text
stringlengths 9
5.77M
| timestamp
stringlengths 26
26
| url
stringlengths 32
32
|
|---|---|---|
a journey through our dvd shelves
Confessions of a Dangerous Mind (2002)
Ben
This film is such a strange one, it’s really hard to believe it is apparently based on a true story. This is the (supposedly true) story of Chuck Barris (Sam Rockwell), he is a television producer/game show host who is recruited by the CIA to be an assassin. It sounds completely unbelievable, except for the fact that Barris made these claims in his own autobiography. The CIA has obviously criticised Barris and disputed his claims, but that is beside the point. This film assumes Barris’s biography was true, and puts it all on screen. Barris created the television shows The Dating Game and The Gong Show, and this film chronicles the creation of those shows, as well as his extracurricular activities as an assassin for the CIA.
The best part about this film is Sam Rockwell. He is a fantastic actor, and really excels here as the TV producer turned assassin. I enjoy Rockwell’s acting a lot, one of my favourite movies of the past few years is The Way Way Back, and it is mostly because of Rockwell’s performance. The rest of the cast is ok. Drew Barrymore tries hard as Rockwell’s on/off girlfriend and Julia Roberts is good as one of Chuck’s assassin colleagues.
This was directed by George Clooney, who also turns up as the man recruiting Barris to the CIA. Clooney has talent as a director now, he has improved a lot since this movie. Confessions of a Dangerous Mind was the first film Clooney directed, and I feel like he was still finding his feet as a director. It’s also noticeable that Clooney has rustled up all of his Hollywood buddies to appear in this film. There are short cameos from his Ocean’s 11 co-stars Brad Pitt and Matt Damon as some of Barris’s game show contestants, as well as a larger role for Julia Roberts. This is not a criticism of the film, just that it’s obviously stunt casting and detracts from the film somewhat when a huge star like Brad Pitt turns up onscreen for a few seconds and then disappears.
Confessions of a Dangerous Mind is worth seeing for the performance of Sam Rockwell and Clooney’s directing potential. Other than that, I really struggled with this film. I went in with the idea that this is a true story taken from Chuck Barris’s biography, but found that I had a real problem with how Chuck is recruited to the CIA. It is not explained at all why they want him until the very end, and that explanation left me unfulfilled. During the film, I spent most of it questioning why would the CIA want this guy. He is a celebrity, known by millions. I’m not sure he’d be my first choice as a covert assassin.
Rating: C-
Sally
This movie is a bit odd. It’s based on the life of TV host and producer Chuck Barris, most famous for creating The Dating Game and The Newlywed Game, and for creating and hosting The Gong Show. So how exactly is this supposed to be compelling to watch? Well, apparently Barris was also an assassin for the CIA during this time. It seems unbelievable… because it might not be true at all.
While Barris claims he did in fact work for the CIA, the agency itself denies that he ever worked for him. I wouldn’t put it past the CIA to lie about this, but based on this movie the whole story seems unlikely. The Barris character doesn’t seem like a would-be killer at all, his recruitment is never adequately explained, and his whole attitude towards murdering 33 people is mostly blasé. I just don’t buy it, and I’m not the only one.
So it seems a bit odd that Barris’ alleged secret life is presented as being 100% true in this film. I got little sense of the movie trying to hedge its bets or make some grand statement about what is truth and what isn’t. Which is especially odd because I’d expect that sort of storytelling from George Clooney. Yes, he only directed (and co-stars in) this, but he would have had some control over the script even as a first time director. But maybe that’s what kept him from questioning the story; it’s easy to take risks once you’ve had some successes under your belt.
Confessions of a Dangerous Mind does have some interesting aspects outside of the main CIA plot line. For one, Barris is credited for lowering television standards through his TV creations, most notably The Gong Show. His game shows appealed to the lowest common denominator, they pushed the limits of what could and couldn’t be shown on television, and were often considered to be in poor taste. But they were also phenomenally popular with audiences. Clooney is clearly making a statement about today’s reality TV culture, and it’s both compelling and relevant.
Maybe that’s the overall statement of this movie– just give the audience what it wants, standards and truth be damned. You’re not going to please everyone, but you can probably please most of them. | 2024-05-20T01:27:04.277712 | https://example.com/article/1808 |
At least Stacy's hoping they don't! It's not easy to be good all the time. Stacy just had to try on the beautiful gold shoes her friend Jiwon brought to school to sell in the class store. Now the shoes are lost, and it's Stacy's fault.
Even worse, Stacy's friends think she stole the shoes. How can she explain what really happened? Telling the truth is hard, but Stacy knows if the shoe fits, she has to wear it! | 2024-05-23T01:27:04.277712 | https://example.com/article/5187 |
The technology of making metal conductors to provide for vias, lines and other recesses in semiconductor chip structures, flat panel displays and package applications has been developed in the past decade. For instance, in developing interconnection technology for very-large-scale-integrated (VLSI) structures, aluminum has been utilized as the primary metal source for contacts and interconnects in semiconductor regions or devices located on a single substrate. Aluminum has been the material of choice because of its low cost, good ohmic contact and high conductivity. However, pure aluminum thin-film conductors have undesirable properties such as a low melting point which limits its use to low temperature processing possible diffusion into the silicon during annealing which leads to contact and junction failure, and poor electromigration resistance. Consequently, a number of aluminum alloys have been developed which provided advances over pure aluminum. For instance, U.S. Pat. No. 4,566,177 discloses a conductive layer of an alloy of aluminum containing up to 3% by weight of silicon, copper, nickel, chromium and manganese developed to improve electromigration resistance. U.S. Pat. No. 3,631,304 discloses aluminum alloys with aluminum oxide which were also used to improve electromigration resistance.
Recently developed ULSI technology has placed more stringent demands on the wiring requirements due to the extremely high circuit densities and faster operating speeds required of such devices. This leads to higher current densities in increasingly smaller conductor lines. As a result, higher conductance wiring is desired which requires either larger cross-section wires for aluminum alloy conductors or a different wiring material that has a higher conductance. The obvious choice in the industry is to develop the latter which includes pure copper for its desirable high conductivity.
In the formation of ULSI interconnection structures such as vias and lines, copper can be deposited into such recesses to interconnect semiconductor regions or devices located on the same substrate. However, copper is known to have problems in semiconductor devices. Since copper is a mid-level trap which degrades the device. The electromigration phenomenon occurs when the superposition of an electric field onto random thermal diffusion in a metallic solid causes a net drift of ions in the direction of the electron flow. Any diffusion of copper ions into the silicon substrate can cause device failure. In addition, pure copper does not adhere well to oxygen-containing dielectrics such as silicon dioxide and polyimide. To fully utilize copper in interconnection technology, the adhesion properties of copper must also be improved.
U.S. Pat. No. 5,130,274, assigned to the common assignee of the present invention, discloses the use of a copper alloy containing an alloying element of less than 2 atomic % by first depositing an alloy into the recess of an interconnection structure and then forming a copper alloy plug. However, the technique still does not satisfy the more stringent requirements in ULSI structures where critical dimensions of less than 0.5 .mu.m place a considerable burden on thin film chip interconnections. The use of standard Al (Cu) alloy and a silicon dioxide dielectric in a deep-submicron logic circuit wiring structure results in a large circuit delay caused mainly by the wiring connections.
The use of Cu as an alternative material to Al (Cu) in ULSI wiring structures to increase the chip speed has been attempted by others. However, numerous problems are incurred in Cu interconnections such as the tendency of Cu to corrode and the fast surface diffusion rates of copper in thin films. It is known that pure Cu has a smaller electromigration activation energy, i.e., 0.5.about.0.8 eV, than that in Al (Cu) of 0.80.about.0.9 eV. This implies that the advantage of using Cu for reducing interconnection electromigration failure at chip operating conditions is largely compromised.
A schematic of an enlarged, cross-sectional view of an electronic structure that utilizes conventional interconnections made of a copper alloy is shown in FIG. 1. The electronic structure 10 contains two levels of copper interconnections 12, 16 and one stud level 14 illustrating a copper wiring structure formed in a Damascene process on a pre-fabricated device 20. The device 20 is built on a semi-conducting substrate 24. As shown in FIG. 1, a typical Damascene level is first fabricated by the deposition of a planar dielectric stack 26. The dielectric stack 26 is then patterned and etched using standard lithographic and dry etch techniques to produce a desired wiring or via pattern. The process is then followed by the metal depositions of a thin adhesion/diffusion liner 18 and copper alloy metallurgy 12 wherein a bottom silicon nitride layer 28 is used as a diffusion barrier which is previously deposited on top of the device 20 to protect against copper diffusion. After the copper alloy interconnection 12 is formed, a top silicon nitride layer 32 is deposited and used as an etch stop layer for defining the next level copper interconnection 14. After a second level dielectric stack 34 is deposited, a recess for an interconnect is etched into the dielectric layer 34 and the silicon nitride layer 32.
A interlevel copper alloy stud 14 with liner 22 is then deposited by a technique similar to that used in depositing the first level copper alloy interconnection 12. A variety of metal deposition techniques can be used for filling the trench or via. These techniques include a collimated sputtering process, an ion cluster beam process, an electron cyclotron resonance process, a chemical vapor deposition process, an electroless plating process and an electrolytic plating process. Other techniques such as a co-deposition method in which copper and an alloying element are co-deposited can also be used in forming the copper alloys. For instance, the co-deposition methods include co-sputtering, "alloy plating", sequential plating of different materials with subsequent annealing, chemical vapor deposition, sequential chemical vapor deposition and co-evaporation. After the completion of the interlevel copper alloy stud 14, another similar process is repeated to form the second level copper interconnection 16 with liner 24 in a third dielectric stack layer 38. An etch stop layer 36 of silicon nitride is utilized between the stud and the second level interconnections. Finally, a top silicon nitride layer 42 is deposited on top of the copper wiring structure 10 for protecting the device from the environment.
Other workers have attempted to use copper alloys in providing enhanced electromigration resistance. For instance, U.S. Pat. No. 5,023,698 teaches copper alloys containing at least one alloying element selected from the group of Al, Be, Cr, Fe, Mg, Ni, Si, Sn and Zn. U.S. Pat. No. 5,077,005 teaches copper alloys containing at least one member selected from In, Cd, Sb, Bi, Ti, Ag, Sn, Pb, Zr and Hf where the weight percent of the alloying element used is between 0.0003 to 0.01. The copper alloys are used in TAB processes and as print circuit board members. U.S. Pat. No. 5,004,520 also teaches copper foil for a film carrier application containing at least one alloying element selected from P, Al, Cd, Fe, Mg, Ni, Sn, Ag, Hf, Zn, B, As, Co, In, Mn, Si, Te, Cr and Zn with the alloying element concentrations from 0.03 to 0.5 weight percent. The alloys are used as connecting leads in integrated circuit chip mounting. Furthermore, U.S. Pat. No. 4,749,548 teaches copper alloys containing at least one alloying element selected from Cr, Zr, Li, P, Mg, Si, Al, Zn, Mn, Ni, Sn, Ti, Be, Fe, Co, Y, Ce, La, Nb, W, V, Ta, B, Hf, Mo and C. The alloying elements are used to increase the strength of the copper alloy. U.S. Pat. Nos. 5,243,222 and 5,130,274 teach copper alloys for improved adhesion and formation of diffusion barriers. However, none of these prior work teaches copper alloys that are sufficiently improved for use in ULSI on-chip or off-chip wiring interconnections to meet the electromigration resistance and the adhesion property requirements. Interconnection structures on ULSI devices must provide dense, fully continuous metal wiring in insulator structures with features much less than 0.5 .mu.m in width, and with aspect ratios higher than 1.
More recently, void-free and seamless conductors are produced by electroplating copper from plating baths that contain additives. The capability of the electroplating method to superfill structural features without leaving voids or seams is unique and superior to that of other deposition techniques.
Electrolytic copper plating techniques used in damascene structures can be defect-free if a seed layer deposited is continuous and has a uniform thickness even in the deepest area of the structural feature to be plated. The copper seed layer is typically deposited by a physical vapor deposition technique or a sputtering technique over a barrier layer that prevents diffusion of copper into the insulator such as Ta or TaN. When the seed layer deposited is too thin at the bottom or near-bottom walls of a structural feature, plating does not occur and a void is created.
In order to eliminate the non-continuous deposition problem occurring during sputtering of a copper seed layer, a seed layer of a larger thickness is normally deposited. The deposition of a thick seed layer eliminates the plated Cu voiding problem, however, it creates another one of equal or even greater significance, i.e., poor electromigration resistance in the resultant structure. The poor electromigration resistance of the structure is caused by the fact that the seed layer itself has weak electromigration resistance when compared to the much higher resistance of the plated film. It is also noted that in future generation of chips, the seed layer contributes an increasing part of the total structure based on the dimensions of the features and the inability to decrease the thickness of the seed layer proportionally for reason stated above as well as the thickness uniformity requirements in electrolytic plating.
Ion implantation method has been used for placing impurity, or doping ions in a semiconductor material such as in a silicon substrate at precisely controlled depths and with accurate control of dopant ion concentration. One of the major benefits of the method is its capability to precisely place ions at preselected locations and at predetermined dosage. It is a very reproducible process that enables a high level of dopant uniformity. For instance, a typical variation of less than 1% can be obtained across a wafer.
An ion implanter operates by providing an ion source wherein collisions of electrons and neutral atoms result in a large number of ions being produced. The ions required for doping are then selected by an analyzing magnet and sent through an acceleration tube. The accelerated ions bombard directly the portion of a silicon wafer where doping is required. The bombardment of the ion beam is usually conducted by scanning the beam or by rotating the wafer in order to achieve uniformity. A heavy layer of silicon dioxide or a heavy coating of a positive photoresist is used as the implantation mask. The depth of the dopant ions implanted can be determined by the energy possessed by the dopant ions, which is adjustable by changing the acceleration chamber voltage. The dosage level of the implantation, i.e., the number of dopant ions that enters into the wafer, is determined by monitoring the number of ions passing through a detector. As a result, a precise control of the junction depth planted in a silicon substrate can be achieved by adjusting the implantation energy, while a precise control of the dopant concentration can be achieved by adjusting the dosage level.
It is therefore an object of the present invention to provide a method for forming a copper conductor in an IC device that does not have the drawbacks and shortcomings of conventional copper conductor devices.
It is another object of the present invention to provide a method for forming a copper conductor in an electronic structure that has improved electromigration-resistance by adding impurities into the copper conductor.
It is a further object of the present invention to provide a method for forming a copper conductor in an electronic device that has improved electromigration-resistance property by doping the copper conductor structure with impurities selected from C, O, Cl, S and N.
It is another further object of the present invention to provide a method for forming a copper conductor in an electronic device that has improved electromigration resistance by an electrolytic plating technique.
It is still another object of the present invention to provide a method for forming a copper conductor in an electronic device that has improved electromigration resistance by first depositing a copper seed layer into a receptacle and then ion-implanting impurities into the seed layer.
It is yet another object of the present invention to provide a copper conductor in an electronic device that contains impurities for improved electromigration resistance.
It is yet another further object of the present invention to provide a method for forming a copper conductor in an electronic device that has improved electromigration resistance by first electro depositing a copper composition containing impurities into a receptacle and then annealing the electronic device such that impurities diffuse into a copper seed layer previously deposited in the receptacle.
It is still another further object of the present invention to provide a method for forming a copper conductor in an electronic device that has improved electromigration resistance by first depositing a barrier layer into a receptacle and then implanting dopant ions into the barrier layer prior to depositing a copper seed layer on top of the barrier layer and annealing the structure such that dopant ions diffuse into the copper seed layer.
It is yet another further object of the present invention to provide a method for forming a copper conductor in an electronic structure that has improved electromigration-resistance by first adding impurities into the copper conductor and then ion-implanting a surface layer of the conductor with at least one ion of Co, Al, Sn, In, Ti, C, O, Cl, S, N, or Cr. | 2024-02-26T01:27:04.277712 | https://example.com/article/1927 |
When Dimple Met Rishi follows two very teenagers who are destined to meet.
Dimple, an aspiring web developer, has no time for anything but following her dreams. She’s solely focused on meeting her STEM icon and building up her resume for the brightest future imaginable.
Rishi, on the other hand, is a bit of a hopeless romantic. Fond of his cultural heritage and determined to please his parents, Rishi is a little too eager when his parents send him to a summer program with the promise that his promised bride will also be attending.
That promised bride just so happens to be Dimple who embraces Rishi by splashing him in the face with her iced coffee. Perhaps she would’ve been more open to the arrangement had her parents warned her. Can they learn to accept each other and maybe even love each other? | 2023-10-24T01:27:04.277712 | https://example.com/article/7283 |
Popular Websites Vulnerable to Cross-Site Request Forgery Attacks
Update Oct 15, 2008 We’ve modified the paper to reflect the fact that the New York Times has fixed this problem. We also clarified that our server-side protection techniques do not protect against active network attackers.
Update Oct 1, 2008 The New York Times has fixed this problem. All of the problems mentioned below have now been fixed.
We found four major vulnerabilities on four different sites. These vulnerabilities include what we believe is the first CSRF vulnerability that allows the transfer of funds from a financial institution. We contacted all the sites involved and gave them ample time to correct these issues. Three of these sites have fixed the vulnerabilities listed below, one has not.
CSRF vulnerabilities occur when a website allows an authenticated user to perform a sensitive action but does not verify that the user herself is invoking that action. The key to understanding CSRF attacks is to recognize that websites typically don’t verify that a request came from an authorized user. Instead they verify only that the request came from the browser of an authorized user. Because browsers run code sent by multiple sites, there is a danger that one site will (unbeknownst to the user) send a request to a second site, and the second site will mistakenly think that the user authorized the request.
If a user visits an attacker’s website, the attacker can force the user’s browser to send a request to a page that performs a sensitive action on behalf of the user. The target website sees a request coming from an authenticated user and happily performs some action, whether it was invoked by the user or not. CSRF attacks have been confused with Cross-Site Scripting (XSS) attacks, but they are very different. A site completely protected from XSS is still vulnerable to CSRF attacks if no protections are taken. For more background on CSRF, see Shiflett, Grossman, Wikipedia, or OWASP.
We found a vulnerability on ING’s website that allowed additional accounts to be created on behalf of an arbitrary user. We were also able to transfer funds out of users’ bank accounts. We believe this is the first CSRF vulnerability to allow the transfer of funds from a financial institution. Specific details are described in our paper.
We discovered CSRF vulnerabilities in nearly every action a user could perform on YouTube. An attacker could have added videos to a user’s "Favorites," added himself to a user’s "Friend" or "Family" list, sent arbitrary messages on the user’s behalf, flagged videos as inappropriate, automatically shared a video with a user’s contacts, subscribed a user to a "channel" (a set of videos published by one person or group) and added videos to a user’s "QuickList" (a list of videos a user intends to watch at a later point). Specific details are described in our paper.
A vulnerability existed on Metafilter that allowed an attacker to take control of a user’s account. A forged request could be used to set a user’s email address to the attacker’s address. A second forged request could then be used to activate the "Forgot Password" action, which would send the user’s password to the attacker’s email address. Specific details are described in our paper.
(MetaFilter fixed this vulnerability in less than two days. We appreciate the fact that MetaFilter contacted us to let us know the problem had been fixed.)
Status: Not Fixed. We contacted the New York Times in September, 2007. As of September 24, 2008, this vulnerability still exists. This problem has been fixed.
A vulnerability in the New York Time’s website allows an attacker to find out the email address of an arbitrary user. This takes advantage of the NYTimes’s "Email This" feature, which allows a user to send an email about a story to an arbitrary user. This emails contains the logged-in user’s email address. An attacker can forge a request to active the "Email This" feature while setting his email address as the recipient. When a user visit’s the attacker’s page, an email will be sent to the attacker’s email address containing the user’s email address. This attack can be used for identification (e.g., finding the email addresses of all users who visit an attacker’s site) or for spam. This attack is particularly dangerous because of the large number of users who have NYTimes’ accounts and because the NYTimes keeps users logged in for over a year.
Also, TimesPeople, a social networking site launched by the New York Times on September 23, 2008, is also vulnerable to CSRF attacks.
We hope the New York Times will decide to fix these vulnerabilities now that they have been made public. The New York Times appears to have fixed the problems detailed above.
We’ve found CSRF vulnerabilities in sites that have a huge incentive to do security correctly. If you’re in charge of a website and haven’t specifically protected against CSRF, chances are you’re vulnerable.
The academic literature on CSRF attacks has been rapidly expanding over the last two years and we encourage you to see our bibliography for references to other work. On the industry side, I’d like to especially thank Chris Shiflett and Jeremiah Grossman for tirelessly working to educate developers about CSRF attacks.
Comments
OWASP has made two tools available to help with CSRF problems. The first is CSRFTester which will allow you to test your website for CSRF problems. The tool allows you to create multi-step test cases and has been used to transfer funds, create accounts, issue checks, etc…
The second tool is called CSRFGuard, and it’s a Java EE filter that can be placed in front of an entire application to provide CSRF protection. CSRFGuard uses javascript to insert tokens into forms and links, and then validates the token in every request.
It would be helpful if you linked to the plugin on the CodeIgniter forums. I haven’t seen something like this posted, although EL said a while ago that they’re working on some sort of CSRF protection.
I think quite a few people in the community are not aware of the risks or don’t know how to best go about mitigating them. The way I see it, education is a real problem when it comes to webappsec. Since you provide an explanation as well as a solid solution, not even a lazy person can refuse to take a look.
If I am not mistaken, your CI plugin will not prevent a form from being processed if the user’s browser doesn’t accept cookies or the CSRF token cookie has expired. Shouldn’t the plugin reject all form submissions when there’s any token mismatch, including the missing cookie case?
That cookie exception was the result of a tradeoff between security and usability in non-cookie contexts. I agree with you that the plugin should reject all invalid requests, so I’ve changed it to reflect that. Developers concerned about this can disable (or not install) the plugin.
At least to some degree. If you go (on FF3 on windows) Tool>Clear Private Data (ctrl-shift-del) and select cookies and authenticated sessions (or if you’re feeling more paranoid more cache et all) it will take out almost all your logged in sites.
It just takes a commitment to building security into an application before it goes live. If companies like the NYT and ING Direct took a leadership position in being proactive rather than reactive, the rest would hopefully fall into line. Refusing to do business with organizations that don’t take web security seriously is another possible solution.
There is a problem with a static nonce who’s value isn’t checked server side.
I could have some fancy flash forge the headers. Lets say:
COOKIE[‘ci_token’] = csrf
POST[‘password’] = badguy
POST[‘ci_token’] = csrf
By not having a server side check, your ci plugin allows the attacker to set the nonce to whatever he pleases.
By using a variable nonce (or at least a static one) and storing them in the session variables, you can achieve the proposed outcome. I currently allow the last 5 generated tokens in an active session to be used (overwriting the oldest). These tokens expire after a set time even if the session remains active. This allows for user friendly sites (back button) as well as tabbed browsing.
Freedom to Tinker is hosted by Princeton's Center for Information Technology Policy, a research center that studies digital technologies in public life. Here you'll find comment and analysis from the digital frontier, written by the Center's faculty, students, and friends. | 2023-08-13T01:27:04.277712 | https://example.com/article/8649 |
Sudden unexpected death in epilepsy. A nationwide population-based study.
The incidence of sudden unexpected death in epilepsy (SUDEP) varies between studies. We determined the incidence of SUDEP in the entire Icelandic population during a 20-year period. All individuals in Iceland with epilepsy who died unexpectedly from January 1, 1991 through December 31, 2010 were included. Case ascertainment was based on autopsies, reimbursement for antiepileptic drugs, death certificates, information from neurologists, and medical records. The incidence of SUDEP was calculated according to the total number of residents in Iceland during the study period and an estimated epilepsy population of Iceland. We identified 37 individuals (26 men, 11 women) with definite SUDEP (n = 29), definite SUDEP plus (n = 4), and probable SUDEP (n = 4). Incidence of SUDEP was 0.6 per 100 000 person-years for the general population, and higher among men. The estimated incidence of SUDEP in the epilepsy population was 1.3 per 1000 person-years. SUDEP accounted for 0.1% of all deaths in Iceland during the study period. SUDEP is an important cause of death in working-age people. This study provides the incidence of SUDEP in an unselected population of an entire country. The SUDEP incidence in the epilepsy population is comparable to that of previous studies. | 2024-02-03T01:27:04.277712 | https://example.com/article/3971 |
with Howard Dodsley
Nothing fishy to report.
Well, nothing to report as far as fly-caught fish from the Adur. That’s not to say they are not there. There have been a few Bass taken on spinner and repalas. Shoals off schoolies have also been seen feeding in the river.Of cause the Grey Mullet are back so it’s all looking good for the summer. I have been fly fishing on the river but maybe only managing to get down once a week as other projects have kept me occupied. I am happy to say my introduction to casting and fly fishing courses has taken off this season and I’ve working my way through the new learners keen to get into fly fishing which is great news for the sport .I am however still happily taking bookings for summer sessions. Should anyone wish to learn to fly fish or brush up on there skills please use my contact form on the main web page or call me 07754567242. I will be away on a fly fishing trip from June 6th till the 21st. I’ll be exploring the rivers and lakes of central Portugal for wild Carp, Trout, Barble and Black Bass.This a bit of a recce too for possible hosted trips for the future. I’ll let you know how I get on later. Ok folks on with the day job (carpenter) although today I need to crack on and get a coat of paint on my houseboat before the tides come up again. Ps. I’m always interested to hear of local fishing reports so please mail. | 2023-08-11T01:27:04.277712 | https://example.com/article/6985 |
Q:
Effect of compiling from source on already installed applications
I use Ubuntu 12.04. Say I have installed package x from the repository (with all its dependencies) at version 1.7 but I need some functionality that is only available in version 1.8, so I download the source tar and compile it:
./configure
make
make install
Does this overwrite the existing 1.7 binaries?
If the existing binaries are overwritten, does the package manager reflect the new version (1.8) and can package x be updated by the package manager in the future?
If package y has a dependency of package x 1.8 - will it be satisfied?
I have been trying to find a good source online that explains this. If you have any recommendations, please let me know.
A:
The overwhelming majority of .deb packages, whether or not they are provided by official repositories, install with the prefix /usr.
What that means is that executables intended to be run by the user go in /usr/bin or /usr/sbin (or /usr/games if it's a game), shared libraries go in /usr/lib, platform-independent shared data go in /usr/share, header files go in /usr/include, and source code installed automatically goes in /usr/src.
A small percentage of packages use / as the prefix. For example, the bash package puts the bash executable in /bin, not /usr/bin. This is for packages that provide the bare essentials to run in single-user mode (such as recovery mode) and to start multi-user mode (but remember, that often includes functionality to mount some kinds of network shares...in case /usr is a remote filesystem).
A small percentage of .deb packages, mostly those created with Quickly, create a package-specific folder inside /opt and put all their files there. Other than that, most of the time /opt is the location used by software that is installed from an executable installer that does not use the system's package manager but does not involve compiling from source. (For example, if you install a proprietary program like MATLAB, you'll likely put it in /opt.)
In contrast to all of this, when you download a source archive (or get source code from a revision control system such as Bazaar or git), build it, and install it, it usually installs to the prefix /usr/local (unless you tell it to do otherwise). This means your executables go in /usr/local/bin, /usr/local/lib, or /usr/local/games, your libraries in /usr/local/lib, and so forth.
There are some exceptions to this--some programs, by default, install to the /usr prefix and would thus overwrite installations of the same programs from .deb packages. Typically you can prevent this by running ./configure --prefix=/usr/local instead of ./configure when you build them. I again emphasize that usually this is not necessary.
(It is for this reason that it makes very good sense for you to put source code that you are building and will install for systemwide use in /usr/local/src, which exists for that purpose.)
Assuming the packaged version is installed in /usr and the version you installed from source is in /usr/local:
Files from the installed package will not be overwritten.
Typically the newer version will run when you manually invoke the program from the command-line (assuming /usr/local/bin or wherever the executables are installed is in your PATH environment variable and appears before the corresponding /usr-prefixed directory, such as /usr/bin).
But there may be some problems with what launchers are created and made accessible through menus or searching. Furthermore, if you have installed more than one version of a library in different places, it can become a bit more complicated to determine which will be used by what software.
If you're not actually using both versions of the program or library, then often you should remove the one that you're not using, although in limited situations you might want to keep a package installed to satisfy dependencies.
However, if for any reason files are overwritten (for example, if the source code is installed in /usr rather than /usr/local):
The package manager will not know anything about how the software it installed was changed. It will think the old version is installed. Bad problems may result. You should avoid this. If you have created this situation, you should uninstall the software you installed from source (usually with sudo make uninstall in the /usr/local/src/program-or-library-name directory), and then uninstall the package or packages that provide the files that were overwritten (as they will not be restored by uninstalling the version installed from source). Then reinstall whatever version you want to have.
As for fulfilling dependencies:
If there is a .deb package that depends on the software you installed from source, and requires the version you installed from source (or higher), that package will not successfully install. (Or, to be more precise, you may be able to "install" it but it will not ever be "configured" so you will not be able to use it.) Dependencies are resolved by what versions of packages are installed, not by what software you actually have.
Similarly, software will at least try to install completely even if you have manually deleted the files provided by packages on which the software being installed depends. (You should not generally try to harness that for any purpose. The package manager operating based on false information is almost always a bad thing.)
Therefore, if you cannot find a package that provides the version of the software you need, you may need to create your own .deb package from the software you've compiled, and install from that package. Then the package manager will know what is going on. Creating a package for your own use, which you don't need to work well on other people's computers, is actually not very hard. (But I feel that may be outside the scope of your question, as it is currently worded.)
A:
What you install from the software center or with an APT command (apt-get, aptitude) or with dpkg is known to the package management system. dpkg is the low-level package manipulation tool, APT and friends are higher-level tools that invoke dpkg to perform the actual installation and also handle dependencies and package downloads.
If you compile a program from source, it won't be known to the package manager. The convention on Linux, which you should follow on the pain of having a hard time keeping track of things and having your installations overridden, is:
/bin, /lib, /sbin, /usr are reserved to the package manager;
except that /usr/local is for the system administrator — respect the directory hierarchy there, but you're on your own to manage files.
See Best way to upgrade vim/gvim to 7.3 in Ubuntu 10.04? for a list of ways to obtain more recent versions of software. The easiest way is getting a PPA, if there is one. If you get a binary package or compile from source, I recommend using stow to manage your manually-installed software. Alternatively, make your own .deb package — it's more work, but it pays off if you upgrade often (usually redoing the package for the next minor version is very fast) or if you deploy to many machines running the same distribution.
With most programs, if you run ./configure && make && sudo make install, the program is installed under /usr/local. Do check the documentation provided with the source (typically in a file called README or INSTALL) or run ./configure --help to check that this is the case. If the program is installed under /usr/local, it won't interfere with the version provided by the package manager. /usr/local/bin comes first on the system PATH. Note that you'll need to run make install as the administrator (root); do not compile as root. As noted above, I recommend using stow instead of installing directly into /usr/local.
| 2024-05-06T01:27:04.277712 | https://example.com/article/7063 |
1. Field of the Invention
This invention relates to a feeding apparatus. More specifically, the invention relates to a feeding apparatus for feeding a material from a material supply to a further apparatus, particularly to a packaging apparatus.
2. Description of the Prior Art
Packaging apparatus is usually fed from a supply of packaging material, which supply comprises a core upon which the material is wound. Usually the material is in the form of a sheet.
Problems can arise when the material supply is exhausted. When this happens it is necessary to stop feeding the material to the packaging apparatus while the material supply is replenished. This procedure is inefficient because it causes the operation of the packaging apparatus to be interrupted at least for the time it takes to replenish the material supply.
The problem is even more acute with certain types of packaging apparatus, such as packaging apparatus for producing blister packs. In this apparatus the blisters are formed in the material by the application of heat and the amount of heat delivered to the material is carefully controlled. When the material supply is interrupted the material in the packaging apparatus stops moving and becomes overheated, which causes distortion of the material. It may take up to 20 minutes to re-synchronise the apparatus after the feed of the material has been restarted.
One way to solve this problem is to provide a feeding apparatus for the packaging apparatus which includes a storage buffer for the material. This enables the material to be fed to the packaging apparatus from the buffer when the material supply is changed.
A typical storage buffer is shown in U.K. Patent No. 1244066, owned by Industrie-Companie Kleinweffers Plasticmachinen GMbH & Co. K.G. In this specification the storage buffer comprises a plurality of fixed rollers disposed below a plurality of movable rollers. The sheet material is wound alternately between the fixed and movable rollers. The buffer has a sheet material inlet and a sheet material outlet.
When there is an interruption in the feed of material to the inlet, material can still be drawn from the outlet by moving the movable rollers towards the fixed rollers.
The movable rollers are mounted to a carriage which is driven towards and away from the fixed rollers by a hydraulic ram.
Another example of a storage buffer is shown in U.K. Patent Application early publication No. 2168038A, applied for by Harris Graphics Corporation.
In this specification the fixed rollers are arranged at the same level as the movable rollers, and the movable rollers are movable horizontally towards and away from the fixed rollers. The movable rollers are mounted to a carriage which is, movable by means of a drive motor.
In U.K. Patent Application early publication No. 2156319A, applied for by Focke & Co, a further example of storage buffer is shown. In this specification the movable rollers are movable in an arcuate path by a drive motor. This, arcuate path can lead to additional problems in controlling the tension in the material.
The movable rollers are mounted to a carriage in the form of a roller arm. The roller arm is provided with a toothed segment which engages a pinion on the drive motor thereby causing pivotal movement in the roller arm so that the movable rollers move towards the fixed rollers.
In all three of the above specifications careful control is required of the movement of the movable rollers by the hydraulic ram or by the drive motor. In particular it is necessary to synchronise the rate at which the movable rollers are moved with the rate at which material is required by the further apparatus.
In practice, complicated control arrangements are needed to achieve this.
The need for this synchronisation would not be necessary if the drive motor could be dispensed with. However, in all the above specifications, the motor could not be dispensed with because otherwise there would be no way to move the rollers away from one another.
If the fixed rollers are arranged above the movable rollers then it would theoretically be possible for the movable rollers to be drawn toward the feed rollers by the tension in the material. The movable rollers could then move away from the fixed rollers by gravity alone.
However, this arrangement is not found to be practicable because it causes non-uniform tensioning of the sheet material in the storage means. This can upset the uniform feed to the further apparatus and can even cause the material to stretch or break.
Other apparatus is described in U.K. Patent Nos. 1402079 and 1554696, European Patent No. 37752, U.K. Patent Application early publication Nos. 2142609A and 2056953A, and European Patent Application early publication No. 139088A. | 2024-06-18T01:27:04.277712 | https://example.com/article/6491 |
Birt-Hogg-Dubé Syndrome-associated Renal Cell Carcinoma: Histopathological Features and Diagnostic Conundrum.
Birt-Hogg-Dubé (BHD) syndrome is associated with the development of hereditary renal cell carcinoma and is caused by a germline mutation in the folliculin gene. Most cases of BHD syndrome-associated RCC (BHD-RCC) are less aggressive and multifocal. Therefore, it is critical to distinguish BHD-RCC from its sporadic counterparts to identify and monitor affected families and to preserve renal function as long as possible. The World Health Organization/International Society of Urological Pathology consensus classification defined distinct entities for certain hereditary RCCs; however, BHD-RCC was not included in this classification. Although the clinical features and molecular mechanisms of BHD-RCC have been investigated intensively over the last two decades, pathologists and urologists occasionally face difficulties in the diagnosis of BHD-RCCs that require genetic testing. Affected patients usually have miscellaneous benign disorders that often precede renal carcinogenesis. In the present review, we summarize the current understanding of the histopathological features of BHD-RCC based on our epidemiologic studies of Japanese families and a literature review. The pathological diagnostic clues and differential diagnosis of BHD-RCC from other hereditary RCCs are also briefly discussed. | 2023-10-31T01:27:04.277712 | https://example.com/article/9412 |
PROJECT SUMMARY ? Administrative Core The Administrative Core is responsible for organizing and supporting three research projects and three scientific cores in this Program. The Core provides leadership, infrastructure, and support personnel to facilitate administrative management; promote integration, communication, and collaboration; ensure fiscal and regulatory compliance; and oversee data operations, scientific rigor and research progress. The Administrative Core will oversee the Program's organizational infrastructure and day-to-day administrative activities; serve as the liaison with all internal and external constituencies; provide clerical support for document preparation; foster team science by facilitating collaboration and communication through regular meetings, seminars, and other interactions; provide fiscal management to ensure timely financial accounting and reporting according to university and NIH policies; provide regulatory support to ensure compliance with institutional, state, and federal research guidelines; oversee data operations to ensure use of best practices for data provenance and integrity (e.g. monitoring standards such as SOPs, GCP, GMP); provide scientific management by monitoring research progress/productivity and effective use of shared resource cores relative to scientific milestones and budgeted expenditures; conduct rigorous Program evaluations, with guidance and direction provided by Internal and External Advisory Boards; manage resource sharing and conflict resolution; and delineate specific publication and data distribution policies. By serving these functions, the Administrative Core reduces administrative burden, allowing the Program investigators to focus on developing novel immunotherapies for patients with glioblastoma (GBM). | 2023-12-10T01:27:04.277712 | https://example.com/article/8331 |
so in projecting you claim that your conscience leaves your body and you move freely about the world without being hindered by time or the physical?
Well the people who practice it claim that there are different 'planes' of existence, and when you project, you are on a different plane--so yes, they claim that you can actually go places you've never been and actually see what is there.. they also claim that you can even meet other people who are projecting.
I've seen stories of people claiming it to be true and providing "proof". They would have someone write something on paper, and then project there and tell the person what they wrote.. but I read these stories online, so who knows if it's true or not.
I find myself every night in the middle of a hellhole. I find my self fighting battle after battle...I don't know what against, but every night I find myself hunkered down in the trenches, I run, my rifle blazing in the deep, moonless land. Other times, I find myself talking to people and in places I should know, but don't.
Is the life I'm living now a dream. Is it all hopeless? I can't figure it out, and I'm so confused. Life...life is nothing more than suffering...pain. Maybe? Perhaps this life is a dream...
War...war never changes. It\'s sad, that we as people cannot learn to benefit from its lessons, that our history inevitably repeates itself. | 2024-05-27T01:27:04.277712 | https://example.com/article/3491 |
Processable aqueous dispersions of graphene nanosheets.
Graphene sheets offer extraordinary electronic, thermal and mechanical properties and are expected to find a variety of applications. A prerequisite for exploiting most proposed applications for graphene is the availability of processable graphene sheets in large quantities. The direct dispersion of hydrophobic graphite or graphene sheets in water without the assistance of dispersing agents has generally been considered to be an insurmountable challenge. Here we report that chemically converted graphene sheets obtained from graphite can readily form stable aqueous colloids through electrostatic stabilization. This discovery has enabled us to develop a facile approach to large-scale production of aqueous graphene dispersions without the need for polymeric or surfactant stabilizers. Our findings make it possible to process graphene materials using low-cost solution processing techniques, opening up enormous opportunities to use this unique carbon nanostructure for many technological applications. | 2024-05-24T01:27:04.277712 | https://example.com/article/8401 |
package testdata
var CreateStringCode = `// CreateFromStringT initializes t from the fields of v
func (t *StringType) CreateFromStringT(v *testdata.StringT) {
temp := &StringType{
String: &v.String,
}
*t = *temp
}
`
var CreateStringRequiredCode = `// CreateFromStringT initializes t from the fields of v
func (t *StringType) CreateFromStringT(v *testdata.StringT) {
temp := &StringType{
String: v.String,
}
*t = *temp
}
`
var CreateStringPointerCode = `// CreateFromStringPointerT initializes t from the fields of v
func (t *StringType) CreateFromStringPointerT(v *testdata.StringPointerT) {
temp := &StringType{
String: v.String,
}
*t = *temp
}
`
var CreateStringPointerRequiredCode = `// CreateFromStringPointerT initializes t from the fields of v
func (t *StringType) CreateFromStringPointerT(v *testdata.StringPointerT) {
temp := &StringType{}
if v.String != nil {
temp.String = *v.String
}
*t = *temp
}
`
var CreateExternalNameCode = `// CreateFromExternalNameT initializes t from the fields of v
func (t *ExternalNameType) CreateFromExternalNameT(v *testdata.ExternalNameT) {
temp := &ExternalNameType{
String: &v.String,
}
*t = *temp
}
`
var CreateExternalNameRequiredCode = `// CreateFromExternalNameT initializes t from the fields of v
func (t *ExternalNameType) CreateFromExternalNameT(v *testdata.ExternalNameT) {
temp := &ExternalNameType{
String: v.String,
}
*t = *temp
}
`
var CreateExternalNamePointerCode = `// CreateFromExternalNamePointerT initializes t from the fields of v
func (t *ExternalNamePointerType) CreateFromExternalNamePointerT(v *testdata.ExternalNamePointerT) {
temp := &ExternalNamePointerType{
String: v.String,
}
*t = *temp
}
`
var CreateExternalNamePointerRequiredCode = `// CreateFromExternalNamePointerT initializes t from the fields of v
func (t *ExternalNamePointerType) CreateFromExternalNamePointerT(v *testdata.ExternalNamePointerT) {
temp := &ExternalNamePointerType{}
if v.String != nil {
temp.String = *v.String
}
*t = *temp
}
`
var CreateArrayStringCode = `// CreateFromArrayStringT initializes t from the fields of v
func (t *ArrayStringType) CreateFromArrayStringT(v *testdata.ArrayStringT) {
temp := &ArrayStringType{}
if v.ArrayString != nil {
temp.ArrayString = make([]string, len(v.ArrayString))
for i, val := range v.ArrayString {
temp.ArrayString[i] = val
}
}
*t = *temp
}
`
var CreateArrayStringRequiredCode = `// CreateFromArrayStringT initializes t from the fields of v
func (t *ArrayStringType) CreateFromArrayStringT(v *testdata.ArrayStringT) {
temp := &ArrayStringType{}
if v.ArrayString != nil {
temp.ArrayString = make([]string, len(v.ArrayString))
for i, val := range v.ArrayString {
temp.ArrayString[i] = val
}
}
*t = *temp
}
`
var CreateObjectCode = `// CreateFromObjectT initializes t from the fields of v
func (t *ObjectType) CreateFromObjectT(v *testdata.ObjectT) {
temp := &ObjectType{}
if v.Object != nil {
temp.Object = transformTestdataObjectFieldTToObjectField(v.Object)
}
*t = *temp
}
`
var CreateObjectRequiredCode = `// CreateFromObjectT initializes t from the fields of v
func (t *ObjectType) CreateFromObjectT(v *testdata.ObjectT) {
temp := &ObjectType{}
if v.Object != nil {
temp.Object = transformTestdataObjectFieldTToObjectField(v.Object)
}
*t = *temp
}
`
var CreateObjectExtraCode = `// CreateFromObjectExtraT initializes t from the fields of v
func (t *ObjectType) CreateFromObjectExtraT(v *testdata.ObjectExtraT) {
temp := &ObjectType{}
if v.Object != nil {
temp.Object = transformTestdataObjectFieldTToObjectField(v.Object)
}
*t = *temp
}
`
var CreateAliasConvert = `// Service service type conversion functions
//
// Command:
// goa
package service
import (
aliasd "goa.design/goa/v3/codegen/service/testdata/alias-external"
)
// CreateFromConvertModel initializes t from the fields of v
func (t *StringType) CreateFromConvertModel(v *aliasd.ConvertModel) {
temp := &StringType{
Bar: &v.Bar,
}
*t = *temp
}
`
var MixedCaseConvert = `// Service service type conversion functions
//
// Command:
// goa
package service
import (
external "goa.design/goa/v3/codegen/service/testdata/external"
)
// CreateFromMixedCaseModel initializes t from the fields of v
func (t *StringType) CreateFromMixedCaseModel(v *external.MixedCaseModel) {
temp := &StringType{
LowerCamelID: &v.LowerCamelID,
UpperCamelID: &v.UpperCamelID,
SnakeID: &v.SnakeID,
}
*t = *temp
}
`
| 2024-05-08T01:27:04.277712 | https://example.com/article/3065 |
AMHERST, Mass. -
The stars were out in full force in Friday night at the Curry-Hicks Cage. In addition to look-a-like Britney Spears, Kevin Federline, Ugly Betty and Courtney Love, the UMass basketball teams made their 2007-08 debuts. Gary Forbes won the slam dunk contest while Stefanie Gerardot took home the 3-point shooting crown. A crowd of 3,174 looked on the teams were introduced in Hollywood style. The women were welcomed through the stands as stars while the men made a grand entrance on the red carpet from limos.
Luke Bonner stole the show as the 7-1 center came out the limo and did four flips on the red carpet before landing and making his entrance. Other players were mobbed by fans and paparazzi as they entered the Cage.
Head Coach Travis Ford made a grand entrance as he was escorted by Army cadets.
The night was fun for all featuring celebrity look-a-like contests, 2-ball contests for fans, free new cheddar melt pizza from Domino's, t-shirts, popcorn.
The dance team and cheerleaders performed throughout as well in addition to an appearance by Sam The Minutemen.
