2
Let v = 244 - 243. Let q(o) = -47*o**4 + 23*o**3 + 355*o**2 - 72*o - 648. Let m(p) = -p**4 - p**3 + p**2. Let z(y) = v*q(y) + 3*m(y). Factor z(j).
-2*(j - 2)**2*(5*j + 9)**2
Let x(c) be the first derivative of 170 + 7/3*c**3 + 8*c + 7*c**2 + 1/4*c**4. Factor x(l).
(l + 1)*(l + 2)*(l + 4)
Suppose -194*m**2 - 2*m - 511 + 198*m**2 + 511 - 2*m**3 = 0. Calculate m.
0, 1
Let c(k) be the first derivative of k**7/2520 - k**5/30 - 2*k**4/9 - k**3/3 + 33*k - 70. Let w(y) be the third derivative of c(y). Factor w(n).
(n - 4)*(n + 2)**2/3
Suppose 738*z - 2650 = -587*z. Factor 15/4*p - p**3 + 0 - 7/4*p**z.
-p*(p + 3)*(4*p - 5)/4
Factor 190/3 + 188/3*c**2 + 1/3*c**3 - 379/3*c.
(c - 1)**2*(c + 190)/3
Let i(g) be the third derivative of 0*g - 7/33*g**4 + 0 + 1/11*g**5 + 1/1155*g**7 - 1/55*g**6 + 3/11*g**3 + 119*g**2. Factor i(z).
2*(z - 9)*(z - 1)**3/11
Suppose 3*m = 3*a - 141, 4*a - 47 = m + 5*a. Let q = m - -53. Find p such that 7*p - 2*p - 62*p**3 + 61*p**3 - 2*p**2 + q = 0.
-3, -1, 2
Let b(y) be the first derivative of y**6/9 - 2*y**5/5 - y**4/2 + 14*y**3/9 + 2*y**2 - 2336. Let b(a) = 0. What is a?
-1, 0, 2, 3
Let d = 31 - 26. Suppose 0*u - 3*m - 18 = -u, -3*m - 114 = -d*u. Solve -59*j - 6*j**2 + u*j**4 + 3*j**3 + 59*j + 15*j**5 = 0 for j.
-1, 0, 2/5
Let h(n) be the third derivative of -n**5/30 + 15*n**4/2 + 184*n**3/3 + 10*n**2 - 29. Suppose h(g) = 0. What is g?
-2, 92
Suppose -4 + 5 = f. Let m be 0 + 5 + -1 + f. Solve 23*l**2 - 11*l**3 - l**3 - 8*l**4 + 3*l**m - 31*l**2 - 2*l - 5*l**5 = 0 for l.
-1, 0
Let z(f) be the second derivative of 2*f**7/105 + 19*f**6/150 + 23*f**5/100 + f**4/12 - f**3/10 + f - 648. Solve z(s) = 0.
-3, -1, 0, 1/4
Suppose -132 = -4*h + 72. Factor 8*n + 8*n + h*n**4 - 24*n**2 + 32 - 4*n**3 - 47*n**4.
4*(n - 2)**2*(n + 1)*(n + 2)
Let w(u) = -3*u + 0*u**3 - 2*u - u**3 - 5*u**2. Let x(h) = -1 - 1 - 2244*h + 2 + 2243*h. Let m(t) = 3*w(t) - 3*x(t). Factor m(b).
-3*b*(b + 1)*(b + 4)
Solve 76/9*q + 82/3 - 2/9*q**2 = 0.
-3, 41
Let h = 12 + -2. Let w = 12 - h. Let t(i) = 9*i**3 + 2*i**2 - 9*i - 2. Let n(o) = o**3 - o. Let m(f) = w*t(f) - 14*n(f). Factor m(s).
4*(s - 1)*(s + 1)**2
Let g(j) be the third derivative of 0 + 1/28*j**4 - 1/28*j**5 + 0*j**3 + 0*j - 41*j**2 + 1/70*j**6 - 1/490*j**7. Suppose g(b) = 0. Calculate b.
0, 1, 2
Let q be (-4)/(-14)*(-1)/(-1). Let r be (5 + (19 - 1414/56)*-4)/(6 + 1). Factor -r*a**2 + 0 + 50/7*a - 18/7*a**3 - q*a**4.
-2*a*(a - 1)*(a + 5)**2/7
Let z(o) be the third derivative of o**8/12 + 20*o**7/21 - 11*o**6/6 - 10*o**5/3 + 8*o**4 - 1756*o**2. Determine q, given that z(q | 2024-04-25T01:27:04.277712 | https://example.com/article/9661 |
package com.joker.blurapplication.activity.bluractivity;
import android.content.Intent;
import android.graphics.Bitmap;
import android.graphics.drawable.BitmapDrawable;
import android.graphics.drawable.Drawable;
import android.graphics.drawable.TransitionDrawable;
import android.os.Bundle;
import android.support.v7.app.AppCompatActivity;
import com.joker.blurapplication.R;
import com.joker.blurapplication.activity.BaseActivity;
import com.joker.blurapplication.activity.BlurInterface;
import com.joker.blurapplication.rxkit.PicassoError;
import com.joker.blurapplication.rxkit.RxBlurEffective;
import com.joker.blurapplication.rxkit.SchedulersCompat;
import com.joker.blurapplication.rxkit.SimpleSubscriber;
import com.trello.rxlifecycle.ActivityEvent;
import rx.Observable;
import rx.functions.Func1;
import rx.schedulers.Schedulers;
import rx.schedulers.Timestamped;
public class FastBlurActivity extends BaseActivity implements BlurInterface {
private static final String TAG = FastBlurActivity.class.getSimpleName();
public static void navigateToFastBlur(AppCompatActivity startingActivity) {
Intent intent = new Intent(startingActivity, FastBlurActivity.class);
startingActivity.startActivity(intent);
}
@Override protected void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
FastBlurActivity.this.loadBlurBitmap();
}
@Override public void loadBlurBitmap() {
subscription.add(RxBlurEffective
.fastBlur(FastBlurActivity.this, DRAWABLE_ID, BLUR_RADIUS)
.timestamp()
.flatMap(new Func1<Timestamped<Bitmap>, Observable<Integer>>() {
@SuppressWarnings("deprecation") @Override
public Observable<Integer> call(Timestamped<Bitmap> timestamped) {
int count = (int) (timestamped.getTimestampMillis() - startTime);
FastBlurActivity.this.removeLoading();
BitmapDrawable bitmapDrawable =
new BitmapDrawable(FastBlurActivity.this.getResources(), timestamped.getValue());
Drawable[] layers = new Drawable[] {
FastBlurActivity.this.getResources().getDrawable(DRAWABLE_ID), bitmapDrawable
};
TransitionDrawable transitionDrawable = new TransitionDrawable(layers);
FastBlurActivity.this.blurIv.setImageDrawable(transitionDrawable);
transitionDrawable.startTransition(count);
return Observable
.range(0, count, Schedulers.computation())
.compose(FastBlurActivity.this.<Integer>bindUntilEvent(ActivityEvent.DESTROY));
}
})
.onBackpressureBuffer()
.compose(SchedulersCompat.<Integer>observeOnMainThread())
.subscribe(new SimpleSubscriber<Integer>() {
@Override public void onStart() {
this.request(1);
FastBlurActivity.this.startTime = System.currentTimeMillis();
}
@Override public void onNext(Integer integer) {
durationTv.setText("" + integer + "ms");
request(1);
}
@Override public void onError(Throwable e) {
super.onError(e);
FastBlurActivity.this.removeLoading();
if (e instanceof PicassoError) {
blurIv.setImageDrawable(((PicassoError) e).getErrorDrawable());
}
}
}));
}
@Override public int getLayoutId() {
return R.layout.activity_simple_layout;
}
@Override public void setupActionBar() {
getSupportActionBar().setTitle("Fast Blur");
}
}
| 2024-02-29T01:27:04.277712 | https://example.com/article/4010 |
Q:
Can't use get parameter
My .htaccess: Rewriterule ^(.*?)-(?:.*).html$ ver.php?id=$1 [L]
My URL is like this: http://www.site.com/listado/s.html
I can't use GET to parse pages: `ie: http://www.site.com/listado/s.html?page=2
What am I doing wrong?
How can I fix this?
A:
You need the QSA flag, so mod_rewrite will append your query string to the rewrite.
Rewriterule ^(.*?)-(?:.*).html$ ver.php?id=$1 [L,QSA]
| 2023-12-21T01:27:04.277712 | https://example.com/article/7053 |
Location:
Member since:
Networks
Are you vegan, vegetarian or just curious?
What is your favorite local vegan-friendly restaurant?
Eden. Piper's Pub.
Are you the only vegan or vegetarian in your family?
Yes, and it is pretty damn lonely.
Anything else you would like to share about yourself?
I am constantly looking for ways to improve my health & wellness while not causing any harm to our animal friends. In my darkest days, I ate improper, made poor decisions, and carried around an immense amount of extra baggage and piss-poor excuses. After my journey of self-discovery, health, and veganism, I haven't felt better.
What are you hoping to get out of this meetup?
New friends who share the same beliefs.
Introduction
My name is Thom and I want to be more involved in the vegan community, find a job that is more inline with my lifestyle/beliefs, meet likeminded people, and be more adventurous. I have an endless appetite and a bottomless heart. Let's be friends!
Meet fellow Vegans near you! Come to a local Vegan Meetup and discuss living a healthy vegan lifestyle. Have delicious meals, share your favorite vegan recipes and make new friends!
We get together regularly, mainly for potlucks and restaurant outings. The food is always vegan, but you don't have to be. Our members are vegans, vegetarians and even an odd omnivore or two. Don't miss the Messages section to see what's up in our world. | 2023-09-12T01:27:04.277712 | https://example.com/article/4888 |
Well I have an issue where I have to set some data, I'm a little lost on how to do it, but I made a "cheating" way of doing this... A little background, the data that is coming in sometimes has bad data, it is very noticeable in the plots because the bad points of data show up as the same value over and over, so I devised a way to look through the needed variables and turn the bad data to ether 0 or NaN's so when it plots, we can see the useful information.