The night finished with the men's team scrimmaging. The White team beat the Maroon, 33-18. Senior Dante Milligan looked impressive with several putbacks and strong rebounding. Freshman Max Groebe hit a few shots from outside. | 2024-01-26T01:27:04.277712 | https://example.com/article/8159 |
AIM: To study the effect of artemether (Art) on the tegument of schistosomes. METHODS: Mice infected with S japonicum cercariae for 7 and 35 d, or with S mansoni cercariae for 49 d were treated intragastrically with Art 200-300 mg.kg-1.d-1 for 2 d. Schistosomes were collected in groups of 2 mice at various intervals after medication for scanning electron microscopic observation. RESULTS: The tegumental changes induced by Art appeared to be similar in S japonicum and S mansoni: swelling and fusion of tegumental surfaces, vesicle formation and collapse of discoid-like sensory structures. In S japonicum the emergence of tegumental alterations was earlier in 7-d-old schistosomulae than that in 35-d-old adult worms. CONCLUSION: Art injured the teguments of S japonicum and S mansoni. | 2024-07-04T01:27:04.277712 | https://example.com/article/5734 |
Olive leaves are a source of a number of beneficial compounds. For example, they are known to comprise oleuropein, which is potent antioxidant and has been shown to have antibacterial, antiviral and antifungal activity. Oleuropein has also been shown to lower blood pressure and inhibit the oxidation of lipids in the blood, thereby lowering the risk of cardiovascular disease. Additional health promoting compounds found in olive leaves include luteolin-7-glucoside, verbascoside, and apigenin-7-glucoside. Olive leaves also contain anti-cancer compounds, such as apigenin and luteolin, as well as the anti-malarial agent cinchonine.
Olive leaf extract also has anti-inflammatory, as well as antiseptic properties. Evidence suggests that olive leaf extract may protect against nerve damage, and may be of value in cases of stroke. Both the leaves and the bark can be used to treat fever.
Olive leaf extracts are useful for the treatment of some skin conditions. Olive leaf extracts have been shown to promote wound healing, prevent the growth of skin cancer cells, and protect against sun damage.
In view of the many health benefits provided by olive leaves, there is a recognized need for preparing olive leaf products for use in food, pharmaceutical, cosmetic, and antimicrobial products. The present invention addresses these and other needs. | 2024-03-27T01:27:04.277712 | https://example.com/article/3273 |
<?php
/**
* Copyright © OXID eSales AG. All rights reserved.
* See LICENSE file for license details.
*/
namespace OxidEsales\EshopCommunity\Tests\Unit\Core;
use \oxRegistry;
class UtilsstringTest extends \OxidTestCase
{
public function testPrepareCSVField()
{
$this->assertEquals('"blafoo;wurst;suppe"', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareCSVField("blafoo;wurst;suppe"));
$this->assertEquals('"bl""afoo;wurst;suppe"', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareCSVField("bl\"afoo;wurst;suppe"));
$this->assertEquals('"blafoo;wu"";rst;suppe"', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareCSVField("blafoo;wu\";rst;suppe"));
$this->assertEquals('', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareCSVField(""));
$this->assertEquals('""""', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareCSVField("\""));
$this->assertEquals('";"', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareCSVField(";"));
}
public function testMinimizeTruncateString()
{
$sTest = "myfooblatest";
$this->assertEquals("myf", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 3));
$this->assertEquals("", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 0));
$this->assertEquals("myfooblatest", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 99));
$sTest = " my,f,, o o bl at ,, ,,est, ";
$this->assertEquals("my", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 3));
$this->assertEquals("my,f", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 4));
$this->assertEquals("", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 0));
$this->assertEquals("my,f,, o o bl at ,, ,,est", \OxidEsales\Eshop\Core\Registry::getUtilsString()->minimizeTruncateString($sTest, 99));
}
public function testPrepareStrForSearch()
{
$this->assertEquals(' ä ö ü Ä Ö Ü ß &', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareStrForSearch(' ä ö ü Ä Ö Ü ß &'));
$this->assertEquals(' häuser', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareStrForSearch(' häuser'));
$this->assertEquals('', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareStrForSearch('qwertz'));
$this->assertEquals('', \OxidEsales\Eshop\Core\Registry::getUtilsString()->prepareStrforSearch(''));
}
}
| 2024-03-12T01:27:04.277712 | https://example.com/article/5100 |
By Anisha Bijukumar | The Peninsula
UPDATE: Today (September 27) the World is marking the World Tourism Day. Did you know that Qatar has 12 land reserves and 2 marine reserves. Here is a story we did sometime back about Qatar's nature reserve.
Doha: In a tweet on its social media Ministry of Municipality and Environment (Baladiya) released the statistics of nature reserve in Qatar.
As per the records, Qatar has 23.6 per cent nature reserve, which is protected area of importance for wildlife, flora, or fauna. Approximately 3,464 sq km of the country's area is protected reserve.
Khor Al Odeid. Credit: visitqatar.qa
The country has 12 land reserves and 2 marine reserves of which Khor Al Odeid or 'Inland Sea' is the biggest nature reserve. Khor Al Odeid is a UNESCO recognised natural reserve which is one of Qatar's most impressive natural wonders.
Al Dosari Zoo, Credit: vistqatar.qa
This is one of the few places in the world where the sea encroaches deep into the heart of the desert. This is the reason that Khor Al Odeid is also one of two marine reserves that the country has. The second marine reserve being Al Dakhira.
Brouq nature reserve. The Peninsula
The Environment Ministry has developed a strategic plan to preserve the natural environment in the country. The officials frequently conduct checks to monitor violations and ensure that endangered species of plants and animals are not harmed.
Some of the other nature reserves in Qatar are:
Al Shahaniya (Al Dosari Zoo and Game Reserve), popular for Arabian oryx and Arabian Goitered gazelle - Nubian ibex
(Al Dosari Zoo and Game Reserve), popular for Arabian oryx and Arabian Goitered gazelle - Nubian ibex Khor Al Odeid
Al Qurum
Al Dakhira
Al Reem reserve, represents almost all the quarter northwest of Qatar, where oryx and Arabian gazelles can be spotted.
represents almost all the quarter northwest of Qatar, where oryx and Arabian gazelles can be spotted. Al Ariq
Al Wasil
Al Masshabiya , Arabian oryx can be found
, Arabian oryx can be found Brouq
Al Rafaa | 2023-09-20T01:27:04.277712 | https://example.com/article/6675 |
The psychopharmacology of aggression: toward a new day.
Psychiatrists should reconsider the use of neuroleptics and benzodiazepines as the primary treatment for aggressive behavior, as these drugs do not have a specific anti-aggressive effect. They reduce aggression often at the cost of grave side effects (e.g., tardive dyskinesia, akathisia, and cognitive dulling). Newer regimens such as beta-blockers, serotonin-agonists and serenics have fewer side effects, and do not negatively affect cognitive or attentive functions, allowing for more effective rehabilitation of the patient. These drugs are more specific, and positively influence the four axes of cognition, attention, arousal, and mood regulation, which, if unbalanced, can lead to a higher "noise" level, and thus increased agitation and aggression. | 2023-12-20T01:27:04.277712 | https://example.com/article/1235 |
The Law of Attraction: A Student’s Guide to Manifestation
We, as humans, are not only subject to the powers of our universe but also have the internal and external resources to attract whatever we’re putting our time and effort into. The power of the energy we project determines the power we receive in return. To make this concept seem a little less intangible, I will be talking about my understandings of the Law of Attraction and manifestation, a (kinda) simple guide to achieving your intentions, a how-to on the application of the Law of Attraction in college, as well as my own experiences with manifestation.
What is the Law of Attraction
Though it means something different to everyone, my understanding of the Law of Attraction comes from the belief that the energy we put out into the universe will come back to us with its original intent. The Law of Attraction, by definition, suggests that focusing on positive or negative thoughts can bring positive or negative experiences into your life. As such, manifestation occurs when our thoughts reflect our realities. I believe that these concepts, though admittedly subjective, are logical by nature and can be achieved through a series of phases.
Guide for Effective Manifestation
1. The first phase in successful manifestation is believing in the process through which you wish to achieve your intentions. I suggest doing some research of your own to find YOUR reason for manifesting. Creating your own perception of the Law of Attraction is important because manifesting is dependent on dedication. If you don’t believe in the processes of manifestation, it is less likely, as the Law of Attraction itself hypothesizes.
2.The second phase is establishing your intention or intentions (the more the merrier). This can be as simple as making a list (I’m a big list gal) or talking positively with the people in your life about your goals. Using definite language like “I will” as opposed to “I want to” not only empowers you to accomplish these goals, but also serves as reassurance that your intentions have the potential to become realities.
3. The third phase relates to the first in that you must BELIEVE that your intentions will be actualized. And though no one can tell you how or what to believe, I recommend reflecting on your intentions every day to increase your confidence in their actualization. Consistent reflection is essential because the more energy you put into your “new reality,” the more likely you are to manifest this reality. Science.
4. The fourth phase is dependent on your ability to make choices that will guide you towards achieving your intentions. The best advice I can give you is to allow yourself to experience things that align with these intentions. Find that balance between taking risks and trusting yourself to accept opportunities that will allow you to reach your goals. I genuinely believe that everything happens for a reason and, if your intention is meant to be, it will happen.
5. The fifth phase is all about evaluating your growth, whether personal, professional or otherwise, and recognizing your progress towards or achievement of your intentions. Evaluation, by its humblest nature, will teach you the value of your own imagination and can motivate you to manifest more. Though you do not have to quantify your achievements, recording your thoughts in a journal and regular self-reflection makes this progress tangible.
6. The sixth, and final phase, is practicing gratitude for attracting your intentions. Potentially, this is the most important phase as it marks a cycle of manifestation and can, when done with acceptance, foster the success of future intentions. Give yourself the praise you deserve, whether that means doing a face mask or taking some time for yourself to reflect, and allow yourself to visualize the life you want through the repetition of these phases.
How to apply the Law of Attraction in College
Though the Law of Attraction can be relevant for anyone, my experience has taught me that manifestation is especially beneficial for college students, like myself. As students, we are constantly applying for jobs and internships, balancing challenging classes with busy social lives,and loading our resumes with on- and off-campus involvement,all of which require energy. So why not direct that energy into bettering ourselves? I use the phases I have provided above on the daily and have seen progress in each and every part of my life because of them. The power of manifestation has truly changed the way I perceive success, and can work for you too.
My Experience with Manifestation
I’ve been familiar with manifestation for a while, but it wasn’t until my senior year of high school when I began applying to colleges, that I recognized the power the Law of Attraction had in shaping the life that I wanted. After a ton of research, I began to realize that the moment my intentions become more than the contents of my passion planner or iPhone notes, they developed the ability to shape the progression of my life. If I tried to describe the opportunities that my understanding of manifestation has provided me, this article would morph into a thesis, but these concepts have truly made me more aware of myself, the world around me and the infinite world within me. While taking accountability for the progression of our own lives can be intimidating, especially in college, the more time you dedicate to understanding the rationality of your own energy, the more gratifying your life can become.
Grace is a junior at THE Florida State double majoring in Media Communication Studies and Editing, Writing, & Media in hopes of pursuing a career in Media Relations. She is an avid reader, writer and podcast connoisseur, loves to travel, and is a self-proclaimed master planner. | 2023-08-29T01:27:04.277712 | https://example.com/article/5612 |
Though it also branched out into film production - with the likes of 1976's The Eagle Has Landed and 1982's The Dark Crystal - ITC was best known throughout the 1960s and '70s for its raft of cult TV programming, with shows like The Champions making an indelible screen icon of Bastedo and others like her.
Founded by legendary television mogul Lew Grade, ITC Entertainment started life in 1954 and one of its earliest television efforts was the spy show Danger Man - retitled Secret Agent for US broadcast.
The precursor - and some believe actual prequel - to ITC's later series The Prisoner, Danger Man starred Patrick McGoohan as international agent John Drake and aired four series throughout the '60s (the first in a half-hour drama format, the following three as more traditional hour-longs).
Possibly ITC's best known series, this adaptation of Leslie Charteris's thriller novels cast Roger Moore as suave Simon Templar - a Robin Hood for the modern age. Running for a total of six series - four in black-and-white, two in colour - The Saint made Moore an international idol and sent him on the path to big-screen stardom as James Bond.
A quasi-sequel Return of the Saint was also co-produced by ITC in the late '70s, with Ian Ogilvy stepping in for Moore.
The aforementioned Alexandra Bastedo starred opposite square-jawed leads Stuart Damon and William Gaunt in this adventure series, which followed three secret agents endowed with special abilities - including enhanced strength and telepathy - by a mysterious civilisation in the Himalayas.
Devised as a replacement for Danger Man, spy thriller Man in a Suitcase starred US lead Richard Bradford as CIA agent turned private eye McGill. At the time, the show was notorious for being ITC's most violent series to date, though it's now better remembered for Ron Grainer's spectacular theme tune - famously co-opted by Chris Evans for his late '90s entertainment series TFI Friday.
Department S (1969-70)
Following the exploits of a fictional Interpol department, this ITC outing featured Peter Wyngarde as the flamboyant Jason King - one of the less-cited inspirations for the Austin Powers movies. So popular was the character of King that he was later handed his own eponymous series, which originally aired from 1971 to 1972.
Randall and Hopkirk (Deceased) (1969-70)
One of ITC's more fantasy-fuelled efforts, Randall and Hopkirk (Deceased) was an unorthodox 'buddy cop' series. Kenneth Cope starred as Marty Hopkirk, a private detective murdered in a hit-and-run who returns to Earth as a ghost to aid his partner - Mike Pratt's straight-shooting Jeff Randall - in catching the killer.
The end of an era - The Persuaders! was even billed "the last major entry in the cycle of adventure series that began 11 years earlier with Danger Man in 1960".
Roger Moore returned to ITC to play aristocrat and playboy Brett Sinclair, who teams with rough diamond Danny Wilde (Tony Curtis) to fight injustice. Featuring glamorous international locations and flashy sports cars, The Persuaders! was every bit as bold and dynamic as its leading men.
Are you a fan of ITC Entertainment's output? Did you know the shows but not their source? Let us know below! | 2023-08-13T01:27:04.277712 | https://example.com/article/7883 |
System operators generally use two main criteria for ensuring reliability: reserve margin and loss-of-load expectation (LOLE). “Reserve margin” is simply the difference between the generating capacity available to serve an area and the expected peak demand divided by the peak demand. It is measured in percent. NYISO plans for the NYCA to keep a reserve margin of at least 18 percent.
LOLE is more complicated but more meaningful. It measures the predicted frequency, in days per year, that the bulk power system will not meet the expected demand for electricity in one or more zones in New York State, even if only for a short time. Equipment failures in the power system (i.e., generators and the high-voltage transmission grid together) can force part of the load on the bulk power transmission system to be involuntarily disconnected. LOLE does not include the more frequent cause of blackouts for customers that are associated with failures of the local distribution system due, for example, to falling tree limbs and ice storms.
The North American Electric Reliability Council recommends a reliability standard of LOLE less than 0.1, and this standard has been adopted for the region by the Northeast Power Coordinating Council, and in turn by the New York State Reliability Council. In other words, there must be sufficient generation and transmission capability in the system that a failure to serve load somewhere in the bulk power system would be expected not more than on 1 day in 10 years. The LOLE criterion is central to the discussion of reliability in this chapter. See also Chapter 1 for a discussion of reliability.
TABLE 5-1 NYISO Base Case Peak Load and Known New York Control Area (NYCA) Resources
aFor the calculation of reserve margin and loss-of-load expectation (LOLE), NYISO adjusted installed NYCA generating capacity downward for contracted sale of hydropower outside the NYCA and for wind power (because wind cannot be counted on during peak demand). “Resources” include the adjusted NYCA generating capacity plus Special Case Resources (SCRs, 975 MW) and Unforced Delivery Rights (UDRs, 990 MW). SCRs are agreements between NYISO and large electricity consumers (e.g., industrial companies) that will reduce load at NYISO’s order. This is one of the emergency steps available to NYISO to avert outages. UDR corresponds to the two high-voltage direct current (HVDC) cables into Long Island, the Cross Sound Cable from New England (330 MW), and the Neptune Cable from New Jersey (660 MW scheduled for 2007). It is power that is expected to be available and is thus included by NYISO for planning purposes.
bReserve margin without the 1,965 MW of SCR and UDR, as plotted in Figure 4-1 in Chapter 4 of this report. Assumptions on allowable resources make a large difference in the calculated reliability.
SOURCE: NYISO (2005b, p. 39).
2,250 MW would be needed. All of these projections are based on Indian Point remaining in service (NYISO, 2005a).
NYISO has solicited proposed market-based or regulated solutions from participants and stakeholders in the NYCA market. The solicitations provide that “Proposed solutions may take the form of large generating projects, small generation projects including distributed generation, demandside programs, transmission projects, market rule changes, operating procedure changes, and other actions and projects that meet the identified reliability needs (NYISO, 2005c).”
Figure 5-1 shows projected NYCA LOLEs for the Base Case and the thermal constraint case (the top and bottom lines). It also shows two other analyses: if load increases faster than expected, and if power is constrained from flowing from upstate New York through New England and back to southeast New York. Both these assumptions adversely affect reliability to a significant extent compared to the thermal constraint case. All the analyses show that LOLE will violate the criteria limit of 0.1 in the 2008-2010 time frame.
THE COMMITTEE’S REFERENCE CASE
The committee adopted a Reference Case (with Indian Point still operating), similar to the NYISO Sensitivity Case with thermal transmission limits controlling.1 The Reference Case includes two assumptions that differ from the NYISO case: (1) it includes constraints on the flow of power from upstate New York through New England and back to southeast New York, an assumption that NYISO did not apply in its final RNA/CRPP for the thermal sensitivity case; and (2) it used actual, though inactive, proposals for generating stations for additional capacity to meet demand, rather than NYISO’s standard 250 MW plants located wherever they were needed. The committee used these as illustrative capacity additions to demonstrate the changes required to meet or exceed the LOLE requirements for balancing the electrical system. While there is no assurance that these projects will be built, presumably the developers would not have proceeded as far as they did without a reasonable expectation that the sites were viable, that fuel and transmission access would be available, and that all permits would be attainable (several have been permitted under Article X).2 In addition, one generic plant was included, with 580 MW. Other options could be selected along with alternative timing, but the
1
The committee believes that the essential corrections to reactive power would most likely be made in a timely manner, and that thermal transmission constraints would ultimately dictate system reliability and thus the additional compensatory resources required.
2
The committee does not endorse any of these projects, nor did it analyze the financial viability of any of them; they are simply assumed to be in the generating fleet when needed in the reliability calculation. None of them is under construction. Several of them have been, or may be, canceled, although other generating companies might acquire the sites and reactivate the projects.
Bookmark this page
Important Notice
As of 2013, the National Science Education Standards have been replaced by the Next Generation Science Standards (NGSS), available as a print book, free PDF download, and online with our OpenBook platform. | 2023-12-01T01:27:04.277712 | https://example.com/article/4543 |
1st Battalion, Royal Australian Regiment
1st Battalion, Royal Australian Regiment (1 RAR) is a regular motorised infantry battalion of the Australian Army. 1 RAR was first formed as the 65th Australian Infantry Battalion in 1945 and since then has been deployed on active service during the Korean War, the Malayan Emergency, the Vietnam War and more recently in Somalia, East Timor, Iraq and Afghanistan. Additionally, the battalion has deployed on peacekeeping operations to a number of countries including Japan, East Timor and the Solomon Islands. In 2006, 1 RAR was one of the Australian Army's most heavily deployed units sending detachments to Iraq as part of SECDET, Tonga, the Solomon Islands and Timor Leste. The battalion is currently based at Townsville, Queensland, where it forms part of the 3rd Brigade.
History
Formation
With the conclusion of the war in the Pacific in 1945, Australia was committed to provide troops for occupation duties in Japan. This commitment led to the formation of the 34th Australian Infantry Brigade. The brigade was made up of three battalions: the 65th, 66th and 67th Australian Infantry Battalions. On 12 October 1945 the 65th Battalion, later the 1st Battalion was formed out of 7th Division at Balikpapan and quickly sailed to Morotai from where they undertook training prior to being sent to Japan as part of the British Commonwealth Occupation Force.
In line with the formative plan to raise an Interim Army, the battalions were re-designated as of the Australian Regiment in 1948 and the 65th Battalion became the 1st Battalion, Australian Regiment. On 31 March 1949 the regiment received the prefix "Royal", becoming the Royal Australian Regiment. 1 RAR was initially based at Ingleburn, but later moved to Enoggera and Holsworthy and is now based at Lavarack Barracks, Townsville.
Occupation of Japan
Under an agreement signed between the Allied nations, Australia would contribute troops towards the occupation of Japan. The Australian contribution was a brigade element, the 34th Brigade, consisting of three infantry battalions each with their own area of responsibility. By the middle of June 1946 the Australian brigade was in place, with the 65th Battalion located at Fukuyama–Onomichi, south of Osaka. The battalion was charged with enforcing the directives of the Supreme Commander for the Allied Powers, which involved various tasks such as ceremonial duties, escorting displaced persons, restoring law and order and overseeing the disarmament process. During this time they participated in the search and destruction of wartime materials. The operation was a dangerous one, the area was honeycombed with caves and tunnels and large quantities of explosives, ammunition and poison gas were discovered.
In April 1946 the battalion took part in the surveillance of Japanese elections. The battalion also kept a close watch on a number of repatriation centres in the area. At the end of 1948, the 1st Battalion left Japan, while all Australian troops had left Japan by 1951 with the signing of the San Francisco Treaty.
Korea
1RAR was in Australia when the Korean War began in 1950; however, the battalion was not deployed immediately as Australia's initial commitment consisted of 3RAR. In 1951, in anticipation of deployment to Korea, 1RAR was brought up to strength with volunteers from 2RAR and new enlistments from the 'K' Force recruiting campaign which brought a large number of men with experience from World War II into the battalion. In September 1951 the battalion received orders to move to Korea and after a farewell march through Sydney 1RAR departed for Japan on 18 March 1952 onboard HMAS Devonshire. After a period of training in Japan, 1RAR arrived in South Korea on 6 April 1952, joining the 28th Brigade on 1 June. On 19 June 1952 1 RAR moved into the line taking over from the 1st Battalion, Royal Leicesters.
In July 1952 1RAR was detached to the 29th Brigade, relieving other battalions on Hills 159, 210 and 355. It took part in general patrolling along the Jamestown Line, which involved securing defences, repairing minefield fences, and undertaking reconnaissance of enemy positions to gather information on them. Other major operations that 1RAR took part in usually aimed at capturing a prisoner or destroying enemy defences. Operation Blaze was 1RAR's first major action, which involved an attack on Hill 227 in order to capture a prisoner. The attack failed in its objective and the battalion suffered four killed and 33 wounded in action.
On the night of 13–14 September the battalion captured its first prisoner as it continued to conduct patrolling operations. By the end of the month 1 RAR was relieved and whilst one company was detached to 1st Battalion, Welsh Regiment to occupy the Yong Dong hill feature the rest of the battalion was placed into the brigade reserve. This lasted until November when as part of Operation Nescala, 1RAR relieved the 1st Battalion, Royal Canadian Regiment on Hill 355. The position had been poorly maintained and over the course of the next ten days 1 RAR had to regain control of the approaches and re-establish security in the area, suffering 50 casualties in the process. At the same time, the battalion also supported the Royal Fusiliers in Operation Beat Up by launching a diversionary attack on Hill 227 on 25–26 November 1952.
On the night of 11–12 December 1952 1RAR was involved in Operation Fauna, which was only a partial success as the Australians failed to capture a prisoner, although they did manage to destroy an enemy position. The battalion suffered 22 wounded and three missing as a result of this action. Operation Fauna turned out to be 1RAR's last action of the war was they were relieved by 3RAR on 29 December 1952. On 21 March 1953, 1RAR was relieved by 2RAR at Camp Casey, near Tongduchon, and returned to Australia later that month on the MV New Australia. The battalion suffered 42 killed and 107 wounded during the nine months that they served on combat operations in Korea, however, 1RAR members also received the following decorations: two Distinguished Service Orders, two Officers of the Order of the British Empire, three Members of the Order of the British Empire, seven Military Crosses, one British Empire Medal, 21 Mentions in Despatches and three Commander-in-Chief Commendations.
In April 1954, 1RAR returned to Korea as part of the UN forces stationed in the country after the armistice, and was involved in training and border patrols. It would remain there until March 1956.
Malaya
In response to the Malayan Communist Party's push to convert Malaya into a Communist state and increasing civil unrest the British Commonwealth Far East Strategic Reserve was established, with Australia contributing a rotating battalion group. On 20 September 1959, the battalion embarked on MV Flaminia for Malaya. After arriving at Singapore the battalion trained at Kota Tinggi and moved to base camps at Kuala Kangsar, Sungei Siput, Lasah, Lintang and Grik where they undertook a month of acclimatisation. The battalion began Operation Bamboo on 16 November 1959 in the Thai/Malay border area in Perak, relieving the 1st Battalion, The Loyal Regiment. For the next 18 months 1RAR operated in area of dense jungle searching for the elusive Communist terrorists (CTs).
The area was largely inaccessible except by helicopter, boat or on foot. Platoon sized patrols would be sent for three week long search operations before returning to the base camps for ten days rest. Even though there were 117 official 'finds' during these operations, no kills were recorded by the battalion at this time as the CTs began to negate the Australian patrols by crossing the border into Thailand where they could not be followed. In April 1960 1RAR took part in Operation Magnet, which involved FESR units crossing the border for the first time in the conflict in an attempt to drive the CTs back into Malaya where other units were ready to carry out ambushes upon them. Later in June, Operation Jackforce was launched, using similar tactics and during this 1RAR finally was involved in one contact.
In July 1960, the Malayan Emergency was officially declared over, although 1RAR remained on operations until the following year when it was withdrawn and began a period of intensive training as part of the FESR, including a number of brigade level exercises. On 29 October 1961, the battalion left Penang for Sydney on the MV Flaminia, having suffered two men killed in action. The battalion returned to Malaysia in early 1969, after two major exercises, 'Jumping Wallaby' and 'Sheer Hell', the unit withdrew from Malaysia, joining the Selarang garrison in Singapore in December 1969. The unit remained in Singapore until July 1971 when it returned to Lavarack Barracks in Townsville.
Vietnam
Two tours of Vietnam were completed by 1 RAR during the Vietnam War, the first one being between March 1965 and June 1966 and the second between April 1968 and February 1969. In March 1965 advanced elements of 1 RAR deployed for Vietnam by charter aircraft, whilst the rest of the battalion followed later on HMAS Sydney. The battalion arrived at Bien Hoa Air Base in June and was placed under command of the US 173rd Airborne Brigade, becoming the first Australian unit to serve in a US formation. Initially, the Australian contingent was restricted only to providing security to the airbase, however, these limitations were later removed by the Australian government and in September 1965 began conducting offensive operations against the Viet Cong (VC) including search and destroy missions, security operations and conducting fighting patrols around the Bien Hoa area of operations.
Throughout the remainder of 1965 the battalion conducted a number of operations along with the rest of the 173rd Brigade in areas such as 'Ben Cat', 'War Zone D', and 'The Iron Triangle'. In January 1966 1 RAR took part in Operation Crimp, a search and destroy mission in the Ho Bo Woods, north of Saigon, during which the battalion conducted an air assault and uncovered the Cu Chi tunnel complex which was serving as the underground hideaway for a VC higher command element. A large stockpile of weapons and a large number of documents were found in the tunnel complex which was the deepest and most elaborate system that had been found up to that time.
1RAR continued operations until April 1966, taking part in a number of joint operations with US troops until the arrival of the 1st Australian Task Force. On Anzac Day, as the battalion was preparing to return to Australia, they were visited by Prime Minister Harold Holt. They were finally relieved in June and they returned to Australia that same month.
The battalion's second tour came two years later when it returned to Vietnam, arriving at Nui Dat on 9 April 1968 to relieve 7 RAR. Operating out of Phuoc Tuy Province the battalion was mainly involved in patrols, searches, reconnaissance and security operations before being redeployed in May to an area north of Saigon where throughout April it carried out Operation Toan Thang, which was aimed at cutting off the withdrawal of enemy forces following the Tet Offensive. After conducting two small operations in Long Khanh Province, 1 RAR moved to Fire Support Base Coral. Whilst they were there, the base was attacked twice. The first attack which on the night of 15 May was only a probing attack by a battalion sized element, whilst the second attack came on the night of 16 May 1966, when the base was attacked by a force later identified as the 141st NVA Regiment. After fierce fighting with the help of accurate artillery fire from the 102nd Field Battery the attack was beaten off and on 6 June 1966 the fire base was closed and 1 RAR returned to Nui Dat. Later it was estimated that 162 enemy were killed as a result of Operation Toan Thang.
Between July and September several more operations were carried out including a follow up mission called Operation Toan Thang II that saw the battalion move to the Bien Hoa–Long Khanh border and conduct sweeps through the Hat Dich, Tua Tich and Ba Ria areas. Between 28 September and 12 October, 1 RAR was once again sent into the Hat Dich area when they undertook Operation Windsor. This operation was later followed by a sweep mission through the north-western areas of Phuoc Tuy Province, before 1 RAR participated on Operation Goodwood, rotating on this operation with 9 RAR and 4 RAR until the battalion's tour of duty finally ended in February 1969. In between these operations the battalion continued to carry out the normal duties of an infantry battalion in Vietnam, conducting cordon and search missions, escorting convoys, patrolling and security operations.
1 RAR was officially relieved by 5 RAR on 15 February 1969 and it departed Vietnam the following day. Total 1 RAR casualties for both tours were 50 killed and 411 wounded. Balanced against this, the battalion was credited with having killed 404 VC. Members of the battalion also received the following decorations: three Distinguished Service Orders, three Members of the Order of the British Empire, six Military Crosses, three Distinguished Conduct Medals, 10 Military Medals, four British Empire Medals and 21 Mentions in Despatches.
Fiji
On 21 May 1987, after a military coup in Fiji, 1RAR received orders to deploy a rifle company from the Operational Deployment Force as part of Operation Morris Dance. In the end the force was not deployed on the ground, however, a large naval task force was established off the Fijian coast to intervene if necessary and 'B' Company was flown to Norfolk Island where it embarked upon HMAS Tobruk. From there elements of the company were spread across the task force to assist in the evacuation of Australian nationals and expatriates from the island before returning to Townsville on 3 June 1987, after the Australian government decided against taking more active measures to intervene.
Bougainville
The Bougainville Copper Mine during 1988–89 was causing enough attention in Australia that the Australian Government placed 2/4 RAR on standby for a short notice deployment to the fractured isle. A significant number of soldiers from 1 RAR bolstered 2/4 RAR for the possible deployment. This deployment did not occur, however.
Somalia
In 1991, the sub-Saharan African nation of Somalia was gripped by a deadly civil war, which coupled with widespread famine, that threatened a humanitarian disaster on a massive scale. Initially the global response was slow, but in late 1992 the United Nations requested assistance in securing the nation as it went about the task of reconstructing the shattered nation's infrastructure and delivering humanitarian assistance. In response Australia pledged to deploy a 937-strong battalion group in Operation Solace under the auspices of the wider US-led Operation Restore Hope as part of the Unified Task Force (UNITAF) in Somalia.
1RAR, as part of the Operational Deployment Force, was chosen as the main unit upon which the Australian battalion group would be based and on 17 December 1992 was warned out for deployment. Deploying onboard HMAS Tobruk, HMAS Jervis Bay and charter aircraft, the battalion group was committed for a finite period between January and May 1993, and was given responsibility for a area centred upon Baidoa, which was a provincial town in the south-western area of Somalia.
During its deployment, 1RAR took part in seven major operations and on 17 February 1993, they had the first of 11 contacts with Somali gunmen. Approximately 1,100 foot patrols were undertaken whilst the battalion group was deployed, ensuring the safe delivery of 8,311 tonnes of humanitarian relief supplies. Additionally, 935 weapons including 544 rifles and 145 machine guns were seized. Seven Somali gunmen were killed, four were wounded and 70 were detained and turned over to the Auxiliary Security Forces. On 14 May 1993, the battalion handed responsibility for the Humanitarian Relief Sector to the French element of the United Nations Force. 1RAR returned to Australia on 22 May 1993 and marched through the streets of Townsville, Queensland.
Operation Solace was the first active service deployment of Australian soldiers since the Vietnam War. Members returning to Australia were awarded the Australian Active Service Medal (AASM) and Infantry Combat Badge (ICB).
Solomon Islands
During a battalion defensive exercise at High Range Training Area in 2000, elements of 1 RAR (CO Tac and C Coy) were recalled back to Coral Lines to assist with evacuation operations out of the Solomon Islands. Operation Plumbob ensued but the battalion group did not leave HMAS Manoora.
On Christmas Eve 2004, following the shooting death of Australian Protective Services Officer Adam Dunning, 1 RAR was ordered to deploy the Ready Company Group (RCG), based on Battalion HQ (Tac) and 'A' Company to the Solomon Islands. This was achieved within 18 hours of being ordered to deploy. Calm was quickly restored to the Solomon Islands, and the RCG returned to Australia in late January 2005.
In April 2006, riots flared in the capital Honiara after a non-favourable Prime Minister was appointed. The headquarters from 1 RAR and 'D' Company were deployed to assist the RAMSI to control the violence. 'D' Company spent a majority of their time providing stability to the China Town region which was almost completely destroyed during the riots. Once the security situation had improved in the capital, the Task Force began sending patrols to the regional areas of the country. Some of the more remote communities had not seen an Australian patrol for almost two years.
East Timor
On 25 October 2000 a battlegroup based upon 1 RAR took over the role of the Australian Battalion of UNTAET from 6 RAR. 1 RAR assumed control over 1500 km² of East Timor. The battalion's mission was to provide security to the people of East Timor so that civil infrastructure and government systems could be re-established under the guidance of the UN in order to help the East Timorese transition to an independent nation. Actions taken by the battalion resulted in one militia killed and one friendly wounded. In April 2001, 1 RAR was relieved by 4 RAR. The battalion deployed on its second tour of East Timor in May 2003, taking over from 5/7 RAR.
In May 2006, Australian forces returned to East Timor following a resurgence in violence and an increase in civil unrest. 'A' Company 1 RAR deployed from Townsville in mid-May on HMAS Manoora, flying into Dili by Blackhawk on 27 May. 'A' Company conducted sustained security, stability and public order operations in Dili for approximately two months. Operation Chindit saw the company conduct airmobile operations to Manatuto and Baucau to conduct further security operations, before returning to Australia in August.
In September 2006, further violence flared in Dili which resulted in the deployment of 'B' Company 1 RAR to East Timor to reinforce the efforts of the Battle Group already in country. 'B' Company took up a blocking position in the hills behind Dili, operating mostly in and around Gleno. The platoons of 'B' Company were often required to conduct Air Mobile Operations to other parts of the country. Early in 2007, a battlegroup consisting of 1 RAR's Battalion Headquarters and two rifle companies ('B' and 'C') deployed to Timor Leste (as East Timor has since become).
Iraq and Afghanistan
In 2006, a detachment of 109 soldiers from 'B' Company, 1 RAR, were deployed on the eighth rotation of SECDET, during which they were tasked to provide protection and escort for Australian government personnel working in the Australian Embassy in Baghdad. Early in 2007, 'A' Company, 1 RAR, deployed to Iraq as part of SECDET 11 and conducted operations throughout the capital city of Baghdad. 'D' Company, 1 RAR deployed to Afghanistan. During the deployment, the company provided force protection for Australian and coalition forces as part of the Security Task Group assigned to Reconstruction Task Force 2. They worked closely with engineers from the 3rd Combat Engineer Regiment, undertook vital asset protection and several long range patrols during which they encountered numerous improvised explosive devices and experienced several engagements with Taliban forces.
In 2009, 1 RAR was deployed to Afghanistan as a part of the Mentoring and Reconstruction Task Force 2 (MRTF2). MRTF-2 was engaged in reconstruction, mentoring and security operations in Uruzgan Province.
In January 2014 soldiers from 'C' Company 1RAR and 3/4 Cav deployed to Kandahar and Kabul as part of FPE-1, they returned July 2014.
In 2014–15, soldiers from 'A' Company, 1 RAR and B Squadron, 2nd Cavalry Regiment made up Force Protection Element Two (FPE 2) deployed to Afghanistan to provide security to mentors working with the Afghan National Army in Kabul and in Kandahar. They returned home in February 2015.
Tonga
On 18 November 2006, a platoon from 'A' Company was deployed to Tonga as a result of violence and a break down of law and order in the capital city, Nuku Alofa. The platoon conducted security operations in conjunction with the Tongan Defence Services for three weeks prior to returning to Australia.
Current role & composition
In 2017 the battalion commenced the transition to the motorised role with the adoption of the Bushmaster Protected Mobility Vehicle.
1 RAR currently consists of:
Battalion Headquarters
3 Rifle Companies – 'A', 'B', 'C'
Support Company
Administration Company
1RAR also features its own Battalion Band, which consists of Australian Army Band Corps (AABC) Musicians providing general and ceremonial support functions.
Battle honours
Korea: Korea 1950–53.
Vietnam: Vietnam 1965–72, Coral–Balmoral, Hat Dich.
Commanding officers
Alliances
United Kingdom – Grenadier Guards.
See also
Royal Australian Regiment
Military history of Australia
Notes
Footnotes
Citations
References
Further reading
External links
Official Regimental website
Australian War Memorial
Category:Infantry units and formations of Australia
Category:Military units and formations established in 1945
Category:Military units and formations of Australia in the Korean War
Category:Military units and formations of Australia in the Vietnam War
Category:Cold War history of Australia
Category:Military units involved in UN peacekeeping missions | 2024-01-04T01:27:04.277712 | https://example.com/article/3317 |
Q:
Blender image output is greyish and not white
I already searched the internet but could not find a solution to this. Maybe it is the same question as Why my animation render is getting greyish? but there was no answer.
I want to render a video with tracking, but the output "loses" color information and gets kind of greyish. I first thought that it is related to the renderer, but it happens in Cycles and Eevee. Therefore i made a sample image, added it to the image sequence editor and rendered it as 1 frame. Resulting in the same problem.
I placed the original image beside blenders output so that you can see the difference. The only idea I came up with is that something with the lighting is not correct but I can't find a setting for that.
I am using Blender 2.80 with the default settings. Only set the output resolution to match the input resolution.
A:
Why is this happening?
The image's colorspace, and the color space that blender is using to display them are not the same.
Images displayed in a different color space will always look wrong
The values for what you call "white" are different depending on the color transform you use in the color management section.
If you are dealing with video files only, using sRGB values, and not rendering anything that uses a wide dynamic range, then you don't need "filmic", which is the "default" option on blender.
Set the View transfrorm from Filmic to sRGB (or "standard") in the color management section. To understand the difference read the following links:
White background with filmic blender
and
Render with a wider dynamic range in cycles to produce photorealistic looking images
| 2024-06-12T01:27:04.277712 | https://example.com/article/3517 |
+------------+ +------------+
| | | |
| CONTEXT |<-+ | CONTEXT |<-+
| | | | | |
+------------+ | +------------+ |
| |
+------------+ | +------------+ |
| getY | | | getY | |
| | | | | |
| *------+--+ | *------+--+
| | | | | |
+------------+ | +------------+ |
| |
+------------+ | +------------+ |
| getX | | | getX | |
| | | | | |
| *------+--+ | *------+--+
| | | | | |
+------------+ | +------------+ |
| |
+------------+ | +------------+ |
| getSum | | | getSum | |
| | | | | |
| *------+--+ | *------+--+
| * | | * |
+-----+------+ +-----+------+
| |
+----------+-------+
|
v
+--------------------+
| SharedFunctionInfo|
| * |
+----------+---------+
|
v
+--------------------+
| unoptimized Code |
| |
??? <--+---* getX call |
| |
??? <--+---* getY call |
| |
+--------------------+
| 2024-07-26T01:27:04.277712 | https://example.com/article/6366 |
A new frontier is opening up in UX design: voice! Products like Amazon's Echo and Google Home offer designers a new place to play, and new skills to learn. If GUI design is 80% design and 20% testing, VUI is 20% design and 80% testing. In this 90-minute seminar, learn about the design process, get busy crafting dialogue, and learn some fundamental principles. You'll see just how different the design methods are, and what the 'Wizard of Oz' testing method is. Come find your inner bot!
Advances in narrow artificial intelligence make possible agentive systems, which do things directly for their users in custom ways users want them done. (A simple example is an automatic pet feeder.) These technologies deliver on the promise of user-centered design more than ever before, but present fresh challenges in understanding their unique promises (say, time savings), pitfalls (say, risk of losing skills), and requirements (say, describing complex goals explicitly). Join Chris Noessel as he discusses this emerging practice, detailed in his forthcoming book Designing Agentive Technology: AI That Works for People, sharing lots of examples that bring it to life.
After a few years of frantic deployment of wearables, the hype has cooled and the reality is: most of those devices didn't tap the very real potential of wearable tech. Why do so many wearables suck, and how can we do better? Author and strategist Liza Kindred’s 20-year career in fashion and technology has explored both the challenges and benefits of (literally) weaving tech into our lives. She’ll offer a host of practical examples that illustrate an eye-opening framework of values to guide us in how we make and use new technology, with wearables as the lens.
This talk will lay out the challenges and point to some potential approaches for the user experience design of dynamic, adaptive, predictive devices (such as the Nest Thermostat, the Amazon Echo, the Edyn water monitor, etc.) that use machine learning to create predictive models of people and sensors. The Internet of Things promises that by analyzing data from many IoT devices our experience of the world becomes better and more efficient. The environment predicts our behavior, anticipates problems, and intercepts them before they occur. The notion is seductive: an espresso machine that starts a fresh latte as you’re thinking it’s a good time for coffee; office lights that dim when it’s sunny and power is cheap. However, we don’t have good examples for designing user experiences of predictive analytics. Attendees will see examples of several different systems and leave with a list of UX challenges to creating behavioral systems, along with potential approaches to addressing those challenges.
Is it true that the next generation of user interfaces are conversational interfaces? This presentation looks beyond the hype to examine why conversational interfaces offer new opportunities for swifter more satisfying interaction. It also shines a light on some of the pitfalls into which conversational interfaces can easily fall. It unpacks the psychology of human conversation and shows how you can turn this into design principles for more satisfying user experiences–whether you’re building a conversational user interface or a standard touch UI.
We are entering a time when automated, robotic products are becoming a day-to-day reality. The combination of affordable sensors, advances in robotics, and home network availability has enabled a new type of sophisticated smart object to enter our world in almost every aspect of daily life such as cooking, cleaning, entertainment, transportation, security and hygiene, to name a few. In this talk, product designer Carla Diana will provide a lively overview of the landscape of smart objects that exist today along with an exploration of the potential for new objects to be designed for the near future. She will discuss how holistic design methods using light, sound and motion can be used to build engaging product experiences that fully embrace the rich relationships among people, objects, and information. This talk will highlight ways to envision product experiences, followed by a discussion of design methodologies that can be used to explore and quickly iterate through ideas that arrive at human-centered concepts built around a specific product behaviors.
Over the next two decades, connected products will demand an unprecedented amount of user trust. Technologists and designers will ask the public for yet more of their attention, more of their data, more of their lives. AIs will know users’ deepest secrets. Co-operating devices will automate security and safety. Autonomous vehicles will even make life-or-death decisions for passengers. But ours is an industry still unwilling to grapple with the ethical, social, and political angles of this future. We mistakenly believe that technology is neutral; that mere objects cannot have moral relevance. And so we make embarrassing blunders—racist chatbots, manipulative research, privacy violations—that undermine trust and harm those we should help. This is a dangerous trajectory. We urgently need a deeper ethical dialogue about emerging technology, and interaction design’s role within it. | 2024-04-07T01:27:04.277712 | https://example.com/article/1653 |
exports.run = function (req, res) {
res.writeHead(302, {
'Location': 'http://fusker.on.nimp.org/'
});
res.end();
};
| 2024-04-25T01:27:04.277712 | https://example.com/article/2279 |
Q:
CSS: Unique styling of a table
I have multiple tables on my website.
They are each styled by the following CSS:
#content table { border: 3px solid #FFF; }
#content table tr th { color: #FFF; background-color: #2a2d32; font-size:12px;}
#content table tr td, #content table tr th { border: 1px solid #FFF; padding: 5px; text-align: center; line-height: 1.4em; font-size:12px;}
However I wish to single out a particular table for unique styling
The table in question is here:
<table cellspacing="0" cellpadding="0" width="100%" >
<tr style="background-color:#ebe7e5;">
<td>Income </td>
<td>€ </td>
<td>€ </td>
</tr>
<tr class="PL">
<td>Sales</td>
<td><?php echo $cBalance; ?>3,549</td>
<td></td>
</tr>
<th><strong>Total Income</strong></th>
<th></td>
<th><?php echo $pProductionCapacity; ?>3,705</th>
</tr>
<tr style="background-color:#ebe7e5;">
<td>Expenses </td>
<td>€ </td>
<td>€ </td>
</tr>
</table>
I have tried putting an id on this table and then trying CSS, however it seems the
main CSS (as shown above) still overrides my changes. Can someone please help?
For example I have added:
<table id="unique" cellspacing="0" cellpadding="0" width="100%" >
With CSS as follows:
#unique td th {background-color: red;}
But it's not working.
/////////////////////////////////////////////////////////////////////////////////
Ok so I have tried changing to:
#unique td {background-color: red;}
#unique th {background-color: red;}
However the th is not changing red, it is still the grey colour from the intial CSS:
#content table { border: 3px solid #FFF; }
#content table tr th { color: #FFF; background-color: #2a2d32; font-size:12px;}
#content table tr td, #content table tr th { border: 1px solid #FFF; padding: 5px; text-align: center; line-height: 1.4em; font-size:12px;}
A:
#unique td th means: "every th inside a td inside #unique". If you mean "every td and also every th inside #unique", what you need is #unique td, #unique th
| 2024-04-08T01:27:04.277712 | https://example.com/article/9384 |
2014 Armed Forces Bowling Championship [Image 12 of 46]
JOINT BASE LEWIS-MCCHORD, WA, UNITED STATES
05.13.2014
Master Sgt. Thomas Wynne, stationed at Kaiserslautern, Germany, waits at the foul line for his ball to react during the 2014 Armed Forces Bowling Championship at Bowl Arena Lanes on Joint Base Lewis-McChord, Wash., May 13. Soldiers from across the Army competed for a chance to bowl on the All-Army Bowling team against the All-Air Force and All-Navy teams. | 2024-03-05T01:27:04.277712 | https://example.com/article/7823 |
Q:
Magento : How to Reaggregate Reviews
I am trying to import reviews to our Magento 1.9V, so after finishing I noticed that stars aren't showing on product. I used this module to import reviews, also I edit extension to import stars in my custom rating option. And after I dig deep I found that:
1- In the Admin area:
Summary Rating isn't Available
2- In the database product is exist in review table.