So here is the issue, it seems like bad code, sludgy and ugly (maybe its nice, I don't know...). I was hoping for second opinions, advice or help to make it better. If anyone knows how to make it better or how to clean it up then please help me out, I appreciate any help and learning I can get. Here is an example of the code: | 2023-10-16T01:27:04.277712 | https://example.com/article/5576 |
Related Suppliers
Related Suppliers
Featured Research
Featured Research
Quick Stats
Quick Stats
You are here
India's Reliance Industries Says It Will Not Buy Valero
Royal Dutch Shell and China's CNOOC are reportedly still in play as possible acquirers, though.
October 30, 2011, 08:00 pm
SAN ANTONIO -- Indian petroleum refiner and explorer Reliance Industries said it will not buy Valero Energy Corp. The company issued a statement in response to an Oct. 26 story that ran in the UK Daily Mail stating that a bidding war to buy Valero could soon occur, with Reliance and Netherlands-based Royal Dutch Shell as the most likely acquirers.
Although companies rarely comment on takeover rumors, Reliance said it felt compelled to do so.
"Reliance wishes to dispel the rumors and announce it is not in discussions with Valero nor otherwise considering an acquisition of Valero," the company said in a statement, which was obtained by Reuters.
The original UK Daily Mail report said an acquisition by Reliance made a lot of sense because the company needed to expand upon its operating base of India. The news outlet added that Citigroup and J.P. Morgan Chase & Co. were believed to be advisors on the potential deal.
Although Reliance is not apparently a suitor for Valero, Shell could still be a bidder. According to reports, Shell representatives have declined to comment on the takeover speculation. In addition, China's CNOOC has been rumored as a potential bidder for the San Antonio based refiner and convenience retailer.
Valero's shares, trading under the symbol VLO on the New York Stock Exchange, dropped more than 7 percent today on the news. The stock rose more than 15 percent on Oct. 26 when word of a possible takeover was reported. | 2024-01-28T01:27:04.277712 | https://example.com/article/8147 |
New Mobimar windfarm service vessel
Finland’s multi-disciplined boatbuilder, Mobimar Ltd, has been doing well in the offshore wind farm service market with its unique crew transfer CTV trimaran - the Mobimar 18 Wind.
Mobimar says that the vessel enables safer crew transfers by the stable trimaran hull and a unique gripper system attached the bow - while other vessels have to push with full throttle against the wind turbine to remain stable.
With the 18 Wind, disembarkation is possible in up to 2.5m swell, which means more operational days with less downtime.
A 180 degree approaching angle allows the most convenient approach to be taken based on sea and wind currents. During the landing, the engines can idle, while the gripper can be used either in gripping or sliding mode to attach the vessel to the platform.
Antti Immonen, Mobimar's sales development manager, told Boating Business: "We have now done all the laboratory and structural analysis, we have fine tuned the hydraulics in practical conditions and measured the real affecting forces. Our current challenge is to get all the vessel owners and the energy companies that are currently using the conventional mooring to demand more safety and higher utilisation rate from the vessels."
The company says that the gripper makes underwater maintenance, especially, safer and easier to perform.
The trimaran hull also reduces impact on the platform considerably when compared with corresponding CTVs. Because it also offers less water resistance, it means lower fuel consumption. The CTV trimaran has one main engine rating at 750 kW, a catamaran would have two similar engines for power.
Mobimar delivered its first trimaran crew transfer vessel to Finland's Meriaura Ltd in March 2012. | 2024-02-28T01:27:04.277712 | https://example.com/article/5043 |
Large-scale genomic sequence data resolve the deepest divergences in the legume phylogeny and support a near-simultaneous evolutionary origin of all six subfamilies.
Phylogenomics is increasingly used to infer deep-branching relationships while revealing the complexity of evolutionary processes such as incomplete lineage sorting, hybridization/introgression and polyploidization. We investigate the deep-branching relationships among subfamilies of the Leguminosae (or Fabaceae), the third largest angiosperm family. Despite their ecological and economic importance, a robust phylogenetic framework for legumes based on genome-scale sequence data is lacking. We generated alignments of 72 chloroplast genes and 7621 homologous nuclear-encoded proteins, for 157 and 76 taxa, respectively. We analysed these with maximum likelihood, Bayesian inference, and a multispecies coalescent summary method, and evaluated support for alternative topologies across gene trees. We resolve the deepest divergences in the legume phylogeny despite lack of phylogenetic signal across all chloroplast genes and the majority of nuclear genes. Strongly supported conflict in the remainder of nuclear genes is suggestive of incomplete lineage sorting. All six subfamilies originated nearly simultaneously, suggesting that the prevailing view of some subfamilies as 'basal' or 'early-diverging' with respect to others should be abandoned, which has important implications for understanding the evolution of legume diversity and traits. Our study highlights the limits of phylogenetic resolution in relation to rapid successive speciation. | 2024-06-15T01:27:04.277712 | https://example.com/article/5784 |
Telbivudine therapy for chronic hepatitis B: A journey to identify super-responders and to optimize treatment using the roadmap model.
Hepatitis B virus (HBV) infection is one of the most serious health problems worldwide with a high risk for cirrhosis and liver cancer. Several antiviral agents have been approved for the treatment of chronic hepatitis B, leading to a rapid reduction in HBV DNA and normalization of serum alanine aminotransferase levels. Telbivudine, a potent inhibitor of HBV replication, has been shown to be well tolerated. Because of the emergence of drug resistance, optimization strategies for telbivudine therapy have been shown to improve patient responses. Optimal baseline characteristics in so-called super-responders have been used to predict the virological response. Baseline HBV DNA levels < 9 log10 copies/mL (2 × 108 IU/mL) or alanine aminotransferase levels of more than or equal to twofold the upper limit of normal in HBeAg-positive patients and HBV DNA < 7 log10 copies/mL (2 × 106 IU/mL) in HBeAg-negative patients were strong predictors for virological response. In addition, the roadmap model, based on early virological response at week 24 of therapy, is considered as a powerful tool to identify patients at risk of treatment failure (HBV DNA ≥ 300 copies/mL, i.e. 60 IU/mL) and to reduce the risk of antiviral resistance. When considering pre-treatment characteristics and on-treatment responses, telbivudine may provide physicians with a wide choice of options to effectively treat patients with chronic hepatitis B, especially those with or at risk of renal impairment, or women of childbearing age. | 2024-05-28T01:27:04.277712 | https://example.com/article/6076 |
[Prevalence of bacterial vaginosis and associated factors in twenty peruvian cities].
To determine the prevalence of bacterial vaginosis (BV) and associated factors among 18-29-year-old women in 20 Peruvian cities using PREVEN project data. In this cross-sectional study, BV was defined using previously provided vaginal discharge samples on slides, which were Gram stained and observed under a microscope to determine the Nugent scores. A BV diagnosis was applied to samples with scores of 7-10. Prevalence ratios (PR) and 95% confidence intervals (95% CI) were estimated using generalized linear models. A total of 6,322 women participated in the epidemiological survey and provided vaginal swabs. The prevalence of BV was 23.7% (95% CI: 22.6-24.7) and was associated with a greater number of sexual partners in the last 12 months (PR: 1.22, 95% CI: 1.03-1.44, p=0.020 for two partners; PR: 1.46, 95% CI: 1.23-1.74, p<0.001 for three or more partners), not using a condom during last intercourse (PR: 1.16, 95% CI: 1.01-1.34, p=0.034), being a sierra resident (PR: 1.18, 95% CI: 1.05-1.31, p=0.004), and having abnormal vaginal discharge or a bad smell (PR: 1.20, 95% CI: 1.09-1.33, p<0.001). The high prevalence of BV highlights the need to strengthen health services aimed at the detection and treatment of this condition. | 2023-08-16T01:27:04.277712 | https://example.com/article/1537 |
The Subclinical Cardiomyopathy of Friedreich's Ataxia in a Pediatric Population.
Identification of a subclinical cardiomyopathy in pediatric patients with Friedreich's ataxia (FA) has not been well-described. We performed echocardiography (Echo), cardiac magnetic resonance imaging (cMRI), and neurologic assessment in a cross-sectional analysis of 48 genetically confirmed FA subjects aged 9-17 years with moderate neurologic impairment but without a cardiovascular history. Echo- and cMRI-determined left ventricular mass were indexed (LVMI) to height in grams/m2.7. LV remodeling was categorized as concentric remodeling (CR), concentric hypertrophy (CH), or eccentric hypertrophy based upon Echo- determined relative LV wall thickness. Echo LVMI exceeded age-based normal values in 85% of subjects, and cMRI-determined LVMI correlated with depression of both diastolic and systolic tissue Doppler velocity (E': r = -0.65, P < .001, S': r = -0.46, P < .001) as well as increased early diastolic Doppler flow velocity/tissue velocity ratio (r= 0.55, P < .001), a marker of elevated LV filling pressure. Similar associations were found with echo-determined LV mass. Evidence of depressed LV relaxation and increased LV stiffness were observed in 88% and 71%, of subjects, respectively, despite a normal LV ejection fraction in almost all cases (mean = 60% + 7%). CR and CH were present in 40% and 44% of the study group, respectively, although significant depressions of E' and S' were observed only in subjects with CH (P < .005). A subclinical hypertrophic cardiomyopathy is common in pediatric FA patients and CH is associated with both diastolic and systolic dysfunction. | 2023-12-04T01:27:04.277712 | https://example.com/article/2130 |
Deep insemination with sex-sorted Cashmere goat sperm processed in the presence of antioxidants.