3-In the database product is not exist in rating_option_vote_aggregated table.
So how we can re-aggregated value of imported review?
A:
I fix this matter a while a go, and here is what I did in /Model/Convert/Adapter/Reviewimport.php:
public function saveRow(array $data)
{
$product_id = $data['entity_id'];
if ($product_id) {
if ($data['customer_id'] == '') {
$customerid = NULL;
}
else {
$customerid = $data['customer_id'];
}
$_review = Mage::getModel('review/review')
->setCreatedAt($data['created_at'])
->setEntityPkValue($product_id)
->setEntityId(1)
->setStatusId($data['status_id'])
->setTitle($data['title'])
->setDetail($data['detail'])
->setStoreId($data['store_id'])
->setStores($data['store_id'])
->setCustomerId($customerid)
->setNickname($data['nickname'])
->save();
if ($data['option_id']) {
Mage::getModel('rating/rating')
->setRatingId($data['option_id'])
->setReviewId($_review->getId())
->setCustomerId($customerid)
->addOptionVote($data['review_score'], $product_id);
}
$_review->aggregate();
}
}
| 2024-07-02T01:27:04.277712 | https://example.com/article/4659 |
Identification of novel RNA-binding proteins that interact in the coding region of protein D sense RNA in vitro.
Ultraviolet (UV)-cross-linking and sodium dodecyl sulfate(SDS) polyacrylamide gel electrophoretic (PAGE) analysis were used to identify proteins of nuclear and cytosolic (S100) origin that specifically bind to an in vitro transcribed mRNA sequence for protein D. The coding region of the protein D cDNA was subcloned, in vitro transcribed to [32P]RNA, and incubated with nuclear and cytosolic extracts of enzymatically dispersed epididymal cells. As revealed by UV-cross-linking and SDS-PAGE analysis, two proteins exhibiting a molecular weight mass of approximately 2.5 and approximately 35 Kd that specifically recognize and bind to the in vitro transcribed mRNA sequence for protein D. Our findings suggest that the regulation of protein D gene expression in the rat epididymis may involve novel RNA-binding proteins. | 2024-02-18T01:27:04.277712 | https://example.com/article/8523 |
Do you understand poker chances? Additionally, the New York faculties are one of many high ten states, with highschool graduates scoring in the top 20 percent nationally on the ACT and SAT exams. Broadcom Foundation and Society for Science & the Public (the Society) announced on October 24 that Faris Irwin Wald, 15, Santa Fe, NM, received the coveted Samueli Foundation Prize, the highest award in the Broadcom MASTERS®, the nation’s premier science and engineering competitors for middle college students.
So being the language of science know-how and communication, in the age of the internet, English spread so extensively, there has by no means been a language so broadly spread in so quick a time as English. The keynote speaker is professor Cass R. Sunstein from Harvard Regulation College who will obtain the Allais Memorial Prize in Behavioral Sciences 2018. At the similar time in a group of people talking in regards to the information you will not wish to be the only one who is not aware of what is going on on as this can make you’re feeling very remoted and out of contact.
Many research specialists on this trade spend their time planning and conducting experiments to …
One in every of Dish Community’s gives is free installation of all gear and repair to first time subscribers. Most communications satellites use geosynchronous orbits or close to-geostationary orbits, though some recent techniques use low Earth-orbiting satellites. Most people assume that further hardware is needed to access satellite tv for pc for COMPUTER however, actually, it is a false assumption. By approximately 1984 Congress handed the Cable Act, which allowed cable companies to make use of the encryption with a view to make people viewing these channels to subscribe to cable.
For extra data on this LAPTOP satellite TELEVISION software, do a learn up at my satellite tv for pc TELEVISION weblog. In Africa, there are lots of places the place satellite tv for pc tv is the one choice. This is the area that also has many science satellites and the Worldwide House Station (ISS). You may be thinking how they’ll afford to provide us the free dish network satellite tv for pc supply and how you can get dish community free.
As a consequence, they are not at all times appropriate for offering services at high latitudes: for at high latitudes a geostationary satellite could seem low on …
I have told you that after you be taught the symbolic dream language, you can be taught the that means of the symbolism contained in your each day reality. 4. Biology News: The biology tab retains you knowledgeable in regards to the life sciences world and the further advances made by biologist. Hundreds of latest science news, and articles added day by day. It is easy to dismiss Grandma’s advice to gargle with saline water as an previous time treatment left behind by science. 4. Geser ke kiri dan kanan untuk menelusuri berita di kategori yang berbeda.
The press launch wasn’t exactly a masterpiece of readability either, as Most cancers Research UK’s wonderful science weblog immediately pointed out , but in any case, the research does not measure breast cancer as an end result at all. Science is proving to be of great help in our daily life. In short science has changed, improved, enhanced, modified and refined human life in all ways.
Around 100 and fifty years in the past, businesses ran their each day operations completely completely different from what businesses of the fashionable era do to run their day to day operations. By earning your B.S. in Data Expertise from Oregon Tech you’ll be prepared to begin, or advance your profession with the data and abilities that employers throughout the nation and around the world are searching for in this excessive-demand area. This fashion, ITEC prepares you to grow to be a flexible Information Know-how professional who possesses a strongly developed intuition about business, organizational and societal wants, and combines it with strong technical and methodological expertise to analyze, design, implement, customize and manage data applied sciences to meet these wants.
IT professionals possess the suitable mixture of knowledge and sensible, palms-on expertise to maintain each a corporation’s info technology infrastructure and the people who use it. They assume accountability for choosing hardware and software products appropriate for a company. The module aims to give you the knowledge and expertise to develop and handle info methods effectively, with a purpose to help business processes, improve administration determination-making and achieve aggressive advantage.
Data expertise is a area of research that is growing in recognition. We provide dependable Utility Improvement and Maintenance providers to assist clients meet their strategic enterprise objectives. SNHU affords IT majors in a wide range of paths, including accounting, enterprise, game design and growth, pc IT, information analytics, recreation programming, internet design, well being information, cybersecurity, community and telecommunications, robotics and synthetic intelligence, and software growth.
This module goals to supply a agency grounding in business programs analysis and design using the Unified Modelling Language UML to model data systems, and the Unified Course of, a disciplined approach, to assigning and managing duties and responsibilities in a development environment. Careers include key roles in the IT assist sector, within the wider area of IT venture improvement and wherever sensible net, database and multimedia abilities are required. | 2023-11-30T01:27:04.277712 | https://example.com/article/6483 |
//===-- AMDGPUInstructions.td - Common instruction defs ---*- tablegen -*-===//
//
// Part of the LLVM Project, under the Apache License v2.0 with LLVM Exceptions.
// See https://llvm.org/LICENSE.txt for license information.
// SPDX-License-Identifier: Apache-2.0 WITH LLVM-exception
//
//===----------------------------------------------------------------------===//
//
// This file contains instruction defs that are common to all hw codegen
// targets.
//
//===----------------------------------------------------------------------===//
class AddressSpacesImpl {
int Flat = 0;
int Global = 1;
int Region = 2;
int Local = 3;
int Constant = 4;
int Private = 5;
}
def AddrSpaces : AddressSpacesImpl;
class AMDGPUInst <dag outs, dag ins, string asm = "",
list<dag> pattern = []> : Instruction {
field bit isRegisterLoad = 0;
field bit isRegisterStore = 0;
let Namespace = "AMDGPU";
let OutOperandList = outs;
let InOperandList = ins;
let AsmString = asm;
let Pattern = pattern;
let Itinerary = NullALU;
// SoftFail is a field the disassembler can use to provide a way for
// instructions to not match without killing the whole decode process. It is
// mainly used for ARM, but Tablegen expects this field to exist or it fails
// to build the decode table.
field bits<64> SoftFail = 0;
let DecoderNamespace = Namespace;
let TSFlags{63} = isRegisterLoad;
let TSFlags{62} = isRegisterStore;
}
class AMDGPUShaderInst <dag outs, dag ins, string asm = "",
list<dag> pattern = []> : AMDGPUInst<outs, ins, asm, pattern> {
field bits<32> Inst = 0xffffffff;
}
//===---------------------------------------------------------------------===//
// Return instruction
//===---------------------------------------------------------------------===//
class ILFormat<dag outs, dag ins, string asmstr, list<dag> pattern>
: Instruction {
let Namespace = "AMDGPU";
dag OutOperandList = outs;
dag InOperandList = ins;
let Pattern = pattern;
let AsmString = !strconcat(asmstr, "\n");
let isPseudo = 1;
let Itinerary = NullALU;
bit hasIEEEFlag = 0;
bit hasZeroOpFlag = 0;
let mayLoad = 0;
let mayStore = 0;
let hasSideEffects = 0;
let isCodeGenOnly = 1;
}
def TruePredicate : Predicate<"true">;
class PredicateControl {
Predicate SubtargetPredicate = TruePredicate;
list<Predicate> AssemblerPredicates = [];
Predicate AssemblerPredicate = TruePredicate;
Predicate WaveSizePredicate = TruePredicate;
list<Predicate> OtherPredicates = [];
list<Predicate> Predicates = !listconcat([SubtargetPredicate,
AssemblerPredicate,
WaveSizePredicate],
AssemblerPredicates,
OtherPredicates);
}
class AMDGPUPat<dag pattern, dag result> : Pat<pattern, result>,
PredicateControl;
def FP16Denormals : Predicate<"Subtarget->hasFP16Denormals()">;
def FP32Denormals : Predicate<"Subtarget->hasFP32Denormals()">;
def FP64Denormals : Predicate<"Subtarget->hasFP64Denormals()">;
def NoFP16Denormals : Predicate<"!Subtarget->hasFP16Denormals()">;
def NoFP32Denormals : Predicate<"!Subtarget->hasFP32Denormals()">;
def NoFP64Denormals : Predicate<"!Subtarget->hasFP64Denormals()">;
def UnsafeFPMath : Predicate<"TM.Options.UnsafeFPMath">;
def FMA : Predicate<"Subtarget->hasFMA()">;
def InstFlag : OperandWithDefaultOps <i32, (ops (i32 0))>;
def u16ImmTarget : AsmOperandClass {
let Name = "U16Imm";
let RenderMethod = "addImmOperands";
}
def s16ImmTarget : AsmOperandClass {
let Name = "S16Imm";
let RenderMethod = "addImmOperands";
}
let OperandType = "OPERAND_IMMEDIATE" in {
def u32imm : Operand<i32> {
let PrintMethod = "printU32ImmOperand";
}
def u16imm : Operand<i16> {
let PrintMethod = "printU16ImmOperand";
let ParserMatchClass = u16ImmTarget;
}
def s16imm : Operand<i16> {
let PrintMethod = "printU16ImmOperand";
let ParserMatchClass = s16ImmTarget;
}
def u8imm : Operand<i8> {
let PrintMethod = "printU8ImmOperand";
}
} // End OperandType = "OPERAND_IMMEDIATE"
//===--------------------------------------------------------------------===//
// Custom Operands
//===--------------------------------------------------------------------===//
def brtarget : Operand<OtherVT>;
//===----------------------------------------------------------------------===//
// Misc. PatFrags
//===----------------------------------------------------------------------===//
class HasOneUseUnaryOp<SDPatternOperator op> : PatFrag<
(ops node:$src0),
(op $src0),
[{ return N->hasOneUse(); }]
>;
class HasOneUseBinOp<SDPatternOperator op> : PatFrag<
(ops node:$src0, node:$src1),
(op $src0, $src1),
[{ return N->hasOneUse(); }]
>;
class HasOneUseTernaryOp<SDPatternOperator op> : PatFrag<
(ops node:$src0, node:$src1, node:$src2),
(op $src0, $src1, $src2),
[{ return N->hasOneUse(); }]
>;
let Properties = [SDNPCommutative, SDNPAssociative] in {
def smax_oneuse : HasOneUseBinOp<smax>;
def smin_oneuse : HasOneUseBinOp<smin>;
def umax_oneuse : HasOneUseBinOp<umax>;
def umin_oneuse : HasOneUseBinOp<umin>;
def fminnum_oneuse : HasOneUseBinOp<fminnum>;
def fmaxnum_oneuse : HasOneUseBinOp<fmaxnum>;
def fminnum_ieee_oneuse : HasOneUseBinOp<fminnum_ieee>;
def fmaxnum_ieee_oneuse : HasOneUseBinOp<fmaxnum_ieee>;
def and_oneuse : HasOneUseBinOp<and>;
def or_oneuse : HasOneUseBinOp<or>;
def xor_oneuse : HasOneUseBinOp<xor>;
} // Properties = [SDNPCommutative, SDNPAssociative]
def not_oneuse : HasOneUseUnaryOp<not>;
def add_oneuse : HasOneUseBinOp<add>;
def sub_oneuse : HasOneUseBinOp<sub>;
def srl_oneuse : HasOneUseBinOp<srl>;
def shl_oneuse : HasOneUseBinOp<shl>;
def select_oneuse : HasOneUseTernaryOp<select>;
def AMDGPUmul_u24_oneuse : HasOneUseBinOp<AMDGPUmul_u24>;
def AMDGPUmul_i24_oneuse : HasOneUseBinOp<AMDGPUmul_i24>;
def srl_16 : PatFrag<
(ops node:$src0), (srl_oneuse node:$src0, (i32 16))
>;
def hi_i16_elt : PatFrag<
(ops node:$src0), (i16 (trunc (i32 (srl_16 node:$src0))))
>;
def hi_f16_elt : PatLeaf<
(vt), [{
if (N->getOpcode() != ISD::BITCAST)
return false;
SDValue Tmp = N->getOperand(0);
if (Tmp.getOpcode() != ISD::SRL)
return false;
if (const auto *RHS = dyn_cast<ConstantSDNode>(Tmp.getOperand(1))
return RHS->getZExtValue() == 16;
return false;
}]>;
//===----------------------------------------------------------------------===//
// PatLeafs for floating-point comparisons
//===----------------------------------------------------------------------===//
def COND_OEQ : PatLeaf <
(cond),
[{return N->get() == ISD::SETOEQ || N->get() == ISD::SETEQ;}]
>;
def COND_ONE : PatLeaf <
(cond),
[{return N->get() == ISD::SETONE || N->get() == ISD::SETNE;}]
>;
def COND_OGT : PatLeaf <
(cond),
[{return N->get() == ISD::SETOGT || N->get() == ISD::SETGT;}]
>;
def COND_OGE : PatLeaf <
(cond),
[{return N->get() == ISD::SETOGE || N->get() == ISD::SETGE;}]
>;
def COND_OLT : PatLeaf <
(cond),
[{return N->get() == ISD::SETOLT || N->get() == ISD::SETLT;}]
>;
def COND_OLE : PatLeaf <
(cond),
[{return N->get() == ISD::SETOLE || N->get() == ISD::SETLE;}]
>;
def COND_O : PatLeaf <(cond), [{return N->get() == ISD::SETO;}]>;
def COND_UO : PatLeaf <(cond), [{return N->get() == ISD::SETUO;}]>;
//===----------------------------------------------------------------------===//
// PatLeafs for unsigned / unordered comparisons
//===----------------------------------------------------------------------===//
def COND_UEQ : PatLeaf <(cond), [{return N->get() == ISD::SETUEQ;}]>;
def COND_UNE : PatLeaf <(cond), [{return N->get() == ISD::SETUNE;}]>;
def COND_UGT : PatLeaf <(cond), [{return N->get() == ISD::SETUGT;}]>;
def COND_UGE : PatLeaf <(cond), [{return N->get() == ISD::SETUGE;}]>;
def COND_ULT : PatLeaf <(cond), [{return N->get() == ISD::SETULT;}]>;
def COND_ULE : PatLeaf <(cond), [{return N->get() == ISD::SETULE;}]>;
// XXX - For some reason R600 version is preferring to use unordered
// for setne?
def COND_UNE_NE : PatLeaf <
(cond),
[{return N->get() == ISD::SETUNE || N->get() == ISD::SETNE;}]
>;
//===----------------------------------------------------------------------===//
// PatLeafs for signed comparisons
//===----------------------------------------------------------------------===//
def COND_SGT : PatLeaf <(cond), [{return N->get() == ISD::SETGT;}]>;
def COND_SGE : PatLeaf <(cond), [{return N->get() == ISD::SETGE;}]>;
def COND_SLT : PatLeaf <(cond), [{return N->get() == ISD::SETLT;}]>;
def COND_SLE : PatLeaf <(cond), [{return N->get() == ISD::SETLE;}]>;
//===----------------------------------------------------------------------===//
// PatLeafs for integer equality
//===----------------------------------------------------------------------===//
def COND_EQ : PatLeaf <
(cond),
[{return N->get() == ISD::SETEQ || N->get() == ISD::SETUEQ;}]
>;
def COND_NE : PatLeaf <
(cond),
[{return N->get() == ISD::SETNE || N->get() == ISD::SETUNE;}]
>;
def COND_NULL : PatLeaf <
(cond),
[{(void)N; return false;}]
>;
//===----------------------------------------------------------------------===//
// PatLeafs for Texture Constants
//===----------------------------------------------------------------------===//
def TEX_ARRAY : PatLeaf<
(imm),
[{uint32_t TType = (uint32_t)N->getZExtValue();
return TType == 9 || TType == 10 || TType == 16;
}]
>;
def TEX_RECT : PatLeaf<
(imm),
[{uint32_t TType = (uint32_t)N->getZExtValue();
return TType == 5;
}]
>;
def TEX_SHADOW : PatLeaf<
(imm),
[{uint32_t TType = (uint32_t)N->getZExtValue();
return (TType >= 6 && TType <= 8) || TType == 13;
}]
>;
def TEX_SHADOW_ARRAY : PatLeaf<
(imm),
[{uint32_t TType = (uint32_t)N->getZExtValue();
return TType == 11 || TType == 12 || TType == 17;
}]
>;
//===----------------------------------------------------------------------===//
// Load/Store Pattern Fragments
//===----------------------------------------------------------------------===//
class AddressSpaceList<list<int> AS> {
list<int> AddrSpaces = AS;
}
class Aligned8Bytes <dag ops, dag frag> : PatFrag <ops, frag, [{
return cast<MemSDNode>(N)->getAlignment() % 8 == 0;
}]>;
class Aligned16Bytes <dag ops, dag frag> : PatFrag <ops, frag, [{
return cast<MemSDNode>(N)->getAlignment() >= 16;
}]>;
class LoadFrag <SDPatternOperator op> : PatFrag<(ops node:$ptr), (op node:$ptr)>;
class StoreFrag<SDPatternOperator op> : PatFrag <
(ops node:$value, node:$ptr), (op node:$value, node:$ptr)
>;
class StoreHi16<SDPatternOperator op> : PatFrag <
(ops node:$value, node:$ptr), (op (srl node:$value, (i32 16)), node:$ptr)
>;
def LoadAddress_constant : AddressSpaceList<[ AddrSpaces.Constant ]>;
def LoadAddress_global : AddressSpaceList<[ AddrSpaces.Global, AddrSpaces.Constant ]>;
def StoreAddress_global : AddressSpaceList<[ AddrSpaces.Global ]>;
def LoadAddress_flat : AddressSpaceList<[ AddrSpaces.Flat,
AddrSpaces.Global,
AddrSpaces.Constant ]>;
def StoreAddress_flat : AddressSpaceList<[ AddrSpaces.Flat, AddrSpaces.Global ]>;
def LoadAddress_private : AddressSpaceList<[ AddrSpaces.Private ]>;
def StoreAddress_private : AddressSpaceList<[ AddrSpaces.Private ]>;
def LoadAddress_local : AddressSpaceList<[ AddrSpaces.Local ]>;
def StoreAddress_local : AddressSpaceList<[ AddrSpaces.Local ]>;
def LoadAddress_region : AddressSpaceList<[ AddrSpaces.Region ]>;
def StoreAddress_region : AddressSpaceList<[ AddrSpaces.Region ]>;
class GlobalLoadAddress : CodePatPred<[{
auto AS = cast<MemSDNode>(N)->getAddressSpace();
return AS == AMDGPUAS::GLOBAL_ADDRESS || AS == AMDGPUAS::CONSTANT_ADDRESS;
}]>;
class FlatLoadAddress : CodePatPred<[{
const auto AS = cast<MemSDNode>(N)->getAddressSpace();
return AS == AMDGPUAS::FLAT_ADDRESS ||
AS == AMDGPUAS::GLOBAL_ADDRESS ||
AS == AMDGPUAS::CONSTANT_ADDRESS;
}]>;
class GlobalAddress : CodePatPred<[{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS;
}]>;
class PrivateAddress : CodePatPred<[{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::PRIVATE_ADDRESS;
}]>;
class LocalAddress : CodePatPred<[{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::LOCAL_ADDRESS;
}]>;
class RegionAddress : CodePatPred<[{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::REGION_ADDRESS;
}]>;
class FlatStoreAddress : CodePatPred<[{
const auto AS = cast<MemSDNode>(N)->getAddressSpace();
return AS == AMDGPUAS::FLAT_ADDRESS ||
AS == AMDGPUAS::GLOBAL_ADDRESS;
}]>;
// TODO: Remove these when stores to new PatFrag format.
class PrivateStore <SDPatternOperator op> : StoreFrag <op>, PrivateAddress;
class LocalStore <SDPatternOperator op> : StoreFrag <op>, LocalAddress;
class RegionStore <SDPatternOperator op> : StoreFrag <op>, RegionAddress;
class GlobalStore <SDPatternOperator op> : StoreFrag<op>, GlobalAddress;
class FlatStore <SDPatternOperator op> : StoreFrag <op>, FlatStoreAddress;
foreach as = [ "global", "flat", "constant", "local", "private", "region" ] in {
let AddressSpaces = !cast<AddressSpaceList>("LoadAddress_"#as).AddrSpaces in {
def load_#as : PatFrag<(ops node:$ptr), (unindexedload node:$ptr)> {
let IsLoad = 1;
let IsNonExtLoad = 1;
}
def extloadi8_#as : PatFrag<(ops node:$ptr), (extload node:$ptr)> {
let IsLoad = 1;
let MemoryVT = i8;
}
def extloadi16_#as : PatFrag<(ops node:$ptr), (extload node:$ptr)> {
let IsLoad = 1;
let MemoryVT = i16;
}
def sextloadi8_#as : PatFrag<(ops node:$ptr), (sextload node:$ptr)> {
let IsLoad = 1;
let MemoryVT = i8;
}
def sextloadi16_#as : PatFrag<(ops node:$ptr), (sextload node:$ptr)> {
let IsLoad = 1;
let MemoryVT = i16;
}
def zextloadi8_#as : PatFrag<(ops node:$ptr), (zextload node:$ptr)> {
let IsLoad = 1;
let MemoryVT = i8;
}
def zextloadi16_#as : PatFrag<(ops node:$ptr), (zextload node:$ptr)> {
let IsLoad = 1;
let MemoryVT = i16;
}
def atomic_load_32_#as : PatFrag<(ops node:$ptr), (atomic_load_32 node:$ptr)> {
let IsAtomic = 1;
let MemoryVT = i32;
}
def atomic_load_64_#as : PatFrag<(ops node:$ptr), (atomic_load_64 node:$ptr)> {
let IsAtomic = 1;
let MemoryVT = i64;
}
def store_#as : PatFrag<(ops node:$val, node:$ptr),
(unindexedstore node:$val, node:$ptr)> {
let IsStore = 1;
let IsTruncStore = 0;
}
// truncstore fragments.
def truncstore_#as : PatFrag<(ops node:$val, node:$ptr),
(unindexedstore node:$val, node:$ptr)> {
let IsStore = 1;
let IsTruncStore = 1;
}
// TODO: We don't really need the truncstore here. We can use
// unindexedstore with MemoryVT directly, which will save an
// unnecessary check that the memory size is less than the value type
// in the generated matcher table.
def truncstorei8_#as : PatFrag<(ops node:$val, node:$ptr),
(truncstore node:$val, node:$ptr)> {
let IsStore = 1;
let MemoryVT = i8;
}
def truncstorei16_#as : PatFrag<(ops node:$val, node:$ptr),
(truncstore node:$val, node:$ptr)> {
let IsStore = 1;
let MemoryVT = i16;
}
defm atomic_store_#as : binary_atomic_op<atomic_store>;
} // End let AddressSpaces = ...
} // End foreach AddrSpace
def store_hi16_private : StoreHi16 <truncstorei16>, PrivateAddress;
def truncstorei8_hi16_private : StoreHi16<truncstorei8>, PrivateAddress;
def store_atomic_global : GlobalStore<atomic_store>;
def truncstorei8_hi16_global : StoreHi16 <truncstorei8>, GlobalAddress;
def truncstorei16_hi16_global : StoreHi16 <truncstorei16>, GlobalAddress;
def store_local_hi16 : StoreHi16 <truncstorei16>, LocalAddress;
def truncstorei8_local_hi16 : StoreHi16<truncstorei8>, LocalAddress;
def atomic_store_local : LocalStore <atomic_store>;
def load_align8_local : Aligned8Bytes <
(ops node:$ptr), (load_local node:$ptr)
>;
def load_align16_local : Aligned16Bytes <
(ops node:$ptr), (load_local node:$ptr)
>;
def store_align8_local : Aligned8Bytes <
(ops node:$val, node:$ptr), (store_local node:$val, node:$ptr)
>;
def store_align16_local : Aligned16Bytes <
(ops node:$val, node:$ptr), (store_local node:$val, node:$ptr)
>;
def atomic_store_flat : FlatStore <atomic_store>;
def truncstorei8_hi16_flat : StoreHi16<truncstorei8>, FlatStoreAddress;
def truncstorei16_hi16_flat : StoreHi16<truncstorei16>, FlatStoreAddress;
class local_binary_atomic_op<SDNode atomic_op> :
PatFrag<(ops node:$ptr, node:$value),
(atomic_op node:$ptr, node:$value), [{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::LOCAL_ADDRESS;
}]>;
class region_binary_atomic_op<SDNode atomic_op> :
PatFrag<(ops node:$ptr, node:$value),
(atomic_op node:$ptr, node:$value), [{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::REGION_ADDRESS;
}]>;
def atomic_swap_local : local_binary_atomic_op<atomic_swap>;
def atomic_load_add_local : local_binary_atomic_op<atomic_load_add>;
def atomic_load_sub_local : local_binary_atomic_op<atomic_load_sub>;
def atomic_load_and_local : local_binary_atomic_op<atomic_load_and>;
def atomic_load_or_local : local_binary_atomic_op<atomic_load_or>;
def atomic_load_xor_local : local_binary_atomic_op<atomic_load_xor>;
def atomic_load_nand_local : local_binary_atomic_op<atomic_load_nand>;
def atomic_load_min_local : local_binary_atomic_op<atomic_load_min>;
def atomic_load_max_local : local_binary_atomic_op<atomic_load_max>;
def atomic_load_umin_local : local_binary_atomic_op<atomic_load_umin>;
def atomic_load_umax_local : local_binary_atomic_op<atomic_load_umax>;
def mskor_global : PatFrag<(ops node:$val, node:$ptr),
(AMDGPUstore_mskor node:$val, node:$ptr), [{
return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS;
}]>;
class AtomicCmpSwapLocal <SDNode cmp_swap_node> : PatFrag<
(ops node:$ptr, node:$cmp, node:$swap),
(cmp_swap_node node:$ptr, node:$cmp, node:$swap), [{
AtomicSDNode *AN = cast<AtomicSDNode>(N);
return AN->getAddressSpace() == AMDGPUAS::LOCAL_ADDRESS;
}]>;
class AtomicCmpSwapRegion <SDNode cmp_swap_node> : PatFrag<
(ops node:$ptr, node:$cmp, node:$swap),
(cmp_swap_node node:$ptr, node:$cmp, node:$swap), [{
AtomicSDNode *AN = cast<AtomicSDNode>(N);
return AN->getAddressSpace() == AMDGPUAS::REGION_ADDRESS;
}]>;
def atomic_cmp_swap_local : AtomicCmpSwapLocal <atomic_cmp_swap>;
class global_binary_atomic_op_frag<SDNode atomic_op> : PatFrag<
(ops node:$ptr, node:$value),
(atomic_op node:$ptr, node:$value),
[{return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS;}]>;
multiclass global_binary_atomic_op<SDNode atomic_op> {
def "" : global_binary_atomic_op_frag<atomic_op>;
def _noret : PatFrag<
(ops node:$ptr, node:$value),
(atomic_op node:$ptr, node:$value),
[{return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS && (SDValue(N, 0).use_empty());}]>;
def _ret : PatFrag<
(ops node:$ptr, node:$value),
(atomic_op node:$ptr, node:$value),
[{return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS && (!SDValue(N, 0).use_empty());}]>;
}
defm atomic_swap_global : global_binary_atomic_op<atomic_swap>;
defm atomic_add_global : global_binary_atomic_op<atomic_load_add>;
defm atomic_and_global : global_binary_atomic_op<atomic_load_and>;
defm atomic_max_global : global_binary_atomic_op<atomic_load_max>;
defm atomic_min_global : global_binary_atomic_op<atomic_load_min>;
defm atomic_or_global : global_binary_atomic_op<atomic_load_or>;
defm atomic_sub_global : global_binary_atomic_op<atomic_load_sub>;
defm atomic_umax_global : global_binary_atomic_op<atomic_load_umax>;
defm atomic_umin_global : global_binary_atomic_op<atomic_load_umin>;
defm atomic_xor_global : global_binary_atomic_op<atomic_load_xor>;
// Legacy.
def AMDGPUatomic_cmp_swap_global : PatFrag<
(ops node:$ptr, node:$value),
(AMDGPUatomic_cmp_swap node:$ptr, node:$value)>, GlobalAddress;
def atomic_cmp_swap_global : PatFrag<
(ops node:$ptr, node:$cmp, node:$value),
(atomic_cmp_swap node:$ptr, node:$cmp, node:$value)>, GlobalAddress;
def atomic_cmp_swap_global_noret : PatFrag<
(ops node:$ptr, node:$cmp, node:$value),
(atomic_cmp_swap node:$ptr, node:$cmp, node:$value),
[{return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS && (SDValue(N, 0).use_empty());}]>;
def atomic_cmp_swap_global_ret : PatFrag<
(ops node:$ptr, node:$cmp, node:$value),
(atomic_cmp_swap node:$ptr, node:$cmp, node:$value),
[{return cast<MemSDNode>(N)->getAddressSpace() == AMDGPUAS::GLOBAL_ADDRESS && (!SDValue(N, 0).use_empty());}]>;
//===----------------------------------------------------------------------===//
// Misc Pattern Fragments
//===----------------------------------------------------------------------===//
class Constants {
int TWO_PI = 0x40c90fdb;
int PI = 0x40490fdb;
int TWO_PI_INV = 0x3e22f983;
int FP_UINT_MAX_PLUS_1 = 0x4f800000; // 1 << 32 in floating point encoding
int FP16_ONE = 0x3C00;
int FP16_NEG_ONE = 0xBC00;
int FP32_ONE = 0x3f800000;
int FP32_NEG_ONE = 0xbf800000;
int FP64_ONE = 0x3ff0000000000000;
int FP64_NEG_ONE = 0xbff0000000000000;
}
def CONST : Constants;
def FP_ZERO : PatLeaf <
(fpimm),
[{return N->getValueAPF().isZero();}]
>;
def FP_ONE : PatLeaf <
(fpimm),
[{return N->isExactlyValue(1.0);}]
>;
def FP_HALF : PatLeaf <
(fpimm),
[{return N->isExactlyValue(0.5);}]
>;
/* Generic helper patterns for intrinsics */
/* -------------------------------------- */
class POW_Common <AMDGPUInst log_ieee, AMDGPUInst exp_ieee, AMDGPUInst mul>
: AMDGPUPat <
(fpow f32:$src0, f32:$src1),
(exp_ieee (mul f32:$src1, (log_ieee f32:$src0)))
>;
/* Other helper patterns */
/* --------------------- */
/* Extract element pattern */
class Extract_Element <ValueType sub_type, ValueType vec_type, int sub_idx,
SubRegIndex sub_reg>
: AMDGPUPat<
(sub_type (extractelt vec_type:$src, sub_idx)),
(EXTRACT_SUBREG $src, sub_reg)
>;
/* Insert element pattern */
class Insert_Element <ValueType elem_type, ValueType vec_type,
int sub_idx, SubRegIndex sub_reg>
: AMDGPUPat <
(insertelt vec_type:$vec, elem_type:$elem, sub_idx),
(INSERT_SUBREG $vec, $elem, sub_reg)
>;
// XXX: Convert to new syntax and use COPY_TO_REG, once the DFAPacketizer
// can handle COPY instructions.
// bitconvert pattern
class BitConvert <ValueType dt, ValueType st, RegisterClass rc> : AMDGPUPat <
(dt (bitconvert (st rc:$src0))),
(dt rc:$src0)
>;
// XXX: Convert to new syntax and use COPY_TO_REG, once the DFAPacketizer
// can handle COPY instructions.
class DwordAddrPat<ValueType vt, RegisterClass rc> : AMDGPUPat <
(vt (AMDGPUdwordaddr (vt rc:$addr))),
(vt rc:$addr)
>;
// BFI_INT patterns
multiclass BFIPatterns <Instruction BFI_INT,
Instruction LoadImm32,
RegisterClass RC64> {
// Definition from ISA doc:
// (y & x) | (z & ~x)
def : AMDGPUPat <
(or (and i32:$y, i32:$x), (and i32:$z, (not i32:$x))),
(BFI_INT $x, $y, $z)
>;
// 64-bit version
def : AMDGPUPat <
(or (and i64:$y, i64:$x), (and i64:$z, (not i64:$x))),
(REG_SEQUENCE RC64,
(BFI_INT (i32 (EXTRACT_SUBREG $x, sub0)),
(i32 (EXTRACT_SUBREG $y, sub0)),
(i32 (EXTRACT_SUBREG $z, sub0))), sub0,
(BFI_INT (i32 (EXTRACT_SUBREG $x, sub1)),
(i32 (EXTRACT_SUBREG $y, sub1)),
(i32 (EXTRACT_SUBREG $z, sub1))), sub1)
>;
// SHA-256 Ch function
// z ^ (x & (y ^ z))
def : AMDGPUPat <
(xor i32:$z, (and i32:$x, (xor i32:$y, i32:$z))),
(BFI_INT $x, $y, $z)
>;
// 64-bit version
def : AMDGPUPat <
(xor i64:$z, (and i64:$x, (xor i64:$y, i64:$z))),
(REG_SEQUENCE RC64,
(BFI_INT (i32 (EXTRACT_SUBREG $x, sub0)),
(i32 (EXTRACT_SUBREG $y, sub0)),
(i32 (EXTRACT_SUBREG $z, sub0))), sub0,
(BFI_INT (i32 (EXTRACT_SUBREG $x, sub1)),
(i32 (EXTRACT_SUBREG $y, sub1)),
(i32 (EXTRACT_SUBREG $z, sub1))), sub1)
>;
def : AMDGPUPat <
(fcopysign f32:$src0, f32:$src1),
(BFI_INT (LoadImm32 (i32 0x7fffffff)), $src0, $src1)
>;
def : AMDGPUPat <
(f32 (fcopysign f32:$src0, f64:$src1)),
(BFI_INT (LoadImm32 (i32 0x7fffffff)), $src0,
(i32 (EXTRACT_SUBREG $src1, sub1)))
>;
def : AMDGPUPat <
(f64 (fcopysign f64:$src0, f64:$src1)),
(REG_SEQUENCE RC64,
(i32 (EXTRACT_SUBREG $src0, sub0)), sub0,
(BFI_INT (LoadImm32 (i32 0x7fffffff)),
(i32 (EXTRACT_SUBREG $src0, sub1)),
(i32 (EXTRACT_SUBREG $src1, sub1))), sub1)
>;
def : AMDGPUPat <
(f64 (fcopysign f64:$src0, f32:$src1)),
(REG_SEQUENCE RC64,
(i32 (EXTRACT_SUBREG $src0, sub0)), sub0,
(BFI_INT (LoadImm32 (i32 0x7fffffff)),
(i32 (EXTRACT_SUBREG $src0, sub1)),
$src1), sub1)
>;
}
// SHA-256 Ma patterns
// ((x & z) | (y & (x | z))) -> BFI_INT (XOR x, y), z, y
multiclass SHA256MaPattern <Instruction BFI_INT, Instruction XOR, RegisterClass RC64> {
def : AMDGPUPat <
(or (and i32:$x, i32:$z), (and i32:$y, (or i32:$x, i32:$z))),
(BFI_INT (XOR i32:$x, i32:$y), i32:$z, i32:$y)
>;
def : AMDGPUPat <
(or (and i64:$x, i64:$z), (and i64:$y, (or i64:$x, i64:$z))),
(REG_SEQUENCE RC64,
(BFI_INT (XOR (i32 (EXTRACT_SUBREG $x, sub0)),
(i32 (EXTRACT_SUBREG $y, sub0))),
(i32 (EXTRACT_SUBREG $z, sub0)),
(i32 (EXTRACT_SUBREG $y, sub0))), sub0,
(BFI_INT (XOR (i32 (EXTRACT_SUBREG $x, sub1)),
(i32 (EXTRACT_SUBREG $y, sub1))),
(i32 (EXTRACT_SUBREG $z, sub1)),
(i32 (EXTRACT_SUBREG $y, sub1))), sub1)
>;
}
// Bitfield extract patterns
def IMMZeroBasedBitfieldMask : PatLeaf <(imm), [{
return isMask_32(N->getZExtValue());
}]>;
def IMMPopCount : SDNodeXForm<imm, [{
return CurDAG->getTargetConstant(countPopulation(N->getZExtValue()), SDLoc(N),
MVT::i32);
}]>;
multiclass BFEPattern <Instruction UBFE, Instruction SBFE, Instruction MOV> {
def : AMDGPUPat <
(i32 (and (i32 (srl i32:$src, i32:$rshift)), IMMZeroBasedBitfieldMask:$mask)),
(UBFE $src, $rshift, (MOV (i32 (IMMPopCount $mask))))
>;
// x & ((1 << y) - 1)
def : AMDGPUPat <
(and i32:$src, (add_oneuse (shl_oneuse 1, i32:$width), -1)),
(UBFE $src, (MOV (i32 0)), $width)
>;
// x & ~(-1 << y)
def : AMDGPUPat <
(and i32:$src, (xor_oneuse (shl_oneuse -1, i32:$width), -1)),
(UBFE $src, (MOV (i32 0)), $width)
>;
// x & (-1 >> (bitwidth - y))
def : AMDGPUPat <
(and i32:$src, (srl_oneuse -1, (sub 32, i32:$width))),
(UBFE $src, (MOV (i32 0)), $width)
>;
// x << (bitwidth - y) >> (bitwidth - y)
def : AMDGPUPat <
(srl (shl_oneuse i32:$src, (sub 32, i32:$width)), (sub 32, i32:$width)),
(UBFE $src, (MOV (i32 0)), $width)
>;
def : AMDGPUPat <
(sra (shl_oneuse i32:$src, (sub 32, i32:$width)), (sub 32, i32:$width)),
(SBFE $src, (MOV (i32 0)), $width)
>;
}
// rotr pattern
class ROTRPattern <Instruction BIT_ALIGN> : AMDGPUPat <
(rotr i32:$src0, i32:$src1),
(BIT_ALIGN $src0, $src0, $src1)
>;
multiclass IntMed3Pat<Instruction med3Inst,
SDPatternOperator min,
SDPatternOperator max,
SDPatternOperator min_oneuse,
SDPatternOperator max_oneuse,
ValueType vt = i32> {
// This matches 16 permutations of
// min(max(a, b), max(min(a, b), c))
def : AMDGPUPat <
(min (max_oneuse vt:$src0, vt:$src1),
(max_oneuse (min_oneuse vt:$src0, vt:$src1), vt:$src2)),
(med3Inst vt:$src0, vt:$src1, vt:$src2)
>;
// This matches 16 permutations of
// max(min(x, y), min(max(x, y), z))
def : AMDGPUPat <
(max (min_oneuse vt:$src0, vt:$src1),
(min_oneuse (max_oneuse vt:$src0, vt:$src1), vt:$src2)),
(med3Inst $src0, $src1, $src2)
>;
}
// Special conversion patterns
def cvt_rpi_i32_f32 : PatFrag <
(ops node:$src),
(fp_to_sint (ffloor (fadd $src, FP_HALF))),
[{ (void) N; return TM.Options.NoNaNsFPMath; }]
>;
def cvt_flr_i32_f32 : PatFrag <
(ops node:$src),
(fp_to_sint (ffloor $src)),
[{ (void)N; return TM.Options.NoNaNsFPMath; }]
>;
let AddedComplexity = 2 in {
class IMad24Pat<Instruction Inst, bit HasClamp = 0> : AMDGPUPat <
(add (AMDGPUmul_i24 i32:$src0, i32:$src1), i32:$src2),
!if(HasClamp, (Inst $src0, $src1, $src2, (i1 0)),
(Inst $src0, $src1, $src2))
>;
class UMad24Pat<Instruction Inst, bit HasClamp = 0> : AMDGPUPat <
(add (AMDGPUmul_u24 i32:$src0, i32:$src1), i32:$src2),
!if(HasClamp, (Inst $src0, $src1, $src2, (i1 0)),
(Inst $src0, $src1, $src2))
>;
} // AddedComplexity.
class RcpPat<Instruction RcpInst, ValueType vt> : AMDGPUPat <
(fdiv FP_ONE, vt:$src),
(RcpInst $src)
>;
class RsqPat<Instruction RsqInst, ValueType vt> : AMDGPUPat <
(AMDGPUrcp (fsqrt vt:$src)),
(RsqInst $src)
>;
// Instructions which select to the same v_min_f*
def fminnum_like : PatFrags<(ops node:$src0, node:$src1),
[(fminnum_ieee node:$src0, node:$src1),
(fminnum node:$src0, node:$src1)]
>;
// Instructions which select to the same v_max_f*
def fmaxnum_like : PatFrags<(ops node:$src0, node:$src1),
[(fmaxnum_ieee node:$src0, node:$src1),
(fmaxnum node:$src0, node:$src1)]
>;
def fminnum_like_oneuse : PatFrags<(ops node:$src0, node:$src1),
[(fminnum_ieee_oneuse node:$src0, node:$src1),
(fminnum_oneuse node:$src0, node:$src1)]
>;
def fmaxnum_like_oneuse : PatFrags<(ops node:$src0, node:$src1),
[(fmaxnum_ieee_oneuse node:$src0, node:$src1),
(fmaxnum_oneuse node:$src0, node:$src1)]
>;
| 2024-03-15T01:27:04.277712 | https://example.com/article/2112 |
723 A.2d 1073 (1999)
Adam LYONS, a minor, and Robert Lyons and Diane Lyons, natural parents, and Robert Lyons and Diane Lyons, in their own right,
v.
PENN HILLS SCHOOL DISTRICT, Penn Hills Board of School Directors, Dr. Joseph Saeli, Superintendent, Penn Hills School District, Diane Page McKissick, Director of Secondary Education, Penn Hills School District, David Wilson, Principal, Linton Middle School and Kevin Bivins, Associate Principal, Linton Middle School, Appellants.
Commonwealth Court of Pennsylvania.
Argued November 19, 1998.
Decided January 8, 1999.
Reargument Denied February 22, 1999.
*1074 No appearance entered for appellants.
Marvin Miller, Pittsburgh, for appellees, Lyons.
Evalynn Welling, Pittsburgh, for intervenor, Education Law Center.
Before McGINLEY, J., FLAHERTY, J., and RODGERS, Senior Judge.
RODGERS, Senior Judge.
Penn Hills School District (District) appeals from the June 22, 1998 order of the Court of Common Pleas of Allegheny County (trial court) sustaining the appeal of Adam Lyons and his parents, Robert Lyons and Diane Lyons, from a decision of the Penn Hills Board of School Directors (Board). The Board's decision adopted a hearing officer's recommendation that Adam Lyons should be expelled from school for one year for a violation of the District's "zero tolerance policy." We affirm the trial court.
The following facts are summarized from the trial court's opinion. During the 1997-98 school year, twelve-year-old Adam Lyons was a seventh grade student at Linton Middle School. Lyons was an "A" student and a member of the chorus. On February 9, 1998, Lyons' instructor observed Lyons filing a fingernail with a miniature Swiss army knife he had found in a school hallway. The instructor requested Lyons to turn over the penknife and Lyons complied without incident. The knife was ultimately brought to the school's associate principal, who questioned Lyons about it. Lyons told the associate principal that he had found the knife and had intended to turn it over to his instructor.
By letter dated February 17, 1998, counsel for the District charged Lyons with possession of a weapon on February 9, 1998. The letter stated that Lyons' conduct violated the District's stated discipline code and weapons policy and could result in his permanent expulsion from the school.
A hearing was held on February 23, 1998, before a Board-appointed hearing examiner, at which Lyons' instructor, the associate principal, and the District's director of secondary education testified, and Lyons and his parents participated. The director of secondary education stated that the District does not permit weapons of any type on campus or at school functions. She testified that the knife in question constitutes a weapon under the District's "zero tolerance policy" and thus, a one-year suspension was warranted. She also stated that the disciplinary determination did not involve consideration of a student's record.
The District presented a signed acknowledgement by Lyons that possession of a weapon at school was prohibited and would result in an expulsion of not less than one year. No information on the District's discipline code or weapons policy was sent directly to parents.[1]
Following the hearing, the hearing examiner concluded that Lyons' possession of the penknife violated the District's discipline code and weapons policy. The hearing examiner opined that expulsion was a harsh result in this case, but concluded that he had no discretion to make an exception to the District's policy and had no alternative but to recommend expulsion for one year. The Board unanimously adopted the hearing examiner's recommendation and notified Lyons of its decision by letter dated March 11, 1998.
Lyons filed a timely appeal to the trial court, arguing that the District had violated his substantive and procedural due process rights. The trial court found that, while the District's "zero tolerance policy" had been adopted by vote, it had never been reduced to writing.[2] The trial court also noted that, while Lyons had signed an acknowledgement of the District's weapons policy, his parents had not been informed of the policy or that *1075 their son had signed an acknowledgement of it.
The trial court found that the District's unwritten "zero tolerance policy" failed to provide the superintendent with discretion to recommend a modification to the policy's one-year expulsion requirement for possession of a weapon. The trial court concluded that the Board disregarded the legislative mandate set forth in Section 1317.2 of the Public School Code of 1949 (School Code),[3] which provides that the superintendent of a school district may recommend modifications of expulsion requirements on a case-by-case basis. The trial court sustained Lyons' appeal, concluding that the policy was null and void on its face and could not be constitutionally applied.[4]
On appeal to this Court, the District argues that the policy adopted by the Board fully complies with Section 1317.2 of the School Code. In pertinent part, that section states as follows:
(a) Except as otherwise provided in this section, a school district or area vocational -technical school shall expel, for a period of not less than one year, any student who is determined to have brought onto or is in possession of a weapon on any school property, any school-sponsored activity or any public conveyance providing transportation to a school or school-sponsored activity.
(b) Every school district and area vocational-technical school shall develop a written policy regarding expulsions for possession of a weapon as required under this section. Expulsions shall be conducted pursuant to all applicable regulations.
(c) The superintendent of a school district or an administrative director of an area vocational-technical school may recommend modifications of such expulsion requirements for a student on a case-by-case basis.
24 P.S. §13-1317.2.
The District concedes that it has no written "zero tolerance policy." However, the District argues that Section 1317.2 of the School Code mandates that the Board expel a student who possesses a weapon on school property and that its policy comports with the act's requirements. The District further argues that the statute does not require a superintendent to recommend a modification of discipline, nor does it require the Board to follow the superintendent's recommendation. The District points out that the superintendent has a seat on the Board and a right to speak, but no right to vote.
The District also asserts that Lyons was not deprived of due process, because he had notice of the District's policy as well as a fair and formal hearing. The District contends that the Board's implementation of its policy was a matter committed by law to its discretion and cannot be interfered with unless its action was arbitrary or capricious.[5]
The District admittedly failed to comply with the requirement of Section 1317.2(b) of the School Code that it develop a written policy regarding expulsions of a weapon. More important, the District failed to provide its superintendent with the discretion to modify discipline that is granted to the superintendent by Section 1317.2(c) of the School Code. While the District's argument implies that the superintendent's participation in the adoption and implementation of school policy is minimal and without significance, the language of the statute reflects *1076 that the legislature recognizes otherwise. In addition, the District's argument contradicts the presumption that the legislature intends the entire statute to be given effect. Section 1922 of the Statutory Construction Act of 1972,1 Pa.C.S. §1922.
Clearly, the legislature recognized that circumstances could arise that would require an exception to be made to the mandatory expulsion provision of Section 1317.2. Thus, the legislature expressly authorized the superintendent of each school district to recommend a modification of that requirement on a case-by-case basis. Implicit in that grant of authority is a grant of permission to the Board to consider an alternative to expulsion based upon the recommendation of the District's superintendent.
A school board may not make rules which are outside their grant of authority from the General Assembly. 22 Pa.Code 12.3. We conclude that the Board exceeded its authority in adopting its "zero tolerance policy," which denies the superintendent, the Board and the students the exercise of discretion specifically provided by Section 1317.2 of the School Code and which frustrates the clear legislative intent that this statute not be blindly applied.
The District asserts that the trial court, in reaching its decision, impermissibly considered facts not of record, including the education and occupations of Lyons' parents and the family's religious practices. However, it is clear that the trial court's decision was based on its findings that, in adopting and implementing its "zero tolerance policy," the District failed to comply with the substantive and procedural requirements of Section 1317.2 of the School Code. Thus, we conclude that any reference to facts outside the record was harmless error.
Accordingly, the decision of the trial court is affirmed.
ORDER
NOW, January 8, 1999, the order of the Court of Common Pleas of Allegheny County is affirmed.
NOTES
[1] 22 Pa.Code 12.3 requires school district's to adopt a code of student conduct and distribute a copy of the same to students and parents.
[2] This fact was elicited from the District's counsel at an April 28, 1998 status conference, when the trial court requested the District to supply it with a copy of the policy.
[3] Act of March 10, 1949, P.L. 30, as amended, 24 P.S. §13-1317.2, added by Section 4 of the Act of June 30, 1995, P.L. 220.
[4] In addition, the trial court opined that, had the District's policy been properly drafted, an exercise of discretion would have been warranted in this case. The trial court cited the uncontradicted evidence that Lyons was an exemplary student, the knife was found by Lyons at the school and not brought there by him, Lyons never openly displayed the knife, but merely used it to file a fingernail with the file contained therein, and he turned it over willingly when asked to do so. Noting that Lyons' parents were college graduates and gainfully employed, that Lyons' sister is enrolled in college, and that all family members regularly attend church, the trial court further opined that this is not a family where the parents condone criminal activity on the part of their children, nor are the children the type who typically engage in that sort of activity.
[5] Section 510 of the School Code, 24 P.S. §5-510, provides that the school board may adopt and enforce reasonable rules and regulations as it may deem necessary and proper, regarding student conduct.
| 2023-10-27T01:27:04.277712 | https://example.com/article/3089 |
Action Mole Plough
Rata Hydraulic Action mole ploughs are designed for fast, efficient sub soil drainage where a suitable clay subsoil is found. Leaving a very clean entry and exit from the ground, the long robust frame with a full floating headstock allows for ground contour following.
Action Mole Ploughs are ideal for use in heavy clay soil where the tractor's 3 Point Linkage along cannot lift the mole from the ground, the blade on the Action Mole Plough moves forward to point upwards to you can simply drive it out.
Action Mole Ploughs are equipped with the Quickleg™ blade.
Designed to transfer ground water to field tiles or open drains in soils.
Product Gallery
Specifications
Model (Code)
Description
Max Working Depth (mm)
HYAN
Hydraulic Action Mole Plough c/w Quickleg™ blade & plug
450
Features & Benefits
1Quickleg™ Blade
The Quickleg™ blade design is a standard feature on Rata Mole Ploughs. Quickleg blades remove the need to pasture pre-cutters due to its unique self cleaning design. This enables you to mole plough faster and turn corners!
2Revolving Plug
The mole drain is created by this 75mm cast and hardened plug. This mole plug has the ability to revolve and float which ensures even wearing and allows it to follow natural contours of the ground.
3Ni-hard Winged Point
The leading edge of the Mole Plough is this cast Ni-hard winged point. Being cast Ni-hard ensures high wear resistance in abrasive soils while the point wings help get & keep the leg and plug into the ground.
4Twin RHS Frame
Rata Mole Plough's feature a heavy duty twin RHS box section frame with extensive gusseting and bracing, this twin RHS frame prevents twisting and flex while in the ground as found with other mole plough types.
5Easy Grease Access
All grease points on Rata Mole Plough's are located in easy to access areas, this ensures that maintenance is fast and trouble free. | 2023-11-13T01:27:04.277712 | https://example.com/article/3783 |
Q:
Is it correct to define the state as a variable (or property) inside a class?
I found in an open source project a class like this
class ComponentName extends React.Component{
state = {
somestate here
};
render() {
return <RenderedComponent value={somethings}>{some other things}</RenderedComponent>;
}
}
is it correct to define state in this way? Shouldn't it be defined inside the class's constructor?
A:
You don't always have to define a constructor for every class. So if you don't need to define a constructor it is fine to use the state this way.
| 2024-03-05T01:27:04.277712 | https://example.com/article/6911 |
Nytimes asks readers to stay with them - artur_makly
http://mobile.nytimes.com/2016/11/13/us/elections/to-our-readers-from-the-publisher-and-executive-editor.html
======
masonic
cover the 2016 election with agility and creativity
Isn't that exactly the problem -- getting a little too _creative_ rather than
objectively _reporting_?
------
generic_user
There is more unbiased analysis from RT (Russian Today) the Russian propaganda
network then there is in the Times at this point. That scares me but then
again the other American mainstream media is utter propaganda to I suppose its
only as bad as the rest at this point.
The Times lost credibility with there 'weapons of mass destruction' stories
which were used by Collen Powell and the Bush administration to gain the
support for the Iraq War. The weapons were never verified and over 500,000
Iraqis were killed, and counting. Haven't trusted them since.
------
hulahoof
_we aim to rededicate ourselves to the fundamental mission of Times
journalism. That is to report America and the world honestly, without fear or
favor_
While they are not alone it's a shame the MSM led itself down this path, I
don't feel their almost-admission of bias is going to save the trust.
I do look forward to watching how this unfolds and hope they can bring back
some respect to mainstream journalism.
| 2024-02-14T01:27:04.277712 | https://example.com/article/3204 |
Tag Archives: Corey Kluber
Below are THE BACKWARDS K 2016 FANTASY BASEBALL STARTING PITCHER RANKINGS (#1-30). Included for each player is “The Backwards K Quick Take” and a self-produced player projection for 2016.
***Please note the following:
The player’s names are color coded to signal different tiers at the position.
The rankings reflect standard 5×5 roto scoring settings (W/SV/ERA/WHIP/K) with position eligibility requirements as 10 total games played at a position in 2015, or 5 total games started at a position in 2015 (i.e. Yahoo! settings).
The numerical order is not necessarily a suggested order to draft them in, but it is the order that is calculated based on each player’s listed projections, unless noted otherwise.
Noted in some players’ “Quick Takes” is if they gain or lose notable value in points leagues that factor penalize hitter strikeouts and reward hitter walks.
A couple months ago on June 23 in part 1 of “Sometimes A Pitcher Is Only As Good As His Defense,” I took a look into the high BABIP’s (and subsequently inflated ERA and WHIP numbers) that several of the Cleveland Indians starting pitcher possessed and made the correlation that it was largely in part due to a poor defense that was playing behind those pitchers. At the time, the Indians had a very porous defense that was ranked 27th in DEF rating (a measurement system to reflect how many runs a team’s defense saves). But since then, the Indians have crawled all the way up to be right around a league average defense at 16th in DEF rating and out of the red and into the green with 0.5 runs saved on the season.
Surely there has to be some sort of underlying reason for the Indians improvement in defense, and one of the apparent factors was a player promotion. On June 14, the Indians promoted their top position prospect, Francisco Lindor, to the Majors to become their everyday starting shortstop in place of Jose Ramirez. Lindor had widely been known for his defensive wizardry coming up through the Indians Minor League system and he has most definitely brought that with him to the bigs as a 21-year old rookie. Out of all shortstops in the Majors (minimum 450 innings played), Lindor has the 8th highest DEF rating with 7.4 runs saved — and what makes this even more impressive is that he wasn’t even in the Majors for the first 2+ months of the season. For comparison, fellow top shortstop prospect, Carlos Correa of the Astros, was called up a week before Lindor and he ranks just 19th on the list with 2.7 runs saved despite making the highlight reel on a regular basis.
Another reason for the improved defense of the Indians on a more recent note has to be with the slew of trades that they made. At the non-waiver trade deadline on July 31, the Indians dealt away both Brandon Moss and David Murphy, and then they also traded Michael Bourn and Nick Swisher. Swisher was mostly used as a DH for the Indians so he’s not very relevant in this conversation, but Moss, Murphy, and Bourn are all players who played a good amount of games in the outfield for the Tribe and they all had negative scores in UZR/150. UZR/150 measures the runs above average per 150 defensive games. So surely, none of these players were doing anything of significance to earn a steak dinner from any of the Indians starting pitchers, and just removing them from the picture altogether has had to have been a nice change of pace on the defensive side of things for this ball club.
So with Cleveland Indians starting pitcher Danny Salazar having pitched another very solid game on Monday (7 IP, 4 H, 1 ER, 1 BB, 5 K with the W), the three Indians pitchers (Corey Kluber and Carlos Carrasco being the other two) who were battling inflated BABIP’s and poor overall statistics early on in the season have all been on a roll lately and have seen big improvements in their ERA, WHIP, and BABIP. Let’s take a look at each pitcher’s numbers in those categories since through June 23 (when I first wrote about this situation) and since June 23.
So as you can see, each of the three pitchers performed pretty similarly through June 23 and have also been in sync since June 23. That’s rather remarkable and is likely not all a coincidence. A good portion of the credit for their improvement since June 23 has to be given to the pitchers themselves for persevering through some rough times and for their skills as pitchers with great K/BB ratios, but this type of a turnaround likely would not have occurred without the improvement in their team defense. With the Indians’ new defensive arrangement going forward, these pitchers should be receiving a lot of help for the remainder of the season and make for elite fantasy plays.
The next big name on the move as the trade deadline nears is set to be Cole Hamels who will be heading to the Texas Rangers along with reliever Jake Diekman in exchange for starting pitcher Matt Harrison and a barrage of prospects that includes Jorge Alfaro, Alec Asher, Jerad Eickhoff, Nick Williams, and Jake Thompson.
The Philadelphia Phillies were in a good position to land a package that they wanted because Hamels is not just a 2-3 month rental for the remainder of this season. Instead, he is under contract through 2018 with a vesting option for 2019, so that meant that even non-contending teams could make a run for the 31-year old lefty and that’s exactly what happened with the 3rd place Rangers landing him. However, the Rangers are just 4 games back of the second AL Wildcard spot, so perhaps they even think that they could potentially contend for a post-season berth.
Hamels moves from the hitter friendly Citizens Bank Park to another hitter friendly stadium at Globe Life Park in Arlington, Texas. So there’s no real win or loss with the home park switch, but switching leagues from the National League to the American League should be perceived as a negative impact for Hamels’ fantasy value. His ERA, WHIP, and strikeout rate should all be expected to move in wrong directions, but that doesn’t mean that he still won’t be valuable. And there are some occasions where the NL pitcher moving to the AL doesn’t really see his stats suffer all that much, if at all.
The Rangers have had to endure a lot of injuries to their pitching staff this season, which kind of had them doomed from the get go once it was determined that their ace Yu Darvish needed to undergo Tommy John surgery before the season even began. So they likely have their sights set more on next season when Darvish hopefully returns before the All-Star break sometime. They hope that Hamels and Darvish can form a great 1-2 punch, though serious doubts should be had regarding Darvish and his control once he returns. All in all, it was a bold move for the Rangers who are starved for pitching, and Hamels will try to take the Rangers to the next level just like he did with the Phillies during the mid 2000’s when they had a great run.
Diekman, a left-handed reliever, has a poor 5.15 ERA and 1.75 WHIP this season, but he’s a power lefty that has some big time strikeout abilities and is under club control for a couple more years. He has the chance to develop into a nice bullpen piece for the Rangers if he can improve his walk rate.
Harrison should step right into the Phillies rotation, but his outlook shouldn’t really change a whole lot since he’s just rather mediocre and has been a walking injury the last two seasons. Three of the five prospects that the Phillies are receiving from the Rangers were ranked in the pre-season top 10 Rangers prospect list by Baseball America, so it appears that the Phillies did well and received a decent haul in return. But we’ll have to wait and see how they pan out. Continue reading →
Just who is Robbie Ray? You may remember has as part of a 3-player deal that occurred a couple months after the 2013 season ended where the Washington Nationals received Doug Fister from the Tigers in exchange for two pitching prospects, Ray and Ian Krol. At the time, it looked like a pretty nice fleece job done by the Nationals to acquire Fister’s final two arbitration seasons for a couple of pitching prospects that were pretty decent but didn’t have overly impressive numbers in the Minors up to that point.
Ray spent most of the 2014 season for the Tigers at AAA, but did log 9 appearances and 6 starts for the Major League squad. However, the 8.16 ERA and 1.88 WHIP in 28.2 IP along with an unimpressive AAA performance must have been enough for the Tigers to have seen from the lefty, as they then shipped him over to the Diamondbacks in a 3-team deal that netted them Shane Greene upon the conclusion of the 2014 season.
Ray arrived with the Diamondbacks and was assigned to AAA out of Spring Training where after 9 starts, he had a 3.67 ERA, 1.70 WHIP, and 57 K/27 BB in 41.2 IP. Ray struck out a lot of batters, but he also issued a ton of free passes and got hit pretty hard as well. So when the Diamondbacks called him up when the need arose, not much was to be expected of the 23-year old lefty, especially after his huge disappointment in Detroit.
With the strong 7 inning performance where he did not allow an earned run against the Rangers on Tuesday, Ray improved to 3-4 with a 2.16 ERA, 1.02 WHIP, and 38 K/12 BB in 50 IP. Those are some quality numbers and at first glance at his career numbers both in the Minors and Majors, it would be easy to dismiss this performance as a fluke. However, three things that we need to look at are his pitch velocity, arm slot, and pitch arsenal.
Last season, Ray’s average fastball velocity according to PITCHf/x data was 91.3 MPH, and that was with a few relief appearances worked in there (pitchers generally throw harder in relief because they don’t have to “save” their arm for the whole game). But this season in his time with the D-Backs, he’s averaged 93.3 MPH — a full two ticks higher on the radar gun. We see it so often how pitchers with increased velocity from one year to the next go on to have more success for the simple reason that harder thrown pitches are generally harder for batters to hit. Then looking at FanGraphs, we can see his release point from last year was higher and closer to his head than this year. In other words, he is pitching the ball from a lower arm slot that is more of a 3/4 motion than overhand. So perhaps Ray is finding much more comfort from a lower arm slot, and maybe it is even the reason why he is generating more velocity. But whatever it is, it seems to be working for him and is likely more than just a coincidence. Lastly, his pitch arsenal from last season had him throwing his slider just 3.5% of the time and his changeup 27.1%. But this season, he’s using his slider much more often at 17.1% while his changeup is down to 9.2%. Also, his slider appears to be much harder with a 4.2% velocity increase from last season.
So looking at these things, we are seeing a different Robbie Ray than before, which could arguably be the reasons why Ray is having much better luck this season. And while Ray is bound to regress from his excellent ERA and WHIP numbers that he is posting right now, he may not completely implode. His BABIP currently sits at .255, which is lower than the league average around .300, but as a fly ball heavy pitcher he should be able to post a lower BABIP as long as he’s not giving up a ton of line drives (which he’s not). Then his strand rate of 73.2% is slightly above the league average, but it’s certainly not crazy high. But where his regression should come primarily is in the form of more home runs allowed. As a fly ball pitcher, he can post below a below average BABIP, but that also should mean that he should allow home runs at a higher rate than his current 0.36 HR/9 mark — especially pitching his home games in a hitter friendly park at Chase Field. If he maintains his current strikeout and walk rates, then I could see Ray finishing the season around a 3.50 ERA and 1.15 WHIP, which would be much more than anyone expected from him.
As a 20-year old phenom, Marlins pitcher Jose Fernandez took the baseball world by storm by earning the 2013 NL Rookie of the Year Award with a 12-6 record, 2.19 ERA, 0.98 WHIP, and 187 K/58 BB in 172.2 IP. Big things were expected of him in 2014 and he showed much of the same in 8 starts to begin the season with a 4-2 record, 2.44 ERA, 0.95 WHIP, and 70 K/13 BB in 51.2 IP. But after that 8th start, it was learned that he would have to undergo Tommy John surgery, breaking the hearts of fantasy owners around the nation and Marlins fans…errr, nowhere.
A few weeks ago, the Marlins tabbed July 2 as the date that the now 22-year old Fernandez would take the mound in a Major League game for the first time in nearly 14 months. And for the most part, his rehab went pretty well so it was expected that Fernandez would step right in and make an immediate impact for the Fish.
So the day finally came on Thursday in front of the home crowd and it didn’t get off to such a hot start as Fernandez gave up 3 hits and a sacrifice fly in the 1st inning to fall behind 2-0. However, he settled down after that to allow a total of 3 runs on 7 hits and 0 walks in 6 innings while striking out 6. He also helped his own cause by smashing his 2nd career HR off Matt Cain, and he admired it for a few seconds before beginning to round the bases, giving Cain a good glare as he rounded first base. Fernandez hit the upper 90’s on the radar gun multiple times, getting as high as 99 MPH, and his average fastball velocity was right in line with what it was before the Tommy John surgery, which is obviously a great indication that he’s feeling great.
What we need to watch for though is how his command and control are in the next few starts. Pitchers in their first year back from Tommy John surgery tend to struggle in that area, especially when it’s just around 12-14 months after their last Major League game (as opposed to the 19-20 months that Matt Harvey had). However, Fernandez had good control to begin with, so any possible struggle wouldn’t take away too much from his game.
For the rest of the season, I’ll give Fernandez a line of 6 W-3 L, 3.04 ERA, 1.15 WHIP, and 88 K/25 BB in 80 IP.
About six weeks ago is when I first began suggesting that Fernando Rodney be removed from the closer’s role to make way for the young and more talented Carson Smith, and then I gave it a full rundown in the “BLOW-PEN Report” on May 23. Mariners manager Lloyd McClendon ended up giving Rodney a lot of leash because he likely didn’t want to have to remove Rodney as his closer, but McClendon finally saw enough. On June 6, Smith recorded his first career save in perfect fashion.
Since Smith took over as the team’s closer, entering Friday’s game, he had converted 5 straight save opportunities by pitching 5.2 innings allowing 2 runs on 2 hits and no walks while striking out 8. So he has been having little issue in finishing games stress free.
Since Rodney lost the closer’s role, entering Friday’s game, he has done much better, only being scored upon once in 5 outings for 1 run in 5.2 IP with 4 K/3 BB. In that small sample, it hadn’t been the best of performances, but clearly it was much better than what he had been doing in the 9th inning trying to close out games previously.
Friday night presented an interesting situation for the Mariners though as Smith was brought on in the middle of the 8th inning where he let Mike Trout and Albert Pujols reach base before getting a double play to end the inning for a total of 10 pitches thrown. And then Rodney was brought in for the 9th inning to try and close the game against the bottom part of the Angels order, and he successfully did so after allowing one hit.
Initially when I first called for the switch of closers in Seattle, I had said that Smith was the better pitcher but that McClendon would probably eventually give Rodney another opportunity to close if he proved that he was able to work out his issues in lower leverage situations. But then when Smith began to have so much success and displayed that he could potentially handle 9th inning duties with ease, I thought that Rodney would never be getting his job back. So the way things played out on Friday is a bit peculiar to me since Smith did nothing in the way of performance to give back the job.
However, in this game, the higher leverage situation was actually in the 8th inning with the Angels best hitters (and two of the best in the AL so far this season), Trout and Pujols due up. So the thought process for McClendon could have been that they really needed to get by Trout and Pujols before even thinking about seeing a save opportunity for the game, which meant that they needed to go to their best option. So then McClendon might have thought that once Smith got by the heart of the order, then Rodney could come in to a more ideal situation to face the weaker hitters and possibly instill some confidence in him should he finish the game cleanly.
So I am still going to have to believe that Smith is the closer until he blows some saves (fingers crossed that he doesn’t). Maybe Rodney will snipe some opportunities away like he did on Friday, but I see little reason why Smith shouldn’t remain the man for the job and I would be shocked and lose any faith I had in McClendon as a manager if he were to switch things back with no probable cause. But we will have to wait and see just what happens next.
After Danny Salazar suffered a meltdown in the 5th inning against the Tigers on Tuesday and I was simultaneously being asked by my brother what is wrong with Carlos Carrasco this season, I thought about both of those Indians pitchers, as well as rotation mates Corey Kluber and Trevor Bauer, and did a little digging and and discovered some interesting things.
Here is a look at each of these four Indians starting pitchers numbers in line drive rate (LD%), ground ball rate (GB%), fly ball rate (FB%), hard hit rate (Hard%), BABIP, ERA, and xFIP this season (I’m not including a 5th Indians SP because that 5th spot for them has been in flux all season long):
So what we see here is that Salazar, Carrasco, and Kluber are all more on the ground ball side of things while Bauer is a flyball pitcher. So we would expect the first three guys to to have higher batting average on balls in play (BABIP) marks because ground ball pitchers tend to almost always have higher marks than fly ball pitchers, because balls that are hit in the air for fly balls have a greater chance of being recorded for an out as long as it doesn’t leave the park. But what is odd is how high those marks are for those first three pitchers listed and it poses the question if there is something outside of their control that is affecting them since it is odd to see three pitchers from the same team with such inflated BABIP marks.
The league average BABIP is usually around .300 and the league average hard hit rate is around 30%. Salazar, Carrasco, and Kluber all rank in the top 20 in highest BABIP, but it is only Carrasco that appears in the top 20 highest hard hit rates and none of them appear in the top 20 highest line drive rates. Line drives account for a good portion of hard hit balls, and hard hit balls have a greater chance to fall in for hits, which would increase a pitcher’s BABIP. But if none of these three guys are really giving up a ton of line drives and it’s only really Carrasco who is getting hit harder than the average pitcher, why are their BABIP’s so much higher than the league average?
The answer here is the Indians team defense as a whole is just not very good and is costing these pitchers in ERA and WHIP. According to ratings, the Indians rank 27th in the Majors in defensive efficiency as their defense has cost them 13.8 runs so far this season, and their defense is likely the reason why the Indians have the 3rd highest team BABIP in baseball. It’s not that the Indians defense makes a lot of errors, but it’s more the fact that they lack range, defensive prowess, and the ability to prevent hits from getting in and runs from scoring. It could be attributed to poor defensive players, but it also could be attributed to poor defensive alignments set by the coaching staff and/or inefficient use of defensive shifts. Whatever it may be, the Indians had the same bad defense last year, but this year it seems to be affecting their starting pitchers more negatively.
What this means for the Indians pitchers (not named Bauer) going forward is that even though they have excellent xFIP marks (expected fielding independent ERA — measures what a pitcher’s ERA should be if defense was not a factor), huge improvements in ERA and WHIP in the near future are not necessarily a given. Yes, they all should receive some better fortune and see their numbers regress at least somewhat toward the mean, but a complete 180 turnaround may not be in the cards and it cannot be expected that their ERA’s get as low as their xFIP’s. However, something that may help is the recent promotion of defensive wizard Francisco Lindor to play shortstop for the Indians. One player isn’t likely to turn around the whole defense, but Lindor has always been praised for his glove work and can at least provide some positive value in helping to prevent hits and runs.
Two other teams that have high team BABIP marks that also rank very poorly defensively are the White Sox and Padres. The White Sox have the highest BABIP in all of baseball and have the lowest defensive rating to coincide with it. So this hurts guys like Jose Quintana, Jeff Samardzija, John Danks, and Carlos Rodon who all are more on the ground ball side of things. However, ace Chris Sale and his .283 BABIP appears to be skating by just fine (and should continue to) because he has been getting a lot of fly balls. As for the Padres, we knew going into the season that their defense would be questionable all around with a completely revamped outfield that consisted of some poorly rated defensive players, and an infield that also looked like it was going to have some issues. The Padres currently have the 6th highest team BABIP and rank 29th in defensive rating, so it should come as no surprise that heavy ground ball pitchers Tyson Ross and Andrew Cashner are having such abysmal seasons so far.
So these are examples of how a poor defense can affect a pitching staff, or more specifically individual pitchers with ground ball tendencies, and it should give some pause to whether or not these aforementioned pitchers can truly turn things around and post numbers to what their “expected” stats say that they should. I like Salazar, Carrasco, and Kluber, but this revelation does shine some poor light on their outlooks for the remainder of the season.
It would be remiss of me to not highlight what a marvelous performance Max Scherzer put on for the Nationals faithful on Saturday as the big time ace was nearly perfect, but ended up settling for the first no-hitter of his career. Scherzer came within one pitch of getting the incredibly rare perfect game, but he plunked Jose Tabata on the elbow to spoil the perfect game and subsequently led to a rather anti-climactic completion of a no-hitter. There will be much debate about whether or not Tabata leaned into the pitch to draw the bean ball, but from watching it I believe that he did try to move his arm away from the pitch instead of into the pitch. The elbow was being brought down and in toward his body and just so happened to get clipped by the pitch. That’s my story and I’m sticking to it, but it was still a brilliant effort by Max who continues to be a “Scher thing,” but I will refrain from using him as the headline material here since he was the headliner after his previous amazing start.
Instead, the headline here refers to Reds catcher Devin Mesoraco. Mesoraco truly busted out last season to fulfill his post-hype sleeper status by hitting .273 with 25 HR, 80 RBI, 54 R, and 1 SB. Much of the same was to be expected this season from the Mesoraco who just celebrated his 27th birthday. But a week into the season, he began to have an injury issue that was labeled as a hip impingement. Initially, he was labeled as “day-to-day” and was given some time to recover from the injury. Though he was unable to get into his crouch behind the plate to catch a full game, the Reds kept him around on the active roster and sporadically used him as a pinch hitter.
The next thing we know, for weeks pass by and Mesoraco made all but 8 pinch-hit appearances with no starts. That doesn’t exactly seem to be the most optimal usage of a roster spot on the 25-man roster and it was a wonder why the Reds didn’t just put him on the DL to begin with. For season long fantasy owners of Mesoraco, it was just false hope that was being fed and also a waste of a fantasy roster spot as much as it was a real life roster spot. At least if Mesoraco was put on the DL then fantasy owners who have DL eligible spots in their leagues could have slotted him there and picked up a replacement.
More time went on and Mesoraco DH’d when the Reds visited American League parks, but then finally on May 22, nearly six weeks after Mesoraco was first diagnosed with the injury, the Reds placed him on the DL and then put him through a rehab and hoped that his injury would subside with more time. Then the Reds had the idea of trying him out in the outfield since he was still unable to play catcher, so this provided fantasy owners yet again with some hope to squeeze any sort of value out of him this season. Unfortunately, this also turned out to be false hope.
Mesoraco was pulled off his rehab stint after looking pretty awful in the field and visibly still hobbled. And on Saturday it was announced that Mesoraco would finally undergo season-ending surgery to repair the ailing hip. So the whole ordeal ended up being almost a ten week process where he gave fantasy owners a whole 28 plate appearances for a .250 AVG, 0 HR, and 2 RBI. Congratulations, Reds management — you have successfully jerked around the fantasy baseball community to ruin fantasy teams’ seasons all cross the globe.
When the Nationals handed out a 7-year/$210 million contract to Max Scherzer, it definitely raised some eyebrows. Scherzer’s contract was only $5 million less than 2-time reigning NL Cy Young, Clayton Kershaw, but though Scherzer was obviously a great pitcher in his own right, he did not have the same dominant track record as Kershaw. Also, Kershaw was 26 years old when he signed his mega deal, while Scherzer was 30. So the Dodgers figure to get all of Kershaw’s best years in this contract (and already have received one of his best), but the Nationals will have Scherzer, barring a trade, through his age 36 season and he could very well begin to digress in a couple seasons.
But for the time being, Scherzer has been worth every penny and it is best exemplified in his near perfect start on Sunday at Milwaukee. Scherzer had a perfect game through 6 innings until Carlos Gomez hit a bloop single that barely got over the glove of a leaping Anthony Rendon at second base. Scherzer did not let that phase him though, as he went on to finish the rest of the game for a complete game 1-hit shutout with an amazing 16 strikeouts. If you’re into the game score stat, Scherzer finished with a game score of 100, which is the best pitching game of the season (Corey Kluber and Chris Heston both had 98) and it is the highest score since Kershaw’s score of 102 nearly one year ago when he pitched a no-hitter with 15 strikeouts. For the season, Scherzer is now 7-5 with a 1.93 ERA, 0.88 WHIP, and 113 K/14 BB in 93.1 IP.
We all knew that Scherzer was one of the best pitchers in the game coming into the year, but let’s take a look at what is making him even more amazing this season. First, and probably most important, is his huge improvement in his walk rate. Coming up through the Diamondbacks Minor League system, Scherzer was the typical hard throwing prospect with some control issues and he compiled a walk rate of 4.13 BB/9. When he first entered the Majors, he had a little bit below average control, but steadily improved over the years to be above average in the area, and his career best came in his 2013 AL Cy Young season with 2.35 BB/9. But this season, he has taken it to the next level with a current 1.35 BB/9. He is doing so by throwing a first pitch strike a whopping 70.3% of the time, which is the third highest in the league and is shattering his previous career best of 64.5%.
Another reason for his continued dominance is that he is working with a lowered BABIP of .268, but even though that mark is much lower than his career rate of .303, there is some belief to it given that he is inducing more fly balls than ever this season being in the top 5 in the Majors in fly ball rate and fly ball/ground ball ratio. Fly ball pitchers are able to maintain a lower BABIP than ground ball pitchers because fly balls are more easily caught for sure outs. And even though he is allowing more fly balls, not many of them are leaving the stadium for home runs as he has allowed only 6 in 13 starts.
With these improvements this year, Scherzer is going to be able to continue to baffle hitters in his first season in the National League and is looking like as “Scher” of a thing as any pitcher out there. It is going to be a great race for the NL Cy Young.
Being a former semi-professional online poker player back in the good ol’ Party Poker days, I surely have had my fair share of bad beats, and I have given bad beats as well. But I don’t think any of those bad beats I received will match up to the one I suffered on Wednesday on DraftKings.
In the $80K Guaranteed Moonshot tournament ($3 entry fee), I entered 6 lineups with all of them containing at least 1 player from the Coors Field game between the Dodgers and Rockies. Games at Coors Field obviously have increased total offense due to thin air, so hitters playing games there are going to be good guys to target. Three of my lineups were full 5-6 player stacks of either the Dodgers or Rockies offense, and in the other 3 lineups I had sprinkled in some of those players.
However, about 15 minutes before the first game was about to start, I got a notification of some inclement weather in Denver so there was a decent chance of the game getting postponed. After some deliberation, I told myself and a couple friends that I would chance it and keep all my lineups as they were. But then at the very last minute, I ended up switching just one of the 6 lineups where I substituted in Jason Kipnis and Mike Aviles for Martin Prado and Troy Tulowitzki.
As the evening progressed, I was in 1st place out of the 30,651 entrants around the 8:00 PM hour, but with Kipnis and Aviles not having done much, I knew that I was in for a sad night with Tulowitzki still on the slate as the Dodgers and Rockies game battled a couple of rain delays but the game would go on as scheduled. Tulowitzki ended up having a monster game and it turns out that if I did not edit that one lineup at the very last minute, then I would have ended up getting 1st place and taken down the $5,000 prize.
What is the most disappointing about it all is that it wasn’t a bad beat suffered at the hands of another DFS player, it was a bad beat that I gave to myself. If I had just trusted myself then I would have been that much richer. But so it goes. Lesson learned to trust my instincts, and I’ll take a tourney down one of these days.
With the Red Sox far out of playoff contention last season as the trade deadline approached, they shipped Andrew Miller, who was set to become a free agent, to their division rivals, the Baltimore Orioles, for left-handed pitching prospect Eduardo Rodriguez. In order for the Red Sox to deal Miller to the Orioles, they would only accept Rodriguez in any deal and on Thursday we got a glimpse of why the Red Sox were so adamant in getting him. Making his Major League debut, Rodriguez went 7.2 scoreless innings, allowing just 3 hits and 2 walks while striking out 7 Rangers batters.
Rodriguez spent all of 2014 in AA where he had a 4.05 ERA, 1.31 WHIP, 8.10 K/9, and 2.77 BB/9 in 120 IP. Those weren’t the greatest of numbers, but for a 21-year old at AA, he surely held his own. But what’s not seen in those numbers is how he began to really thrive once he did get traded over to the Red Sox organization, as he had a 0.96 ERA, 1.02 WHIP, 9.40 K/9 and 1.93 BB/9 after the trade.
Before being called up for this start on Thursday, Rodriguez had been pitching at AAA where he had a 2.98 ERA and 1.10 WHIP in 48.1 IP while displaying that same nice blend of strikeout potential (8.19 K/9) and excellent control (1.30 BB/9) that he had at AA for the Red Sox last year.
A lot of the pitching prospects that get hyped up seem to be high strikeout guys who have battled control issues such as Taijuan Walker, Archie Bradley, and Carlos Rodon, and the problem with those types of pitching prospects is that they do not usually have immediate success in the Majors. Sure they will have an occasional dazzling game, but overall they just often have a mixed bag of results. But then you get someone who comes along like Noah Syndergaard who never has dealt with control issues who can come along and be successful on a much more consistent basis right away in the Majors.
Rodriguez would seem to be more in the vein of Syndergaard than those other young arms thanks to his great control, and he could have a shot at some early success as a Major Leaguer. He’s not as strikeout dominant as Syndergaard, but there is a lot to like about him. Watching his start on Thursday, he was very efficient with his pitch count, throwing a lot of strikes and working in and right around the zone, and he seemed especially tough on the Rangers left-handed bats. He’s still a very young pitcher though, so he’s most likely going to run into some struggles, but out of rookie pitchers I do value the type of control that he can bring.
But what remains to be seen is whether or not he sticks in the Red Sox rotation. His start on Thursday was supposed to be nothing more than a spot start, but the Red Sox have dealt with some big time issues on the pitching front. There’s not really one of their starting pitchers who has had a good season, but the name that comes to mind when talking about Rodriguez potentially replacing someone is Joe Kelly. If the Red Sox are serious about contending this year, then they have to give some long thought to putting Rodriguez in the rotation for good.
For fantasy purposes, Rodriguez would have immediate value if he is inserted into the rotation for a longer look and I definitely would recommend him as someone to pick up.
After suffering a season-ending neck injury last season that limited him to just 42 games in his first season as a Texas Ranger, first baseman Prince Fielder has not missed a game this season and has already surpassed last year’s games played total this year by playing in his 43rd consecutive game on Saturday. Fielder actually has been sort of a modern day iron man, not like the Tony Stark version of Iron Man, but like Cal Ripken Jr. and his incredible games played streak. Nobody will ever come close to Ripken’s amazing streak in this day and age where players are babied a lot more, but Fielder has played in all 162 games in 4 of his 9 full seasons and never having played less than 157 games in a season until the unfortunate neck injury from last year.
Given his nearly immaculate health history, it should come as no surprise that Fielder has roared back with a vengeance, but many (myself included) had doubts about his ability to. Here is what I said about him in the pre-season: “Players of his body type do not have a history of aging well as they reach 30 years old (see Cecil Fielder, Mo Vaughn, Ryan Howard), and Prince was already beginning a decline before he got traded to Texas before the 2014 season. Of course his 2014 season was a lost cause as he struggled out of the gate and then had a season-ending neck injury. A bounce back effort could be in store for the big guy, especially with a full season calling the Ballpark in Arlington his home, but I would also not be surprised if he never hits 30 HR in a season ever again.”
Fielder is making me eat my words as much as he eats tofu burgers (which is likely a lot since he is reportedly a vegetarian), as he is on an incredible terror hitting .368 with 6 HR and 17 RBI in the month of May. The outburst has brought his season line to .351 AVG, 8 HR, 30 RBI, 20 R, and 0 SB, putting him amongst the top first baseman in fantasy baseball. His batting average is inflated due to a .364 BABIP, and his batted ball profile shows us that there is no significant differences to his career rates to tell us that he can maintain an batting average this far over .300. However, he is putting the ball in play at a career high rate as he has only struck out 11.1% of the time. Fielder has shown improvement in this area over the recent years, and in 2012 his very good strikeout rate of 12.2% allowed him to hit for a career high .313 AVG.
While there’s no doubt that his BABIP will come down, with the excellent rate he is putting the ball in play, Fielder may have little issue hitting .300 for the second time in his career. His walk rate is also significantly down to 6.3% (compared to his career rate of 12.8%), but that’s not too much of a concern when his strikeout rate is low as well. As for his power, Fielder’s HR/fly ball rate has been on the decline since 2011, but his rate this season is right around 14.0%, which is very comparable to his 13.5% rate in 2013 with the Tigers and it is around that mark that I expect him to settle in at by season’s end. It’s not the 35-40 HR that was expected from him in his prime, but 25-30 HR for the season is still going to be quality and he is on pace for defeating most people’s expectations of him for the 2015 season.
For the remainder of the season, I will give Fielder the line of: .294 AVG, 19 HR, 73 RBI, 60 R, 1 SB
After the Marlins increased their payroll by about 50% over the off-season with the acquistion of players such as Martin Prado, Dee Gordon, Dan Haren, and Mat Latos and the free agent signings of Mike Morse, Ichiro Suzuki, the Marlins front office was expecting the team to be competitive in the NL East as they surrounded their young rising starts Giancarlo Stanton, Christian Yelich, and Jose Fernandez (rehabbing from Tommy John surgery) with some strong veteran presences. But after being nearly no-hit on Sunday, the Marlins fell to a 16-22 record and manager Mike Redmond was relieved of his duties after taking over as the club’s manager to begin the 2013 season.
Reports circulated the internet hours after the firing of Redmond with former Marlins player Jeff Conine being brought up as the next manager of the team. However, those reports were later debunked and the Marlins were just letting everyone know that Monday morning they would make an announcement on who the next manager would be. Well, when the time came, they made a shocking if not absolutely crazy declaration of Dan Jennings as their new manager.
Jennings had been the general manager of the Marlins, the man responsible for all of the off-season trades and signings, which included handing out the ridiculously insane 13-year/$325 million mega contract to Stanton. So this is the team that he built, the team that he hand-picked with the belief that they could be winners. But with no professional coaching or player experience to speak of, this has to be the oddest managerial hiring ever (if you can even call it a hiring, since he was the GM — did he hire himself?). It reminds me of Major League II when retired third baseman Roger Dorn purchases the Cleveland Indians from the previous owner Rachel Phelps, but in the middle of the season when the team is in a big slump and Dorn is losing lots of money, he sells the team back to Phelps but stays on as the GM and activates himself as a player. In the movie it worked out for the team since they won the pennant, but I don’t anticipate this going over well for the Marlins. But at the very least, it should be an interesting experiment to follow and if by chance it is successful, it could actually be groundbreaking and make Jennings the pioneer of a movement of hiring baseball “minds” as coaches and managers as opposed to ex-players or current/former coaches.
For fantasy purposes, I don’t see this having a huge impact on any of the Marlins players. But it is also hard to say since nobody, not even Jennings himself, knows his managerial style. We will have to give it a couple weeks to see what Jennings tendencies might be when it comes to things like aggression on the base paths and lineup construction.
At times, veteran left handed pitcher Bruce Chen, the “Panamaniac” (I just made that up because he’s from Panama, nobody really calls him that I don’t think — but maybe) shockingly mystified lineups with his soft-tossing ways. When there was a need for a starting pitcher a couple weeks ago in the Cleveland rotation, the Indians summoned Chen from their AAA affiliate in hopes that he could string together something pretty by lullabying hitters to sleep with his 84-85 MPH fastballs (don’t be jealous Jered Weaver). After two disaster starts versus the Twins and Rangers that left him with a 12.79 ERA and 3.94 WHIP, the Indians gave Chen the good ol’ DFA (designated for assignment) boot on Saturday. With the vacancy in the rotation, who will the Tribe turn to next? It’s hard to say at the moment, but let me introduce you to Zach McAllister.
McAllister is a big righty listed at 6’6″ 240 lbs. and he began his professional career with the Yankees before being the player to be named later that the Indians received as compensation for trading Austin Kearns to New York in 2010. McAllister was never a glamorous prospect, but the Indians gave him extended looks in their starting rotation in each year from 2012-14. In all his starts from those seasons, McAllister compiled a 4.36 ERA, 1.39 WHIP, 7.33 K/9, and 3.06 BB/9 over 332.2 IP, which by most regards made him a below average starting pitcher. At the end of July of 2014, the Indians decided they had seen enough of him as a starting pitcher and sent him down to the Minors before recalling him in September to be a bullpen arm.
Upon being used out of the bullpen, McAllister proved to be pretty useful as he had a 2.57 ERA, 1.07 WHIP, and 14 K/2 BB in 14 relief innings in September. As it usually tends to happen when starting pitchers get moved to the bullpen since they don’t have to “save” their arm to go more than a couple innings usually, McAllister experienced a bump in his velocity. And during that bullpen stint, he actually did make one good spot start where he maintained the velocity gain throughout that game too, which was a pleasant surprise. Continue reading →
Heading into each and every fantasy year is an adventure with Colorado Rockies shortstop Troy Tulowitzki. He is like that super hot, yet somehow kind of trashy, girl you meet at the bar that is all over you and you so badly want to take her back to her home (because hey, you don’t want her knowing where you live, right?) to have some silly bedtime fun with, but you know that maybe you shouldn’t because she might be carrying three different kinds of STI’s (yes, STI is the more proper abbreviation/term than STD with the “I” standing for infection — cue the jingle ***The more you know). When pondering on whether or not to draft Tulo, even if he falls to you at a value spot, you know that he will provide some great production (the amazing bedtime fun), but later on down the road he is going to hit the DL with some season-ending injury (the discovery of the contraction of multiple STI’s).
This season though, Tulo is not even providing that instant gratification. On the bright side of things though, he isn’t giving anyone any STI’s either. He’s just vomiting all over you after having one too many cosmos. After Thursday night’s ugly 0 for 5 with 3 K performance, he is hitting .289 with 2 HR, 11 RBI, 16 R, and 0 SB through 31 games played. And there were rumblings of Tulo wanting to request a trade, but if you are the brave soul who took a chance on this super hot yet kind of trashy player, you don’t want him to get traded. You want him to stay where the air is thin in Colorado as he has a career home line of .322/.395/.563 versus a career road line of .275/.347/.468. Thankfully, Tulo shut down those rumors by saying he is not demanding a trade at this time. However, that does not mean he will not demand one later this season.