Flow cytometrically sex-sorted sperm have been widely used for improving reproductive management in the dairy industry. However, the industrial application of this technology in other domestic species is largely limited by the lower fertility after insemination. The aim of this study was to investigate effects of antioxidant supplementation during the sex-sorting and freezing process on the quality and functions of sorted sperm from Liaoning Cashmere goats. We tested the effects of antioxidant supplementation during sex-sorting and freezing process, including ascorbic acid-2-glucoside AA-2G, glutathione, melatonin and vitamin C (VC), on the quality and functions of sex-sorted fresh and frozen-thawed sperm. Based on these experiments, we performed deep insemination with sex-sorted sperm using our improved strategy, in comparison to unsorted sperm. In Experiment 1, compared with control group and other antioxidants, AA-2G supplementation significantly alleviated the degradation of motility and viability of fresh sperm after sorting and showed the highest percentage of sperm with normal morphology. In addition, AA-2G supplementation showed an evident protection against the sorting process-induced membrane and acrosome damage. In Experiment 2, AA-2G supplementation was most effective in protecting motility, while melatonin supplementation appears to facilitate the degradation of quality of frozen-thawed sex-sorted sperm. In Experiment 3, we performed deep insemination with sperm that were sorted and frozen in the presence of AA-2G and obtained a satisfying pregnancy rate comparable to that from unsorted sperm. The results showed that AA-2G supplementation efficiently protects quality and function of both fresh and frozen-thawed sex-sorted sperm of Cashmere goats, thus obtaining a satisfying pregnancy outcome. | 2023-12-09T01:27:04.277712 | https://example.com/article/9759 |
/*
* Microblaze MMU emulation for qemu.
*
* Copyright (c) 2009 Edgar E. Iglesias
* Copyright (c) 2009-2012 PetaLogix Qld Pty Ltd.
*
* This library is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 2 of the License, or (at your option) any later version.
*
* This library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library; if not, see <http://www.gnu.org/licenses/>.
*/
#include "qemu/osdep.h"
#include "cpu.h"
#include "exec/exec-all.h"
static unsigned int tlb_decode_size(unsigned int f)
{
static const unsigned int sizes[] = {
1 * 1024, 4 * 1024, 16 * 1024, 64 * 1024, 256 * 1024,
1 * 1024 * 1024, 4 * 1024 * 1024, 16 * 1024 * 1024
};
assert(f < ARRAY_SIZE(sizes));
return sizes[f];
}
static void mmu_flush_idx(CPUMBState *env, unsigned int idx)
{
CPUState *cs = CPU(mb_env_get_cpu(env));
struct microblaze_mmu *mmu = &env->mmu;
unsigned int tlb_size;
uint32_t tlb_tag, end, t;
t = mmu->rams[RAM_TAG][idx];
if (!(t & TLB_VALID))
return;
tlb_tag = t & TLB_EPN_MASK;
tlb_size = tlb_decode_size((t & TLB_PAGESZ_MASK) >> 7);
end = tlb_tag + tlb_size;
while (tlb_tag < end) {
tlb_flush_page(cs, tlb_tag);
tlb_tag += TARGET_PAGE_SIZE;
}
}
static void mmu_change_pid(CPUMBState *env, unsigned int newpid)
{
struct microblaze_mmu *mmu = &env->mmu;
unsigned int i;
uint32_t t;
if (newpid & ~0xff)
qemu_log_mask(LOG_GUEST_ERROR, "Illegal rpid=%x\n", newpid);
for (i = 0; i < ARRAY_SIZE(mmu->rams[RAM_TAG]); i++) {
/* Lookup and decode. */
t = mmu->rams[RAM_TAG][i];
if (t & TLB_VALID) {
if (mmu->tids[i] && ((mmu->regs[MMU_R_PID] & 0xff) == mmu->tids[i]))
mmu_flush_idx(env, i);
}
}
}
/* rw - 0 = read, 1 = write, 2 = fetch. */
unsigned int mmu_translate(struct microblaze_mmu *mmu,
struct microblaze_mmu_lookup *lu,
target_ulong vaddr, int rw, int mmu_idx)
{
unsigned int i, hit = 0;
unsigned int tlb_ex = 0, tlb_wr = 0, tlb_zsel;
uint64_t tlb_tag, tlb_rpn, mask;
uint32_t tlb_size, t0;
lu->err = ERR_MISS;
for (i = 0; i < ARRAY_SIZE(mmu->rams[RAM_TAG]); i++) {
uint64_t t, d;
/* Lookup and decode. */
t = mmu->rams[RAM_TAG][i];
if (t & TLB_VALID) {
tlb_size = tlb_decode_size((t & TLB_PAGESZ_MASK) >> 7);
if (tlb_size < TARGET_PAGE_SIZE) {
qemu_log_mask(LOG_UNIMP, "%d pages not supported\n", tlb_size);
abort();
}
mask = ~((uint64_t)tlb_size - 1);
tlb_tag = t & TLB_EPN_MASK;
if ((vaddr & mask) != (tlb_tag & mask)) {
continue;
}
if (mmu->tids[i]
&& ((mmu->regs[MMU_R_PID] & 0xff) != mmu->tids[i])) {
continue;
}
/* Bring in the data part. */
d = mmu->rams[RAM_DATA][i];
tlb_ex = d & TLB_EX;
tlb_wr = d & TLB_WR;
/* Now let's see if there is a zone that overrides the protbits. */
tlb_zsel = (d >> 4) & 0xf;
t0 = mmu->regs[MMU_R_ZPR] >> (30 - (tlb_zsel * 2));
t0 &= 0x3;
if (tlb_zsel > mmu->c_mmu_zones) {
qemu_log_mask(LOG_GUEST_ERROR,
"tlb zone select out of range! %d\n", tlb_zsel);
t0 = 1; /* Ignore. */
}
if (mmu->c_mmu == 1) {
t0 = 1; /* Zones are disabled. */
}
switch (t0) {
case 0:
if (mmu_idx == MMU_USER_IDX)
continue;
break;
case 2:
if (mmu_idx != MMU_USER_IDX) {
tlb_ex = 1;
tlb_wr = 1;
}
break;
case 3:
tlb_ex = 1;
tlb_wr = 1;
break;
default: break;
}
lu->err = ERR_PROT;
lu->prot = PAGE_READ;
if (tlb_wr)
lu->prot |= PAGE_WRITE;
else if (rw == 1)
goto done;
if (tlb_ex)
lu->prot |=PAGE_EXEC;
else if (rw == 2) {
goto done;
}
tlb_rpn = d & TLB_RPN_MASK;
lu->vaddr = tlb_tag;
lu->paddr = tlb_rpn & mmu->c_addr_mask;
lu->size = tlb_size;
lu->err = ERR_HIT;
lu->idx = i;
hit = 1;
goto done;
}
}
done:
qemu_log_mask(CPU_LOG_MMU,
"MMU vaddr=%" PRIx64 " rw=%d tlb_wr=%d tlb_ex=%d hit=%d\n",
vaddr, rw, tlb_wr, tlb_ex, hit);
return hit;
}
/* Writes/reads to the MMU's special regs end up here. */
uint32_t mmu_read(CPUMBState *env, bool ext, uint32_t rn)
{
unsigned int i;
uint32_t r = 0;
if (env->mmu.c_mmu < 2 || !env->mmu.c_mmu_tlb_access) {
qemu_log_mask(LOG_GUEST_ERROR, "MMU access on MMU-less system\n");
return 0;
}
if (ext && rn != MMU_R_TLBLO) {
qemu_log_mask(LOG_GUEST_ERROR, "Extended access only to TLBLO.\n");
return 0;
}
switch (rn) {
/* Reads to HI/LO trig reads from the mmu rams. */
case MMU_R_TLBLO:
case MMU_R_TLBHI:
if (!(env->mmu.c_mmu_tlb_access & 1)) {
qemu_log_mask(LOG_GUEST_ERROR,
"Invalid access to MMU reg %d\n", rn);
return 0;
}
i = env->mmu.regs[MMU_R_TLBX] & 0xff;
r = extract64(env->mmu.rams[rn & 1][i], ext * 32, 32);
if (rn == MMU_R_TLBHI)
env->mmu.regs[MMU_R_PID] = env->mmu.tids[i];
break;
case MMU_R_PID:
case MMU_R_ZPR:
if (!(env->mmu.c_mmu_tlb_access & 1)) {
qemu_log_mask(LOG_GUEST_ERROR,
"Invalid access to MMU reg %d\n", rn);
return 0;
}
r = env->mmu.regs[rn];
break;
case MMU_R_TLBX:
r = env->mmu.regs[rn];
break;
case MMU_R_TLBSX:
qemu_log_mask(LOG_GUEST_ERROR, "TLBSX is write-only.\n");
break;
default:
qemu_log_mask(LOG_GUEST_ERROR, "Invalid MMU register %d.\n", rn);
break;
}
qemu_log_mask(CPU_LOG_MMU, "%s rn=%d=%x\n", __func__, rn, r);
return r;
}
void mmu_write(CPUMBState *env, bool ext, uint32_t rn, uint32_t v)
{
MicroBlazeCPU *cpu = mb_env_get_cpu(env);
uint64_t tmp64;
unsigned int i;
qemu_log_mask(CPU_LOG_MMU,
"%s rn=%d=%x old=%x\n", __func__, rn, v, env->mmu.regs[rn]);
if (env->mmu.c_mmu < 2 || !env->mmu.c_mmu_tlb_access) {
qemu_log_mask(LOG_GUEST_ERROR, "MMU access on MMU-less system\n");
return;
}
if (ext && rn != MMU_R_TLBLO) {
qemu_log_mask(LOG_GUEST_ERROR, "Extended access only to TLBLO.\n");
return;
}
switch (rn) {
/* Writes to HI/LO trig writes to the mmu rams. */
case MMU_R_TLBLO:
case MMU_R_TLBHI:
i = env->mmu.regs[MMU_R_TLBX] & 0xff;
if (rn == MMU_R_TLBHI) {
if (i < 3 && !(v & TLB_VALID) && qemu_loglevel_mask(~0))
qemu_log_mask(LOG_GUEST_ERROR,
"invalidating index %x at pc=%" PRIx64 "\n",
i, env->sregs[SR_PC]);
env->mmu.tids[i] = env->mmu.regs[MMU_R_PID] & 0xff;
mmu_flush_idx(env, i);
}
tmp64 = env->mmu.rams[rn & 1][i];
env->mmu.rams[rn & 1][i] = deposit64(tmp64, ext * 32, 32, v);
break;
case MMU_R_ZPR:
if (env->mmu.c_mmu_tlb_access <= 1) {
qemu_log_mask(LOG_GUEST_ERROR,
"Invalid access to MMU reg %d\n", rn);
return;
}
/* Changes to the zone protection reg flush the QEMU TLB.
Fortunately, these are very uncommon. */
if (v != env->mmu.regs[rn]) {
tlb_flush(CPU(cpu));
}
env->mmu.regs[rn] = v;
break;
case MMU_R_PID:
if (env->mmu.c_mmu_tlb_access <= 1) {
qemu_log_mask(LOG_GUEST_ERROR,
"Invalid access to MMU reg %d\n", rn);
return;
}
if (v != env->mmu.regs[rn]) {
mmu_change_pid(env, v);
env->mmu.regs[rn] = v;
}
break;
case MMU_R_TLBX:
/* Bit 31 is read-only. */
env->mmu.regs[rn] = deposit32(env->mmu.regs[rn], 0, 31, v);
break;
case MMU_R_TLBSX:
{
struct microblaze_mmu_lookup lu;
int hit;
if (env->mmu.c_mmu_tlb_access <= 1) {
qemu_log_mask(LOG_GUEST_ERROR,
"Invalid access to MMU reg %d\n", rn);
return;
}
hit = mmu_translate(&env->mmu, &lu,
v & TLB_EPN_MASK, 0, cpu_mmu_index(env, false));
if (hit) {
env->mmu.regs[MMU_R_TLBX] = lu.idx;
} else {
env->mmu.regs[MMU_R_TLBX] |= R_TBLX_MISS_MASK;
}
break;
}
default:
qemu_log_mask(LOG_GUEST_ERROR, "Invalid MMU register %d.\n", rn);
break;
}
}
void mmu_init(struct microblaze_mmu *mmu)
{
int i;
for (i = 0; i < ARRAY_SIZE(mmu->regs); i++) {
mmu->regs[i] = 0;
}
}
| 2023-09-07T01:27:04.277712 | https://example.com/article/9783 |
Emma Fielding
Emma Georgina Annalies Fielding (born 10 July 1966 in Catterick, North Riding of Yorkshire) is an English actress.
Biography
The daughter of a British Army officer, Lt. Colonel Johnny Fielding and Sheila Fielding, she was raised Catholic and spent much of her childhood in Malaysia and Nigeria in 1979, and a period in Malvern above her grandparents' betting shop. While studying at the Berkhamsted Collegiate boarding school, she won a place at Robinson College, Cambridge to study law, but abandoned it and spent a gap year which included five months in a West Bank kibbutz picking watermelons, and as an usherette at the Oxford Apollo; before embarking on the study of acting at the Royal Scottish Academy of Music and Drama.
After graduation she worked for the Royal National Theatre and the Royal Shakespeare Company, coming to the attention of critics in 1993's RSC production of Tom Stoppard's Arcadia, in which she created the role of Thomasina, and then most notably in John Ford's The Broken Heart for which she won the Dame Peggy Ashcroft Award for Best Actress. Also in 1993, she was Agnes in The School for Wives at the Almeida Theatre, for which she won the Ian Charleson Award. She made her Broadway theatre debut in 2003 in Noël Coward's Private Lives. She has also appeared in numerous radio plays for the BBC, including playing Esme in Tom Stoppard's Rock 'n' Roll, a role she also played in the West End. More recently, she appeared in the BBC TV mini-series Cranford.
In 2009 she appeared as Daisy alongside Timothy West in the BBC Radio 4 adaptation of John Mortimer's "Rumpole and the Penge Bungalow Murders". She has also appeared in the crime drama 'Death in Paradise' playing the part of Astrid Knight. (Season 1 Episode 4). In 2014, she appeared in another crime drama DCI Banks (Series 3 Episodes 17 & 18).
In 2018, Fielding appeared in EastEnders as Ted Murray's (Christopher Timothy) daughter.
In November 2018, she provided the voice for the alien Kisar in the Doctor Who episode "Demons of the Punjab".
Awards and nominations
Fielding was nominated for a 1999 Laurence Olivier Award for Best Supporting Performance for her role in The School for Scandal in the 1998 season.
She was nominated for a 2002 Laurence Olivier Theatre Award for Best Actress in a Supporting Role of 2001 for her performance in Private Lives at the Albery Theatre, London. She won a Theatre World Award for outstanding Broadway debut for the same role when the show was produced on Broadway in 2002.
She was awarded the 1993 Critics' Circle Theatre Award for Most Promising Newcomer for her performances in Arcadia and The School for Wives.
Filmography
Audiobooks
His Dark Materials as Mrs Coulter
Vanity Fair as Rebecca Sharp Crawley
The Haunting of Hill House as The Narrator. (By Shirley Jackson. Audiobook, BBC).
Israbel as Israbel. (By Tanith Lee. Dramatisation, [A Short History of Vampires Episode 3 of 4], BBC).
Funny Girl as The Narrator. (By Nick Hornby, 2014, Penguin Audio).
She has narrated the following
for Naxos Audiobooks:
Hamlet
Hedda Gabler
Jane Eyre
Lady Windermere's Fan
Othello
Rebecca
The Turn of the Screw
Fanny Hill
for Random House Audio:
I Don't Know How She Does It
References
External links
Category:1966 births
Category:Alumni of the Royal Conservatoire of Scotland
Category:Audiobook narrators
Category:Critics' Circle Theatre Award winners
Category:English film actresses
Category:English radio actresses
Category:English stage actresses
Category:English television actresses
Category:Living people
Category:People from Catterick, North Yorkshire
Category:Royal Shakespeare Company members
Category:English Shakespearean actresses
Category:Ian Charleson Award winners | 2023-10-18T01:27:04.277712 | https://example.com/article/7446 |
Final Fantasy VI Music
Many consider Final Fantasy VI to be Uematsu's greatest work. The soundtrack is brilliantly scripted and themed, and plays more like a deep opera than a movie soundtrack (which is the standard to which games are usually held). It's emotive without being sappy, and energetic without sounding like a school's fight song. Fantastic overall, and you can hear it all here... in MIDI form. Well, it's better than nothing.
You could always try the SPC soundtrack on the downloads page instead. | 2024-05-01T01:27:04.277712 | https://example.com/article/6146 |
The multimedia playing system made with the integration of a computer system and an audiovisual player is gaining popularity and is widely used on many occasions, including offices and households, because the rapid development of computer technology.
The design of the conventional multimedia playing systems is basically interfacing a computer system with an audiovisual player. With this type of design, the user usually needs to boot the computer system up in order to activate and operate the audiovisual player. In other words, the user must wait until the computer system completes the BIOS program initialization, POST program, peripheral detection and driving, OS activation, system state setting, and so on, before the user can execute the audiovisual program to play the audiovisual data. It is inconvenient for the user as there is no shortcut to bypass the tedious booting process of the computer system. Similar problems also occur in a mobile internet device (MID).
To overcome the aforementioned drawback, the current technology utilizes different designs to implement express execution of multimedia playing. These designs configure a different region in the hard-disk and install a first operating system, such as Linux-based OS, and a second operation system, such as a Windows OS, in different hard-disk regions. These designs require modification to the computer BIOS. The user can select the execution of PC mode or the AV mode by depressing its power button or specific hotkey respectively. When the user selects the AV mode, the computer system does not execute the usual booting process when the computer is turned on. Instead, the computer system loads and executes a first operating system in the first hard-disk region, and drives the audiovisual player. That is, the user does not enter the Windows OS; therefore, the time waiting for the system to finish the initialization of the hardware is saved.
However, the current implementations still requires the user to memorize the operation instruction and follow strictly in order to select between the PC mode and the AV mode (or internet mode of a MID). This lack of ease of use is still in convenient for the user.
Although some designs display operation instructions on the monitor to guide the user, this display of instruction usually takes place after the computer system enters the operating system mode; therefore, it does not meet the demands of express execution of playing multimedia data.