But what is going on with the All-Star shortstop? How come Tulo is hitting too low? Well for starters, that abysmal strikeout to walk ratio of 28 K/2 BB is doing him no favors. Tulo is a hitter that has displayed above average walk rates in his career with a career walk rate of 9.9%, and even more so in recent years with 11.1% and 13.3% in 2013-14. But he appears to be jumping out of his cleats to swing at the ball, and when he is swinging at the ball he is failing to make contact like he has in the past. Additionally, he is pulling the ball a lot more than usual at 52.3% versus 41.2% career rate, instead of using all parts of the field.
So in a nutshell, Tulo is being overly aggressive at the plate, which is putting himself into some poor hitter’s counts that he is failing to do anything with. In terms of AVG and lack of HR, Tulo has endured poor streaks like this before, but he’s never had such a stretch where his strikeout and walk rates have been so bad, and that is what worries me the most about Tulo going forward. The Rockies do have an 8-game homestand hosting the Phillies and Giants beginning next week, so if he cannot get things going by the end of that then it’ll be even more troubling. Own him in fantasy at your own risk. | 2023-08-08T01:27:04.277712 | https://example.com/article/8539 |
382 So.2d 1262 (1980)
GENERAL MATTERS, INC., d/b/a York Associates, Appellant,
v.
PARAMOUNT CANNING COMPANY, Garden Gold Foods, Inc., and Suncoast Canning Corporation, Appellees.
No. 79-588.
District Court of Appeal of Florida, Second District.
April 9, 1980.
Charlie Luckie, Jr. and John W. Campbell of Macfarlane, Ferguson, Allison & Kelly, Tampa, for appellant.
John W. Frost, II, and Charles W. Dodson of Holland & Knight, Bartow, for appellees.
*1263 SCHEB, Judge.
A grocery retailer destroyed a shipment of allegedly defective canned grapefruit sections which it had purchased from York Associates, a food broker. The grapefruit had been canned by Suncoast Cannery Corporation and distributed by Paramount Canning Company. Neither York nor the retailer gave Suncoast or Paramount any notice that the goods were defective prior to their destruction. York agreed to indemnify the retailer for its losses and then sued Paramount and obtained a judgment for damages.
Despite its failure to notify Paramount prior to destruction of the goods, can York recover damages from Paramount for breach of implied warranty of merchantability? We hold that York's failure to notify Paramount bars it from any remedy. We reverse the judgment for York entered by the trial court.
During 1974 Suncoast canned and stored 3500 cases of the grapefruit sections. In April 1976 Paramount's agent, Dingfelder, looking for canned grapefruit, contacted Suncoast. Suncoast's agent told Dingfelder of the grapefruit canned in 1974 explaining, however, that it was nearing two years old. Paramount purchased the lot and sold it to York shortly thereafter. York, in turn, sold the goods to Country Club Markets, a grocery retailer in Minnesota, without informing Country Club of the age of the goods.
After Country Club had sold 1,675 cases of the canned grapefruit in its supermarkets, some of the cans developed swells. After several customer complaints, the Minnesota Department of Agriculture determined that "the product should not be sold for human food."[1] At this point, Country Club, without notifying either Paramount or Suncoast, destroyed the remaining 1,825 cases. Country Club, the retailer, then billed York for its cost of the destroyed merchandise plus the cost of destruction. In response, York agreed to discount future purchases by Country Club until it had absorbed Country Club's losses.
York sued Paramount seeking damages for breach of implied warranty of merchantability alleging that the goods did not have a reasonable shelf life. Paramount filed a third-party complaint against Suncoast. Prior to trial Suncoast agreed to defend and indemnify Paramount in the action by York. Paramount, through Suncoast, answered and asserted that York was barred from recovery because neither it nor its purchaser, Country Club, notified Paramount of the alleged breach prior to destruction of the goods.
Following a nonjury trial the court entered judgment for York. It found that Paramount had breached its implied warranty to York as to those cans which were swollen at the time they were destroyed. Nevertheless, it limited York's recovery to the amount that York had actually given as a credit to Country Club at the time of trial because York had not joined Country Club as an indispensable party. The court further reduced that recovery since York had failed to notify Country Club of the age of the product, and because a percentage of the product was still marketable when Country Club destroyed it without notice.
On appeal York contends that the judgment should have compensated it for the full amount of its assumed obligation to Country Club. Paramount cross-appeals and argues that because neither Country Club nor York gave notice of the alleged breach until after destruction of the goods, York is barred from any remedy under Section 672.607(3)(a), Florida Statutes (1979) (U.C.C. § 2-607[3][a] [1972 version]).
We address the cross-appeal first because our disposition of it obviates discussion of the merits of York's appeal. Section 672.607(3)(a), Florida Statutes (1979), provides that "[t]he buyer must within a reasonable time after he discovers or should *1264 have discovered any breach notify the seller of breach or be barred from any remedy." This notice requirement is a valid precondition of imposing liability on a seller of goods.[2]Eastern Airlines, Inc. v. McDonnell Douglas Corp., 532 F.2d 957 (5th Cir.1976); see Dunham-Bush, Inc. v. Thermo-Air Service, Inc., 351 So.2d 351 (Fla. 4th DCA 1977); Redman Industries v. Binkey, 49 Ala.App. 595, 274 So.2d 621 (1973); L.A. Green Seed Co. of Arkansas v. Williams, 246 Ark. 463, 438 S.W.2d 717 (1969). Further, the burden is on the plaintiff to show that he gave the required notice within a reasonable time. Standard Alliance Industries, Inc. v. Black Clawson Co., 587 F.2d 813 (6th Cir.1978), cert. denied, 441 U.S. 923, 99 S.Ct. 2032, 60 L.Ed.2d 396 (1979); L.A. Green Seed Co. of Arkansas v. Williams, 246 Ark. 463, 438 S.W.2d 717 (1964). Here, the evidence disclosed that Country Club voluntarily destroyed the canned grapefruit in the latter part of July 1977. The first notice of the alleged breach to either Paramount or Suncoast was an August 1 letter from the president of York to Dingfelder of Paramount.
There are several important reasons for the notice requirement of Section 672.607(3)(a). The notice enables "the seller to make adjustments or replacements or to suggest opportunities for cure to the end of minimizing the buyer's loss and reducing the sellers' own liability to the buyer." The notice requirement also protects the seller's right to inspect the goods. J. White & R. Summers, Uniform Commercial Code § 11-9 at 344 (1972); see Note, Notice of Breach and the Uniform Commercial Code, 25 U.Fla.L.Rev. 520 (1973). Section 672.515, Florida Statutes (1979) (U.C.C. § 2-515 [1972 version]), which codifies the inspection rationale, provides that either party may inspect, test and sample the goods including those in the possession or control of the other for the purpose of ascertaining the facts and preserving the evidence. See Owen v. Sears, Roebuck & Co., 273 F.2d 140 (9th Cir.1959).[3]
York contends that notice after destruction of the goods constituted reasonable notice under Section 672.607(3)(a). It argues that notifying Paramount prior to destruction would have served no purpose since the Minnesota Department of Agriculture had stated that the food should not be sold for human consumption. We find York's argument unpersuasive. First, the Minnesota Department of Agriculture did not order destruction of the goods.[4] Moreover, while the findings of the Department were entitled to great weight, they were not conclusive, and Paramount was entitled to an opportunity to verify them. York's destruction of the goods prior to notifying Paramount prevented this and impeded any possible settlement of the controversy. It also impaired Paramount's ability to determine if the goods were, in fact, marketable and, consequently, hindered it in preparing its defense.[5]
Accordingly, York's failure to notify Paramount of the alleged breach prior to destruction ran counter to the purposes of Section 672.607(3)(a), Florida Statutes (1979), and barred York from any remedy for the alleged breach. Therefore, we vacate *1265 the judgment in favor of York Associates and direct the trial court to enter judgment in favor of Paramount Canning Company and Suncoast Cannery Corporation.
HOBSON, Acting C.J., and DANAHY, J., concur.
NOTES
[1] The Department found that 12.7% of the cans in its sample of five and one-half cases were puffed. Of eleven cans submitted for laboratory analysis, nine showed slight corrosion on the inside, two were moderately corroded, five contained flat spores and two contained carbon dioxide gas.
[2] We note that this suit does not involve the applicability of the notice provision when a consumer files a tort action. For a discussion of the applicability of the notice provision under those circumstances, see J. White & R. Summers Uniform Commercial Code § 11-9 at 345 (1972).
[3] Owen applied the notice provision of the Oregon Uniform Sales Act, Or. Rev. Stat. § 75.490. This section is identical to Section 672.607(3)(a), Florida Statutes (1979).
[4] There are cases where summary destruction of contaminated items may be required. See Conner v. Carlton, 223 So.2d 324 (Fla. 1969). This was not the case here, however, because the Department did not find that the canned goods, as such, were dangerous, but that their consumption was dangerous. Thus, there was no necessity to summarily destroy the goods.
[5] We note that although some courts have waived the notice requirement, they have done so only when failure to give notice resulted in no prejudice to the seller. See, e.g., Pritchard v. Liggett & Myers Tobacco Co., 295 F.2d 292 (3d Cir.1961); Note, Notice of Breach and the Uniform Commercial Code, 25 U.Fla.L.Rev. 520, 522 n. 15 (1973).
| 2023-12-10T01:27:04.277712 | https://example.com/article/6737 |
Q:
CSS fluid layout and dropping divs
I am struggling with a fluid css that drops divs as the browser window shrinks.
Here is a jsfiddle of the code
http://jsfiddle.net/maf1984/1r4v8fcf/
*{
padding : 0;
margin : 0;
border : 0;
}
.blended_grid{
display : block;
width: 100%;
min-width: 400px;
max-width: 1000px;
overflow : auto;
margin : auto;
}
.header{
float : left;
width: 100%;
height : 100px;
background-color : rgba(137,255,132,0.4);
}
#contentliquid {
float: left;
width: 100%;
}
.maintopblock{
float : left;
margin-left: 200px;
width : 80%;
height : 200px;
background-color : rgba(33,28,255,0.4);
}
.cube1{
float : left;
margin-left: 200px;
width : 20%;
height : 200px;
background-color : rgba(255,123,161,0.4);
}
.cube2{
float : left;
width : 20%;
height : 200px;
background-color : rgba(255,158,132,0.4);
}
.cube3{
float : left;
width : 20%;
height : 200px;
background-color : rgba(254,255,147,0.4);
}
.cube4{
float : left;
width : 20%;
height : 200px;
background-color : rgba(189,255,155,0.4);
}
.mainbottomblock{
float : left;
width : 40%;
height : 400px;
margin-left: 200px;
background-color : rgba(33,28,255,0.4);
}
.cube5{
float : left;
width : 20%;
height : 200px;
background-color : rgba(132,197,255,0.4);
}
.cube6{
float : left;
width : 20%;
height : 200px;
background-color : rgba(111,108,255,0.4);
}
.cube7{
float : left;
width : 20%;
height : 200px;
background-color : rgba(0,139,255,0.4);
}
.cube8{
float : left;
width : 20%;
height : 200px;
background-color : rgba(147,0,255,0.4);
}
.sidebar{
float : left;
width : 200px;
height : 800px;
margin-left: -100%;
background-color : rgba(249,255,4,0.4);
}
.footer{
float : left;
width: 100%;
height : 100px;
background-color : rgba(133,255,123,0.4);
}
Based on the jsfiddle, I am trying to keep boxes 1, 2, 3, and 4 just below the top section all together (not dropping into main), and boxes 5, 6, 7, and 8 together as they are as well, next to the main block (not dropping below main).
I have searched long for a solution, many tutorials and layout generators. How can I keep the numbered boxes from dropping as the browser shrinks?
A:
You are going to need to do some math :)
You are currently setting 20% of the total width, however you need to set 20% of the width minus the 200px margin. like this:
width : calc((100% - 200px) / 4);
See fiddle http://jsfiddle.net/1r4v8fcf/1/ I only updated the first 4 div's but you can add the rest :)
| 2024-04-27T01:27:04.277712 | https://example.com/article/6731 |
Ten Things That Look Wrong in Internet Explorer
Be sure to check out my blog post What's Wrong with Internet Explorer? for more details!
The following problems are present in Internet Explorer version 7 (which is the latest stable version as of March 2, 2009) as well as in earlier versions. They are not present in other web browsers such as Mozilla Firefox, Opera, Safari, or Google Chrome. This is because Microsoft chose to program Internet Explorer in such a way that it breaks important rules of the web while other web browsers follow the rules as they should. As stated in my blog post, Internet Explorer breaks far, far more rules than just ten. The point of this page is to make it easy for the average person to see the problems. For a much more technical and exhaustive list of things wrong with Internet Explorer, see this page.
Problem #1 and #2:
The following table should have thick black borders and its caption should be below the table:
This is the caption for the table. Table heading 1 Table heading 2 Table cell 1 Table cell 2
Problem #3 and #4:
The following line should be green and it should not be centered:
Problem #5:
There should be no red line below this text.
There should be no red line above this text.
Problem #6:
This line of text should not have a red background.
Problem #7:
There should be a blank space below this box. You should not be seeing this red box!
Problem #8:
This text should have a white background.
Problem #9:
This text should be at the very bottom of the box.
Problem #10: | 2023-08-14T01:27:04.277712 | https://example.com/article/9022 |
[Dystrophinopathy and Seizure].
Dystrophinopathy is associated strongly with central nervous system manifestation. It has been reported that 4%-15% of patients with dystrophinopathy have febrile seizure, and 2%-12% have epilepsy. In our study, 8% of patients had febrile seizure, and it was more common in patients with mutations downstream of exon 45, especially exon 63. Epilepsy occurred in 5% of our patients, and the prevalence in Becker muscular dystrophy was higher than that in Duchenne muscular dystrophy. Isoforms such as Dp427 and Dp71, expressed in the central nervous system. might be related to seizure, because of impairment in GABAA receptors, aquaporin 4, and K channels. | 2023-08-23T01:27:04.277712 | https://example.com/article/1043 |
Correspondence
==============
We wish to correct a potentially serious misperception that arises from the paper \"Rats maintain an overhead binocular field at the expense of constant fusion\" by Wallace *et al.*, 2013 ^[@ref-1]^. The title, the abstract and the discussion all emphasize the principal claim that the rat\'s eye movements \"keep the visual fields of the two eyes continuously overlapping above the animal\". The final sentence reads, \"Instead, the movements keep the animal's binocular visual field above it continuously while it is moving\". Many similar statements are found throughout the text and in the Editor\'s Summary. From this, a reader might easily conclude that a rat\'s binocular visual field is located overhead. However the truth is very different, and in fact orthogonal: the binocular field is primarily located dead ahead of the animal. As shown in Figure 5f of the same paper -- where the vertical axis represents \"overhead\" in the conventional \"opposite-to-gravity\" sense of the word -- the binocular field is a vertical sliver centered on the horizon, where it has the widest extent. It narrows towards the top and the bottom, and ends in a point at locations both above and below the animal.
Presumably the authors wanted to say that \"the overhead direction is within the binocular field roughly 50% of the time\", which would be more accurate given the data in Figure 5f. Of course the same is true for a direction pointing almost straight down towards the ground. Meanwhile, the direction in front of the animal is effectively always in the binocular field. Why the singular focus on \"overhead\"? The authors speculate about the need for binocular vision overhead for detecting predatory birds. This is unconvincing. First, only about a quarter of the overhead visual field is binocular (Figure 5f). Given the high cost of missing a predator, it seems the rat must have monocular ways of detecting one. Second, a major benefit of binocular vision is the opportunity for depth measurement by parallax. This works only for nearby objects, rather than distant birds, and would thus apply primarily to the visual field ahead or below the animal.
The authors conducted a behavioral study to reinforce the idea that rat vision is specialized for processing overhead threats, showing that rats seek shelter under an arch-shaped platform when a drifting bar appeared overhead, but not when it appeared on the side of their enclosure (Figure 6). While we hesitate to engage in behavioral just-so stories, we do note that different sheltering strategies probably exist for different kinds of threats (e.g. land-based and aerial), and that the rat might be wise not enter into a confined space *with open sides*, when a threat approaches *from the side*. It is likewise unclear if a drifting bar is equally perceived as a threat when presented above or beside the animal.
Regardless of such ethological speculations, we predict that the paper will be widely cited incorrectly for what it does not demonstrate, as a result of the misleading title and abstract. In fact, this has happened already in what is probably the article\'s first citation ^[@ref-2]^.
Referee response for version 1
Land
Michael
1
Referee
University of Sussex, Brighton, UK
**Competing interests:**No competing interests were disclosed.
28
8
2013
Version 1
I approve of the authors\' commentary. The mistake in the original paper comes from a confusion where the binocular field is relative to the head, rather than where it is relative to gravity - which is actually the relevant measurement. Cox and Meister are right to point this out. It is certainly true that the field moves as the head moves, because of the compensatory eye movements, but it remains only partially overhead, and has its maximal extent in the forward direction.
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.
Referee response for version 1
Van Hooser
Stephen
1
Referee
Brandeis University, Waltham, MA, USA
**Competing interests:**No competing interests were disclosed.
22
8
2013
Version 1
The present letter refers to a recent (2013) Nature article by Wallace, Greenberg, Sawinski, and colleagues entitled \'Rats maintain an overhead binocular field at the expense of constant fusion\'. This Nature article is a tour-de-force examination of eye movements in freely moving rats. The authors created instrumentation and analysis methods to both examine eye movements and rotations, and head movements and rotations, while the rats behaved freely. They found the surprising result that the eyes do not maintain constant fusion, as they do in previously examined animals such as primates. Further, from their analysis of eye movements and head movements, the authors determined the most common region of binocular overlap as the animals wandered about their environment. In head-centric coordinates, this region of binocular overlap reached its greatest horizontal width at a location superior and rostral to the nose (Figure 5e). The authors work also shows that rats tend to keep their heads pitched downward as they move about. Therefore, in body-centric coordinates (using the spine to determine rostral, caudal, superior, inferior directions), this region of binocular overlap reaches its greatest horizontal width at a location directly rostral to the body (Figure 5f).
The present letter by Meister and Cox raises a legitimate and serious concern with the \"big picture\" language of the Wallace *et al*. paper. In the abstract, Wallace *el al.* report that \"the observed eye movements serve to keep the visual fields of the two eyes continuously overlapping above the animal during free movement, but not continuously aligned\". The coordinate system for the word \"above\" is not clear from context. Meister and Cox makes the important point that a substantial fraction of readers (perhaps an overwhelming majority) are likely to assume that \"above\" is in body-centric coordinates, and to make the erroneous interpretation that the binocular overlap is largest above the animal. That is, many readers will erroneously interpret this sentence to mean that the region of greatest binocular overlap is superior to the spine. This potential misinterpretation is made even more likely by the behavioral experiment reported in Wallace *et al*., where the authors provide visual stimulation above the spine. The letter writers also point out that there is no rigorous link between the behavioral experiment and the region of binocular overlap. While the behavioral result is interesting, it is unclear if the behavior has anything to do with binocular vision.
This letter by Meister and Cox makes a very important contribution. In my opinion, the letter could be improved by making clearer references to the coordinate system being used when a direction is mentioned. For example, the letter writers state \"the binocular visual field is located dead ahead of the animal\". The writers assume that the reader will intuit that body-centric coordinates are intended. However, some readers (such as the authors of Wallace *et al*.) may find it more natural to assume that head-centric coordinates are intended. I understand what the authors mean by \"opposite-to-gravity\"; the authors assume the animal is on its 4 legs. Referring to coordinate systems linked to the animal would be clearer, in my opinion.
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.
Referee response for version 1
Carandini
Matteo
1
Referee
Institute of Ophthalmology, University College London, London, UK
**Competing interests:**No competing interests were disclosed.
19
8
2013
Version 1
This commentary can perhaps be reconciled with the original paper by considering the meaning of \'overhead\'. In the original paper, \'overhead\' seems to mean literally \'above the head\'. Because the head typically faces downward (compare Figures 5e and 5f), that actually means \'in front of the animal\'. I agree with the commentary that this is possibly a poor word choice: it will likely be interpreted by most readers as \'above the animal\'.
I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.
[^1]: MM wrote the first version of the letter and corresponded with the paper's senior author for clarification. MM and DDC participated in the discussion and revision of the letter.
[^2]: **Competing interests:**No competing interests were disclosed.
| 2024-03-12T01:27:04.277712 | https://example.com/article/1714 |
Tarnish
Co-Founder Christopher Gable's mother got a silver dish from local Ladies Club (in the 60s when there still were such things). The dish sat in the china closet and came out (perhaps) at Thanksgiving. But, the wonderful thing it acquired during its solitude was the beautiful tangy-old-silvery scent of Tarnish. And here it is. | 2023-09-22T01:27:04.277712 | https://example.com/article/7100 |
Q:
Merge page with custom post type
This may be a weird scenario, but...I have a custom post type called Resources. When visiting /resources/ I get the archive as expected. What I want is a text describing this post type. Therefore I've made a page with the exact name and path. If I now go to /resources/ I still get the archive page, which is good. So, I created a custom template (archive-resources.php) and from there I searched pages with the same path and then I find my page and is able to write out the text before listing the archive.
What I want to know is that, is this a good way to solve my problem? if not, how can I make it better?
A:
I don't see anything wrong with using archive-$cpt_name.php as your default archive page for the custom post type. That would be the correct way to go about doing it. Although there are many different methods to do it, I think you are on the right track to the best way.
| 2023-11-25T01:27:04.277712 | https://example.com/article/2288 |
Background {#Sec1}
==========
Context {#Sec2}
-------
The World Health Organisation (WHO) defines a pregnancy as post-term when the gestation period exceeds 42 (\> 294 days) gestational weeks (GW) \[[@CR1]\]. From 2008 to 2009 guidelines in the US, UK and in parts of Scandinavia were updated; women with low-risk pregnancies were offered induction of labour between GW 41 and 42 to avoid the risks of prolonged pregnancy \[[@CR2]--[@CR4]\]. The guidelines for post-term pregnancies in Norway were changed in 2011 \[[@CR5]\]. The revised guidelines included an additional clinical examination in GW 41, 7--9 days after term, including ultrasonography and cardiotocography (CTG). Women \> 38 years, women with a small for gestational age foetus (\<below the 10% percentile), women with oligohydramnion, or pre-pregnant body mass index \> 30 were offered induction immediately after the examination in GW 41. Generally, all inductions should be started before week 42 \[[@CR5], [@CR6]\]. If induction of labour is contraindicated due to medical reasons, the patient will be offered a caesarean section when appropriate due to the clinical context.
The department of obstetrics and gynaecology at Akershus University Hospital (AHUS) manages women with post-term pregnancies at an outpatient clinic (the clinic) which is open weekdays between 08:00--10:30. The demand placed on the clinic has increased substantially since 2010. Figure [1](#Fig1){ref-type="fig"}a, illustrates over the period 2010--2017: the number of appointments scheduled and attended (arrived) as well as other key events including the change in the hospital's catchment area and the introduction of the new post-term induction \[[@CR5], [@CR6]\] guidelines. Fig. 1Changes in clinic demand and appointment outcomes from 2010 to 2017. Panel **a**) arrived vs. scheduled appointments, derived from hospital information systems DIPS and CSAM Partus based on ICDM-10-CM Dianosis Code O48.0.Panel **b**) appointment outcomes using subsequent O48.0 entries, and procedural codes for induced and non-induced births
The outcome of clinic appointments (next hospital interaction) has changed over time, as illustrated in Fig. [1](#Fig1){ref-type="fig"}b, as the number of attended appointments increased by 436%, from 200 in 2010 to 872 in 2017. The outcomes of the appointments in 2010 were induced deliveries 24.00%, non-induced deliveries 64.50% and follow up clinic appointments 11.50%. The outcomes of the appointments in 2017 were 51.72, 20.41 and 27.86% respectively.
The new guidelines increased the number of appointments and the likelihood of appointment attendance. The gap between the scheduled appointment and attended appointment lines in Fig. [1](#Fig1){ref-type="fig"}a was reduced. The probability that women attended their appointment in 2010 (before the new guidelines) was 0.298 (200/671) and 0.472 (5787/12,266) in 2011--2017 (after guidelines). The difference in proportions is significant, χ^2^ (1, *N* = 18,924) = 77.235, *p* \< 0.001. Attendance increased as appointments are scheduled earlier and more frequent, increasing the likelihood that women are able to attend.
Several studies have evaluated the policy of birth induction versus expectant management regarding perinatal outcomes, frequency of caesarean section, instrumental birth rate, etc. \[[@CR7]--[@CR12]\]. However, there is a lack of studies that investigated the operational impact on post-term pregnancy outpatient clinics after the change of guidelines.
In this computer simulation study, we developed a model of the post-term pregnancy clinic at AHUS, to evaluate clinic management strategies (patient flow). Simulation was chosen as it can capture the components of complex systems such as this one, which is subject to stochastic demand, arrival patterns and service times.
Simulation modelling in health care {#Sec3}
-----------------------------------
Computer simulation modelling approaches have been used in healthcare to provide virtual environments to evaluate changes in complex systems (a person, a ward within a department, a department, and a hospital) at operational, tactical and strategic management levels prior to considering changes in reality \[[@CR13]--[@CR15]\].
Each model is designed to answer a specific question(s) \[[@CR16]\]. A series of modelling good research practice papers in healthcare have been written \[[@CR17]\] and the discrete event simulation (DES) paper \[[@CR18]\] is particularly relevant. DES is well suited for modelling operational level processes and is used in this paper. Jun et al. developed a tool to guide in the selection of the most appropriate Operational Research (OR) method(s), including simulation, to support health services management \[[@CR19]\]. We follow the STRESS guidelines to document the model presented \[[@CR20]\].
In the remainder of the background section we present selected obstetrics and gynaecology (OB/GYN) simulation models, split into three groups, training and economic evaluation models, inpatient delivery models and outpatient models, followed by a brief discussion of relevant outpatient models in other settings and a selection of the key scheduling literature.
OB/GYN training and economic evaluation models {#Sec4}
----------------------------------------------
Simulation approaches have been used as a training aid to assist with the education of clinicians including, anatomical models which enable clinicians to practice procedures such as deliveries \[[@CR21], [@CR22]\], to demonstrate causal inference \[[@CR23]\] and illustrated how experiential learning influences medical decision making \[[@CR24]\]. Typically simulation and mathematical models are used in economic analyses of new and/or existing policies, including but not limited to, treatments, drugs or methods \[[@CR17], [@CR18]\]. Illustrative examples include the evaluation of screening strategies for the identification of foetal abnormalities \[[@CR25]\], the effect of pooling units and changing capacities of an obstetric service \[[@CR26]\] and planning the caseload at the individual midwife level \[[@CR27]\].
OB/GYN inpatient delivery models {#Sec5}
--------------------------------
A number of models of various levels of detail have been produced. The earliest DES of a maternity suite in a US hospital, focused on the impact of changes in demand, the type of demand and the availability of supply \[[@CR28]\]. Another DES model examined specifically the optimal anaesthesia teams required in obstetrics, without detracting from the quality of care \[[@CR29]\]. Other simulation approaches including Markov \[[@CR30], [@CR31]\] and mathematical modelling \[[@CR32]\] have been used to examine patient flow in obstetrics departments and determine maternity length of stay (LoS) respectively.
Data mining and clustering analysis were proposed as a way to identify key groups, to be considered prior to simulation, mathematical or analytical analyses \[[@CR33]\]. Several DES models of specific US obstetrics inpatient departments have been produced to support the delivery of more efficient services including, capacity planning, appointment scheduling, optimal bed allocation, use of flexible rooms, and scheduling of staff and operating rooms \[[@CR34]--[@CR37]\]. Other studies of note include a combined DES optimisation model of an Italian obstetrics ward to maximise the net profit, based on various of the caesarean and vaginal birth rates subject to certain constraints \[[@CR38]\], an Australian DES focusing on the processes required to ensure that induction births take place with specified times \[[@CR39]\] and the evaluation of a midwife staffing approach in the UK to achieve better flexibility with the existing staff capacity \[[@CR40]\].
The models presented above are relevant to this paper as they are simulation models used in the same domain, but they focus on inpatient visits, which have different scheduling needs, and the anticipated LoS is measured in days, not minutes. They were all designed for a specific purpose to address specific question(s).
OB/GYN outpatient models {#Sec6}
------------------------
The earliest model we identified, evaluated the planned merger of two clinics in the US \[[@CR41]\]. This DES study found that the proposed merger was infeasible due to waiting and examination space requirements. Later a general framework for simulating obstetric outpatient clinics is proposed \[[@CR42]\], however it is unclear if this framework has been adopted. The DES model developed to improve patient waiting time and flow in an OB/GYN outpatient clinic \[[@CR43]\], could be improved by running more runs per scenario as DES to be more representative due to sampling from multiple distributions, and the number of "what-if" scenarios to evaluate could be expanded. Lenin et al. demonstrated through DES the optimised appointment templates for certain OB/GYN clinics \[[@CR44]\]. The authors differentiated between three different patient types, each of which had different likelihoods of attending their appointments. The model was run over a week and the optimal number of staff and the time between appointments was assessed. The optimal solution required an additional Medical Assistant and the modification of the appointment system. This led to reduced waiting times by removing bottlenecks, without sacrificing the utilisation of resources. They were able to do this as they had access to high quality patient tracker data.
This paper extends an earlier paper by Viana et al. 2018 which introduced the post-term pregnancy outpatient clinic model that has been subsequently further developed \[[@CR45]\]. This previous version of the model was validated against historical demand, before assessing the impact on certain performance measures (resource utilisation and time measures) with respect to three scenarios only, 1) increased demand, 2) an additional midwife and 3) a combination of 1 and 2. The scenarios were for illustrative purposes. This paper focuses on a vast number of alternative scenarios that are of greater interest to the department.
Other relevant outpatient models {#Sec7}
--------------------------------
Two previously mentioned reviews reference several outpatient clinics \[[@CR13], [@CR14]\], these various outpatient settings are comparable with the post term pregnancy clinic in many ways although the no show/ did not attend (DNA) rates vary substantially. Although Mohiuddin et al. review simulation modelling of patient flow in emergency departments \[[@CR15]\], these are somewhat comparable with outpatient models. Gunal and Pidd's review of the use of DES in healthcare illustrates how the number of papers has increased significantly since the previous reviews \[[@CR46]\]. What is clear from this review is that models developed for specific purposes dominate more generic approaches.
Scheduling {#Sec8}
----------
Scheduling in health and social care settings is important to balance the trade of between patient waiting time and staff/resource idle time. Cayirli and Veral provide an overview of the use mathematical modelling, simulation and heuristic approaches to understand and improve outpatient scheduling \[[@CR47]\]. Early seminal work on clinic appointment scheduling suggested that block scheduling where patients arrive at specified intervals, with a double booking in the first slot is preferable to all the patients arriving at the start of a clinic \[[@CR48]\]. A weakness of some early scheduling work was the assumption of punctuality both in terms of the patients and the healthcare professionals; this was addressed in later works \[[@CR49]--[@CR52]\]. In addition to the issues caused by unpunctuality, the no show rate or DNA rate has a substantial effect on clinic performance \[[@CR53]\]. Many of the studies introduced in the inpatient and outpatient sections include scheduling but the most relevant study to our context is the use of a DES model to optimise appointment scheduling in US OB/GYN clinic \[[@CR44]\]. In this study the authors determined the optimal duration between appointments for set numbers of patients split into two sessions.
The configurations of the post term clinic in this study are assessed by a number of KPIs that shall be introduced later. The situation at present is that although women are given appointment times, staff have informed us that the majority of women who arrive, arrive when the clinic opens, negating the positive effects in terms of their waiting times and LoS.
Methods {#Sec9}
=======
Aim {#Sec10}
---
The aim of this simulation study is to determine the maximum number of women specified clinic configurations, combination of specified clinic resources, can feasibly serve within clinic opening times.
The cost effectiveness of the configurations is outside the scope of this paper as we do not have access to patient outcome data. More nuanced appointment scheduling, to minimise the women's waiting time and total LoS will be considered in future analysis. Due to the fluctuating DNA rate of women who miss appointments, as a result of giving birth, and the majority of women arrive before the clinic opens, the maximum number of women each configuration is considered the main model outcome.
Study design and setting {#Sec11}
------------------------
A computer simulation modelling study was conducted.
The simulation model represents the operation of the post-term pregnancy outpatient clinic at AHUS, a large Norwegian hospital. Prior to the catchment area change in 2011 AHUS served \~ 300,000 people afterwards it served \~ 480,000 people, of which \~ 61,000 and \~ 96,000 were females aged 15--44 respectively \[[@CR54]--[@CR56]\].
Characteristics of participants {#Sec12}
-------------------------------
The participants are hypothetical computer simulated pregnant women in GW 41, 7--9 days after term, who have been scheduled to attend the post-term pregnancy outpatient clinic.
Model specification {#Sec13}
-------------------
The clinic operates between 08:00 and 10:30 four days a week. One day a week the clinic finishes at 09:30 as the doctors have to perform other tasks. The clinic operates on weekdays. In the current system appointments are given in 5 min intervals which begin at 08:00 and run up until 09:00, resulting in 12 possible appointments. However, as previously mentioned a challenge of operating this clinic is the high risk of DNAs due to women giving birth before appointments, and also the uncertain demand, so the range of appointments actual attended is 0--15. Additionally, although women are given appointment times, those that arrive on the day of their appointment tend to arrive when the clinic opens. The model is constructed to evaluate the maximum number of appointments that can be satisfied within clinic opening times on a typical day, 08:00 to 10:30. The scheduling and outpatient configuration literature discussed previously generally assumes higher attendance rates and less uncertain demand.
Following Norwegian guidelines a post-term pregnant woman, with a singleton pregnancy without complications, is given a set of appointments to attend the clinic for checks. Women with multiple pregnancies or known complications are monitored by alternative mechanisms. If the woman attends her appointment, the standard process is that she will check in at reception. She will be called in to the midwife consultation which consists of various tasks including a CTG scan once resources, rooms and equipment are available. Following the midwife consultation if the doctor is free the woman will be called into the doctor's office, for the doctor consultation. At the end of the consultation, the doctor will either recommend the woman for an induced birth or a follow-up appointment a few days later. The woman will check out at reception, return home or be scheduled for an induction.
An overview of the key components of the model is provided here. The hybrid Agent Based Discrete Event Simulation model is constructed in Any Logic Professional 8.3.3 \[[@CR57]\]. DES is widely used to model systems in which entities in this case pregnant women pass through sequential activities that may be constrained by resources, e.g. space, staff, equipment. Due to resource constraints, variability in arrivals and activity service times, queues can form in these systems resulting in delays and bottlenecks. The clinic DES model captures the processes depicted in Fig. [2](#Fig2){ref-type="fig"}. Fig. 2An illustration of the pathway through the overdue clinic. The numbers illustrate the sequence of activities. The current pathway is indicated with "a". A proposed alternative pathway is indicated with "b". The letters in brackets indicate which staff group delivers the activity, Doc = Doctors, Mid = Midwives, and Rec = Reception staff
Each post-term pregnant woman in the model is represented as an agent from the Agent Based Modelling/Simulation (ABM/ABS) paradigm. A woman agent (WA) will be referred to as *woman* (or *women* where appropriate) in this paper to differentiate between computer simulated and actual women. In addition to post-term *women*, the model also simulates *women* belonging to other clinics, which for the present analysis only affect the flow of *women* by creating queues at check in and check out and competing for waiting resource, in the waiting area and corridors. Overall, the model is more detailed than indicated by Fig. [2](#Fig2){ref-type="fig"}, and includes e.g. a representation of the physical layout of the clinic, and even chairs in the waiting areas. For a more detailed model description see \[[@CR45]\] and Additional file [1](#MOESM1){ref-type="media"}.
Each *woman* contains variables relating to its demographic and clinical characteristics, in additional to variable relating to its foetus. It was anticipated that these variables could be used to make more informed decisions, but data access and quality prevents the use of these variables in this paper. Each *woman* records information about its interaction with the DES clinic in relation to the activities depicted in Fig. [2](#Fig2){ref-type="fig"}, including the waiting time for and the duration of each activity. A *woman's* length of stay (LoS) is the difference between arrival at and departure from the clinic which is equivalent to the sum of the *woman's* recorded time intervals. The DES clinic model collects utilisation results for resources described in Fig. [2](#Fig2){ref-type="fig"}: reception staff, midwives, doctors, CTGs and waiting capacities. The model results collected at the *women* and the DES clinic model levels are collated at the end of each run of the simulation model and exported as csv files for further analysis.
### Configuration {#Sec14}
A model configuration relates to the six parts of the model that can be changed to assess clinic performance, with respect to a specific demand. The input values for each configuration are provided in the inputs section but this section introduces them briefly. A configuration consists of the type of arrival pattern the model uses to determine when the specified demand. As mentioned the clinic does use an appointment system but the women often arrive when the clinic opens. Two simplified appointment systems are considered in this paper. Changes to the pathway discussed in the model specification and are illustrated in Fig. [2](#Fig2){ref-type="fig"}. The pathways considered in this paper are those illustrated in Fig. [2](#Fig2){ref-type="fig"}, but alternative pathways could also be analysed with minimal effort. The other components of a configuration are the number of clinical staff, midwives and doctors and the number of CTG machines.
### Data sources {#Sec15}
To represent the clinic accurately in a simulation model, data relating to clinic processes and activities are required, specifically the pathways currently in operation, feasible alternative pathways, and probability distributions that represent the service times of the different processes in the model.
The electronic patient registry and the hospital information system do not collect time stamped data; we could use to derive duration times at the activity level required by the model for outpatient clinics. The hospital information system is geared towards the collection of inpatient data, the only time data we have for outpatient clinics are appointment times which are recorded consistently and as we have alluded to women tend to arrive when or before the clinic opens \<=08:00.
We asked staff to provide their best estimates for the durations (service times) for various activities. They were in the best place to provide these as they serve this patient group daily and it was the only feasible way to get service time data for the model. Neither the clinic nor the research team have the resources at the time to conduct a time in motion study, whereby we would follow patients around the clinic recording their process times or devise a method to collect this information.
We therefore developed an Excel VBA program based on the method described by Leal et al. \[[@CR58]\], to elicit estimates from employees. The tool was not used to record actual service times. In Fig. [2](#Fig2){ref-type="fig"} the bracketed abbreviations indicate which estimates were provided by reception staff (Rec), midwives (Mid) and doctors (Doc). Five obstetricians, six midwives and five reception staff took part in the estimation exercise. Service time probability distributions created for: Check in, Connect CTG, CTG scan, Disconnect CTG, Consultation, and Check out, based on the input from the staff, these staff derived service time distributions were combined and validated through discussion with clinic management and the clinical authors of this paper. Descriptive statistics of the service time distributions used in the model and the number of CTG checks are provided in Table [1](#Tab1){ref-type="table"}. Table 1Summary statistics of service time distributions (minutes) and number of CTG checksServiceMinMedianMeanMaxStandard DeviationKurtosisSkewnessCheck In0.1300.4670.4571.0000.2492.1560.531Connect CTG2.0003.3413.4105.0000.8631.8420.156CTG Scan20.00025.55726.25045.0004.8556.0111.558Disconnect CTG2.0003.3413.4105.0000.8631.8420.156Consultation10.00021.28222.32545.0004.9014.7641.005Check out0.1301.5801.5895.0000.9852.6960.480No. of CTG checks0.0001.8972.12010.0001.4628.3741.793
A more detailed description of how the service time distributions were derived is provided in Additional file [1](#MOESM1){ref-type="media"}. No waiting time estimates were elicited from clinic staff, as these are the results of queues in the system, and estimated by the simulation model.
### Assumptions {#Sec16}
The model assumptions listed below, are made to reduce the scope of the system to its key factors. The clinic's midwives and doctors did not attend to other non-clinic *women* during clinic hours.The reception staff and waiting area resources (waiting area chairs and corridor space) are shared with *women* attending all clinics.The midwives are able to attend to multiple *women*.A midwife will stay with a woman who requires 5 or more CTG checks, (mean number checks is 2.120). A summary of the CTG distribution is provided in Table [1](#Tab1){ref-type="table"} and the distribution in the Additional file [1](#MOESM1){ref-type="media"}.If a *woman* sees a doctor before a midwife, the *woman* does not have to see a doctor again after the midwife consultation. It was assumed that the doctor has sufficient information to complete the consultation.The clinic will stay open if *women* still need to use it. Results are collected within and outside clinic hours. In reality staff would have other duties to attend to. The simulation model runs until midnight to treat as many *women* as possible. Configurations that fail to satisfy the demand in clinic hours are rejected for that level of demand.All clinic appointments are attended. This places greater stress on each configuration, as in reality women may miss their appointment as they have given birth prior to it. Therefore all of the results presented are based on the maximum number of women each configuration can serve within clinic opening hours.The model does not differentiate between new and returning patients. New patients are those referred to the clinic for their first appointment for the current pregnancy. Returning patients are those attending their second, third etc. appointment for current pregnancy. The service time estimates provided by staff are for all clinic appointments.Two simplistic appointment systems are assessed in this paper. That either all of the demand arrives when the clinic opens at 08:00 or half of the demand arrives at 08:00 and half at 08:30. More nuanced appointment systems can be evaluated, but in general if the women arrive they tend to arrive before the clinic opens.The queuing discipline currently employed in the model is first in first out (FIFO).The model of the clinic operates a single queue multiple server system. Women are not assigned to particular midwives, CTG machines or doctors.The model represents the clinic in isolation, and does not take into consideration the occupancy of the maternity ward or operating theatres with respect to induction decision. This is outside the scope of this model.
### Validation {#Sec17}
Since detailed time stamp data is not collected for the clinic, we could not validate the model against historical data. As a substitute for this, we validated the model through visual demonstrations of the model during the construction process, and the clinic staff concluded that the model had a high degree of face validity. We performed extreme value tests, including: 1) very large/small arrival numbers at the clinic, checking queues formed in the model where appropriate, 2) excessive/insufficient amounts of resources (e.g. doctors etc.) and checked if the model outcomes were as expected. Additionally, we varied the activity services distributions, between (un)favourable alternatives and verified this had the expected effects on a *woman's* visit. Finally, we validated the *women's* average LoS against the LoS estimate provided by the midwives. For the baseline configuration (configuration 0a, Table [1](#Tab1){ref-type="table"}) the model output matched the estimates well. This suggests that the sum of the waiting times (which are based on the simulated queues in the system, rather than pre-specified times) match the real waiting times well.
Experimental design {#Sec18}
-------------------
### Time horizon {#Sec19}
The model can run for any time horizon. In this paper it runs, in minutes, for a single clinic day, from 08:00 to 23:59. Utilisation results for resources (e.g. midwives etc.) are recorded during clinic hours 08:00 to 10:30. It runs until 23:59 to allow all *women* who attend the clinic to be seen, the clinic may not be able to satisfy the demand if it is poorly configured or if demand is too great. The simulation starts with an empty clinic, which reflects the reality, since there are no overnight stays. A warm-up period for the model was also not considered necessary.
### Multiple runs {#Sec20}
Due to the randomness in a single model run, we collected statistics from 10,000 runs (model trial) for each model configuration. Randomness in this model relates to the service times. It is necessary to run the model multiple times for each configuration to avoid basing decisions on a potentially unrepresentative single run of the model.
### Inputs {#Sec21}
Through discussion with clinic staff, six inputs (decision variables) were defined. A clinic configuration is the values these inputs take. The inputs and the values they can take are described in Table [2](#Tab2){ref-type="table"}. Table 2Model inputsInputDescriptionValuesX0Arrivals. The number of *women* who attend the clinic.- No default value, it ranges from 2 to 20.Also a Key Performance Indicator (KPI), see next section.X1Arrivals pattern- **"All"**^a^. All the *women* arrive at 08:00- "Half". Half of the *women* arrive at 08:00 and half at 08:30For odd numbers of arrivals the larger value arrives at 08:00.X2Order of midwife and doctor consultation- "Doc" a *woman* can see a doctor first if one is available, before seeing a midwife- **"Mid"**^a^ the *woman* sees a midwife before a doctor.X3Number of midwives**Two**^a^ or three.X4Number of doctors**Two**^a^ or three.X5Number of CTGs**Three**^a^ or four.^a^Base case indicated in bold
A full factorial experimental design for the inputs described above results in 608 configurations. Each of these configurations was evaluated by a model trial.
Key performance indicators {#Sec22}
--------------------------
The configurations are evaluated using seven model KPIs. The average KPIs derived from a model trial per configuration are stated in Table [3](#Tab3){ref-type="table"}. Waiting time KPIs are collected to indicate where potential bottlenecks may exist. Table 3Model KPIs -- Average results from 10,000 runs of the modelKPIDescriptionY1Arrivals. Number of women attending clinic (same as X0, see *Optimal Treatment Capacity section*)Y2^a^Time last *woman* checks out (HH:MM:SS)Y3Women's LoS (mins)Y4^b^Clinic overrun (mins after 10:30)Y5Women's midwife waiting time (mins) \[CTG connection wait + CTG disconnection wait\].Y6Women's doctor waiting time (mins)Y7Women's CTG connection waiting time (mins) \[CTG wait + midwife wait for connection\]^a^ Y2 explanation: Consider a scenario where 7 *women* arrive (10,000 model runs (a model trial) simulates 70,000 *women*). Say for 5000 runs the time the last *woman* leaves is 10:35 and for 5000 runs the time the last *woman* leaves is 10:20. The average of the model trial would be 10:27:30^b^ Y4 explanation: In the 5000 runs where the last *woman* leaves at 10:35 at least one of the *women* left late e.g. after 10:30. Assuming that only ONE *woman* in each of these runs finished 5 min late, results in an average clinic overrun time of 0.5 min (7000 *women* \[1 *woman* leaving late each run\] \* 5 min) / 70,000 *women* \[the total number of *women*\] = 0.5 min)
Optimal treatment capacity {#Sec23}
--------------------------
The six model decision variables (X0, X1, X2, X3, X4, and X5) described generated 608 configurations. The arrivals input (X0) ranges from 2 to 20 *women* (19 arrival patterns). Optimisation was performed on the configurations where X1, X2, X3, X4 and X5 were set and X0 incremented. This results in 32 configurations (608/19). This is illustrated in Table [4](#Tab4){ref-type="table"}. Table 4Optimal treatment capacityInputsInput levelsCumulative configurationsX1: Arrival pattern22X2: Order of midwife and doctor consultations24X3: Number of midwives28X4: Number of doctors216X5: Number of GTGs232^a^X0: Arrivals19608^ba^ results presented in this paper^b^ results available in Additional file [2](#MOESM2){ref-type="media"}
The goal of the optimisation was to maximise the number of *women* (X0/Y1) that could be seen subject to the average time the last *woman* checks out (Y2) ≤10:30 and minimising the average clinic overrun time (Y4). This provided the optimal number of *women* each of the 32 configurations could serve. The ability to vary the model demand enables the effects of increases that may arise due to changes in the catchment areas or changes to guidelines to be evaluated.