Furthermore, as most designs require the user to enter their selections through keyboard or mouse, which are only activated after the computer system enters the operating system mode, it is still inconvenient for the user. | 2024-05-03T01:27:04.277712 | https://example.com/article/9312 |
"Winning nominee for the Geijutsu Sai (Arts Prize), 1963" "Produced by Nikkatsu Ltd and Ishihara Promotions" "Nikkatsu Productions Ltd" "ALONE ACROSS THE PACIFIC" "Produced by NAKAl Akira Based on the book by HORIE Kenichi" "Screenplay by WADA Natto" "Cinematography by YAMAZAKI Yoshihiro" "Art direction by MATS U YAMA So Editing by TSUJII Masanori" "Original music by AKUTAGAWA Yasushi and TAKEMITSU Toru" "Cast" "Horie Kenichi" " ISHIHARA Yujiro" "Kenichi's sister" " ASAOKA Ruriko Master of shipyard" " OSAKA Shiro" "Kenichi's senior" " HANA Hajime Carpenter" " ASHIYA Gannosuke" "Kenichi's mother" " TANAKA Kinuyo Kenichi's father" " MORI Masayuki" "Directed by ICHIKAWA Kon" "Lights!" "MAY 12TH 1962 NISHINOMIYA HARBOUR" "Under Japanese law, no small craft was allowed to leave the country." "The only way to do it was in secret." "Hey, you're really going, no matter what?" "Forgive me." "Let's go." " Not a word to anyone about this." " You don't need to tell me that." "I don't want to make any trouble for you two." "Give it a week, then if anyone asks, just say I've gone." "Now I was totally alone." "I wasn't afraid..." "I felt good." "For five years, I'd been dreaming of this and now I was setting off." "My greatest fear was being caught In Japanese waters and forced back." "Those two had probably gone home." "All I wanted was to put Japan behind me, yet there was no wind!" "10:00 pm." "At last I had left Nishinomlya Harbour." "1 hour 20 minutes to get to the breakwater." "Just 500 metres!" "Slower than swimming!" "Dawn arrived and still not the slightest breath of wind." "I was still in sight of the Nishinomlya lighthouse, and it was really starting to get on my nerves." "Hey, is that yacht down there the same one we saw this morning?" "What the hell's he doing?" "Just bobbing along in the same place all day." "He's in no hurry." "Yachts run on the wind, so what's the point of fitting engines to them?" "I built my yacht so that it couldn't take an engine." "Divine retribution for being so awkward." "As long as there was no wind, there was absolutely nothing I could do." "Even by nightfall, I was still in the middle of Osaka Bay." "I hadn't fitted any lights, so I hung a lantern to warn any other boats that might collide with me." "But I was scared of getting caught, so I was constantly hiding it every time a boat drew near!" "What a palaver!" "I'd been manning the rudder 24 hours and was exhausted and frozen." "My feet were wet in the long boots, but I just slept in the clothes I stood in." "I left the lantern burning." "As long as the authorities didn't find my food supplies, they wouldn't suspect anything." "I'm drifting eastwards." "11:00?" "Right, then." "I'll catch up on my sleep." "Wind!" "A northerly wind." "Let's go!" "Thank you!" "Thank you!" "I'd counted on reaching the southern straits of Tomoga Island within 10 hours." "Now I was seeing them, 39 hours into my voyage!" "...a south-southeasterly wind." "Wind velocity: 6." "Rain. 1002 millibars." "Temperature: 21 degrees." "For Tori Island..." "Rain. 1000 millibars. 24 degrees." "At Hachijo Island, a south-easterly wind 1003 millibars. 28 degrees..." "I was right, it's safer having no light." "Too many patrol boats in these waters." "Thank goodness for the storm!" "But really I was praying that somebody would come and rescue me!" "Listen, I'm not telling you your business because you're the expert, but this keel seems a little shaky." "Why don't you just wait until I've finished it?" " it's a bit loose." " Any complaints, speak to the guv'nor." "The Kingfisher hull is small but it's superbly designed." "These are the blueprints I bought in Yokohama for 10,000 yen." "It's no good if you don't follow the blueprints!" "I am following the blueprints to the letter." "I've never heard of lauan-wood masts." "I promised you a hull for 200,000 yen, so a lauan-wood mast will have to do." "You're the one who came up with the figure of 200,000 yen!" "I can't give you a penny more so please be fair with me." "You're always chopping and changing." "If you don't trust us, come in every day and supervise it." "I will, then!" "Just look..." "it's seeping in from all directions." "Is there a single join that's safe?" "Hey, look... there are gaps everywhere." "Every day I have to put up with this..." "Enough!" "If you're only using 9-mm thick veneer, you've got to make sure it's a tight fit." "Boats absorb water when they're afloat." "Wood expands when it's in water." "I don't relish having to bail out bilge water from the ship's hull." "In a rocking boat, puking my guts up..." "Give me some room, I can't do my work." "If a yacht takes on too much water, then it'll sink, simple as that." "I guarantee the boat'll be fine in the Seto Inland Sea." "As long as you bail out water faster than it comes in, the boat won't sink." "Nine days into my voyage now." "Seems I've been drifting aimlessly in the seas around Shizuoka." "I'm halfway through my schedule already." "I allowed for being delayed near the Japanese coast, but this was too much!" "It rained almost non-stop every day, and pressure dropped in stormy seas." "What's the rest of the voyage going to be like?" "Serves you right, leaving the country without permission!" "Think bad thoughts and you'll be sent back home!" "I don't care." "Go ahead!" "Japan is such a closed country." "I was fully prepared and confident in my skills, but you wouldn't let me go." "But the law is the law!" "It only allows things which are safe." "But nothing is totally safe." "Even battleships sink." "I started this and I'll see it through!" "I'll keep a watchful eye out!" "I have to say, right, that you and me are the same person." "Can I trust you?" "Just leave it to me!" "Really?" "You'll soon leave Japan behind you." "Stop weeping and start singing!" "OK..." ""Reef"?" "What's that?" "Dictionary, dictionary..." ""Hidden reef, shore reef..."" ""To run aground on a reef."" "That's something I'd better avoid." ""I shall walk with my head held high"" ""So my tears won't fall..."" "I discovered that crying can help to maintain mental wellbeing." "It feels good having a cry." "You can bawl your eyes out, no one's looking." "I wept as though I was utterly alone in this world." "If I say I'm not going, I won't go." "Where the hell is it?" "It should be put back where it belongs." " Listen, Dad..." " Go and ask your mother!" "Mum just tells me to talk to you." "I'm just going round in circles." "This is where it's been left!" "Anyway, I've decided I'm not going to university, but it'd make me feel better if I had your consent, Dad." " Only because you want to go sailing!" " Guess so." "Anyway, why can't you do both?" "That's what you've been doing so far." "I'll pay your tuition fees for you whatever happens." "Even if I wanted to go to university, I'd find a way of paying for myself." "Anyhow, I hate studying!" " I didn't even want to go to high school." " You can't sail yachts all your life!" " I'll work." " Where?" "Here." "I can work with you, Dad." "I don't want you to get into this business." "Go back to school." "Doing the same as everyone else doesn't interest me." "Work isn't supposed to "interest" you, you stubborn fool!" "You're the stubborn one!" "Why do you say that?" "I'm always easy-going, everybody'll tell you that." "You're going to university!" "No way!" "I'm just popping out." "Have you finished that work for Okazaki?" "Not quite, but Yoshi said he'd finish it off." " Off to Nishinomiya again?" " That's right." "Your mother tells me you have a yacht now." "A mate invited me into part ownership with nine other guys, so I own one tenth of the yacht." "A mate?" "What does he do for a living?" "Runs a clothes shop, a shoe shop, a flower shop..." "This and that." "So the yacht's his pastime?" "He must be rolling in it, eh?" "He's not rolling in it at all, that's why he asked me." "It's 100,000 yen per person to be paid in monthly instalments." "Since I earn only 10,000 a month, it's pretty tight!" "10,000 yen?" "I'm paying you too much!" "I'll have to get you working harder." "You said you didn't want me working at the yard." "You came here of your own free will." "I never said that!" "I don't want to inherit this place off you." "I'm just hanging around here so you'll get rid of me." "Good-for-nothing!" "I'm 20 years old now." "I can take care of myself now." "If you did your job properly, I wouldn't have to discipline the others." "Just tell them to ignore me and get on with it." "I'm off!" "What?" "Something you want to talk about?" "So you're leaving and going to work somewhere else for a year?" " I was going to talk to you about it..." " What's to talk about?" "You've decided." "If it was a regular job, fine, but it's only for a year!" " I don't want to be an office worker." " And after a year, then what?" "A mate put a good word in for me, the salary's three times what I get here." "It's a travel agency, providing services for tourists travelling by boat or plane." "I'll be a driver, taking passengers' baggage to the airport." "You'll upset your mother even more." "Why?" "You tried to hide it from her, but she realised all along that all you want to do is sail off in your yacht." "Hanako said as much..." ""The only books my brother reads are ones about the sea," ""about circumnavigating the globe and diaries of castaways."" "What does Hana-chan know?" "They're only books." "It's only natural for someone as wilful as you to run off to sea!" "Don't be so hard on me!" "You understand what it's like, Dad." "Pushing and shoving through life, trying to survive." "To test yourself and your capabilities, that's the best feeling, isn't it?" "You don't have to go to sea for that!" "I never said that." "I don't even have my own yacht." "I know you well enough, you'll build one." "I expressly forbid it!" "I want you to give it up." "You're my only son." " You're too suspicious!" " Disobey me, and I'll cut you off!" "Well, there's nothing I can do about that." "That's Tateyama?" "So, if Tateyama's at exactly zero..." "Precisely north!" "That's north, so... zero, zero, zero... 180." "All right!" "I'm good!" "So if my current position is here and I maintain a course due south, then I should pass between Hachijo Island and Mikura Island." "After that, I hit the Pacific Ocean!" "What a great device you are!" "Good job I insisted on getting one." "With all those reefs around the Izu Archipelago, you better show me you're worth the 57,000 yen I spent on you!" "I'm relying on you." "On the front starboard side, we have the moon." "In the heavens, we have the Plough, and at the side, the Pole Star." "With my right hand on the rudder and my left holding some cheese," "I listened to music on the radio." "I passed through the Izu Islands safely." "I won't forget that sense of satisfaction at my achievement." "...133 degrees 45 minutes of east longitude." "985 millibars, a category-3 typhoon, 15 kilometres northeast..." "It's hot but it's great weather!" "Just once..." "I'd love to sail in a typhoon." "Me and my big mouth, talking about typhoons!" "Now it's following me!" "With such a