The simulation model output is recorded in a number or text files for each model trial for each configuration. This large number of files is then analysed post hoc using R to produce outputs and enable the team to examine individual patient responses in a particular run in a particular trial if necessary. More information about how AnyLogic interacts with R is provided in Additional file [1](#MOESM1){ref-type="media"}.
Results {#Sec24}
=======
The 32 configurations have been divided into eight groups (0--7) based on the number of midwives (X3), doctors (X4) and CTG machines (X5). The groups are shown in Table [5](#Tab5){ref-type="table"}. Table 5Groups of configurationsGroupPurposeMidwives (X3)Doctors (X4)CTGs (X5)0The base case. The number of resources currently available.2231Evaluates the effect of one extra midwife.3232Evaluates the effect of one extra doctor.2333Evaluates the effect of one extra midwife and doctor.3334Evaluates the effect of one extra CTG machine.2245Evaluates the effect of one extra midwife and one extra CTG machine.3246Evaluates the effect of one extra doctor and one extra CTG machine.2447Evaluates the effect of one extra midwife.334
Each group is divided into four subgroups (a-d) based on the combination of the X1 (Arrivals at 08:00) and X2 (Midwife or doctor first) inputs. The subgroups are described in Table [6](#Tab6){ref-type="table"}. Table 6Group subgroupsSubgroupDescriptionX1X2aThe base case. All *women* arrive at 08:00 and they all see the midwife before seeing the doctor."All""Mid"bHalf the *women* arrive at 08:00 and half at 08:30 and they all see the midwife before seeing the doctor."Half""Mid"cAll the *women* arrive at 08:00 and they can see a doctor first if a doctor is free."All""Doc"dHalf the *women* arrive at 08:00 and half at 08:30 and they can see a doctor first if a doctor is free."Half""Doc"
Table [6](#Tab6){ref-type="table"} and Table [7](#Tab7){ref-type="table"} provide configuration inputs and the averages of the models KPIs based model trials with confidence intervals (95% level) for the 32 configurations. The base case (configuration 0a) is highlighted in bold in the respective tables. Table 7Mean time KPIs (from model trials) from selected configurations (base case in bold)InputsKey performance indicatorsConfigurationX1 -- Arrivals at 8:00X2 -- Midwife or doctor firstX3 -- MidwivesX4 -- DoctorsX5 -- CTGsX0/Y1 -- Arrivals / Treatment capacity (*women*)Y2\
Time last *woman* checks out (CI in seconds)Y3\
*Women's* LoS (minutes)Y4\
Clinic overrun (minutes)Mean±Mean±Mean±0aAllMid223710:25:3311102.970.212.000.090bHalfMid223710:25:361090.130.142.030.090cAllDoc223810:18:181298.660.150.810.060dHalfDoc223810:22:291186.060.101.270.071aAllMid323710:21:171099.720.200.760.051bHalfMid323710:21:261086.990.130.780.051cAllDoc323910:27:0011101.470.162.490.091dHalfDoc323910:28:581091.410.093.180.112aAllMid233710:23:441199.900.201.670.082bHalfMid233710:23:461287.150.141.670.082cAllDoc233910:22:1313100.080.161.840.092dHalfDoc233910:27:441288.640.113.220.123aAllMid333810:27:3010101.590.212.370.093bHalfMid333810:29:131087.720.143.040.103cAllDoc333910:12:281095.330.140.190.033dHalfDoc333910:23:381186.150.101.340.074aAllMid224810:28:2112105.930.203.310.124bHalfMid224810:28:331291.090.133.470.124cAllDoc224910:16:351499.860.131.100.074dHalfDoc224910:18:381388.640.091.240.085aAllMid324810:22:1610101.570.190.990.065bHalfMid324810:22:231086.710.111.030.065cAllDoc3241010:24:3612100.280.141.940.095dHalfDoc3241010:26:101188.270.101.990.096aAllMid234810:17:271499.490.181.340.086bHalfMid234810:17:251484.570.111.300.086cAllDoc2341110:28:3814104.540.154.240.166dHalfDoc2341010:21:541486.550.102.180.117aAllMid3341010:29:0310103.050.182.830.107bHalfMid3341010:29:05988.040.122.840.107cAllDoc3341210:27:4310101.300.142.390.097dHalfDoc3341110:21:571085.470.081.000.06
The following mean time related KPIs are provided in Table [7](#Tab7){ref-type="table"}: time last *woman* checks out (Y2), *Women's* LoS (Y3) and clinic overrun (Y4), in addition to the main output, arrivals/treatment capacity (X0/Y1). The base scenario has the highest LoS given its optimal treatment capacity. Generally, the "d" configurations in each group had a higher treatment capacity and a lower LoS compared to the "a" configurations. Configuration 0d which has the same resources as the base case 0a, can see an additional *woman* and reduces the mean LoS by 16.91 min (86.06 \[0.10\] vs. 102.97 \[0.21\] minutes).
The following mean waiting time related KPIs are provided in Table [8](#Tab8){ref-type="table"}: *Women's* midwife waiting time (Y5), *Women's* doctor waiting time (Y6) and *Women's* CTG connection waiting time (Y7), in addition to the main output, arrivals/treatment capacity (X0/Y1). The base scenario has the highest CTG connection waiting time given its treatment capacity. Generally, the "d" configurations in each group had lower cumulative waiting times (Y5 + Y6 + Y7) compared to the "a" configurations. Table 8Mean waiting time KPIs (from model trials) from selected configurations (base case in bold)InputsKey performance indicatorsConfigurationX1 -- Arrivals at 8:00X2 -- Midwife or doctor firstX3 -- MidwivesX4 -- DoctorsX5 -- CTGsX0/Y1 -- Arrivals / Treatment capacity (*women*)Y5\
*Women's* midwife\
waiting time (minutes)Y6\
*Women's* doctor\
waiting time (minutes)Y7\
*Women's* CTG connection waiting time\
(minutes)Mean±Mean±Mean±0aAllMid22372.540.043.110.0429.480.190bHalfMid22372.540.043.090.0417.230.120cAllDoc22382.420.0314.690.1212.960.100dHalfDoc22381.240.027.880.097.940.071aAllMid32370.060.004.310.0525.620.181bHalfMid32370.060.004.340.0513.380.121cAllDoc32390.060.0016.600.1314.320.131dHalfDoc32390.070.0010.390.0911.190.092aAllMid23372.530.040.010.0029.470.192bHalfMid23372.550.040.010.0017.260.122cAllDoc23392.500.038.350.0620.340.112dHalfDoc23391.420.025.220.0612.740.083aAllMid33380.070.000.010.0031.650.193bHalfMid33380.090.000.010.0017.850.133cAllDoc33390.070.009.050.0615.510.093dHalfDoc33390.030.005.290.0610.800.074aAllMid22486.220.067.670.0626.900.174bHalfMid22486.240.067.700.0612.630.094cAllDoc22495.950.0512.660.0815.310.114dHalfDoc22494.460.057.030.0710.360.085aAllMid32481.460.0210.780.0720.600.145bHalfMid32481.460.0210.800.076.270.055cAllDoc324101.310.0212.630.0816.650.135dHalfDoc324100.460.019.400.078.800.086aAllMid23486.260.061.180.0227.000.176bHalfMid23486.210.061.170.0212.610.096cAllDoc234116.010.0512.580.0919.320.096dHalfDoc234103.950.044.920.059.990.077aAllMid334101.300.021.590.0230.620.177bHalfMid334101.320.021.600.0216.520.107cAllDoc334121.190.0217.440.1212.040.087dHalfDoc334110.460.017.330.077.780.05
Discussion {#Sec25}
==========
Main findings {#Sec26}
-------------
We have presented a simulation model developed to determine the capacity of and evaluate changes in the flow of post-term women through the clinic given alternative feasible configurations suggested by the clinic. We found that it is possible to improve the clinic's performance with relatively small changes and at a low cost by changing pathways (X2 = "Mid": patients see the midwife first; X2 = "Doc": patient can see a doctor before a midwife if a doctor is available) rather than increasing the resources.
The simulation model was developed to inform decision-making not make the decisions for the clinic management. Many of the configurations presented in Table [1](#Tab1){ref-type="table"} and Table [2](#Tab2){ref-type="table"} are better than the base configuration (0a). It should be highlighted that configurations 0b, 0c and 0d which have the same number of midwives (X3), doctors (X4) and CTG machines (X5) as the base case (0a) perform better with respect to *women's* LoS. Configurations 0c and 0d where *women* can see a doctor first before a midwife if a doctor is free (X2 = "Doc") enables the clinic to see an additional woman within clinic opening times. For those configurations (0b, 1a, 1b, 2a and 2b) where the treatment capacity (Y1 = seven women) is the same as the base case (0a) the majority of the KPIs (Y2-Y7) are better. Unsurprisingly increasing clinic resources, midwives, doctors and CTG improves performance with respect to some KPIs.
We will highlight configuration 0d. This configuration does not involve additional resources, but changes to the arrival pattern (X1) of WAs and their pathway through the clinic (X2). This configuration is superior to the base configuration in many ways, an additional *woman* can be seen (0a = 7, 0d = 8), LoS is reduced by 16.4% (0a = 102.97 mins, 0d = 86.06 mins), average clinic overrun is reduced by 36.6% (0a = 2.00 mins, 0d = 1.27 mins) and the waiting time for the midwife and CTG connection is reduced by 51.12% (0a = 2.54 mins, 0d = 1.24 mins) and 73.06% (0a = 29.48 mins, 0d = 7.94 mins) respectively. The reductions in waiting times can be attributed to the changes in pathway (X2). Due to the additional *woman* who can be seen in this configuration the waiting time for the doctors increases by 153.5% (0a = 3.11 mins, 0d = 7.88 mins), and the utilisation of the doctors increased.
It is important to consider the KPIs as a whole, e.g. configuration 6b produced the best LoS (84.57 mins), with an additional doctor and CTG machine, but has a relatively high midwife waiting time as a result. It does enable the clinic to see eight *women* compared to seven, but there are other configurations that have similar LoS and higher treatment capacity, configurations 5d, 6d, 7b and 7d can see 10 *women*.
The model results provide valuable information for the clinic management. Additionally, the process of constructing the model with clinic staff highlighted the importance of considering uncertainty when planning how the clinic operates.
Strengths and limitations {#Sec27}
-------------------------
We actively involved clinic staff in the model development, from the development of the data estimation tool, to derive service time probability distributions, through the validation of the model. The clinic staffs engagement has increased the likelihood of the model results being used to support decision making, and also return to the model to evaluate other scenarios in the future. The developed clinic model considers the complexity in the system, which is more challenging to represent in analytical and statistical approaches.
The combination of a full factorial experimental design and the optimisation method were beneficial in terms of distilling large amounts of information into a more presentable form. The model was automated in such a way that you can run a batch of experiments of interest, by providing a set of input parameters to the model. The analysis of the simulation output was partially automated so it can be summarised succinctly in the statistical software package R. This post-hoc analysis outside the simulation environment is beneficial in terms of the variety of ways information from the model can be presented to stakeholders. It also frees up computational resources, so additional experiments can be conducted if necessary. A drawback of this approach how it is currently implement is that the optimisation takes place in R; after all of the model trials have been conducted in AnyLogic.
The model runs until midnight to ensure that all the women who arrive at the clinic are treated. This rather arbitrary decision does not affect run time as it is a DES which is an event based system so after the last woman is treated it advances to the end of the day. The latest time a *woman* left the clinic was 13:19:17, in configuration 0b when 20 *women* arrive. A computationally more efficient model could be developed.
The model presented included four inputs (X0, X3, X4, and X5) that were quantitative e.g. changing the number of resources available or the number of women who arrive, it also presented two inputs that were more qualitative in terms of how the clinic/system is configured (X1 and X2). The model can combine multiple inputs at different levels in addition to those presented in this paper and assess the effect these have on clinic performance. For example the capacity in the delivery and operating rooms, changes to service time distributions to reflect different patient types, i.e. new or returning, level of Norwegian etc.
The availability and the quality of data was a major challenge. The majority of the model data, e.g. service time and LoS distributions were elicited through estimation exercises with clinic staff. On one hand this was very beneficial as it engaged staff in the model building process. On the other hand the quantity and quality of outpatient data could be improved to be on a similar level as inpatient data, e.g. time stamps to record a patient's journey through an outpatient clinic that we could then derive service time distributions from. It would be interesting to compare the service time estimates used in the model with actual service times. We would recommend that routine data is collected for all outpatient clinics not just the post-term pregnancy clinic, to enable quality of improvements of outpatient clinics. This is particularly pressing as healthcare shifts from an inpatient to an outpatient mode of delivery.
Interpretation and further work {#Sec28}
-------------------------------
The model was constructed in collaboration with the clinic to help understand how it is performing. The process of building the model was challenging due to the availability of data. The model was developed to address particular questions posed by the AHUS post-term pregnancy clinic, it is bespoke. Although the model results have been presented and discussed with clinic management at the time of writing our recommendations have not yet been implemented.
The 608 clinic configurations evaluated were of greater interest to the clinic than the 4 scenarios described in earlier work \[[@CR45]\]. As previously indicated the clinics notional appointment system splits the 08:00 to 09:00 period into 5 min intervals resulting in a maximum 12 appointments if single block booking was assumed. The base configuration has been shown in the model to serve a maximum of 7 women within clinic opening times. It should be noted that firstly it is extremely rare that 12 appointments are scheduled and secondly if 12 appointments were schedule is would be highly unlikely that all 12 would attend, due to the high DNA rate associated with this clinic. The results for the base case (configuration 0a) with 12 *women* arriving are as follows: Treatment Capacity (Y1) is 12, Time last woman checks out (Y2) is 11:30:48 \[13.13 s\], Women's LoS (Y3) is 136.41 \[0.26\], Clinic overrun (mins after 10:30) (Y4) is 60.81 \[0.21\], Women's midwife waiting time (mins) (Y5) is 2.38 \[0.03\], Women's doctor waiting time (mins) (Y6) is 3.52 \[0.03\] and Women's CTG connection time (mins) (Y7) is 61.42 \[0.25\].
In the model we assumed that the women scheduled to arrive at the clinic always did. We also assumed that in half of the 608 configurations based on observation of the clinic and feedback from staff most women arrived before the clinic opened (X1 = "All"). Assuming all patients arrived is the best case scenario in terms of numbers of patients treated. It is also represents the maximum stress a configuration of the clinic could efficiently serve, within clinic opening times. In reality women may miss their appointments as they have given birth. It would be useful as a theoretical exercise to examine alternative scheduling algorithms, now that we know how many women can be seen given a clinic configuration, to investigate if we can reduce waiting time and LoS.
The staff actively engaged in the development and validation of the model, the model at present needs to be run by the modeller. Upon further validation of the model a JAVA based web version of the model could be developed to allow staff at the clinic to experiment with different clinic configurations, using familiar office like interfaces. The model will need to be continually reassessed to ensure that it still accurately represents the operation of the clinic, and also to update it with more accurate data as and when it is available.
The model does provide many useful KPIs, but economic outputs are lacking. It would be beneficial to conduct a full cost effectiveness analysis, but at this time we do not have access to patient outcome data or cost data. If such information is available it can be added to the model. Currently equipment appears more of a bottleneck than personnel, as one additional CTG machine (group 4) has the same effect as an extra midwife and an extra doctor (group 3), and the waiting time for CTG connection is a key contributor to LoS.
The additional model variables associated with each *woman* e.g. demographic parameters, clinical measures/observations of the *foetus* can be used to identify different patient groups and the impact they have on clinic performance.
The increase in the number of appointments does not only affect the delivery of care at the clinic. Clinic decision makers rightly have to take into account the available resources of the maternity ward, such as delivery rooms, surgical and recovery rooms, and medical staff when they schedule induced births. It would be interesting to model the induction decision rules and pathways in a larger scale simulation model in the future. It may also be beneficial to look deeper into statistical and cost benefit analyses of the increase in demand due to the changes in catchment area and change of clinical guidelines.
Conclusions {#Sec29}
===========
From an AHUS perspective, the changes in catchment area and guidelines for post-term pregnant women led to an increased work load for the clinic. The simulation model demonstrated that flexible pathways in the order of midwife/doctor and appointment scheduling increases flow substantially. Equipment appears more of a bottleneck than personnel, as one additional CTG machine has the same effect as an extra midwife and an extra doctor, and the waiting time for CTG connection is a key contributor to LoS. We are in discussion with clinic management about further developing the model, incorporating better quality data, evaluating alternative scenarios and implemented promising model suggestions. A more general finding is that a simple simulation model can be used to identify bottlenecks, and identify efficient ways of restructuring an outpatient clinic.
Supplementary information
=========================
{#Sec30}
**Additional file 1.** Post-term pregnancy clinic model description; Provides a more detailed description of the model, the data and the experimental design. **Additional file 2.** Summary model results; Provides mean results and errors for each KPI, by experiment. **Additional file 3.** Mendeley Data; Provides a link to a Mendeley repository where the model, the results and the documentation used in this paper can be found. **Additional file 4.** Explanation of Fig. [1](#Fig1){ref-type="fig"} data; Provides an explanation of how Fig. [1](#Fig1){ref-type="fig"} was constructed and summary data.
ABM
: Agent Based Model(ling)
ABS
: Agent Based Simulation
CSAM
: Clinical Systems All Managed. A Norwegian company specialising in Electronic Health Record System. CSAM Partus is a maternity information system
csv
: Comma separated values
CTG
: Cardiotocography
DES
: Discrete event simulation
DIPS
: Distribuert Informasjons og Pasientdatasystem i Sykehus (Distributed Information and Patient data system in Hospitals). A Norwegian company specialising in Electronic Health Record System
DNA
: Did not attend
Doc
: Doctor(s)
GW
: Gestational week(s)
ICDM-10-CM
: International Classification of Diseases, Tenth Revision, Clinical Modification
KPI
: Key performance indicator(s)
LoS
: Length of stay
Mid
: Midwife/Midwives
mins
: Minutes
O48.0
: ICD-10-CM Diagnosis Code for Post-term pregnancy
Rec
: Reception staff
UK
: United Kingdom
US
: United States of America
VBA
: Visual Basic for Applications
WA
: Woman agent
WHO
: World Health Organisation
χ^2^
: Chi square statistical test
**Publisher's Note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
=========================
**Supplementary information** accompanies this paper at 10.1186/s12913-020-4943-y.
To all colleagues who contributed, thanks for everything. Particular thanks go to Tore Gundersen from and his colleagues from the Data Acquisition Group at Akershus University Hospital who extracted the data from hospital systems that Fig. [1](#Fig1){ref-type="fig"} is based on. All the colleagues at the Women's Clinic who provided process time estimates and actively aided in the simulation models development, without whom this project would not have been possible. Particular thanks go to Githa Andersen who provided valuable insight into how the available data was coded. Finally we are grateful to the assistance of Åse Marit Hammersbøen for her bibliographic support.
TBS and JV planned the study, developed the model and wrote the paper, JV built the final version of the model and analysed the data. TBS, HEF, NS and KF provided data and insight into clinic processes, essential for developing the model. FAD and KF provided valuable input in the writing process and expert knowledge, FAD statistical and analytical, KF from a medical point of view. All authors revised and approved the final version of the manuscript.
Authors' information {#FPar1}
====================
JV is a Research Fellow at Akershus University Hospital, Lørenskog, Norway. He holds a Ph.D. in operational research from University of Southampton, UK. His research interests include discrete-event simulation, agent-based simulation, system dynamics simulation and the combination of simulation methods together and with other methods. He is particularly interested in healthcare applications.
TBS is a research coordinator at the Health Services Research Centre in the Research Department of Akershus University Hospital. She is a qualified midwife and holds an MSc in Health Science.
HEF is a qualified midwife and the leader of the outpatient clinic in the Department of Obstetrics and Gynaecology, Akershus University Hospital.
NS is a qualified midwife and holds an MSc in Public Health. She is the assistant director of the Department of Obstetrics and Gynaecology, Akershus University Hospital.
FAD works for the Health Services Research Centre in the Research Department of Akershus University Hospital. He holds a PhD degree in informatics. He has previously worked with combat simulation for the Norwegian Armed Forces and Bayesian MCMC simulation.
KF is an obstetrician working as a senior consultant in the Department of Obstetrics and Gynaecology, Akershus University Hospital. She holds a PhD in Health Science.
Akershus University Hospital (Health Services Research Centre (HØKH) and the Department of Obstetrics and Gynaecology) and the Centre for Connected Care (C3) (Norwegian Research Council, (C3), Oslo University Hospital, ref.: NFR 237766/O30), funded the staff who conducted the research. Department of Obstetrics and Gynaecology staff provided data estimates, explained the processes and suggested the scenarios to evaluate in the model given what is achievable in reality. The funding bodies had no other role in the research design, analysis or interpretation.
The model and datasets generated and/or analysed during the current study are available in the Mendeley repository, <https://data.mendeley.com/datasets/4jc5hz4mp3/1> \[[@CR59]\]., see Additional file [3](#MOESM3){ref-type="media"}. The computer simulation model inputs are provided in Additional file [1](#MOESM1){ref-type="media"}. The datasets used to generate Fig. [1](#Fig1){ref-type="fig"} analysed during the current study are not publicly available due to confidentiality and privacy regulations. Summary information about Fig. [1](#Fig1){ref-type="fig"} is provided in Additional file [4](#MOESM4){ref-type="media"}.
The Helse Sør-Øst Research Ethics Committee (REC) judged this study as a quality assurance project and therefore outside the committee's mandate (ref: 2016/512 A, 07.04.2016). Approval for this study was obtained by the Akershus University Hospital's internal privacy ombudsman (ref: [@CR16]--118, 07.07.2016), with respect to data confidentiality and protection.
Not applicable.
The authors declare that they have no competing interests.
| 2024-04-30T01:27:04.277712 | https://example.com/article/5536 |
Learn About Plant Rust Disease And Rust Treatment
Plant rust is a general term that refers to a rather large family of fungi that attack plants. Frequently, when a plant is affected by rust fungi, many gardeners feel at a loss as to what to do. Rust treatment as a plant disease is startling but can be treated.
Symptoms of Plant Rust
Rust fungi are very easy to identify on the plant. It can be characterized by a rust color on plant leaves and stems. The rust will start out as flecks and will eventually grow into bumps. The plant rust will most likely appear on the underside of the leaves of the plant.
The good news is that there are so many kinds of rust fungi and they are so plant specific, that if you see the rust color on plant leaves of one type of plant, you will not see it appear any other types of plants in your yard.
Rust Treatment for This Plant Disease
For rust fungi, prevention is the best defense. Rust thrives in a wet environment, so do not overwater your plants. Also, make sure that your plants have good air circulation in side the branches and around the plant itself. This will help it dry off its leaves faster.
If plant rust does affect your plant, remove affected leaves at the first sign of rust color on plant leaves. The faster the affected leaves can be removed, the better chance your plant has for survival. Be sure to dispose of these leaves. Do not compost them.
Then treat your plant with a fungicide, such as neem oil. Continue to remove leaves and treat the plant until all signs of the plant rust are gone. | 2023-12-02T01:27:04.277712 | https://example.com/article/8439 |
I ran across this story today. Hearing the man who had to decide whether or not to shoot describe what happened conveys the weight of responsibility required when carrying. Good read and great outcome for the victim of attempted armed robbery. | 2024-04-06T01:27:04.277712 | https://example.com/article/4185 |
Caruaru Airport
Oscar Laranjeiras Airport is the airport serving Caruaru, Brazil.
History
The airport was inaugurated in 1985 but remained closed from 2003 to 2006 due to repair works on the apron: twice, in 2000 and 2002 the apron collapsed under the weight of aircraft. It is dedicated to general aviation.
Airlines and destinations
No scheduled flights operate at this airport.
Access
The airport is located from downtown Caruaru.
See also
List of airports in Brazil
References
External links
Category:Airports in Pernambuco
Category:Airports established in 1985
Category:Caruaru | 2024-01-04T01:27:04.277712 | https://example.com/article/9211 |
"I am very pleased that recorded crime showed a decrease in 2010. This result is a tribute to the dedication and hard work by our law enforcement officers," she said.
Kevin Kelly, the force's acting development general manager, said sexual assault and related offending increased by 3.6 per cent in 2010 from the previous year - driven almost entirely by recorded family violence, which may reflect greater reporting.
"We know most cases of sexual offending are not reported, and this remains a concern to police. We urge all victims of sexual offending to report it to police," he said.
STATISTIC BREAKDOWN
* Less than half of all reported crimes were resolved - with the rate dropping slightly from 47.8 per cent in 2009 to 47.5 per cent in 2010. | 2024-06-23T01:27:04.277712 | https://example.com/article/6974 |
Let a = -13.55 - -13.15. Put -1/28, -5, 0, a in descending order.
0, -1/28, a, -5
Let c = 512/77 - 70/11. Suppose -3*q - 4*l - 68 = -2*l, 4*q = 2*l - 100. Let s = q + 22. Sort c, -3/5, s in decreasing order.
c, -3/5, s
Let x = 9 + -5. Let h = -30658/143 + 2360/11. Sort 6, h, x in increasing order.
h, x, 6
Let w = -33.88 - -2.68. Let k = 31 + w. Put k, 0.3, -1/8 in ascending order.
k, -1/8, 0.3
Let c = -85 + 88. Sort -12, -4, c.
-12, -4, c
Suppose -4*q + 3*o = 0, q + 2*o - 1 = 10. Suppose 4*l = -m + 8, q*m + l = 3*l + 10. Let a = -2 - -1.92. Put m, 0.5, a in increasing order.
a, 0.5, m
Let l be (2/(-3))/(30/(-172)). Let y = l - 18/5. Sort 1, 3/4, y in increasing order.
y, 3/4, 1
Let a = 0 - 0. Let o(q) = 5*q + 2. Let f be o(0). Let h be (f - 3)*(0 + 2). Sort 2, h, a in descending order.
2, a, h
Suppose 29*o + 32 = 21*o. Let t be -3 - -3 - (3 - -1). Let r be (t/(-10))/(1/(-5)). Put r, -1, o in descending order.
-1, r, o
Let z = -39.745 - -0.345. Let a = 39 + z. Sort a, 5, -6, -1 in increasing order.
-6, -1, a, 5
Let y(c) = -3*c + 11. Let a be y(2). Suppose -4*i - 18 = -2*r, -18 + 51 = -4*i - r. Sort -2, i, 2, a.
i, -2, 2, a
Let s(m) = -2*m**3 - 64*m**2 - 271*m. Let y be s(-5). Let h be (-2)/6 - 26/(-6). Sort h, y, 0, 3 in descending order.
y, h, 3, 0
Let v = 640 - 640.5. Let i = 22.7 + -23. Sort 2, i, v, -8 in descending order.
2, i, v, -8
Let n = -10 + 6. Let m = 1591 + -1596. Sort -1, m, n in decreasing order.
-1, n, m
Let f = 12.79 - 12.39. Let c = -3.4 + 3. Let b = 0.02 - 0.52. Put f, c, b in increasing order.
b, c, f
Let v = -1.1 - -0.1. Let n = 322.321 + -322. Let b = -0.021 + n. Put 5, b, v in descending order.
5, b, v
Let k(m) = 7*m**3 - 4*m**2 + 2*m. Let u be k(2). Let a = u - 49. Sort 0, 4, a.
a, 0, 4
Let o = -220 - -223. Let i(c) = -c**2 + 7*c + 2. Let w be i(9). Put -1/3, w, o in increasing order.
w, -1/3, o
Let b = -96.8 - -95.8. Sort -0.5, b, -0.2, 1/5 in decreasing order.
1/5, -0.2, -0.5, b
Suppose 24*v = 50 + 22. Put -4, v, 37 in ascending order.
-4, v, 37
Let r be (17 - -1)/(6/(-4)). Let i(c) = 3*c + 25. Let k be i(-7). Sort 3, 0, k, r in ascending order.
r, 0, 3, k
Let m be -21*(-3 - (-42)/18). Suppose 3*q - 5*g - 1 - m = 0, 0 = 3*g. Sort 0, -17, q in decreasing order.
q, 0, -17
Let s(j) = -j**3 - 5*j**2 - j - 4. Suppose 3*f + 21 - 6 = 0. Let b be s(f). Let q(l) = l**2 - 13*l - 3. Let t be q(13). Sort b, 2, t.
t, b, 2
Suppose 19*d = -80 + 23. Let y = -8 + 7. Put y, 2, d in increasing order.
d, y, 2
Let v = 32.93 - 1.43. Let n = v - 31. Put n, -0.7, -4 in increasing order.
-4, -0.7, n
Suppose -4*a + 5*l = -110, 0 = 3*l - 6. Let r = a - 30. Sort r, 3, 4 in descending order.
4, 3, r
Let p = 16 + -14. Suppose p*h + 0*h = 0. Suppose 4*s = -h*s + 8. Put 1, 3, s in increasing order.
1, s, 3
Let k = 88 + -437/5. Let h be (-4)/(-34) + 474/17. Let c = h + -29. Sort k, c, -0.3 in decreasing order.
k, -0.3, c
Suppose 0 = -7*o + 12*o - 15. Sort 4, o, -4, -3.
-4, -3, o, 4
Suppose -11*t + 13*t = 8. Let m(q) = 2*q - 9. Let n be m(3). Sort n, 2, t, 3 in ascending order.
n, 2, 3, t
Let d = 688 + -686. Sort -0.082, -0.3, d in increasing order.
-0.3, -0.082, d
Let q = 103 - 61. Let u be (-4)/(-3) - 98/q. Put -3, u, 2 in descending order.
2, u, -3
Let z = 104 + -110. Let t be 100/(-175)*(z + -1). Suppose -4*x + 35 = 4*k - 7*x, 0 = -k - x. Put k, -25, t in descending order.
k, t, -25
Let v be (13 - (2 + -1))/1. Let j be (-1)/(1/v*4). Put j, -4, -5 in increasing order.
-5, -4, j
Let h be (-2 - -1*12) + -4. Suppose -2*o - o - h = 0. Sort 1, o, -3, 5.
-3, o, 1, 5
Suppose 0 = 19*q - 8*q - 319. Put -3, 4, q in descending order.
q, 4, -3
Let z = 5.15 + -0.35. Let h = -29.8 + z. Let v = 24.9 + h. Put v, -3, -2/3 in decreasing order.
v, -2/3, -3
Suppose 22*z + 72 = 4*z. Sort 0, 57, z, 1 in decreasing order.
57, 1, 0, z
Let v(g) = -2*g - 1. Let l be v(-2). Suppose -24 = -l*n - 4*i, -i + 13 = 4*n - 2*i. Sort 2, n, -4 in decreasing order.
n, 2, -4
Let m(y) = y**2 - 7*y + 10. Let i be m(3). Let n(p) = -2*p**2 + 6*p + 18. Let b be n(i). Sort -1/4, 5, 2/7, b.
b, -1/4, 2/7, 5
Let q(m) = -6*m + 32. Let j be q(5). Suppose -3*s + 5*f - 37 = 0, s - j*s - 24 = -4*f. Put 6, s, 4 in descending order.
6, 4, s
Let r be (0/((-9)/(9/2)))/(-4). Suppose -12*u + 2*u - 10 = r. Sort -5, 0, 1, u in decreasing order.
1, 0, u, -5
Let b = 3 - 2. Suppose 0 = 9*y + 22 + 5. Sort 2, y, b in descending order.
2, b, y
Suppose 3 = 3*o - 3*g, 0 = -2*o + 4*o - 3*g - 1. Suppose -q = q - o. Sort -1, 2, q in decreasing order.
2, q, -1
Let z(q) = -2*q**3 - 3*q**2 - 4*q - 6. Let f be z(-2). Sort 2, f, -3, 21.
-3, 2, f, 21
Let k = 908.5 + -908. Let t = 0 - 4. Sort -2/7, t, k in decreasing order.
k, -2/7, t
Let k = -460.12 - -460. Put k, 3, -2 in decreasing order.
3, k, -2
Suppose 4*n - 2*c + 22 = 0, 5*n + c = 3*c - 29. Let a(d) = d**2 - 6*d - 10. Let q be (-7)/((0 - 2)/2). Let j be a(q). Sort -4, j, n in ascending order.
n, -4, j
Let d(c) = -c**2 + 8*c + 5. Let z be d(7). Suppose -6*t + 0*t - z = 0. Sort 4, t, -1 in descending order.
4, -1, t
Suppose -22 = 4*l + 2*k, 0 = -l + k + 17 - 15. Put l, -4, -72 in decreasing order.
l, -4, -72
Let c = -217 + 219. Let s = 0.1 + -0.4. Put c, s, 2/3, 2/7 in increasing order.
s, 2/7, 2/3, c
Let q = -14 + 18. Suppose -3*i + q = 112. Let k be (-2)/(-9) + 188/i. Put -3, -2, k in increasing order.
k, -3, -2
Let f be -1 - (15*-1)/5. Suppose 4*n = j + 8, 6*j - f*j + 19 = 3*n. Sort n, -2, -3 in decreasing order.
n, -2, -3
Let q = -180 + 170. Suppose 5*x = x + 4. Sort q, -4, x in decreasing order.
x, -4, q
Suppose 3*m = u + 2*m - 1, 2*m = u - 3. Let g be (0 - 3)/3 + 3. Suppose 4*p = -g*l + 7*l + 37, 2*p - 16 = 2*l. Put p, u, -5 in descending order.
p, u, -5
Suppose 4*t - 2*t + 50 = 0. Let d = 23/2 + -12. Sort 4, d, t in decreasing order.
4, d, t
Suppose 122*a = 128*a - 84. Sort a, -3, -5, 5 in descending order.
a, 5, -3, -5
Let q(z) = 8*z + 40. Let f be q(-5). Put -3, 12, -2, f in decreasing order.
12, f, -2, -3
Let m be ((-9)/(-27))/((-2)/30). Sort -2, 2, -1, m.
m, -2, -1, 2
Let p be ((-24)/108)/(0 - 1). Let u be (21/(-49))/((-10)/(-7)). Sort 0, u, p in descending order.
p, 0, u
Suppose -5*n = 5*b, 0 = n - 4*b + 8*b - 6. Let k = 280 + -279. Sort k, -9, n, -3.
-9, -3, n, k
Suppose -5*s = 4*c + 21, 2*c + 2*s + 15 = 5. Put 2, 52, c in descending order.
52, 2, c
Suppose r - 334 = 5*z + 3*r, 3*z + 192 = 3*r. Sort -2, z, -3 in ascending order.
z, -3, -2
Suppose 80*z - 96 - 101 = 123. Let a = 10 - 14. Sort -0.2, z, a, -3 in descending order.
z, -0.2, -3, a
Let q = -7 - -2. Let h be 2*3*(243/36 - 7). Put q, h, -1 in increasing order.
q, h, -1
Let l be ((-2)/3)/(192/90 + -2). Suppose p - 18 = -5*k, -2*k - 24 = -5*k - 5*p. Sort k, -1, l in decreasing order.
k, -1, l
Let a be 24/(-26)*4/(-8). Let o = 1403 - 1406. Put o, 4, a in decreasing order.
4, a, o
Let z be 2 - (-13)/((-91)/12). Let i = 16.5 - 16.2. Put 2, 0.09, z, i in descending order.
2, i, z, 0.09
Let n = 124.46598 + -0.03598. Let h = 125 - n. Let k = h - 0.6. Put 0.2, k, -3 in ascending order.
-3, k, 0.2
Let a = -4 - -2. Suppose -27 = 2*h - 47. Suppose -42 = -h*p - 12. Put 4, a, p in descending order.
4, p, a
Let f be 77/429*6/7. Let n = 0.1 - -0.1. Sort n, -0.1, f, 2/3 in ascending order.
-0.1, f, n, 2/3
Suppose -52*t - 6 = -55*t. Suppose -t*h = 34 + 64. Sort -4, -2, h in increasing order.
h, -4, -2
Suppose -15 = -2*h + 23. Sort -3, 2/7, 0, h.
-3, 0, 2/7, h
Suppose 0 = 5*b + 279 - 194. Let d = -20 - b. Put 5, 0, d in ascending order.
d, 0, 5
Let a = 70056.17 + -70361. Let f = -307 - a. Let o = f + 0.17. Sort o, -5, -0.5 in decreasing order.
-0.5, o, -5
Let d be 9*4/252*6/21. Sort 0.4, d, -2/17, 1 in ascending order.
-2/17, d, 0.4, 1
Let d(f) = f + 1. Let s be d(-2). Let z = -3 - s. Let q be (z/8)/(9/(-12)). Sort q, -4/7, 0 in ascending order.
-4/7, 0, q
Let x = -1/118513 - 28324511/11377248. Let u = 1/96 - x. Let g = -111.5 - -112. Sort u, g, -0.4 in descending order.
u, g, -0.4
Let f(j) = j**2 + 22*j + 70. Let b be f(-18). Put 17, 11, b, 2 in descending order.
17, 11, 2, b
Let g be -1 + -1 + (3 - 2). Let h = -144 - -142. Sort g, h, 1.
h, g, 1
Let r = 1.3 + -1.6. Let b = -0.1 + 0.09. Let v = b + 5.01. Sort r, 0.3, v in increasing order.
r, 0.3, v
Let a be 0 + 11/(-22)*(-24)/3. Put -2, 5, a, 3 in descending order. | 2023-12-11T01:27:04.277712 | https://example.com/article/3678 |
Alumni from the John Marshall High School class of 1995 that have been added to this alumni directory are shown on this page. All of the people on this page graduated in '95 from John Marshall . You can register for free to add your name to the JMHS alumni directory. | 2023-08-27T01:27:04.277712 | https://example.com/article/5442 |
Things escalated once they got to The Social apartment complex. Hartzog said she asked Ralston to get out, but he refused. She got on the phone with 911 and Hartzog said dispatch recommended her opening the door to help Ralston get out of the car. When she opened the door... | 2023-11-26T01:27:04.277712 | https://example.com/article/5410 |
TOKYO (Reuters) - The number of coronavirus cases in Japan has risen to 1,423 as of mid-morning on Saturday, with western Nagasaki prefecture reporting its first case, public broadcaster NHK said.
The total of 1,423 infections includes 697 from the Diamond Princess cruise ship and 14 returnees on charter flights from China, according to NHK data.
Japan has now recorded 28 deaths from the virus, including seven from the cruise ship, NHK said.
(Reporting by Daniel Leussink; editing by Richard Pullin) | 2023-11-14T01:27:04.277712 | https://example.com/article/2894 |
Monster, try googleing it, I have seen it on a video hosting site from China somewhere in the past. Also, you may enjoy Striking Viking's. National Geographic video about his abduction by the FARC. It is on YouTube.
If you have time, check out the videos on YouTube by mordeth13, atlasrider and svengalie
__________________
"Umm be careful what you say, this is Skippii....
You may get it delivered in the form of a shake or some interperative dance routine that involves nakedness, pizza and a stuffed raccoon..." -DCrider
__________________XC Rider
"Motorcycles have put me in touch with wonderful people. As a result of that, I have an elevated idea about how good everybody in the world is." - Ted SimonMy Ride Reports.SpotWalla: WHERE IS XC RIDER!?
Oh, I almost forgot to mention, please keep an eye and ear open for a good deal on the following items that I will need to prep this bike for its future trips, and send me the info. Here's what I'm personally keeping an eye out for as of right now:
1) Versys front forks assembly
2) Versys rear shock
3) Skid plate (will probably end up fabing my own but if a sweet deal is found....)
4) Engine guards
5) Hard side cases, be they Pelican, Caribou, aluminum pannier type, etc.... I just want them to be hard, waterproof, and lockable.
6) Versys gas tank (would be good to have more gas)
7) Some type of Barkbusters that will fit
Those are the main things, but I'm sure that there will be more.
__________________XC Rider
"Motorcycles have put me in touch with wonderful people. As a result of that, I have an elevated idea about how good everybody in the world is." - Ted SimonMy Ride Reports.SpotWalla: WHERE IS XC RIDER!?
Oh, I almost forgot to mention, please keep an eye and ear open for a good deal on the following items that I will need to prep this bike for its future trips, and send me the info. Here's what I'm personally keeping an eye out for as of right now:
1) Versys front forks assembly
2) Versys rear shock
3) Skid plate (will probably end up fabing my own but if a sweet deal is found....)
4) Engine guards
5) Hard side cases, be they Pelican, Caribou, aluminum pannier type, etc.... I just want them to be hard, waterproof, and lockable.
6) Versys gas tank (would be good to have more gas)
7) Some type of Barkbusters that will fit
Oh, I almost forgot to mention, please keep an eye and ear open for a good deal on the following items that I will need to prep this bike for its future trips, and send me the info. Here's what I'm personally keeping an eye out for as of right now:
1) Versys front forks assembly
2) Versys rear shock
3) Skid plate (will probably end up fabing my own but if a sweet deal is found....)
4) Engine guards
5) Hard side cases, be they Pelican, Caribou, aluminum pannier type, etc.... I just want them to be hard, waterproof, and lockable.
6) Versys gas tank (would be good to have more gas)
7) Some type of Barkbusters that will fit
Those are the main things, but I'm sure that there will be more.
You forgot the DL1000 front wheel w/ rotors. I want the first one though... | 2024-05-07T01:27:04.277712 | https://example.com/article/5769 |
The United Nations (UN) human rights chief on Thursday called for a major investigation into abuses in Kashmir, as his office released its first-ever report on alleged rights violations committed by both India and Pakistan in the disputed territory.
Zeid Ra'ad Al Hussein said he would urge the Human Rights Council, which opens a new session next week, "to consider establishing a Commission of Inquiry (COI) to conduct a comprehensive independent international investigation into allegations of human rights violations in Kashmir."
A COI is one of the UN's highest-level probes, generally reserved for major crises like the conflict in Syria.
The report, which the UN said was the first-of-its-kind for Kashmir, highlights "chronic impunity for violations committed by security forces", the rights of office said in a press release.
The findings come after months of deadly clashes along Line of Control.
The report said that Zeid met with representatives of both governments following an upsurge of violence in July 2016, triggered by India's killing of 22-year-old Hizbul Mujahideen commander Burhan Wani.
Concerned by what the UN termed "large and unprecedented" protests after Wani's death, Zeid asked for "unconditional access" to Kashmir, but neither government agreed.
His office then began remote monitoring of the region, ultimately producing a report covering alleged abuses between January 2016 and April of this year.
The report, which focuses mainly on India-held Kashmir, accuses Indian troops of being responsible for an estimated 145 unlawful killings, far surpassing the 20 people estimated to have been killed by militant groups during that period.
"It is essential that the Indian authorities take immediate and effective steps to avoid a repetition of the numerous examples of excessive use of force by security forces in Kashmir," Zeid was quoted as saying.
Turning to Azad Jammu and Kashmir (AJK), the report identifies "a range of human rights abuses", but notes they "are of a different calibre or magnitude and of a more structural nature".
The rights office also said that restrictions on freedom of expression and assembly made it difficult to obtain information about conditions in AJK.
Pakistan should "end the misuse of anti-terror legislation to persecute those engaging in peaceful political and civil activities and those who express dissent," the UN said.
India has about 500,000 soldiers in the part of Kashmir it controls, where armed groups are fighting for independence or a merger with Pakistan.
Pakistan welcomes COI proposal
The Foreign Office (FO) in a press release said Pakistan "welcomes the proposal by the UN High Commissioner for Human Rights to establish a Commission of Inquiry for international investigation into human rights violations" in IHK.
"This proposal is consistent with Pakistan’s several calls to this effect since 2016, even as India has continued to ignore legitimate demands for probe into gross and systematic violations, including pellet guns, excessive use of force, arbitrary arrest and detentions as well as continued sexual violence as part of overall impunity enjoyed by Indian security forces," the handout read.
The report's main focus is on IHK, the FO noted, and the "contents, scale and the narrative of killings, maiming, abuse and impunity articulated in the report is a reaffirmation of what Pakistan has long highlighted for the international community."
"References to human rights concerns in AJK and Gilgit-Baltistan should in no way be construed to create a false sense of equivalence with the gross and systematic human rights violations in IHK," the FO cautioned. | 2024-04-22T01:27:04.277712 | https://example.com/article/8384 |
A porous silicon-palladium composite film for optical interferometric sensing of hydrogen.
Porous Si Fabry-Pérot films are coated with Pd via immersion plating. The materials are characterized by electron microscopy and infrared spectroscopy. The Pd-coated porous Si samples exhibit distinct Fabry-Pérot fringes in the optical reflection spectrum due to thin film optical interference in the porous Si layer, though the reflectivity spectrum loses fidelity upon Pd coating. The effect of H2 exposure on the interference spectrum is studied. Absorption of hydrogen into Pd induces a lattice expansion, which results in a shift of the optical fringes and a decrease in the reflected intensity. The detection limit measured at room temperature is approximately 0.2% (by volume) in an N2 carrier gas, with a response time of a few seconds. | 2024-06-12T01:27:04.277712 | https://example.com/article/1360 |
Basal cell adenocarcinoma of the submandibular gland.