large hole in the boat, you have to drop the price when the time comes to sell!" "Enough is enough!" "If you're facing certain death, call out to me!" "Hail to the Mystic Law of the Lotus Sutra!" "There as well?" "When you first started sailing, you did nothing but complain." "You were so tired when you got back from school sailing trips, you just slept." "I wish you'd given up sailing then." "Listen, it's not that much fun even now, with all the research I have to do in preparation for this crossing." "The stress is making me sick." "So why don't you consider giving it up?" "You have no real friends to speak of, and I appreciate how much this yacht means to you." "I have Pearl." "Pearl?" "She's just a dog!" "I told you, don't worry." "My yacht's been specially designed to right itself from a 130-degree lean." " I'm home." " How come you're back so early?" "Well, it's a holiday." " Is today Sunday?" " Wednesday." " A holiday on a Wednesday?" " I don't know!" "Nice to be so out of it!" "They're so easy-going at that dressmaking college of hers." "I'm talking about Hana-chan." "She goes into classes not knowing it's a day off!" " Must be expensive, that yacht." " Very expensive." "You managed to save up for it." " I've been scrimping and saving." " What scrimping and saving?" "You can save enough from your salary, but when it comes to shoes and shirts, I have to buy them for you!" "You don't have to pay board and lodging in this house!" "Please, Mum, no more ear-bashing!" "First you quit the travel agents, then spend every day down at the boatyard building a yacht!" "Is there nobody that can talk you out of this crazy idea?" "I'll be furious if you discuss my plan with anyone else!" "Yes, but..." "I couldn't bear it if you got angry and left home." "Maybe I should go and talk to your friends." "Don't you dare!" "Even my friends have been saying the same thing lately..." ""Don't mention crossing the Pacific to Horie," ""because the more you try to dissuade him, the more he'll want to go."" "Yes, but you'll still go, even if I say nothing." "What are you after, my dear?" "I'm sure I bought some tobacco..." "but I can't find it anywhere." "Your father won't even discuss the matter with you." "I know. it's the same with my friends." "Is there no way of stopping you?" "It's because you have no girlfriend." "If you had, she'd soon stop you in your tracks!" "Thanks for the food!" "Don't be so daft, Mum, I don't need a girlfriend." "And what money I do have, I spend it on the yacht." "So stop worrying!" "I'm not going anywhere till I'm totally confident." "How about going with a friend?" "You, who can't stand being alone, how can you spend all that time by yourself at sea?" "Day in day out, seeing the same person, even a lover, in a tiny boat..." " it'd end in tears." "Alone is best." " You're just saying that out of pride." "Mum!" "A couple of months without company, I'm bound to get lonely." "It can't be helped." "Listen, it's tough luck if you don't want me to go." "I've made my mind up, I'm going!" "You can't stop me!" "I'll let you know when I'm leaving, but if you keep nagging me, then I'll just leave in secret!" " Off to the boatyard?" " Yeah." "Ken-chan..." "If you're caught in a storm and facing certain death, call out to me." "The wind's changed." "I should get cracking." "I've had enough of working all day." "Now it's your turn." "Don't just sit there, you lazy bastard!" "Why don't you get out there?" "Weird!" "Is that the first sign I'm going mad?" "Right, I'll do it myself!" "There's no one but me on this boat." "No one but me!" "Only ten bags left." "One bag is 3 litres, so that makes 30 litres." "This amount of water should just about last two months." "Plus 12 litres in cans..." "No worries, eh?" "No way!" "Only three good ones." "There was no problem when I tried them out at home." "I left water in plastic bags for a year and there was nothing wrong with it!" "It didn't go murky like this!" "Never mind!" "Never mind!" "I've got loads of canned fruit." "The juice in them is just like water." "And there's rainwater!" "If I can catch it, I can drink that." "However much I tried to laugh it off, it was no good." "It felt like I was caught in a vicious circle." "It wasn't just the loneliness." "There was the exhaustion, cold, lack of sleep and anxiety." "I felt I was losing my sanity." "As I wasn't taking in any water, I drank a little alcohol to quench my thirst." "I deliberately started mixing my drinks." "I thought getting blind drunk would help me." "The physical pain would ease my psychological pain, right?" "I feel awful!" "Oh, that hurts!" "That's the lot." "Do you know the easiest way to travel abroad?" "Air travel's got to be the easiest." " I mean in terms of procedure." " Procedure?" " Know anyone who specialises in it?" " Nah." "Isn't that your company's speciality?" "Only for legitimate clients." "FOREIGN AFFAIRS SECTION" "Could you help me, please?" " This won't do." " Won't do?" "You're missing one document." "Fill it in and return it." "These are the forms I got from a travel agency where I worked." "I see..." "How many days does it take to get a passport?" "You only require an ID card to go to Okinawa." "But I need a document from you that proves my Japanese nationality." "You'll be notified within four to five weeks to come and pick it up." "That long?" "Okinawa's under US military jurisdiction." " Do you do a background check?" " How should I know?" "All we do is pass on your application to the Southern Region General Office." "So there's no way I can go to America with my ID card, right?" "America?" "The counter for passport applications is over there." "What's up?" "No one'll come near me lately." "At least it's better than being criticised by everyone." "I'm told Shikishima Cotton will give you free sails." "Really?" "The only condition is that you display their trademark on the sail." "It's like this, in the shape of a mermaid." "I heard you were hard up for money, so..." "Not exactly hard up, but the yacht has cost me 70,000 yen more than I budgeted." "Ask them if I can change the boat's name to Mermaid." "You sure you don't mind advertising their brand?" "They're not likely to find that many customers in the middle of the Pacific!" "There's a University Sailing Club alumni meeting in May." "I wanted to make it a send-off party, but many members were against it." "That's all right, who cares?" "I might not even be in Japan by then." "There's no need to be so arrogant when you're talking to me." "Sorry..." "You're my senior, and I spoke out of turn." "It's nothing to do with all that "senior/junior" nonsense." "What you are is a maverick." "You always do exactly what you want, and you do it your way." "There's nothing wrong with that." "When you're the only one you can trust, you have to believe in yourself." "Having said that, in order to protect all that's important to you, surely you have to treat those around you with respect." "I mean, you might not see eye to eye with everyone, but they're still your friends and family, right?" "You are one man, and they are many." "If they really want to, they can come down on you like a ton of bricks!" "I've said too much." "Forgive me." "No, I'm not bothered at all." "You don't get it, do you?" "You should be bothered!" "Listen, it's nothing to do with us if you survive or die in the Pacific, but just consider the position you're putting everyone in." "It's almost like you want to die out there." "I realise that, too!" "Total distance in a straight line is 5300 miles adding on a third makes 7000 miles." "At the Mermaid's average speed of approximately 2 to 3 knots that's 60 days minimum, 120 days maximum." "So, 0.5 litres multiplied by 120 makes 60 litres." "60 LITRES OF DRINKING WATER, 30 BREAD ROLLS 5 BOXES OF CRACKERS, 5 KG OF HAM" "Canned goods will be the staff of life, whatever they taste like!" "276 CANNED GOODS 2.5 cups of rice per day multiplied by 120 days..." "I've put each portion in a plastic bag, for convenience." "50 PACKETS OF MISO SOUP, 6 FLASKS OF SOY SAUCE 1 MEDIUM BOTTLE OF KETCHUP, 1 LARGE BOTTLE OF MAYONNAISE" "5 BOXES OF SALT, 10 PACKS OF CHEWING GUM" "I love sweet things so I'll pack plenty." "10 BARS OF CHOCOLATE, 3 BOXES OF BISCUITS 2 CANS OF INSTANT CREAM, 1 TIN OF TEA" "The onboard kerosene stove always stays horizontal." "I looked for a foreign-made stove with a flame guard but couldn't find one." "And I had a whistling kettle specially made, so I can hear it when I'm above deck." "Tin-openers: essential kit!" "1 THERMOS FLASK, 5 SPOONS, 6 FORKS" "I tried to source as much as I could from home." "Even so, I was still well over budget." "1 CHOPPING BOARD, 1 CLEAVER 60 BOXES OF MATCHES" "The red mermaid trademark was too easily spotted, so I took it off." "1 MAIN SAIL, 1 STORM JIB, 1 CRUISING JIB, 1 COMPASS" "There was a second-hand, British-made sextant I really needed." "It was 35,000 yen, but, after an hour, I bartered it down to 25,000 yen." "1 ATMOSPHERIC PRESSURE GAUGE 1 DIRECTION FINDER 1 TRANSISTOR RADIO, 7 RADIO BATTERIES, 4 LAMPS" "I'd use my life jacket as a pillow." "40 LITRES OF PARAFFIN, 6 BUCKETS" "Two large buckets I used for collecting rainwater, four medium buckets for bailing, and I tied a red ribbon on the toilet bucket!" "12 NAUTICAL CHARTS, 1 CONSTELLATION CHART 1 BOOK ON BEACONS, 1 SET OF WATERPROOF CLOTHING" "5 STRAW HATS, 1 BASEBALL CAP" "Exposure to direct sunlight causes exhaustion, so five cheap straw hats." "I need that many because they'll get blown into the sea." "15 T-SHIRTS, 5 PAIRS OF TROUSERS, 7 SWEATERS" "I bought 60 undershirts a few at a time." "80 pairs of cheap shorts, which I'd throw away after wearing." "12 PAIRS OF GLOVES, 3 SCARVES, 3 BELTS, 10 PAIRS OF SOCKS" "There was mountains of stuff!" "I couldn't risk having an overloaded boat in a storm." "There was no end of things to worry about." "I took care not to go over the maximum load of 500 kg." "1 MIRROR, 1 TUBE OF HAIR CREAM, 1 HAIR BRUSH" "Also, a pair of tweezers in case I got any splinters." "And toilet paper: 1 batch, 1000 sheets." "Tons of the stuff!" "But best take it all, just in case." "12 PENCILS, 10 BALL-POINT PENS, 1 PENCIL SHARPENER, 2 RUBBERS" "I needed so many books, for reference and for entertainment." "And I needed cushions as I'd be sleeping on a board." "They were so expensive!" "4 BLANKETS, 1 JAR OF VITAMIN C, STOMACH AND HEADACHE PILLS" "Seasickness tablets are bad for the stomach, so I planned not to take any." "2 PACKS OF EYE DROPS, 1 TIN OF MENTHOLATUM 1 ROLL OF BANDAGE, 1 PACK OF GAUZE" "I needed a calendar I could tear off, otherwise I'd lose track." "And there was a proverb for every day." "It was easy to check, and I could use old sheets to blow my nose." "It would spur me on!" "2 CHISELS, 1 DIVER'S KNIFE, 3 TYPES OF SCREWDRIVERS 3 DRILLS, 1 MONKEY WRENCH, 2 FILES, 1 BOX OF NAILS" "1 SET OF NEEDLES, 50 WOOD SCREWS 1 ROLL OF SELLOTAPE, 1 TAPE MEASURE, 1 WHETSTONE" "1 CAMERA, 3 ROLLS OF FILM, 2 UMBRELLAS 1 SET OF FISHING TACKLE, 1 UKULELE" "A shark!" "If I'd bumped into that, that would've been end of story!" "You pulled me away just in time!" "I thank you." "I'll look after you." "Simple as that!" "A real flush toilet." "Simple as that!" "I'll have to do it in black ink as I don't have any red... sorry!" "I can always see the positive side." "Right, let's go for it!" "If I could sail at this speed every day, I'd get to America in 50 days!" "Fly with the wind!" "The water of the Pacific Ocean, even on sunny days, is a cold blackish blue." "That's because it's so deep and absorbs the light." "The boat caught the waves and sped along." "Yachts are so powerful." "With her sailing in the wind like this, I felt a renewed sense of trust." "The ocean's so wide." "People say that it's a small world, but I can feel the true immenslty of nature." "What a joy!" "Glad I came!" "On the 41st day, I crossed the International date line." "I had covered three sevenths of the distance." "I was smack in the middle of the Pacific Ocean!" "Probably thought I was in distress." "Don't worry about me!" "Just go back to where you came from!" "Oh, no... they can't hear me." "If I wave at them, they might think I'm asking for help." "Oh, yeah!" "My camera!" "No rush, there's plenty of time." "Just look as if I'm leisurely taking photos." "Doesn't matter if they don't come out." "1000 kilometres due south of here is the Mldway Sea." "Exactly 20 years ago in June, many sailors lost their lives in the immense naval battle there." "No one there now." "I offered them a silent prayer." "Another plane." "I suddenly felt nervous." "These planes must be keeping me under surveillance." "Maybe they thought I was spying on American territorial waters." "But America was still far away." "It'll be dark soon, then I can sail off out of sight." "This is "Pineapple Time" on Radio KI KI, Hawaii, brought to you by the Shima Transfer Company from Honolulu, Hawaii." "It's Japan's hit parade, so let's kick off with Murata Hideo's "Champion of Go"." "If the wind blows, my go piece will fly away" "You may laugh at the years I've devoted to go" "But the 808 bridges of old Osaka where I was born..." "If I substituted "my yacht" for "go", this could be my song!" ""If the wind blows, my little yacht will float away" ""And you may laugh at the years I have devoted to it..."" "The proverb for July 13th..." ""Whatever your aspirations," ""they will amount to nothing if you lack stamina and spirit."" "Good morning." "It's morning once again, eh?" "An American ship..." "Fancy meeting you here." "Keep your cool!" "Carry on as you were." "They're not going to arrest me." "Maybe my pronunciation's no good." "Oh, food supplies." "Do I look like a beggar?" "Could I have got this far without my own supplies?" "I wish they'd get going." "What?" "Am I all right?" "Bet he won't understand my Japanese." "I'm all right!" "Time to take my leave..." "Take care!" "Thank you!" "Ta!" "Cheers!" "Thanks!" "Passport?" "Why did she have to bring that up?" "Thanks for reminding me of something else to worry about!" "Thanks for your kindness!" "Bye!" "There'd been no rain for quite a while, so I boiled my rice in beer, to conserve water." "INSTANT CREAM BUTTER" "How is it?" "Pretty tasty, eh?" "I'd kill for some real shortcake." "This stuff tastes awful!" "I'll just have to lump it." "Hmm... tastes good!" "Doesn't really, though." "Good, good." "Tastes good, right?" "How is it?" "Good, eh?" "Well..." "I guess... it's kind of tasty." "Right?" "You're lucky to be eating such delicious food." "Tasty!" "At least I took meals seriously!" "Eating was relaxation for me." "I had to work so hard, I didn't have a moment to relax." "I was plagued by a sense of unease." "And I ate to forget my anxiety, and so overate and made myself ill." "And then, the wind dropped." "In the Pacific Ocean, when the wind blows, it really blows, and when it doesn't blow, it's absolutely calm." "After a week of being becalmed, I started to go slightly mad." "When I leapt into the ocean, ...the boat would edge forward slightly." "Maybe I could leg-kick all the way!" "If I kept going back and forth, shoving it like a swing, the boat would be pushed forwards." "I thought seriously of giving it a go, as nobody was watching me..." "But I looked like an idiot, so I just gave up on it." "I wonder if I'll ever reach America." "There was a cold current, so the temperature dropped." "That meant I wasn't far from land." "I was scared of landing." "I wouldn't know anybody, and I had no passport." "I had no money, and I couldn't speak the language." "You couldn't have chosen a worse day to leave in this rain." "And while your father's away in Tokyo on business, too." "It's better that way." "Your father will be so angry with me." "It'll soon be too late." "If I leave it another day, the weather will be worse." "You will come back?" " Don't worry." " Yes, but..." "Provided I arrive safely, I'll either be chased away, or thrown into a detention centre." "What?" "All this effort just to get thrown into a detention centre?" "No, no, it's just something that might happen." "Please, give up this stupid trip." "Others have made solo crossings of the Pacific Ocean, but no one from Japan yet." "Somebody will, sooner or later." "There's no reason for you to do it." "For a sea-faring nation, Japan's pretty pathetic." "So nobody will be impressed, anyway." "All that effort, just to get thrown into jail!" "Mother, it won't be jail." "He said it'll be a detention centre." "All I want is to cross the Pacific." "I don't care if they arrest me." "It's not like they'll kill me or anything." "I'll be fine." "I'll sell the yacht and buy a ticket back home." " Do you have any money?" " Yeah..." "I've got 2000 yen." "1000 YEN NOTE" "Well, I still have a few things to get..." "so I'll take it." "I should return within 120 days..." "So you mustn't worry about me." "I made it for you to take with you." "You should've given it to me earlier, then I wouldn't have had to buy any." "Anyway, thanks so much." "It's beautiful." "Isn't it, Mum?" "I've carefully researched everything that I possibly can." "I'll just have to face what Fate throws at me." "Land!" "It's America!" "Have I really made it?" "There was San Francisco, right before my eyes." "I imagined so many thoughts would come into my head, but my mind was a blank." "Around here, the currents are strong." "The seabed has tricky contours." "If I wasn't careful, I'd come to grief." "Other vessels were coming and going..." "so, safety first!" "I kept watch outside the harbour all through the night." "It was cold... and I was tired." "I changed my underwear and had a shave." "And then, in the morning, there it was, the Golden Gate Bridge." "And under the bridge and beyond was San Francisco Harbour!" "Mother!" "I made it!" "AUGUST 12TH 1962 SAN FRANCISCO" "You're all speaking English!" "I don't understand!" "This is really America!" "San Francisco!" "I made it!" "I reached America!" "For 94 days I'd been at sea, and my legs were unsteady." "It felt strange being on solid ground." "The Japanese Consul came to meet me and put me in his car." "I was so worried..." "Exactly six days after my son departed, his pet dog gave birth to a litter of five puppies." "Taking care of the puppies took my mind off worrying about my son." "His friends were so anxious, that they launched a search for him four days ago." "Then I started to worry and worry..." "Really..." "I am just so grateful that he's alive." "Sir, you were against your son's trip." "You must be happy now, though?" "When we get him home, I'll make sure he apologises to everyone." "Never again will I let him do such a thing." "How does his sister feel?" "I knew from the very start that my brother would be all right." "We don't have any details just yet." "That's right, he did it alone." " Somebody get the door!" " I'll go!" "Horie Kenichi, from Osaka..." "Osaka!" "Can you hear me?" "So far, I seem to have been welcomed as an object of curiosity." "I think this house belongs to someone who works at the Japanese Consulate." "I think they'll let me stay here for the night." "I've no idea what will happen tomorrow, but at least I'm not in a detention centre." "For that, I'm thankful." "I finished what I set out to do." "I'm tired." "I really need some sleep." "Hello?" "I'll leave some pyjamas here for you!" "Wow!" "What a sight!" "How embarrassing!" "I'd best wipe it with this." "Must be a whole layer of my skin!" "Horie-san, telephone for you!" "An international call, from Japan!" "I think it's your family on the line!" "Right..." "I'm coming now..." "Coming..." "THE END" | 2024-05-24T01:27:04.277712 | https://example.com/article/9693 |
Some House Democrats wanted Nancy Pelosi out as their leader after they failed to win a string of 2017 special elections. And now some want the House minority leader out because they appear to have won a special election.
What gives with the paradox? It doesn’t make sense, except that some House Democrats are prepared to move on from Pelosi -- and some aren’t.
“The watch” is on again on Capitol Hill when it comes to Pelosi, how has been the House’s top Democrat for more than a decade.
Democrat Conor Lamb is on track to vanquish Republican Rick Saccone in a historically GOP district in southwest Pennsylvania that President Trump won by nearly 20 points.
Lamb distanced himself from Pelosi and ran as a moderate Democrat. And now Democrats are eager to replicate Lamb’s prototype in their quest to capture the House in November.
Republicans contend Pelosi is radioactive, considering how critics have branded her as a West Coast liberal losing touch with the party base. And the plan to use the leader to put other moderate Democratic candidates on the spot this year. In other words, will you support Pelosi for House speaker should Democrats win the House? And it’s moderate to conservative Democrats who must win -- in districts Trump carried -- if Democrats are going to have a shot at winning the House.
Pelosi faced a firestorm of criticism in November 2016 after Democrats barely dented the Republican House majority. Democrats gained six seats when they needed 30 to control the House. Few expected Democrats to win the House, but lots of political handicappers projected an anti-Trump backlash could help Democrats win at least 15 to 20 seats.
They never got close. Some Democrats tore into Pelosi. She drew a challenge for her leadership post from Rep. Tim Ryan, D-Ohio. Pelosi prevailed in the end, but an eye-popping 63 Democrats cast ballots for Ryan.
Ohio Rep. John Boehner in 2015 was forced out as House speaker, the chamber’s leader and top Republican, is a similar intra-caucus revolt.
Pelosi’s weathered the internecine tempest so far. But for how long?
Many political prognosticators suggest a Democratic wave is building this fall. If that’s the case, Democrats will swipe seats from Republicans in rural areas in the Midwest and perhaps the south where Pelosi isn’t popular. Could Democrats follow Lamb’s lead and disavow Pelosi?
That could be a sound electoral tactic. But it could cause a problem for Pelosi in her quest to return to the speaker’s suite.
The question is whether Pelosi could command the votes to again become Speaker.
This could be one of the great political incongruities of all time: Democrats win the House and simultaneously deny Pelosi the right to again clasp the speaker’s gavel. There’s a reason why Democrats were willing to re-elect Pelosi as minority leader for two years, despite 63 defections: give her another shot to lead Democrats out of the wilderness.
It may seem strange to potentially have Pelosi return to the Speakership after an eight-year exodus in the minority. But it’s far from unprecedented for house speakers to have broken service.