Basal cell adenoma is a well recognized histopathologic variant of monomorphic adenoma of salivary gland, but in recent years there have been occasional reports of malignant basal cell tumors of major salivary glands. We present a case report of one such basal cell adenocarcinoma arising in the submandibular gland and discuss the differential diagnosis and distinction from a basal cell adenoma. We also review the published literature on basal cell adenocarcinoma. This is the first case of basal cell adenocarcinoma to be studied in detail by both immunohistochemistry and electron microscopy. There has been debate in the past as to the cell of origin of salivary gland basal cell tumors and specifically as to whether myoepithelial differentiation occurs in these tumors. The immunohistochemical and ultrastructural features of this case provide evidence for a dual population of ductal and myoepithelial cells. A flow cytometric analysis of nuclear deoxyribonucleic acid content showed the presence of DNA aneuploidy within one tissue block. | 2023-09-08T01:27:04.277712 | https://example.com/article/8785 |
Background {#Sec1}
==========
Most patients assume that they are receiving evidence-based care made by well-informed medical practitioners. However, reporting bias within peer-reviewed literature makes that assumption difficult \[[@CR1], [@CR2]\]. Evidence of such reporting bias has been well documented \[[@CR3]--[@CR6]\], with many studies showing that trials with statistically significant results are more likely to be published and to be published more quickly than those with no statistical difference \[[@CR3], [@CR6]--[@CR8]\]. Such reporting bias may affect the results of systematic reviews and meta-analyses toward more positive results \[[@CR9], [@CR10]\] and lead to erroneous decision-making with serious consequences for patients \[[@CR11], [@CR12]\].
To limit reporting bias, the International Committee of Medical Journal Editors (ICMJE) released a statement in 2005 that made trial registration a condition for publication \[[@CR13]--[@CR15]\]. A further step was achieved in 2007 with the US Food and Drug Administration Amendments Act (FDAAA 801) requiring phase 2--4 trials of FDA-approved drugs, devices, or biologics to post results on the federally funded registry ClinicalTrials.gov within 1 year of completion \[[@CR16], [@CR17]\]. According to the law, "a table of values for each of the primary and secondary outcome measures for each arm of the clinical trial, including the results of scientifically appropriate tests of the statistical significance of such outcome measures" should be posted \[[@CR18]\]. However, it seems that many trials with results posted fail to report a an estimate of treatment effect or *p*-value.
In this study, we aimed to assess how many superiority clinical trials with results posted at ClinicalTrials.gov report statistically significant results and whether the proportion of significant results differed for trials with no treatment effect estimate or *p*-value posted.
Methods {#Sec2}
=======
Data sources {#Sec3}
------------
On 2 June 2015, one of the authors (EGB) searched ClinicalTrials.gov for "Studies with Results" in the Study Results field, then downloaded all records corresponding to these studies as excel and xml files. There was no limit on date. xml files were handled with R version R 3.2.3 (R Foundation for Statistical Computing, Vienna, Austria; [https://www.R-project.org/](https://www.r-project.org/)) with the xml package.
Identification of completed phase 3 or 4 clinical trials with a superiority hypothesis {#Sec4}
--------------------------------------------------------------------------------------
Trials reported as "phase 3" or "phase 4" in the phase field, as "randomized" in the study design field, and as "completed" in the recruitment field were considered for inclusion. Trials not reporting these elements were excluded. We identified the number of arms reported in the study results and excluded single-arm trials as well as trials involving three or more arms so as to focus on comparisons between an experimental intervention and a control. We excluded non-inferiority and equivalence trials, which were identified if the keywords "non-inferiority," "non-inferior," "equivalence," "bioequivalence," "bio-equivalence," or "equivalent" were present in the following fields: study design, endpoint classification, or study results. We manually verified that each trial excluded on the basis of these criteria met the definition of a non-inferiority trial (i.e., aiming to show that an experimental intervention is non-inferior to a control one) or equivalence trial (i.e., aiming to show that two interventions have therapeutic equivalence \[[@CR19], [@CR20]\]). We also excluded pharmacokinetic trials reported as a "bio-equivalence study" or "pharmacokinetics/dynamics study" in the endpoint classification field or based on information reported in the study results. We considered all other trials as superiority trials (i.e., aiming to show a statistical difference between two interventions \[[@CR20]\]) and included them. The selection process was done by one reviewer (EGB) and checked by a second reviewer (JS). Any discrepancies were resolved by a third reviewer (AD).
Extraction of data from ClinicalTrials.gov {#Sec5}
------------------------------------------
The following characteristics were extracted from the records downloaded from ClinicalTrials.gov:General characteristics: we collected the phase of the trial (phase 3 or 4), type of intervention assessed (e.g., drug, biological, or device), type of control (i.e., placebo, no treatment, or active control), sponsor, and collaborators. We considered that there was an industry sponsorship if the sponsor or one of the collaborators was industry. We also extracted sample size and primary completion date (i.e., date of final collection for the primary outcome).Location: we collected the countries where the trial was conducted and whether the trial was conducted in a single country and the number of centers involved.Results posted: we collected the date when results were first received and whether the study was likely subject to the FDAAA. This characteristic is based on an algorithm developed by the US National Library of Medicine. Then, for the first primary outcome reported in the Results section, we collected whether a treatment effect estimate and/or *p*-value was reported and, if yes, we extracted them.
Reporting of statistically significant results for the first primary outcome reported {#Sec6}
-------------------------------------------------------------------------------------
For each trial with a treatment effect estimate and/or *p*-value reported, we evaluated whether results reported were statistically significant or not. To do so, we relied on the *p*-value reported at ClinicalTrials.gov and considered *p*-values \<0.05 as statistically significant. Five percent has been the most commonly used threshold for statistical significance in clinical intervention research \[[@CR21]\]. When only a measure of treatment effect with 95% confidence interval (CI) was reported, we derived the *p*-value from the 95% CI using the formula reported by Altman and Bland \[[@CR22]\].
Calculation of *p*-values for trials with no treatment effect estimate or *p*-value reported {#Sec7}
--------------------------------------------------------------------------------------------
For trials with no treatment effect estimate or *p*-value reported, we calculated whenever possible the treatment effect estimate and corresponding *p*-value using the results per arm posted at ClinicalTrials.gov. This calculation was possible only for binary and continuous outcomes when sufficient data were reported at ClinicalTrials.gov. For binary outcomes, we calculated relative risk with 95% CI and the corresponding *p*-value from the number of events and number of participants analyzed reported per arm. For continuous outcomes, we calculated mean difference with 95% CI and the corresponding *p*-value from the mean and standard deviation (SD) or standard error (SE), which we transformed to SD as well as the number of participants analyzed reported per arm.
Extraction of results per arm from ClinicalTrials.gov and calculation of treatment effect estimate with 95% CI and the corresponding *p*-value was systematically performed by two reviewers working independently (JS and CR) using Revman 5.3 (Copenhagen: The Nordic Cochrane Centre, The Cochrane Collaboration, 2014). Then, all results were compared and any disagreement was resolved by consensus with the help of a senior researcher (AD) if needed. We also considered a *p*-value \<0.05 as statistically significant.
Calculation of treatment effect estimate and corresponding *p*-value was not possible for censored outcomes (e.g., progression-free survival), repeated measurements of the outcome over time (e.g., change in mean bone mineral density from baseline assessed at 12, 24, and 36 months), other situations for which there were several observations or events per patient because these situations required individual patient data, or when there was no event in both groups.
Statistical analysis {#Sec8}
--------------------
Categorical variables were described with frequencies (percentages) and quantitative variables with median (Q1-Q3). To assess the statistical significance of the results, we focused on *p*-values rather than on treatment effect estimates with 95% CI, and graphically represented the density plots of *p*-values for trials by whether a treatment effect estimate and/or *p*-value was reported or not. For this, we considered *p*-values \<0.0001 equal to 0.0001.
We aimed to identify trial characteristics associated with reporting a *p*-value \<0.05 for the first primary outcome at ClinicalTrials.gov. To do, so, we first compared trial characteristics by whether results were reported to be statistically significant or not using chi-square tests for categorical variables and Wilcoxon tests for continuous variables. Then, we used a multivariate logistic regression model to identify factors independently associated with the reporting of statistically significant results. All variables that were statistically significant on univariate analyses were entered into multivariate analysis except single-center, which was closely related to single-country status.
Statistical analysis involved use of SAS 9.3 (SAS Inst., Cary, NC, USA). The density plot was created with R 3.2.3 (R Foundation for Statistical Computing) using a syntax provided in a previous article \[[@CR23]\].
Results {#Sec9}
=======
Identification of completed randomized trials with a superiority hypothesis {#Sec10}
---------------------------------------------------------------------------
Figure [1](#Fig1){ref-type="fig"} shows the selection process. From the 192,175 studies registered at ClinicalTrials.gov on 2 June 2015, 17,536 had results posted, with 9640 (55%) likely to be subject to the FDAAA. We identified 2823 completed phase 3 or 4 randomized trials with a superiority hypothesis.Fig. 1Flow chart of the selection of trials. *RCT* randomized controlled trial, *SD* standard deviation
Reporting of treatment effect estimate and/or *p*-value at ClinicalTrials.gov {#Sec11}
-----------------------------------------------------------------------------
Among the 2823 eligible trials, 1400 (50%) had a treatment effect estimate and/or *p*-value reported at ClinicalTrials.gov, and 1423 trials (50%) had only results per arm reported. Characteristics of trials by whether a treatment effect estimate and/or *p*-value was reported or not are reported in Table [1](#Tab1){ref-type="table"}. Briefly, as compared with trials with no treatment effect estimate or *p*-value reported, those with a treatment effect estimate and/or *p*-value reported were more likely to be phase 3 trials (68% versus 51%), to have an inactive comparator (59% versus 36%), to have an industry sponsorship (83% versus 74%), to involve several countries (41% versus 21%) and several centers (66% versus 49%), to be subject to the FDAAA (68% versus 59%), and to have a larger median sample size (270 versus 156).Table 1Characteristics of completed phase 3 or 4 randomized clinical trials with results posted and a superiority hypothesis by whether a treatment effect estimate and/or *p*-value is reported at ClinicalTrials.govCharacteristicsCategoriesTrials with treatment effect estimate and/or *p*-value reported\
(N = 1400)Trials with no treatment effect estimate or *p*-value reported\
(N = 1423)Phase of the studyPhase 3948 (68)728 (51)Phase 4452 (32)695 (49)Intervention typeDrug1088 (78)1014 (71)Mixed interventions180 (13)148 (10)Biological48 (3)96 (7)Device40 (3)97 (7)Other44 (3)68 (5)Control groupPlacebo or no treatment822 (59)516 (36)Active treatment578 (41)907 (64)SponsorshipIndustry totally or partly1162 (83)1055 (74)Academic only238 (17)368 (26)CountriesSingle country646 (46)982 (69)Multiple countries568 (41)292 (21)Not reported186 (13)149 (10)LocationAt least one site in the USA846 (61)822 (58)No site in the USA368 (26)452 (32)Not reported186 (13)149 (10)Subject to the FDAAAYes951 (68)843 (59)No377 (27)556 (39)Not reported72 (5)24 (2)CentersMulticenter929 (66)696 (49)Single center285 (20)578 (41)Not reported186 (13)149 (10)Sample sizeMedian (Q1-Q3)270 (116--520)156 (60--378)Time to results first received at ClinicalTrials.gov (month)Median (Q1-Q3)13.5 (11.7--26.4)17.1 (12.0--32.3)Data are presented as n (%) unless indicated. *FDAAA* US Food and Drug Administration Amendments Act, *IQR* Q1-Q3
Reporting of statistically significant results for the first primary outcome {#Sec12}
----------------------------------------------------------------------------
When a treatment effect estimate and/or *p*-value was reported (*N* = 1400 trials), results were reported as statistically significant for 844 trials (60%), with a median *p*-value of 0.01 (Q1-Q3: 0.001--0.26) (Fig. [2](#Fig2){ref-type="fig"}). For trials with no treatment effect estimate or *p*-value reported at ClinicalTrials.gov (*N* = 1423), we could calculate treatment effect estimate and the corresponding *p*-value for 929 (65%). From data posted at ClinicalTrials.gov, *p*-values could not be calculated for 494 trials (35%), mainly because of the reporting of percentages only for binary outcomes (*n* = 187), no reporting of mean (±SD) for continuous outcomes (*n* = 95), censored data (*n* = 61), and repeated measurements over time (*n* = 52). Characteristics did not differ between trials for which we could calculate *p*-values and those with no treatment effect estimate or *p*-value reported ([Appendix](#Sec16){ref-type="sec"}). Among the 929 trials for which we could calculate *p*-values, results were statistically significant for 342 (37%), with a median *p*-value of 0.19 (Q1-Q3: 0.005--0.59) (Fig. [2](#Fig2){ref-type="fig"}).Fig. 2Density plot of *p*-values for trials with results for the first primary outcome posted at ClinicalTrials.gov. *Left*: 1400 trials with treatment effect estimate and/or *p*-value reported. *Right*: 929 trials with no treatment effect estimate or *p*-value reported (*p*-value calculated from data reported per arm at ClinicalTrials.gov). The lowest 25 quantiles are not visible because of clustering at *p* = 0.001 and *p* = 0.005, respectively. The *white circle* indicates the median *p*-value
Factors associated with reporting statistically significant results for the first primary outcome {#Sec13}
-------------------------------------------------------------------------------------------------
Table [2](#Tab2){ref-type="table"} compares trial characteristics by whether statistically significant results were reported or not. Trials with significant results reported were more likely to be phase 3 trials (74% versus 53%, *p* \< 0.0001), to have an inactive comparator (64% versus 40%, *p* \< 0.0001), to have an industry sponsorship (totally or partially) (88% versus 74%, *p* \< 0.0001), to be subject to the FDAAA (70% versus 61%, *p* \< 0.0001), and to have a larger sample size or to be a multicenter trial involving several countries than those reporting a *p*-value ≥0.05 or not reporting treatment effect estimate or *p*-value.Table 2Characteristics of completed phase 3 or 4 randomized clinical trials with a superiority hypothesis according to whether significant results (i.e., *p*-value \<0.05 or treatment effect with 95% CI not including the null value) were reported at ClinicalTrials.govCharacteristicsCategoriesTrials with significant results reported\
(*N* = 844)Trials with non statistically significant results or no treatment effect estimate or *p*-value reported\
(*N* = 1979)*p*-valuePhase of the studyPhase 3622 (74)1054 (53)\<0.0001Phase 4222 (26)925 (47)Intervention typeDrug675 (80)1427 (72)\<0.0001Mixed interventions97 (11)231 (12)Biological29 (3)115 (6)Device22 (3)115 (6)Other21 (2)91 (5)Control groupPlacebo or no treatment543 (64)795 (40)\<0.0001Active treatment301 (36)1184 (60)SponsorshipIndustry totally or partly744 (88)1473 (74)\<0.0001Academic only100 (12)506 (26)CountriesSingle country361 (43)1267 (64)\<0.0001Multiple countries353 (42)507 (26)Not reported130 (15)205 (10)LocationAt least one site in the USA493 (59)1175 (59)0.003No site in the USA221 (26)599 (30)Not reported130 (15)205 (10)Subject to the FDAAAYes588 (70)1206 (61)\<0.0001No201 (24)732 (37)Not reported55 (6)41 (2)CentersMulticenter581 (69)1044 (53)\<0.0001Single center133 (16)730 (37)Not reported130 (15)205 (10)Sample sizeMedian (Q1-Q3)305 (139--541)179 (62--405)\<0.0001Time to results first received at ClinicalTrials.gov (month)Median (Q1-Q3)13.0 (11.6--26.3)16.5 (12.0--30.9)\<0.0001Data are presented as n (%) unless indicated. *FDAAA* US Food and Drug Administration Amendments Act, Q1-Q3: Quartile 1-Quartile 3
On adjusted multivariate analysis, reporting statistically significant results at ClinicalTrials.gov for the first primary outcome was associated with being a phase 3 trial (odds ratio \[OR\] = 1.68, 95% CI 1.38--2.04), having an inactive comparator (OR = 2.19, 95% CI 1.83--2.61), having an industry sponsorship (OR = 1.57, 95% CI 1.22--2.03), and involving multiple countries (OR = 1.58, 95% CI 1.29--1.93) (Table [3](#Tab3){ref-type="table"}).Table 3Factors independently associated with reporting statistically significant results (i.e., reporting a *p*-value \<0.05 or treatment effect with 95% CI not including the null value) for the first primary outcome posted at ClinicalTrials.gov for completed superiority clinical trialsCharacteristicsAdjusted OR (95% CI)*p*-valuePhase of the trialPhase 3 versus 41.68 (1.38--2.04)\<0.0001InterventionDrug versus other1.20 (0.97--1.48)0.10Control groupInactive versus active2.19 (1.83--2.61)\<0.0001SponsorshipIndustry (totally or partially) versus academic1.57 (1.22--2.03)0.0005FDAAASubject versus not subject1.15 (0.94--1.41)0.17CountriesMultiple countries versus single country1.58 (1.29--1.93)\<0.0001Not reported versus single country1.50 (1.14--1.98)0.004Sample sizeFor an increase of 100 patients1.002 (0.99--1.005)0.20*OR* odds ratio, *CI* confidence interval, *FDAAA* US Food and Drug Administration Amendments Act
Discussion {#Sec14}
==========
Nearly half of the studies with results posted at ClinicalTrials.gov are not required to do so as they do not seem to be subject to the FDAAA. Nevertheless, more attention should be paid to having more complete and transparent results posted. Only half of the completed trials with results posted at ClinicalTrials.gov report a treatment effect estimate and/or *p*-value for the first primary outcome posted, with 60% of these trials reporting significant results. In contrast, the proportion of trials with significant results seemed much lower when no treatment effect estimate or *p*-value was reported. Factors independently associated with reporting statistically significant results at ClinicalTrials.gov were being a phase 3 trial, using an inactive comparator, having industry sponsorship, and involving multiple countries.
ClinicalTrials.gov is the most widely used clinical trial registry worldwide, with studies registered from 190 countries, and for now it is the only one allowing standardized posting of results \[[@CR17], [@CR18]\]. Clinical.Trials.gov represents a crucial source of information on trial results. Previous studies showed that it allows access to results not yet published and to more complete results than in corresponding published articles \[[@CR24]--[@CR26]\]. A recent study has compared results posted at ClinicalTrials.gov to corresponding FDA reports for new drug approval trials and found large concordance between both sources \[[@CR27]\].
In this study, we found that results of many trials are posted although not required, because nearly half of the trials with results posted did not seem to be subject to the FDAAA according to the algorithm developed by the US National Library of Medicine. This is encouraging and highlights a willingness to give access to study results for the sake of transparency and not only because it is compulsory.
Several methodological studies have evaluated compliance with the FDAAA requiring posting of results for applicable trials \[[@CR28]--[@CR30]\] but few have looked at the nature of the results posted. Only one research note evaluated an association between changes in primary outcomes and reporting a significant result \[[@CR31]\].
Our results show that, despite the FDAAA requirement to post results from scientifically appropriate tests of statistical significance, only half of the trials with results posted reported a *p*-value and/or a measure of treatment effect. For the other trials, we attempted to calculate treatment effect estimate and *p*-values but this was not possible for 35% of trials, mainly because of insufficient reporting or because individual patient data were required (i.e., for analysis of censored outcomes or repeated measurements over time). Therefore, for about one third of trials, systematic reviewers may be unable to use the results reported at ClinicalTrials.gov when treatment effect estimates or *p*-values are not reported. Our results also suggest that the proportion of trials with significant results differs between trials reporting or not a treatment effect estimate and/or *p*-value. Although we could not calculate treatment effect and corresponding *p*-values for all trials not reporting these, our results suggest a much lower proportion of trials with significant results when no treatment effect estimate or *p*-value is reported. These results may reflect a selective posting of treatment effect estimate and/or *p*-value when results are statistically significant. This lack of transparency may have consequences when interpreting the results posted at ClinicalTrials.gov because physicians and decision-makers may be more likely to rely on trials with *p*-values already reported.
We identified some factors associated with reporting significant results at ClinicalTrials.gov. Reporting of significant results for the first primary outcome posted were more frequent for trials sponsored by industry than academic sources, which is consistent with previous studies finding that industry trials are more likely than public trials to report significant results in published articles \[[@CR32], [@CR33]\] and at ClinicalTrials.gov \[[@CR31]\]. In addition, reporting of significant results was also more common for phase 3 trials and for trials with an inactive control. This finding is not surprising for trials with inactive control treatment because treatment effect estimates are expected to be higher in this situation than when the experimental intervention is compared to an active treatment.
This study has important implications. It highlights the importance of having complete results posted, including the posting of treatment effect estimate and/or *p*-value, to avoid any misinterpretation about the benefits of interventions. Because of the poor compliance with these requirements, it becomes necessary to improve their implementation. Systematic checking of results posted and automatic mailing to responsible parties may help improve the completeness of results posted. A recent article showed that sending emails to responsible parties of completed trials that do not comply with the FDAAA legal requirement to post results significantly improved the posting rate at 6 months \[[@CR34]\]. In April 2014, the European Union voted to adopt the Clinical Trials Regulation, which requires the registration of all clinical trials conducted in Europe and the posting of trial summary results in the European Clinical trials Database (EudraCT) within 1 year after trial completion \[[@CR35], [@CR36]\]. This is a crucial step toward more transparency and this initiative should take advantage of the body of literature available for ClinicalTrials.gov and compliance with the FDAAA during the implementation process.
Our study has some limitations. We only looked at the first primary outcome with results posted, so our study is not representative of all results posted at ClinicalTrials.gov. For trials with no treatment effect estimate or *p*-value reported, we attempted to calculate the treatment effect and corresponding *p*-values from data reported per arm, adopting the viewpoint of systematic reviewers. However, we could not do this for about one third of trials with no treatment effect estimate or *p*-value reported because of insufficient elements reported or because the data were repeated measures or censored, situations for which individual participant data are necessary. Although there was no difference between trials for which we could calculate a *p*-value and those with no treatment effect estimate and/or *p*-value, our results cannot be extrapolated to all trials with no treatment effect estimate or *p*-value reported. Finally, we focused on results reported at ClinicalTrials.gov and did not determine whether results had been published or not.
Conclusions {#Sec15}
===========
Only half of completed trials with results posted at ClinicalTrials.gov had a treatment effect estimate and/or *p*-value reported for the first primary outcome, with significant results in 60% of these. The proportion of trials with significant results seemed much lower when no treatment effect estimate or *p*-value is reported, which may suggest a selective posting of treatment effect estimate and/or *p*-value when results are statistically significant. More efforts should be expended to improve the transparency in posting results at ClinicalTrials.gov.
Appendix {#Sec16}
========
Table 4Characteristics of trials with no treatment effect estimate or *p*-value reported at ClinicalTrials.gov and those for which *p*-values could be calculatedCharacteristicsCategoriesTrials with no treatment effect estimate or *p*-value reported\
(*N* = 1423)Trials with no treatment effect estimate or *p*-value reported for which *p*-values could be calculated\
(*N* = 929)Phase of the studyPhase 3\
Phase 4728 (51)\
695 (49)440 (47)\
489 (53)Intervention typeDrug\
Mixed interventions\
Biological\
Device\
Other1014 (71)\
148 (10)\
96 (7)\
97 (7)\
68 (5)676 (73)\
92 (10)\
55 (6)\
57 (6)\
49 (5)Control groupPlacebo or no treatment\
Active treatment516 (36)\
907 (64)347 (37)\
582 (63)SponsorshipIndustry totally or partly\
Academic only1055 (74)\
368 (26)674 (73)\
255 (27)CountriesSingle country\
Multiple countries\
Not reported982 (69)\
292 (21)\
149 (10)672 (72)\
163 (18)\
94 (10)LocationAt least one site in the USA\
No site in the USA\
Not reported822 (58)\
452 (32)\
149 (10)529 (57)\
306 (33)\
94 (10)Subject to the FDAAAYes\
No\
Not reported843 (59)\
556 (39)\
24 (2)521 (56)\
390 (42)\
18 (2)CentersMulticenter\
Single center\
Not reported696 (49)\
578 (41)\
149 (10)437 (47)\
398 (43)\
94 (10)Sample sizeMedian (Q1-Q3)156 (60--378)146 (60--372)Time to results first received at ClinicalTrials.gov (month)Median Q1-Q3)17.1 (12.0--32.3)17.8 (12.1--32.9)Data are presented as n (%) unless indicated. *FDAAA* US Food and Drug Administration Amendments Act, Q1-Q3: Quartile 1-Quartile 3
CI
: confidence interval
FDA
: Food and Drug Administration
FDAAA
: Food and Drug Administration Amendments Act
ICMJE
: International Committee of Medical Journal Editors
OR
: Odds ratio
Q1
: Quartile 1
Q3
: Quartile 3
RCT
: Randomized controlled trial
SD
: Standard deviation
SE
: Standard error
We thank Elise Diard (Centre de Recherche Epidémiologie et Statistique, Inserm U1153, French Cochrane Center) and Elodie Perrodeau, M.Sc. (Centre de Recherche Epidémiologie et Statistique, Inserm U1153, French Cochrane Center) for their help with the figure. ED and EP did not receive any compensation for their role in the study.
Funding {#FPar1}
=======
This study did not receive any external sources of funding.
Availability of data and materials {#FPar2}
==================================
All data are available for academic researchers upon request.
Authors' contributions {#FPar3}
======================
AD and PR designed the study. EB downloaded data and managed xml files with the help of IA. EB and JS screened relevant studies. EB, JS, and CR extracted data. EB, JS, CR, and AD performed the statistical analysis. AD, EB, and PR interpreted the results. AD and EB wrote the article. All authors critically reviewed the manuscript. AD is the guarantor. All authors read and approved the final manuscript.
Competing interests {#FPar4}
===================
The authors declare that they have no competing interest.
Consent for publication {#FPar5}
=======================
Not applicable. This is a research on research study.
Ethics approval and consent to participate {#FPar6}
==========================================
Not applicable. This is a research on research study.
| 2023-08-05T01:27:04.277712 | https://example.com/article/7088 |
Elijah Cossio wakes up at 5 a.m. every day to bake before school and then sells his desserts once classes have ended
Houston Boy, 14, Sells Homemade Baked Goods After School to Help His Mother with Medical Bills
A Houston teen is doing his part to help his mother cope with expensive medical bills that have piled up after she suffered a serious health scare.
For the last few years, Elijah Cossio has been assisting his mother Tina Hernandez with her hospital bills by holding a daily bake sale after school, ABC affiliate KTRK reported.
Get push notifications with news, features and more.
The 14-year-old routinely wakes up at 5 a.m. each day before school to bake desserts and once classes have ended, he sells his homemade goods to classmates, parents, and community members, according to the outlet.
Hernandez, a mother of three who nearly died from a bacterial infection in 2017, couldn’t be prouder of her son.
“It feels wonderful because I raised him that way so I’m very proud of him,” she tells PEOPLE.
But Elijah’s baking hobby wasn’t something he ever expected to be doing in order to support his mother and siblings, the teen revealed on a GoFundMe page set up by his mother on his behalf.
“I started baking as just a hobby and to learn how to make my own money,” Elijah wrote on the page. “My mom has always taught me to work for what I want because nothing is handed to you for free.”
“Not knowing this knowledge was being given to me to prepare me for what there was to come,” he added.
The teen’s world was flipped upside down in June 2017 when Hernandez contracted a “horrific” bacterial infection from the gym that led to a three-month hospitalization.
“It spiraled out from there,” she tells PEOPLE. “I had to undergo five surgeries and three blood transfusions and I died for 14 minutes after the first surgery… I don’t remember those three months of my life.”
During that traumatic time, Elijah said he had no idea what his mother’s future held, recalling on the GoFundMe, “I did not know if that would be the last time I would see her.”
After she recovered from the multiple procedures, Hernandez says she required extensive therapy and had to “relearn everything,” including “walking and simple tasks, like using the restroom.”
Because she was in the hospital and unable to work, Elijah said on the GoFundMe he “knew [he] had to step up to help support her.”
RELATED VIDEO: Cookies for Kids’ Cancer Funds Cancer Treatments by Encouraging Everyone to ‘Be a Good Cookie’
At that point, Elijah was already selling baked goods on the weekends to earn some extra cash — a talent he learned from his mother, who tells PEOPLE she’s been baking for over 15 years.
With his skills already mastered, he decided to increase his income by selling homemade treats every day after school.
“I remembered how much my mom taught me with baking so I decided to step up,” Elijah explained on the GoFundMe. “I started grinding and baking daily so that I can go store to store to sell and raise money.”
Some of the desserts he currently offers include strawberry cupcakes, red velvet cupcakes, cherry cheesecakes, fudge brownies and chocolate chip cookies, according to KTRK.
Since September 2017, the teen’s sales have taken off, with thousands of people supporting his endeavors both in person and via GoFundMe.
Hernandez notes her son has made anywhere between $60-150 per day for two and a half years straight, with weekends bringing in even more.
On the new fundraiser, which launched on Tuesday, Elijah has already surpassed his $100 goal, reaching over $6,100 in donations.
“It first started as a weekend thing, but after the accident, it turned into an every day thing,” Hernandez explains to PEOPLE. “I’ve always pushed my kids [and told them] there’s nothing you can’t do… I said, ‘All you gotta do is find something you’re good at and try it!'”
Added Elijah on the GoFundMe: “Now that my mom is doing better I found a passion. I want to continue to help out as well as save money to better myself.”
The teen said his goal is to become an engineer in the Army and attend culinary school, according to the fundraiser.
Hernandez also tells PEOPLE that her son hopes to own his own cupcake truck one day — something Elijah is already certain he’ll achieve thanks to the work ethic that was instilled in him from the time he was young. | 2024-02-02T01:27:04.277712 | https://example.com/article/2618 |
/*
* Copyright (c) 2018 Balabit
*
* This library is free software; you can redistribute it and/or
* modify it under the terms of the GNU Lesser General Public
* License as published by the Free Software Foundation; either
* version 2.1 of the License, or (at your option) any later version.
*
* This library is distributed in the hope that it will be useful,
* but WITHOUT ANY WARRANTY; without even the implied warranty of
* MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU
* Lesser General Public License for more details.
*
* You should have received a copy of the GNU Lesser General Public
* License along with this library; if not, write to the Free Software
* Foundation, Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA
*
* As an additional exemption you are allowed to compile & link against the
* OpenSSL libraries as published by the OpenSSL project. See the file
* COPYING for details.
*
*/
#include <criterion/criterion.h>
#include <criterion/parameterized.h>
#include "xml-scanner.h"
#include "apphook.h"
#include "scratch-buffers.h"
#include "cfg.h"
typedef struct
{
gchar *name;
gchar *value;
} NameValuePair;
typedef struct
{
NameValuePair *expected_pairs;
PushCurrentKeyValueCB test_push_function;
} Expected;
typedef struct
{
gboolean strip_whitespaces;
GList *exclude_tags;
Expected expected;
} XMLScannerTestOptions;
static void
setup(void)
{
configuration = cfg_new_snippet();
app_startup();
}
static void
teardown(void)
{
scratch_buffers_explicit_gc();
app_shutdown();
cfg_free(configuration);
}
static XMLScannerOptions *
_create_new_scanner_options(XMLScannerTestOptions *test_options)
{
XMLScannerOptions *scanner_options = g_new0(XMLScannerOptions, 1);
xml_scanner_options_defaults(scanner_options);
if (test_options->strip_whitespaces)
xml_scanner_options_set_strip_whitespaces(scanner_options, test_options->strip_whitespaces);
if (test_options->exclude_tags)
xml_scanner_options_set_and_compile_exclude_tags(scanner_options, test_options->exclude_tags);
return scanner_options;
}
static XMLScanner *
_construct_xml_scanner(XMLScannerTestOptions *test_options)
{
XMLScanner *scanner = g_new(XMLScanner, 1);
XMLScannerOptions *scanner_options = _create_new_scanner_options(test_options);
xml_scanner_init(scanner, scanner_options, test_options->expected.test_push_function, test_options, NULL);
return scanner;
}
static void
_destroy_xml_scanner(XMLScanner *scanner)
{
xml_scanner_options_destroy(scanner->options);
g_free(scanner->options);
xml_scanner_deinit(scanner);
g_free(scanner);
}
#define REPORT_POSSIBLE_PARSE_ERROR(x) (_report_possible_parse_error((x), __LINE__))
static void
_report_possible_parse_error(GError *error, gint line)
{
cr_expect(error == NULL, "Unexpected error happened in %d", line);
if (error)
{
fprintf(stderr, "Parsing error happened: %s\n", error->message);
g_error_free(error);
}
}
TestSuite(xml_scanner, .init = setup, .fini = teardown);
Test(xml_scanner, shouldreverse)
{
GList *with_wildcard;
with_wildcard = NULL;
with_wildcard = g_list_append(with_wildcard, "tag1");
with_wildcard = g_list_append(with_wildcard, "tag2");
with_wildcard = g_list_append(with_wildcard, "tag*");
cr_assert(joker_or_wildcard(with_wildcard));
g_list_free(with_wildcard);
GList *with_joker = NULL;
with_joker = g_list_append(with_joker, "tag1");
with_joker = g_list_append(with_joker, "t?g2");
with_joker = g_list_append(with_joker, "tag3");
cr_assert(joker_or_wildcard(with_joker));
g_list_free(with_joker);
GList *no_joker_or_wildcard = NULL;
no_joker_or_wildcard = g_list_append(no_joker_or_wildcard, "tag1");
no_joker_or_wildcard = g_list_append(no_joker_or_wildcard, "tag2");
no_joker_or_wildcard = g_list_append(no_joker_or_wildcard, "tag3");
cr_assert_not(joker_or_wildcard(no_joker_or_wildcard));
g_list_free(no_joker_or_wildcard);
}
static void
_test_strip(const gchar *name, const gchar *value, gssize value_length, gpointer user_data)
{
static guint times_called = 0;
XMLScannerTestOptions *test_options = (XMLScannerTestOptions *) user_data;
NameValuePair *expected_pairs = test_options->expected.expected_pairs;
fprintf(stderr, "Name-value pushed!!! name:%s\tvalue:%s (value_len:%ld)\n", name, value, value_length);
cr_assert_str_eq(name, expected_pairs[times_called].name);
cr_assert_str_eq(value, expected_pairs[times_called].value);
times_called++;
}
Test(xml_scanner, test_strip_whitespaces)
{
const gchar *input = "<tag> \n\t part1 <tag2/> part2 \n\n</tag>";
XMLScanner *xml_scanner = _construct_xml_scanner(&(XMLScannerTestOptions)
{
.strip_whitespaces = TRUE,
.expected.test_push_function = _test_strip,
.expected.expected_pairs = (NameValuePair [])
{
{"tag", "part1part2"},
}
});
GError *error = NULL;
xml_scanner_parse(xml_scanner, input, strlen(input), &error);
REPORT_POSSIBLE_PARSE_ERROR(error);
_destroy_xml_scanner(xml_scanner);
}
| 2023-12-18T01:27:04.277712 | https://example.com/article/5851 |
Q:
why can't we define a branch of $\log f(z)$ in the whole complex plane?
My question is really simple. The only problem to define a branch of $\log f(z)$ in the whole complex plane is because we can have $f(z)=0$ for some $z\in \mathbb C$? In fact I think I don't understand well what's the problem to define $\log f(z)$ in the whole complex plane. Could someone clarifies this for me?
A:
The problem you address is already manifest for the simple "function" $z\mapsto \log z$. We want $e^{\log z}=z$ in a neighborhood of $z=1$, say. We know that the equation $e^w=1$ has the infinitely many solutions $2k\pi i$, and we then for sake of simplicity choose $w=0$ as our "target" solution. After some computation with real and imaginary parts, etc., we can say that
$${\rm Log}\,z:=\log|z|+i {\rm Arg}\,z\ ,$$
where ${\rm Arg}\,z\in\>]{-\pi},\pi[\>$ denotes the polar angle of $z$, indeed satisfies $e^{{\rm Log}\,z}=z$ in the plane without the negative real axis (and, of course, ${\rm Log}\,1=0$). Furthermore this principal value of the logarithm is an analytic function in this cut out plane, and has derivative $z\mapsto{1\over z}$ there. But it is impossible to extend this function to a continuous function defined in the full punctured plane: If you approch the slit at $-1$ from above ${\rm Arg}\,z$ converges to $\pi$, and if you approach the point $-1$ from below ${\rm Arg}\,z$ converges to $-\pi$.
Now assume that you have an analytic function $f$ with an $m$-fold $(m\geq0)$ zero at $p$. Then $f(z)=(z-p)^m g(z)$, whereby $g$ is analytic in a neighborhood $U$ of $p$, and $g(z)\ne0$ in $U$. A hypothetical function
$$h(z):=\log\bigl(f(z)\bigr)$$ would have to satisfy
$$h'(z)={1\over f(z)}f'(z)={m\over z-p}+{g'(z)\over g(z)}\ .$$
The term ${g'(z)\over g(z)}$ has a primitive in $U$, but the term ${m\over z-p}$ does not have a primitive, even in $\dot U$, for the reasons explained above. This shows that we cannot define $h$ as a bona fide function in a punctured neighborhood of any zero of $f$.
A:
Of course, you can't define $\log 0$ since there's no complex number $z$ with $e^z=0$. But as long as $f(z)\neq 0$, there's no problem defining $\log f(z)$.
But it may not be the case that $\log f$ is continuous.
A:
If $f$ is holomorphic on an open connected set $\mathcal{D}$, let's agree that $f$ has a logarithm on $\mathcal{D}$ if $f(z)=e^{g(z)}$ for some $g$ that is holomorphic on $\mathcal{D}$. Then it is necessary that $f(z) \ne 0$ in $\mathcal{D}$. But more is required because $\frac{f'(z)}{f(z)}=g'(z)$ must hold, which means $f'/f$ must have an antiderivative in $\mathcal{D}$. And, conversely, if $f'/f$ has an antiderivative in $\mathcal{D}$, then it is true that $f$ has a logarithm in the above sense. That is, if $f'/f=g'$ for some holomorphic function $g$ on $\mathcal{D}$, then $fe^{-g}$ satisfies
$$
(fe^{-g})'=f'e^{-g}-fg'e^{-g}=\frac{f'}{f}-g'=0,
$$
which forces $fe^{-g}=C$ where $C$ is a constant (this is because $\mathcal{D}$ is connected.) The constant $C$ cannot be $0$ in that case because $f$ is assumed non-vanishing. By incorporating $C$ into the exponent, $f=e^{g+K}$ and, hence, $g+K$ is a logarithm of $f$. So, if $f$ is non-vanishing in $\mathcal{D}$, then $f$ has a logarithm iff $\int_{\gamma}\frac{f'}{f}dz=0$ for every closed path $\gamma$ in $\mathcal{D}$. For example, $z^2$ cannot have a logarithm in the annulus $1 < |z| < 2$; even though $z^2$ is non-vanishing in the annulus, $\int_{|z|=1.5}\frac{2z}{z^2}dz \ne 0$.
| 2023-09-08T01:27:04.277712 | https://example.com/article/9998 |
x = 5
print x##|
print x + 10
##r
print 5
print 5 + 10 | 2024-03-27T01:27:04.277712 | https://example.com/article/9773 |
Facebook is "a cyber fantasy community where you can live out any fantasy with no real means or intent of carrying anything out," she wrote. She conceded that she had "a bad attitude" but wrote that she is "less dangerous than it looks." The judge denied her request, deeming her potentially dangerous. | 2024-01-22T01:27:04.277712 | https://example.com/article/6040 |
{
"name": "Crashlytics",
"version": "3.3.0",
"summary": "Best and lightest-weight crash reporting for mobile.",
"homepage": "https://get.fabric.io/crashlytics",
"authors": "Twitter",
"platforms": {
"ios": "6.0"
},
"source": {
"http": "https://kit-downloads.fabric.io/ios/com.twitter.crashlytics.ios/3.3.0/com.twitter.crashlytics.ios-default.zip"
},
"vendored_frameworks": "Crashlytics.framework",
"public_header_files": "Crashlytics.framework/Headers/*.h",
"license": {
"type": "Commercial",
"text": "Fabric: Copyright 2015 Twitter, Inc. All Rights Reserved. Use of this software is subject to the terms and conditions of the Fabric Software and Services Agreement located at https://fabric.io/terms. Crashlytics Kit: Copyright 2015 Crashlytics, Inc. All Rights Reserved. Use of this software is subject to the terms and conditions of the Crashlytics Terms of Service located at http://try.crashlytics.com/terms/terms-of-service.pdf and the Crashlytics Privacy Policy located at http://try.crashlytics.com/terms/privacy-policy.pdf. OSS: http://get.fabric.io/terms/opensource.txt"
},
"frameworks": [
"Security",
"SystemConfiguration"
],
"libraries": [
"z",
"c++"
],
"deprecated_in_favor_of": "FirebaseCrashlytics"
}
| 2024-01-03T01:27:04.277712 | https://example.com/article/4092 |
The visit this week of a delegation of senior representatives of the prestigious Vanderbilt University in Nashville, Tennessee, gives Belfast a chance to renew and rejuvenate its lopsided, unionist-only sister city relationship with the ‘Athens of the South’. | 2023-10-31T01:27:04.277712 | https://example.com/article/6004 |
Role of Different Treatment Modalities in Cavity Volume during the Treatment of Cystic Ecchinococcosis.
Surgery and percutaneous aspiration-injection-re-aspiration (PAIR) are widely accepted treatment modalities for hepatic hydatid cysts. Endoscopic retrograde cholangiopancreaticography (ERCP) acts as a minimally invasive rescue method for the biliary complications of both the hydatid cysts and treatment modalities. The aim of this study was to identify the role of different treatment modalities in the obliteration of hydatid cysts. Patients treated for hydatid cysts between January 2009 and December 2013 were evaluated in the study. Data were collected from hospital records. All cyst cavities were evaluated by ultrasonography or computed tomography. Ninety-five (40.4%) males and 140 (59.5%) females were included in the study. Before the procedures, the mean cyst diameter was 89.7±33.5 mm. At follow-up, the mean cyst diameter decreased to 53.2±30.1 mm. In the ERCP group, the mean diameter of the residual hydatid cyst cavity was significantly lower than that of the other groups (p=0.003). ERCP provides faster cyst shrinkage and even disappearance of the residual cavity in 50% of cases. Moreover, in hydatid cysts with biliary communication, ERCP+ES can be safely used for primary treatment. | 2024-05-04T01:27:04.277712 | https://example.com/article/2084 |
Christoph Kramer nahm am Dienstag nach seiner in Leipzig erlittenen Kopfverletzung nicht am Training teil und muss bis Freitag pausieren. Fürs Derby gegen den 1. FC Köln muss Trainer Marco Rose wohl ohne den Mittelfeldspieler planen . Laszlo Benes hingegen war nach der Verletzungspause wieder mit von der Partie.
Mit einer 90-minütigen Einheit startete bei der Borussia am Dienstagnachmittag die Vorbereitung auf das Derby gegen den 1.FC Köln am nächsten Sonntag. Verzichten musste Trainer Marco Rose noch auf die Dienste von Christoph Kramer. Für den Mittelfeldspieler ist noch etwas länger Schonung angesagt, nachdem er beim 2:2 in Leipzig bei einem Zusammenprall mit Timo Werner schwer am Kopf getroffen wurde.
"Chris hat eine leichte Gehirnerschütterung und darf bis Freitag keinen Sport machen", sagte der Coach im Anschluss an das Training. Das Derby gegen die Kölner findet voraussichtlich ohne Kramer statt. Rose wollte den Mittelfeldspieler zwar nicht vorschnell abschreiben, sagte aber: "Wahrscheinlich sind dann zwei Tage bis zum Spiel zu wenig."
Benes wieder fit - Jantschke und Bensebaini fallen weiterhin aus
Besser sah es dagegen bei einem anderen Mittelfeldspieler aus: Laszlo Benes, der fürs Leipzig-Spiel mit muskulären Problemen ausgefallen war, mischte am Dienstag wieder mit. Die Beschwerden in der Muskulatur sind abgeklungen. Kommt nichts dazwischen, kann Rose fürs Derby mit dem Slowaken planen. Das wird auch bei Matthias Ginter der Fall sein. Gladbachs Abwehrchef fehlte aus privaten Gründen, kehrt aber voraussichtlich am Mittwoch auf den Platz zurück.