The first, Frederick Muhlenberg, of Pennsylvania, served as speaker in two different Congresses, interrupted by Speaker Jonathan Trumbull of Connecticut. Same with Henry Clay, of Kentucky, who enjoyed three different turns at speaker.
Speaker Thomas Reed, R-Maine, led the House in the 51st Congress, then again in the 54th and 55th congresses. The best examples of lawmakers returning to the speakership after exile in the minority are Speakers Sam Rayburn, D-Texas, and Joseph Martin, R-Mass. Rayburn became speaker in September 1940.
Martin took the reins in 1947. Rayburn came back in 1949. Martin and the Republicans rallied in 1953. Finally, Rayburn began his last tour as speaker in 1955.
Pelosi keeps close counsel on her future plans. Her confidantes point out it’s against her DNA to bow to pressure or not go without a fight. By the same token, Pelosi is an exceptional vote counter.
She knows how to gauge her caucus and if she has the votes to prevail, accurately predicting she’d get two-thirds of the vote in the Ryan challenge. If Pelosi doesn’t, she will likely exit.
It will boil down to simple mathematics.
Chatter is percolating throughout the Capitol that Pelosi may attempt a cunning departure in an attempt to bolster Democrats in their quest for the House and simultaneously hose Republicans.
House Republican leaders continued making their case this week that votes for Democratic candidates could again elevate Pelosi to speaker.
There’s a theory (and it’s just a theory) that Pelosi could time an exit later this year -- just after Republicans spend millions producing commercials and buying airtime that attempt to link Democratic candidates to her.
Such a scenario could leave Republicans on the hook with lots of outdated ad buys. They will have squandered millions of dollars making a case against someone who is no longer a factor.
Some Republicans may publicly rejoice that that they finally dispatched Pelosi. But sober GOPers know Pelosi taking her leave is bad news for them. It robs Republicans of a foil -- especially if the party is trying to link Democrats to Pelosi.
But these scenarios are just that: scenarios. And few believe Pelosi would bow out early.
Republicans successfully deployed Pelosi against Democrats when they won the House in 2010. Pelosi is certainly radioactive in certain districts. But it’s unclear if the Pelosi maneuver still works.
“This is part of the bankruptcy of the Republican Party,” Pelosi said. “They’re devoid of ideas about how they’re going to meet the needs of the American people. So it’s an ad hominem. They can’t win on the issues. So they go after a person.”
House Democratic Caucus Chairman Joe Crowley says of the Pelosi attacks: “I think they need to get a new game book. The attempts to use Nancy Pelosi, it’s failing them at this point. And I think, quite frankly, it’s sexist.”
Some quarters on Capitol Hill view Crowley as best situated to succeed Pelosi. Another possibility is her longtime rival, House Minority Whip Steny Hoyer, the chamber’s No. 2 Democrat.
Ryan repeatedly says he won’t challenge Pelosi again. But he says she must go and that there’s merit in Lamb’s approach.
“Every candidate’s locally got to make that determination as to how in their own heart, how they feel about Democratic leadership in Washington, D.C., fits into their own agenda and their own election and how their people feel locally,” Ryan said.
Did Lamb’s distance from Pelosi make a difference in the race?
“I don’t think that your opponent should choose your party’s leaders,” said Pelosi, who’s represented San Francisco since 1986. “They’re coming after me because of my city. And they’re against LGBT and they’re against poor children. That’s been my mantra. The poor children of America, I’m here to support. Yes. I am a liberal.”
It’s those “liberal” credentials that work against Pelosi, even inside her party. Can conservative Democrats support liberal for Speaker again?
Unclear.
Lamb’s possible win may portend good things for Democrats in November. But they likely need to win about 25 seats to retake the House. The precise number is unclear because there are a number of vacancies.
The Lamb-Saccone race still isn’t official, and the district will be redrawn for November. And the death this week of Rep. Louise Slaughter, D.N.Y., has now put that seat in play. So, it’s unknown if Democrats will win the House and face a dilemma over who to elect as speaker.
But Pelosi watch is on again on Capitol Hill. | 2024-05-30T01:27:04.277712 | https://example.com/article/1739 |
Gascoyne, former F1 stalwart and now the technical boss of the entire Caterham Group, said this week that Finn Kovalainen harmed his chances of staying in F1 due to his poor management team and a lack of respect as he tried to move up the grid in 2013.
Kovalainen, 31, played down the comments.
"I have always had a good relationship with him (Gascoyne)," he said, "and my relationship with him will continue even now.
"Mike is a seasoned professional and he and I have worked together for a long time," Kovalainen told the Finnish broadcaster MTV3.
"The fact is that my negotiations are not with him. I talk to Tony Fernandes and Cyril Abiteboul.
"At the moment, the negotiations are continuing and I am not thinking about anything other than formula one. First, let's finish playing the game until the end.
"Then, when we know the outcome, think about what to do next," added Kovalainen, who moved to Caterham (then Lotus) in 2010 after being dropped by McLaren.
Gascoyne this week confirmed Caterham is considering replacing Kovalainen with a sponsored driver. | 2024-05-12T01:27:04.277712 | https://example.com/article/7042 |
News Archive
-
Shifting The OL
September 13 2002
By Bryan Hersh of 49ers Paradise
THIS CONTENT IS COPYWRITED, REDISTRIBUTION OF IT (including copy/pasting it to a message board, forum or bbs) IS PROHIBITED AND COULD RESULT IN LEGAL ACTIONS - feel free to quote up to 1 paragraph providing a source link to http://www.49ersparadise.cjb.net is included
In all likelihood when the 49ers play the Broncos this weekend they will be without their primary backup along the offensive line - Matt Willig. Willig underwent an arthroscopic procedure after the 49ers first game to clear some fluid from an infection he has in his leg. He is doubtful for the 49ers second game, this Sunday.
With Willig virtually out for the game, the 49ers have no immediate back up at offensive tackle. What that means, is that if either of the 49ers tackles, Scott Gragg or Derrick Deese, have to leave the 49ers game, the 49ers will juggle their line to accommodate for the loss.
Dave Fiore the 49ers current left guard would move into either tackle position, with rookie guard Eric Heitmann stepping into the guard position. Fiore, of course, had played all the spots along the line, so while this would be inconvenient, it is really the 49ers best option.
The 49ers will like have rookie Kyle Kosier active for the game too. The 49ers have known all off-season that they have a solid starting line, but little depth along that line. The team is rumored to be interested in trading for the Buccaneers Kenyatta Walker, which would help their depth. In the mean time though, the 49esr will just have to make do with what they have, which with Matt Willig out, could be troublesome. Hopefully the 49ers won’t be in a position where they need to reach on to their depth chart. | 2024-02-26T01:27:04.277712 | https://example.com/article/9929 |
C-reactive protein expression in adipose tissue of children with acute appendicitis.
The aim of this study is to gain insights into the role of visceral adipose tissue as a source of C-reactive protein (CRP) in acute inflammation and to explore the potential relationship of CRP expression with the severity of appendicitis. A total of 20 pediatric patients undergoing appendectomy were included in the study. Patients were divided into two groups according to appendicitis severity (uncomplicated and complicated). CRP levels were measured in visceral fat samples by western blotting, as well as in serum by biochemical testing. CRP was found to be expressed in visceral adipose tissue. The adipose tissue of patients with complicated appendicitis showed significantly higher CRP levels (p = 0.002) compared to patients with uncomplicated appendicitis. These results mirrored the CRP values obtained in serum (p = 0.018). In childhood, visceral adipose tissue is a source of CRP in acute inflammation, and its expression is potentially associated with the severity of local inflammation. | 2024-04-18T01:27:04.277712 | https://example.com/article/9089 |
Posts Tagged ‘weather’
Its getting towards the end of November but after a whole month of beautiful illuminations, I feel like it should be Christmas already! Its really cold now even though it seems like summer was just a few weeks ago! Thinking about this I suddenly became aware of the absence of cockroaches and mosquitoes which we were plagued with back then, and the lack of cicada songs. It felt so tropical and exotic when I first arrived but now the climate is much more like home with much brighter sunshine.
This week has been pretty stressful with my first major essay and an important presentation in Japanese so to escape from it all I went out and bought some really good comfort food. Boursin, stuff to make pizza, garlic (not sure why this is “comforting” but I miss it!) and English muffins with a view to making eggs Benedict!
One of the other exchange students, Tim, introduced me to a place that sells chicken Donner kebabs – not exactly the same as in London, but maybe even more delicious – probably because it was less fatty and had less pigeon/rat content. It was so good I had to go back and have a second one – terribly greedy I know, but it was about half the size of one at home so I didn’t feel too bad! Tim has been there so often that the kebab-shop-guy knows his name which I think is hilarious, but the guy selling them is very friendly!
A final good-food occurrence was Thanksgiving dinner last night at the other dorm nearby. With the ingredients available Isadora did a fine job from organising everyone and creating a hearty feast of deliciousness to using her Brazilian connections to get 4 “Turkeys” (which were in fact chickens – only 2 other people noticed other than me so we didn’t say anything!) In case you are wondering why this was such an achievement, I should point out that you cant get whole chickens in Japan. Coming from Dalston where you can get everything from whole cows to monkey meat, I do find this slightly depressing. Things are almost always packaged in individual portion sized amounts which is convenient certainly, but I still find it bizarre that you can buy a bag of 3 slices of bread.
Why 3 slices? It seems that most housewives shop every single day for food so that it is as fresh as possible. They buy what they need for the day ahead and that’s it. The whole concept of a weekly shop, cooking extra for the next day, or taking a doggy bag home from a restaurant is entirely foreign here! (If you are in Japan try doing so and you will get stared at as if you just shouted profanities in your loudest voice.) Slightly different to the American attitude summed up so wonderfully when one person said, “If I go to a restaurant in America and I don’t get enough food on my plate for at least two meals then I am p*****d off”. Luckily Isadora cooked far too much for thanksgiving and I now have a mound of leftovers to work my way through. Mainly stuffing and mashed potatoes – heaven. The lack of soy sauce maketh me happy. | 2024-07-08T01:27:04.277712 | https://example.com/article/8093 |