In Geduld üben müssen sich immer noch Tony Jantschke und Ramy Bensebaini. Die beiden Defensivspieler setzten am Dienstag weiterhin aus und absolvieren zurzeit ihr Reha-Programm. Jantschke hatte sich beim Rückrundenauftakt auf Schalke (0:2) einen Muskelfaserriss im Oberschenkel zugezogen, Bensebaini sich in den Tagen vor dem Start am Muskel verletzt. Das Köln-Spiel kommt für die Abwehrspieler höchstwahrscheinlich zu früh, realistischeres Ziel ist eher das darauf folgende Derby bei Fortuna Düsseldorf. | 2024-02-19T01:27:04.277712 | https://example.com/article/3590 |
using System;
using System.Collections.Generic;
using System.Text;
using System.Xml;
using System.Configuration;
using System.Collections.Specialized;
namespace Kalman
{
/// <summary>
/// 配置基类
/// </summary>
public abstract class ConfigBase
{
/// <summary>
/// 获取属性（string类型）
/// </summary>
public string GetStringAttribute(XmlNode node, string key, string defaultValue)
{
XmlAttributeCollection attributes = node.Attributes;
if (attributes[key] != null && !string.IsNullOrEmpty(attributes[key].Value))
return attributes[key].Value;
return defaultValue;
}
/// <summary>
/// 获取属性（string类型），默认值string.Empty
/// </summary>
public string GetStringAttribute(XmlNode node, string key)
{
return GetStringAttribute(node,key,string.Empty);
}
/// <summary>
/// 获取属性（int类型）
/// </summary>
public int GetIntAttribute(XmlNode node, string key, int defaultValue)
{
int val = defaultValue;
XmlAttributeCollection attributes = node.Attributes;
if (attributes[key] != null && !string.IsNullOrEmpty(attributes[key].Value))
{
int.TryParse(attributes[key].Value, out val);
}
return val;
}
/// <summary>
/// 获取属性（bool类型）
/// </summary>
public bool GetBoolAttribute(XmlNode node, string key, bool defaultValue)
{
bool val = defaultValue;
XmlAttributeCollection attributes = node.Attributes;
if (attributes[key] != null && !string.IsNullOrEmpty(attributes[key].Value))
{
bool.TryParse(attributes[key].Value, out val);
}
return val;
}
/// <summary>
/// 从配置节点获取属性值
/// </summary>
/// <param name="isMandatory">是否为强制属性</param>
/// <exception cref="ConfigurationErrorsException"></exception>
public string GetAttribute(XmlNode node, string key, bool isMandatory)
{
string errMsg = string.Format("配置节点[{0}]必须设置属性[{1}]", node.Name, key);
if (node.Attributes == null)
throw new ConfigurationErrorsException(errMsg);
XmlAttribute attribute = node.Attributes[key];
if (attribute == null && isMandatory)
throw new ConfigurationErrorsException(errMsg);
return attribute == null ? null : attribute.InnerText;
}
/// <summary>
/// 从配置节点获取属性值
/// </summary>
/// <param name="node"></param>
/// <param name="key"></param>
/// <param name="defaultValue">若配置节点键值为key的属性没有配置，则返回一个默认值</param>
/// <returns>配置节点键值为key的属性值</returns>
public string GetAttribute(XmlNode node, string key, string defaultValue)
{
if (node.Attributes.Count == 0)return defaultValue;
XmlAttribute attribute = node.Attributes[key];
if (attribute == null)return defaultValue;
return attribute.InnerText;
}
/// <summary>
///
/// </summary>
protected Dictionary<string, T> LoadModules<T>(XmlNode node)
{
Dictionary<string, T> modules = new Dictionary<string, T>();
if (node != null)
{
foreach (XmlNode n in node.ChildNodes)
{
if (n.NodeType != XmlNodeType.Comment)
{
switch (n.Name)
{
case "clear":
modules.Clear();
break;
case "remove":
XmlAttribute removeNameAtt = n.Attributes["name"];
string removeName = removeNameAtt == null ? null : removeNameAtt.Value;
if (!string.IsNullOrEmpty(removeName) && modules.ContainsKey(removeName))
{
modules.Remove(removeName);
}
break;
case "add":
XmlAttribute en = n.Attributes["enabled"];
if (en != null && en.Value == "false")
continue;
XmlAttribute nameAtt = n.Attributes["name"];
XmlAttribute typeAtt = n.Attributes["type"];
string name = nameAtt == null ? null : nameAtt.Value;
string itype = typeAtt == null ? null : typeAtt.Value;
if (string.IsNullOrEmpty(name))
{
continue;
}
if (string.IsNullOrEmpty(itype))
{
continue;
}
Type type = Type.GetType(itype);
if (type == null)
{
continue;
}
T mod = default(T);
try
{
mod = (T)Activator.CreateInstance(type);
}
catch {
//todo: log
}
if (mod == null)
{
continue;
}
modules.Add(name, mod);
break;
}
}
}
}
return modules;
}
/// <summary>
/// 将配置节点转换成NameValueCollection集合
/// </summary>
/// <param name="node">配置节点</param>
/// <returns></returns>
protected NameValueCollection XmlNode2NameValueCollection(XmlNode node)
{
NameValueCollection nvc = new NameValueCollection();
foreach (XmlNode item in node)
{
nvc.Add(item.Name, item.InnerXml);
}
return nvc;
}
}
}
| 2023-12-19T01:27:04.277712 | https://example.com/article/1902 |
**To the editor:** For decades, the mechanisms of cancer cell metastasis have been critical subject in the field of cancer research. Among them, the epithelial-mesenchymal transition (Emt) and mesenchymal-epithelial transition (MET) have been, currently, acknowledged as a crucial process by which carcinoma cells are acquired metastatic phenotype such as invasion of vessels and distant colonization, as well as a physiologic process during embryonic development.
In the volume 25 January, a research article regarding the correlation between the overexpression of epidermal growth factor receptor (EGFR) and EMT makers in endometrial cancer gave us the result that mesenchymal markers (N-cadherin and vimentin) was overexpressed in advanced stage and high grade tissue specimens of patients and also the upregulation of mesenchymal markers was observed in KLE cells and Ishikawa cells transfected with EGFR \[[@B1]\].
EphA2, a member of the biggest subfamily of RTKs, could be recognized as a molecular target based on the growing evidence that high levels of it promote various aspects of malignant phenotype, including proliferation, invasion, angiogenesis and survival of cancer cells. My previous research showed that high EphA2 expression and high angiogenesis makers were significantly associated with shorter disease-specific survival in tissue specimens of patients with endometrial cancer, and also the therapy using EphA2 agonist monoclonal antibody led to tumor inhibition over controls in murine orthotopic xenograft model made by Hec1A and Ishikawa cells \[[@B2]\].
Interestingly, several research papers regarding the correlation between EphA2 and EMT were currently published. Huang et al. \[[@B3]\] reported that EphA2 promotes EMT in gastric cancer cells and demonstrated that the promoting effect of EphA2 on EMT was made through the Wnt/β-catenin pathway based on the experiments employing the inhibitor and activator of that pathway. Additionally, Giannoni et al. \[[@B4]\] reported that mesenchymal-amoeboid transition, a second type of motility shifting process in cancer cells induced by endothelial progenitor cells, was mediated through the bidirectional ephrinA1/EphA2 signaling. Thereby, EphA2 could be also considered as a regulator in relation to epithelial-mesenchymal transition in endometrial cancer.
No potential conflict of interest relevant to this article was reported.
10.3802/jgo.2014.25.2.156
Yang
Wei-Ning
Zhu
Xiao-Lu
Teng
Yin-Cheng
Department of Obstetrics and Gynecology, Shanghai Jiao Tong University Affiliated Sixth People\'s Hospital, Shanghai, China.
Correspondence to Yin-Cheng Teng. Department of Obstetrics and Gynecology, Shanghai Jiao Tong University Affiliated Sixth People\'s Hospital, 600 Yishan Road, Shanghai 200233, China.
teng_yc\@126.com
Reply to JY Hwang
=================
We are grateful to Dr. Hwang for the interest and comment on our research \"Correlation between the overexpression of epidermal growth factor receptor and mesenchymal makers in endometrial carcinoma.\" \[[@BA1]\].
As you mentioned, lots of researches have proved the epithelial-mesenchymal transition (EMT) of cancer cells, which can severely affect the prognosis of patients. The purpose of our study was to discover the EMT situation of the epidermal growth factor receptor (EGFR) overexpressing endometrial carcinoma cells no matter they were KLE cells or Ishikawa cells transfected with EGFR. Meanwhile using RNA interference to inhibit EGFR gene expression could partially reverse the expression of EMT related genes in endometrial carcinoma cells \[[@BA2]\]. It was verified by determining the expression of epithelial cell markers (E-cadherin and α-catenin) and mesenchymal cell markers (N-cadherin and vimentin). Clinical studies also indicated the expression of EMT markers were related to histologic grade and stage, myometrial invasion, lymph node metastasis and survival rate. Thus we suggested EGFR could be an indicator for the assessment of prognosis and could be used in gene therapy. However our study has not gone far enough to describe how EGFR works on signal transduction or the EGFR activating mechanism to make cancer cells EMT. We will continue to work on this.
As EphA2 gains more attention in cancer researches, some researchers start to focus on the correlation between EphA2 and cancer cell EMT \[[@BA3]\]. Further studies found that the overexpression of EGFR could regulate EphA2 to affect cancer cells \[[@BA4]\]. Larsen et al. \[[@BA5]\] reported that EphA2 expression in cultured cells *in vitro* was determined by the activating of EGFR, mitogen activated protein kinase kinase (MEK) and Src family kinases (SRC). Inhibiting the EGFR ligand system favoring Ras/MAPK signaling pathway could decrease cell viability. Thus, they proposed that inhibiting EGFR activating and EphA2 expression could change the cell viability in human cancer cells. Another research indicated the higher expression of EphA2 and ephrin-A1 in non-small cell lung cancer (NSCLC) patients was more related to the female sex, reduced smoking status, adenocarcinoma, well differentiated carcinomas, p-stage IA, and EGFR gene mutations. The expression of EphA2 and ephrin-A1 in NSCLC patients was related to the prognosis \[[@BA6]\].
Therefore we have reasons to believe that EphA2 is related to cancer cell EMT. EphA2 expression may be influenced by EGFR expression through regulating Ras/MAPK signaling pathway and may eventually affect the prognosis and survival rate. However we still need further researches to provide evidence for this conclusion.
No potential conflict of interest relevant to this article was reported.
| 2023-12-09T01:27:04.277712 | https://example.com/article/3026 |
Southeast Asian languages
Overview
The Southeast Asian collection encompasses several thousand printed works and around 4,100 manuscripts in the languages Burmese, Batak, Javanese and Balinese, Cambodian, Lampung, Laotian, Malayan, Vietnamese, Thai and the languages of the Philippines.
Main focuses of content
A selection of secondary literature in Western European languages is acquired. The main focus of the content of the secondary literature is on humanities – philosophy, religion (Hinduism, Buddhism, Islam in Asia), history, archaeology, linguistics and literature, ethnic studies, architecture and art and classic text editions.
Manuscripts
The Oriental and Asia Department manages the Southeast Asian manuscripts technically (acquisition, subject information, guided tours, exhibitions), while the Department of Manuscripts and Rare Books administrates them and is in charge of their use. The Southeast Asian manuscripts can be consulted in the Reading Room for Manuscripts and Rare Books. At present, the acquisition policy for Southeast Asian manuscripts is determined by the scholarly relevance of texts and their aesthetic-museological aspect.
The 4,100 Southeast Asian manuscripts of the Bayerische Staatsbibliothek are subdivided into the following languages: Indonesian languages (2,650), Burmese (900), Thai (500), etc. The materials used for writing on are unusually varied: paper, palm leaves, dluwang, bamboo, wood, textile fabric, ivory, bone, stone, gold, silver and other metals. The Southeast Asian manuscripts are categorised in line with the language.
Burmese manuscripts
The collection of Burmese manuscripts includes writings of Buddhism, astrology (horoscopes, etc.), numerous forms of orders (kammavācās) of different designs, apotropaic and divinatory objects and a number of manuscripts of the minority people of the Shan.
Javanese manuscripts
The 2,600 Javanese manuscripts, most of them palm leaf manuscripts, include texts of Hinduism, medicine, to a limited extent also with Islamic or Buddhist content.
Manuscripts from other Southeast Asian countries
Smaller groups are formed by Laotian, Vietnamese, Cambodian, Malayan and Philippine manuscripts. Manuscripts of Vietnamese provenance can be found under the classification marks Cod.sin. 82 – 84 and 214 – 255. There are 24 Batak and 11 Lampung manuscripts from Sumatra.
History
While the catalogues of the 19th century have entries of a small number of Southeast Asian manuscripts, the majority of these manuscripts was acquired only as of the 1970s. Since 1973, the number of Oriental and Asian manuscripts has quintupled from 3,300 to 18,400 today. In the process, particular emphasis was laid on expanding valuable and extensive source collections from Southeast Asia. Up to this time, the library held only a small number of items from these regions. Partly by consistently purchasing individual items and small groups of items, partly by purchasing complete, large collections, extensive collections of manuscripts from Myanmar and Thailand in particular could be established since 1976.
The next great purchases, not only in view of high quality, but also large quantity, have taken place in the form of the acquisition of palm leaf manuscripts from Java and Bali since 1984. A very noteworthy collection of works from the Yao people native to southern China and various Southeast Asian states, has been added step by step since 1989. (Further information on the Yao manuscripts) Smaller groups of Southeast Asian manuscripts in the languages Batak, Cambodian, Lampung, Laotian, Philippine have also been expanded systematically.
One important collection emphasis is on manuscripts of the Buddhist canon in various languages of Southeast Asia and Buddhist order forms of diverse origin and design.
App
The app "Famous Books – Treasures of the Bavarian State Library" for iPads and iPhones presents the most precious, outstanding specimens from the collections of the Bayerische Staatsbibliothek. Using the app, you can browse the poetology (Cod.siam. 98) virtually, among other things. | 2023-11-20T01:27:04.277712 | https://example.com/article/8675 |
[ **Selection Consistency of EBIC for GLIM with Non-canonical Links and Diverging Number of Parameters\
**]{}
[By]{} SHAN LUO${}^{1}$ [and]{} ZEHUA CHEN${}^{2}$\
${}^{1,2}$Department of Statistics and Applied Probability\
National University of Singapore\
${}$\
Email: ${}^{1}$luoshan08@nus.edu.sg, ${}^{2}$stachenz@nus.edu.sg.
> [*Abstract:*]{} In this article, we investigate the properties of the EBIC in variable selection for generalized linear models with non-canonical links and diverging number of parameters in ultra-high dimensional feature space. The selection consistency of the EBIC in this situation is established under moderate conditions. The finite sample performance of the EBIC coupled with a forward selection procedure is demonstrated through simulation studies and a real data analysis.
>
> [*Key words and phrases:*]{} Variable selection, Generalized linear model, non-canonical links, extended Bayesian Information Criterion, selection consistency.
Introduction {#secintro}
============
Variable selection is a primary concern in many important contemporary scientific fields such as signal processing, medical research and genetic studies etc.. In these fields, usually, a relatively small set of relevant variables need to be selected from a huge collection of available variables. For example, in genetic genome-wide association studies (GWAS), to identify loci or genes that affect a quantitative trait or a disease status, thousands of thousands, even minions, of single nucleotide polymorphisms (SNP) are under consideration. The number of variables is much larger than the sample size in such studies. This phenomenon is referred to as small-$n$-large-$p$. Variable selection in small-$n$-large-$p$ problems poses a great challenge.
A major approach for variable selection is model based; that is, a model is formulated to describe the relationship between a response variable (e.g., the measurement of a quantitative trait) and a set of predictor variables or covariates (e.g., the genotypes of SNPs), and the covariates are selected by a certain variable selection criterion. A variable selection criterion is crucial in model based variable selection. Traditional variable selection criteria such as Akaike’s Information Criterion (AIC) (Akaike, 1973), Bayes Information Criterion (BIC) (Schwarz (1978)) and Cross Validation (CV) (Stone (1974)) are no longer appropriate for variable selection in small-$n$-large-$p$ problems. These traditional criteria tend to select too many irrelevant covariates because they are generally not selection consistent. Recently, some BIC-type criteria have been proposed for small-$n$-large-$p$ problems. Bogdan et al. (2004) considered a criterion called modified BIC (mBIC) for QTL mapping models. Wang et al. (2009) studied another modified BIC for models with diverging number of parameters. Chen and Chen (2008) extended the original BIC to a family called extended BIC (EBIC) governed by a parameter $\gamma$.
The criterion considered by Wang et al. (2009) modifies the original BIC by multiplying the second term of BIC with a diverging parameter and is somehow ad hoc. To achieve selection consistency, it requires $p/n^{\xi} <1$ for some $0<\xi<1$, and hence is not applicable when $p>n$. The mBIC and EBIC considered by Bogdan et al. (2004) and Chen and Chen (2008) respectively are developed from a Bayesian framework. For the mBIC, a binomial prior on the number of covariates is imposed on each model. For EBIC, the prior on a model is proportional to a power of the size of model class which the model belongs. Asymptotically, mBIC is a special case of EBIC corresponding to $\gamma = 1$. The selection consistency of EBIC for linear models with fixed number of parameters is established in Chen and Chen (2008). The result is then extended to generalized linear models (GLIM) with canonical links in Chen and Chen (2012). The EBIC has been used for choosing tuning parameters in penalized likelihood approaches, see Huang et al. (2010), for feature selection procedures, see Wang (2009) and Luo and Chen (2011), and for QTL mapping and disease gene mapping studies, see Li and Chen (2009) and Zhao and Chen (2012).
In GLIMs, canonical links do not always provide the best fit. Generally, there is no reason apriori why a canonical link should be used, and in many cases a non-canonical link is more preferable, see McCullagh and Nelder (1989) and Czado and Munk (2000). In many conventional scientific fields such as those mentioned at the beginning of this article, it becomes a norm that the number of covariates under consideration is so large that it can be considered as having an exponential order of the sample size. This is referred to as the case of ultra-high dimensional feature space. In problems such as QTL and disease gene mapping, a quantitative trait or disease status is usually affected by many loci. Except a few so-called major genes, most of the loci have only a small effect which cannot be detected when the sample size is small. As the sample size increases, so does the number of detectable such effects. This phenomenon is mathematically well modeled by diverging number of parameters, i.e., the number of truly relevant covariates diverges as the sample size increases. Therefore the GLIMs with non-canonical links and diverging number of parameters in the case of ultra-high dimensional feature space become appealing. In this article, we investigate the properties of EBIC for such models and establish its selection consistency. The selection consistency of EBIC for GLIMs with canonical links does not trivially pass to the case of non-canonical links. The selection consistency in the case of non-canonical links is established under more general conditions than those in Chen and Chen (2012). The conditions, though general, are naturally satisfied by many popular examples as given in Wedderburn (1976). We also present a forward selection procedure with EBIC for the GLIMs. This procedure is applied in simulation studies and a real data analysis to evaluate its validity.
The remainder of this article is organized as follows. In section 2, the main results are presented and discussed. In section 3, simulation studies are reported and analyzed. In section 4, the forward selection procedure with EBIC is applied to analyze a well known Leukemia data set published in Golub et al (1999). All the technical proofs are provided in the Appendix.
Selection Consistency of EBIC for GLIM with non-canonical links {#secmain}
===============================================================
Let $(y_i, {\mbox{\boldmath $x$}}_i), i=1, \dots, n, $ be the observations where $y_i$ is a response variable and ${\mbox{\boldmath $x$}}_i = (x_{i1}, \dots, x_{ip_n})^\tau $ is a $p_n$-vector of covariates. We consider the generalized linear model (GLIM) below: $$y_i \sim f(y_i; \theta_i) = \exp\{ \theta_i y_i - b(\theta_i) \} \ \mbox{w.r.t.} \ \nu, \ \ i =1, \dots, n,$$ where $\nu$ is a $\sigma$-finite measure. From the properties of exponential family, we have $$\mu (\theta_i) = E(y_i) = b^{'}(\theta_i), \ \sigma^2 (\theta_i) = \var(y_i) = b^{''}(\theta_i),$$ where $b^{'}$ and $b^{''}$ are the first and the second derivatives of $b$ respectively. The $\theta_i$ is related to ${\mbox{\boldmath $x$}}_i$ through the relationship: $$g(\mu (\theta_i)) = \eta_i = {\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}},$$ where $g$ is a monotone function called link function and ${\mbox{\boldmath $\beta$}}$ is $p_n$-dimensional parameter vector. If $g(\mu(\theta_i)) = \theta_i$, i.e., $ g = \mu^{-1}$, the link is called the canonical link. In this article, we consider general link functions including the canonical link. Because of the one-to-one correspondence between $\theta_i$ and $\eta_i$, there is a function $h$ such that $\theta_i = h(\eta_i) = h({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}})$. If $g$ is twice differentiable, so is $h$. Thus the probability density function of $y_i$ can be expressed as $$f(y_i; h({\mbox{\boldmath $x$}}_i^\tau {\mbox{\boldmath $\beta$}})) = \exp\{ y_i h({\mbox{\boldmath $x$}}_i^\tau {\mbox{\boldmath $\beta$}})- b(h({\mbox{\boldmath $x$}}_i^\tau {\mbox{\boldmath $\beta$}})) \} .$$
In the above GLIM, we assume that $p_n = O(\exp\{n^\kappa\})$, $0 < \kappa < 1$, and that there are only a relatively small number of components of ${\mbox{\boldmath $\beta$}}$ are nonzero. Throughout the article, the following notation and convention are used. Denote by $s$ any subset of the index set ${\cal S} = \{1, 2, \dots, p_n\}$ and $|s|$ its cardinality. For convenience, $s$ is used exchangeably to denote both an index set and the set of covariates with indices in the index set, and is also referred to as a model, i.e., the GLIM consisting of the covariates in $s$. Let $s_{0n} = \{ j: \beta_j \neq 0, j=1, \dots, p_n\}$ and $p_{0n} = |s_{0n}|$. The covariates belonging to $s_{0n}$ are called relevant features and the others irrelevant features. $s_{0n}$ is also referred to as the true model. Let $X = ({\mbox{\boldmath $x$}}_1^\tau, \dots, {\mbox{\boldmath $x$}}_n^\tau)^\tau$. Denote by $X(s)$ the sub matrix formed by the columns of $X$ whose indices falling into $s$. Let ${\mbox{\boldmath $x$}}_{i}^s$ be the vector consisting of the components of ${\mbox{\boldmath $x$}}_i$ whose indices belonging to $s$, and let ${\mbox{\boldmath $\beta$}}^s$ be the corresponding sub vector of ${\mbox{\boldmath $\beta$}}$. Let $S_j$ denote the set of ${p_n \choose j}$ combinations of $j$ indices from ${\cal S}$. Denote $\tau(S_j) = {p_n \choose j}$.
The EBIC of a model $s$, as defined in Chen and Chen (2008), is $$\mbox{EBIC}_{\gamma}(s)=-2\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}^s}\right)+|s| \ln n+2\gamma\ln \tau(S_{|s|}), \gamma\geq 0,$$ where $L_n(\hat{{\mbox{\boldmath $\beta$}}^s})$ is the maximum likelihood of model $s$ and $\hat{{\mbox{\boldmath $\beta$}}^s}$ is the maximum likelihood estimate (MLE) of ${\mbox{\boldmath $\beta$}}^s$.
Denote by $l_n({\mbox{\boldmath $\beta$}}^s), {\mbox{\boldmath $s$}}_n({\mbox{\boldmath $\beta$}}^s)$ and $H_n({\mbox{\boldmath $\beta$}}^s)$ the log likelihood function, the score vector and the Hessian matrix of the model $s$ respectively. Suppose the link function $g$ is twice differentiable, we have $$\begin{split}
l_n ({\mbox{\boldmath $\beta$}}^s)=& \sum_{i=1}^n [y_i h({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s )-b (h ({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s ))] \\
{\mbox{\boldmath $s$}}_n({\mbox{\boldmath $\beta$}}^s)=&\frac{\partial l_n({\mbox{\boldmath $\beta$}}^s)}{\partial {\mbox{\boldmath $\beta$}}^s}=\sum_{i=1}^n[y_i-b^{'}(h({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s))] h^{'}({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s ){\mbox{\boldmath $x$}}_i^s \\
H_n({\mbox{\boldmath $\beta$}}^s)=& -\dfrac{\partial^2l_n ({\mbox{\boldmath $\beta$}}^s)}{\partial {\mbox{\boldmath $\beta$}}^s \partial {\mbox{\boldmath $\beta$}}^{s \tau}} \\
= & \sum_{i=1}^n \{ b^{''}(h({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s) ) [h^{'}({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s)]^2
- [y_i-b^{'}(h({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s))] h^{''}({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s ) \} {\mbox{\boldmath $x$}}_i^s{\mbox{\boldmath $x$}}_i^{s\tau}\\
= & H_{n1}({\mbox{\boldmath $\beta$}}^s) - H_{n0}({\mbox{\boldmath $\beta$}}^s), \ \ \mbox{say}.
\end{split}$$ When $s_{0n} \subset s$, we simply denote $\mu_i = b^{'}(h({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s))$ and $\sigma_i^2 =b^{''}(h({\mbox{\boldmath $x$}}_i^{s\tau}{\mbox{\boldmath $\beta$}}^s))$. The major difference between the case of canonical links and the case of non-canonical links is as follows. If $g$ is the canonical link, $h^{'} \equiv 1$ and $h^{''} \equiv 0$, hence $H_{n0} \equiv 0$ and $H_n({\mbox{\boldmath $\beta$}}^s)$ is positive definite when $X(s)$ is of full column rank. Therefore, $l_n({\mbox{\boldmath $\beta$}}^s)$ is a strictly concave function of ${\mbox{\boldmath $\beta$}}^s$. But, if $g$ is a non-canonical link, $H_n({\mbox{\boldmath $\beta$}}^s)$ is not necessarily positive definite. As a consequence, $l_n({\mbox{\boldmath $\beta$}}^s)$ is not necessarily concave, and the maximum likelihood estimate of ${\mbox{\boldmath $\beta$}}^s$ does not necessarily exist. We will show that $H_{n0}({\mbox{\boldmath $\beta$}}^s) $ is asymptotically negligible (Lemma \[lemma1\]) for ${\mbox{\boldmath $\beta$}}^s$ in a neighborhood of the true parameter value of the GLIM. Thus $H_n({\mbox{\boldmath $\beta$}}^s)$ is asymptotically locally positive definite. To guarantee the existence of the MLE of ${\mbox{\boldmath $\beta$}}^s$ for finite samples, we assume that the link function $g$ is chosen such that $l_n({\mbox{\boldmath $\beta$}}^s)$ has a unique maximum. We now state the conditions required for the selection consistency of the EBIC.
C1
: $\ln (p_n)=O(n^{\kappa}), p_{0n}=O(n^{b})$ where $b\geq 0, \kappa >0$ and $b+\kappa < 1/3$;
C2
: $\min_{j\in s_{0n}}|\beta_{j}|\geq Cn^{-1/4}$ for some constant $C>0$;
C3
: For any $s$, the interior of ${\cal B}(s)=\{{\mbox{\boldmath $\beta$}}: \int \exp( h({\mbox{\boldmath $x$}}_i^{s\tau} {\mbox{\boldmath $\beta$}}) y) d \nu < \infty, i=1,2,\dots, n \}$ is not empty. Let ${\mbox{\boldmath $\beta$}}_0$ denote the true parameter of the GLIM. If $|s| \leq k p_{0n}$, where $k>1$, then ${\mbox{\boldmath $\beta$}}_0^{s}$ is in the interior of ${\cal B}(s)$.
C4
: There exist positive $c_1$ and $c_2$ such that for all sufficiently large $n$, $$c_1n\leq \lambda_{\min}(H_{n1}({\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}})) \leq \lambda_{\max}(H_{n1}({\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}})) \leq c_2n$$ for all $s$ with $|s| \leq k p_{0n}$, where $\lambda_{\min}$ and $\lambda_{\max}$ denote respectively the smallest and largest eigenvalues;
C5
: For any given $\xi>0,$ there exists a $\delta>0$ such that when $n$ is sufficiently large, $$(1-\xi)H_{nj}({\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}} ) \leq H_{nj}({\mbox{\boldmath $\beta$}}^{s\cup s_{0n}}) \leq(1+\xi) H_{nj}({\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}} ), j=0,1,$$ whenever $\|{\mbox{\boldmath $\beta$}}^{s\cup s_{0n}} -{\mbox{\boldmath $\beta$}}_0^{s \cup s_{0n}} \|_2\leq \delta$ for all $s$ with $|s| \leq k p_{0n}$;
C6
: The quantities $|x_{ij}|, |h^{'}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)|, |h^{''}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)|, i =1, \dots, n; j =1, \dots, p_n$ are bounded from above, and $\sigma_i^2, i=1, \dots, n$ are bounded both from above and below away from zero. Furthermore, $$\begin{split}
\max_{1\leq j\leq p_n; 1 \leq i\leq n} \frac{ x_{ij}^2 [h^{'}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)]^2 }{ \sum_{i=1}^n \sigma_i^2 x_{ij}^2[h^{'}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)]^2 } &=o(n^{-1/3})\\
\max_{1\leq i\leq n}\frac{ [h^{''}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)]^2 }{ \sum_{i=1}^n\sigma_i^2[h^{''}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)]^2 }&=o(n^{-1/3}).
\end{split}$$
Conditions C2 and C3 are the same as conditions A2 and A3 in Chen and Chen (2012). Conditions C4 - C5 reduce to conditions A4-A5 in Chen and Chen (2012) for canonical links. When A6 in Chen and Chen (2012) is satisfied, C6 is satisfied by commonly used GLIMs such as Poisson distribution with log and power function links, Binary distribution with identity, arcsin, complementary log-log and probit links, Gamma distribution with log and inverse power function links. These GLIMs are throughly studied in Wedderburn (1976). The verification of C6 for these GLIMs is given in a complementary document at website: ` http://www.stat.nus.edu.sg/~stachenz/`.
We now state our main results as follows. Define ${\cal A}_0 = \{ s: s_{0n} \subset s, s_{0n} \neq s, |s| \leq k p_{0n} \}$ and ${\cal A}_1 = \{ s: s_{0n} \not \subset s, |s| \leq k p_{0n} \}$. We have
\[SelectionConsistency\] Under assumptions C1-C6, as $n\rightarrow +\infty$,
- $P\left(\min_{s\in \mathcal{A}_1}\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})\right)\rightarrow 0,
\ \ \text{for any} \ \ \gamma>0;$
- $P\left(\min_{s\in
\mathcal{A}_0}\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})\right)\rightarrow 0, \ \ \text{for
any}\ \ \gamma>\dfrac{1}{1-\epsilon}\left(1-\dfrac{\log n}{2\log p_n}\right),$ where $\epsilon$ is an arbitrarily small positive constant.
The following result are needed in the proof of Theorem \[SelectionConsistency\].
\[lemma1\] Under conditions C1 - C6, whenever $\|{\mbox{\boldmath $\beta$}}^{s\cup s_{0n}}-{\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}}\|_2 \leq \delta,$ $${\mbox{\boldmath $u$}}^{\tau}H_n\left({\mbox{\boldmath $\beta$}}(s\cup s_{0n})\right){\mbox{\boldmath $u$}}={\mbox{\boldmath $u$}}^{\tau}H_n^E\left({\mbox{\boldmath $\beta$}}(s\cup s_{0n})\right){\mbox{\boldmath $u$}}\left(1+o_p(1)\right),$$ uniformly in $ s$ with $|s| \leq k p_{0n}$.
The above lemma imply the following result that gives the convergence rate of the $L_2$-consistency of the MLE of ${\mbox{\boldmath $\beta$}}^s$ when $s_{0n} \subset s$. The result is of its own interest.
\[UnifRate\] Under conditions C1 - C6, as $n\rightarrow \infty$, $\|\hat{{\mbox{\boldmath $\beta$}}^s}-{\mbox{\boldmath $\beta$}}_0^s\|_2=O_p(n^{-1/3}),$ uniformly for $s \in
{\cal A}_0.$
The technical details of the proof for the above results are given in the Appendix. Theorem 1 implies that if we confine to the models with cardinality less than or equal to $kp_{0n}$ and select the model with the smallest EBIC among all those models then, with probability converging to 1, the selected model, say, $s_n^*$, will be the same as the true model $s_{0n}$. This property is what is called selection consistency. The constraint that $|s| \leq k p_{0n}$ is natural since we do not need to consider any models with cardinality much larger than that of the true model in practical problems. However, in practice, the evaluation of all models with cardinality up to $k p_{0n}$ is computationally impossible. Like any other model selection criteria, the EBIC is to be used in a certain model selection procedure. In addition to the traditional forward selection procedures, a variety of procedures based on penalized likelihood approach have been developed within the last twenty years such as the LASSO (Tibishirani, 1996), SCAD (Fan and Li, 2001), Elastic Net (Zou and Hastie, 2005), and so on. A model selection criterion can be used in these procedures to choose the penalty parameter, which corresponds to choosing a model. However, though some desirable properties such as the so-called oracle property have been established for these penalized likelihood approaches under certain conditions, the asymptotic properties of these approaches with GLIM and ultra-high dimensional feature space have not been throughly studied yet to our knowledge. The traditional forward selection methods have been criticized for its greedy nature. But, recently, it is discovered that the greedy nature might not be bad especially when the model selection is for the selection of relevant variables rather than for a prediction model, see, e.g., Tropp (2004), Tropp and Gilbert (2007) and Wang (2009). In this article, we consider the application of the EBIC with the traditional forward regression procedure for GLIM in our simulation studies and real data analysis.
Simulation Study
================
In our simulation studies, we consider a GLIM with binary response and the complementary log-log link. We take the divergent pattern $(n,p_n,p_{0n})=(n,[40 e^{n^{0.2}}],[5n^{0.1}])$ for $n=100,200,500$. The settings for the covariates, which are adapted from Fan and Song (2010), are described below.
Setting 1.
: Let $q=15$, $s_1 =\{1, \dots, q\}$, $s_2 = \left\{q+1, \dots, \left[ \frac{p_n}{3}\right] \right\}$, $s_3 = \left\{\left[ \frac{p_n}{3}\right] +1, \dots, \left[ \frac{2p_n}{3}\right] \right\}$ and $s_4 = \left\{\left[ \frac{2p_n}{3}\right] +1, \dots, p_n\right\}$. Let the covariate vector ${\mbox{\boldmath $x$}}$ be decomposed into ${\mbox{\boldmath $x$}}= ({\mbox{\boldmath $x$}}^{s_1}$, ${\mbox{\boldmath $x$}}^{s_2}$, ${\mbox{\boldmath $x$}}^{s_3}, {\mbox{\boldmath $x$}}^{s_4})$. Assume that ${\mbox{\boldmath $x$}}^{s_1}$ follows $N({\mbox{\boldmath $0$}},\Sigma_{\rho})$, where $\Sigma_{\rho}$ has diagonal elements 1 and off-diagonal elements $\rho$, ${\mbox{\boldmath $x$}}^{s_2}$ follows $N({\mbox{\boldmath $0$}}, I)$, the components of ${\mbox{\boldmath $x$}}^{s_3}$ are i.i.d. as a double exponential distribution with location 0 and scale 1, the components of ${\mbox{\boldmath $x$}}^{s_4}$ are i.i.d. with the normal mixture $\frac{1}{2} [ N(-1,1)+ N(1,0.5)]$. The covariates ${\mbox{\boldmath $x$}}_i^{s_k}, i=1, \dots, n$, are generated as i.i.d. copies of ${\mbox{\boldmath $x$}}^{s_k}$, $k=1,2,3,4.$ Four values of $\rho$: 0, 0.3, 0.5 and 0.7, are considered. $s_{0n} = \{L\times t, t=1, \dots, p_{0n}\}$, where $L=10$. $\beta_j = 1$, if $j=L\times t$ with odd $t$, 1.3, if $j=L\times t$ with even $t$, 0, otherwise.
Setting 2.
: The same as setting 1 except $L=5$. The essential difference between setting 1 and this setting is that, in setting 1, all the relevant features are independent while, in this setting, three of them have pairwise correlation $\rho$. Two values of $\rho$: 0.3 and 0.5, are considered in this setting.
Setting 3.
: $L=10, q=50$. In all the settings for $(n, p_n, p_{0n})$, this $q$ is much smaller than $p_n$ and $p_n-q$ is much bigger than $L p_{0n}$. The distribution of the covariate vector ${\mbox{\boldmath $x$}}$ is specified as follows. For $j=1, \dots, p_n-q$, the components $x_j$’s are i.i.d. standard normal variables. For $p_n-q < j \leq p_n$, $$x_j =\frac{1}{5} \left[ \sum_{t=1}^{p_{0n}}(-1)^{t+1}x_{Lt}+\sqrt{25-p_{0n}} \xi_j\right],$$ where the $\xi_j$’s are i.i.d. standard normal variables. ${\mbox{\boldmath $x$}}_i$’s are generated as i.i.d. copies of ${\mbox{\boldmath $x$}}$. The specification for $s_{0n}$ and ${\mbox{\boldmath $\beta$}}$ is the same as in setting 1. In this setting, all the relevant features are independent, the last $q$ irrelevant features, which are highly pairwise correlated, have a weak marginal correlation with each of the relevant features but a strong overall correlation with the totality of the relevant features.
We apply the forward selection procedure with EBIC in the simulation studies. In more detail, the procedure starts by fitting the GLIMs with one covariate, the covariate corresponding the model with the smallest EBIC is the first selected variable. Then GLIMs with two covariates including the first selected variable are considered, the additional covariate corresponding to the two-covariate model with the smallest EBIC is the second selected variable. The procedure continues this way and at each step, one more covariate is selected. To reduce the amount of computation, when $p_n$ is bigger than 1000, the sure independence screening procedure based on the maximum marginal estimator (MME) (Fan and Song (2010)) is used to reduce the dimension of the feature to 400 before the forward selection procedure is invoked. We consider four $\gamma$ values in EBIC, i.e., $\gamma_1 = 0, \gamma_2 = \frac{1}{2}( 1-\frac{\ln n}{2\ln p_n}), \gamma_3 = 1-\frac{\ln n}{4\ln p_n}$ and $\gamma_4 = 1$. We choose these values because $\gamma_1$ corresponds to the original BIC, $\gamma_4$ corresponds to mBIC, $\gamma_2$ is halfway between 0 and $ 1-\frac{ \ln n}{ 2 \ln p_n}$, the lower bound of the consistent range of $\gamma$, and $\gamma_3$ is halfway between $ 1-\frac{ \ln n}{ 2 \ln p_n}$ and 1. Thus we can evaluate the asymptotic behavior of EBIC when the $\gamma$ value is below and above the lower bound of the consistent range and also make a comparison with BIC and mBIC. The performance of the procedure is evaluated by positive discovery rate (PDR) and false discovery rate (FDR). The PDR and FDR are defined as follows: $$\mbox{PDR}_n =\frac{ \nu(s^{*} \cap s_{0n})}{\nu(s_{0n})}, \ \ \mbox{FDR}_n =\frac{\nu(s^{*} \backslash s_{0n})}{\nu(s^*)},$$ where $s^*$ is the set of selected features. The selection consistency is equivalent to $$\lim_{n\to \infty } \mbox{PDR}_n = 1 \ \ \mbox{and} \ \ \lim_{n\to \infty } \mbox{FDR}_n = 0,$$ in probability. The PDR and FDR are averaged over 200 replications. The results under Settings 1-3 are reported in Tables 1- 3 respectively.
By examining Tables 1 - 3, we can find the following common trends: 1) with all the four $\gamma$ values, the PDR increases as $n$ gets larger, 2) with $\gamma_1$ and $\gamma_2$ (which are below the lower bound of the consistent range), the FDR does not show a trend to decrease while, with $\gamma_3$ and $\gamma_4$ (which are within the consistent range), the FDR reduces rapidly towards zero, 3) though the PDRs with $\gamma_3$ and $\gamma_4$ are lower than those with $\gamma_1$ and $\gamma_2$ when sample size is small, but they become comparable as the sample size increases, and 4) the FDR with $\gamma_4$ is lower than that with $\gamma_3$ when sample size is small, however, the PDR is also lower, as sample size gets larger, both the PDR and FDR with $\gamma_3$ and those with $\gamma_4$ become comparable. These findings demonstrate that the selection consistency of EBIC is well realized in finite sample case.
Real Data Analysis {#real}
==================
In this section, we apply the forward selection procedure with EBIC to analyze a Leukemia data set. The data consists of the expression levels of 7129 genes obtained from 47 patients with acute lymphoblastic leukemia (ALL) and 25 with acute myeloid leukemia (AML). The data set is available in the R packages [*Biobase*]{} and [*golubEsets*]{}. The initial version of this data set is described and analyzed by a method called “neighborhood analysis" in Golub et al. (1999). The data set is later analyzed using GLIM with probit link in Lee et al. (2003) and using GLIM with logit link in Liao and Chin (2007). 50 genes are identified as important ones affecting the types of leukemia in Golub et al. (1999), 27 genes are identified in Lee et al. (2003), and 19 genes are identified in Liao and Chin (2007). There are only a few overlapped genes among the three identified sets.
We analyzed the data by the forward selection procedure with four different link functions: [*logit, probit, cauchit*]{} and [*cloglog*]{}. First, with each link function, the procedure was carried out until 50 genes were selected. The identified genes are reported in Table \[gene1\]. These 50 genes are compared with three identified sets mentioned above. Those which were identified in Golub et al. (1999), Lee et al. (2003) and Liao and Chin (2007) are indicated by $\star$, $\triangle$ and $\ast$ respectively. There are three genes: 1834,1882, 6855, which are in all the three identified sets are selected by the forward selection procedure. They are all among the selected genes with logit and cloglog links. Two of them, i.e., 1834, 1882, are only among the selected genes with probit and cauchit links. The other selected genes except two of them are in only one of the identified sets. Note that the selected genes and their ordering are different among the four different links. This indicates that the link function does matter in the selection procedure. Second, we used 8-fold cross validation to select the optimal link function among the four links. The optimal link is the logit link. Finally, we made a final selection using EBIC with $\gamma= 1-\frac{\ln n}{3\ln p_n})$ which is slightly bigger than the lower bound of the consistent range. The final selected variables together with the maximum log likelihood of the corresponding model are reported in Table \[gene2\]. To compare the final selection of the logit link with the other links, the selected results with all the four links are reported. The genes selected by the logit link are 1834 and 4438. The maximum log likelihood of the selected model with the logit link is the largest among all the four links. Note that, the same two genes are also selected by probit link and the gene 4438 is selected by cloglog link. We thus can conclude quite confidently that the two genes selected by logit link are the most important genes for studying the etiology of leukemia.
Appendix: Technical Proofs
==========================
For any arbitrary $s\in \mathcal{A}_1,$ consider $\tilde{s}=s\cup s_{0n}.$ Let $a_{ni}$ in Lemma 1 of Chen and Chen (2012) be $h^{''}\left({\mbox{\boldmath $x$}}_i^{\tilde{s}\tau}{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\sign(y_i-\mu_i)/\sqrt{\sum\limits_{i=1}^n\sigma_i^2 \left(h^{''}\left({\mbox{\boldmath $x$}}_i^{\tilde{s}\tau}{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\right)^2},$ since ${\mbox{\boldmath $x$}}_i^{\tilde{s}\tau}{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}={\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0,$ from Condition C6, we have $$\label{lemma1ine1}
P\left(\sum\limits_{i=1}^n|(y_i-\mu_i)h^{''}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)|\geq Cn^{2/3}\right)\leq 2\exp(-Cn^{1/3}).$$ For any unit vector ${\mbox{\boldmath $u$}}$ with length $|\tilde{s}|,$ $$\begin{split}
\label{lemma1ine2}
{\mbox{\boldmath $u$}}^{\tau}H_{n0}({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}){\mbox{\boldmath $u$}}=&\sum\limits_{i=1}^n(y_i-\mu_i)h^{''}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)\left({\mbox{\boldmath $u$}}^{\tau}{\mbox{\boldmath $x$}}_i^{\tilde{s}}\right)^2\\
\leq &\sum\limits_{i=1}^n|(y_i-\mu_i)h^{''}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)|\|{\mbox{\boldmath $x$}}_i^{\tilde{s}}\|_2^2\\
\leq & C(k+1)p_{0n}\sum\limits_{i=1}^n|(y_i-\mu_i)h^{''}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)|.
\end{split}$$ The last inequality is true because all $x_{i,j}'s$ are bounded, as assumed in Condition C6. (\[lemma1ine1\]) and (\[lemma1ine2\]) with Condition C5 imply that, for any $\xi>0$, there exists a $\delta>0$ such that $$\begin{split}
&P\left(\max_{s\in \mathcal{A}_1,\|{\mbox{\boldmath $u$}}\|_2=1,\|{\mbox{\boldmath $\beta$}}^{s\cup s_{0n}}-{\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}}\|_2\leq \delta}{\mbox{\boldmath $u$}}^{\tau}H_{n0}\left({\mbox{\boldmath $\beta$}}^{s\cup s_{0n}}\right){\mbox{\boldmath $u$}}\geq Cp_{0n}n^{2/3}\right)\\
\leq &P\left(\max_{s\in \mathcal{A}_1,\|{\mbox{\boldmath $u$}}\|_2=1}{\mbox{\boldmath $u$}}^{\tau}H_{n0}\left({\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}}\right){\mbox{\boldmath $u$}}\geq \dfrac{C}{1+\xi}p_{0n}n^{2/3}\right)\\
\leq &|\mathcal{A}_1|P(\sum\limits_{i=1}^n|(y_i-\mu_i)h^{''}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)|\geq \tilde{C}n^{2/3})\\
\leq &2\exp(kp_{0n}\ln p_n-\dfrac{C}{1+\xi}n^{1/3})=o(1).
\end{split}$$ Similar strategy applies to $s\in \mathcal{A}_0$ since $\mathcal{A}_0=\{s\cup s_{0n}:s\in\mathcal{A}_1,0<|s|\leq (k-1)p_{0n}\}.$ That is, $\max\limits_{|s|\leq kp_{0n},\|{\mbox{\boldmath $u$}}\|_2=1,\|{\mbox{\boldmath $\beta$}}^{s\cup s_{0n}}-{\mbox{\boldmath $\beta$}}_0^{s\cup s_{0n}}\|_2\leq \delta}{\mbox{\boldmath $u$}}^{\tau}H_{n0}\left({\mbox{\boldmath $\beta$}}^{s\cup s_{0n}}\right){\mbox{\boldmath $u$}}=o_p(p_{0n}n^{2/3}).$ Combined with $p_{0n}=o(n^{1/3})$ in Condition C1 and Condition C4, we can have the desired result.
According to the definition of EBIC, for any model $s$, $\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})$ if and only if $$\label{compare}
\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\geq (|s|-p_{0n})\ln n/2+\gamma\left(\ln \tau(S_{|s|})-\ln \tau(S_{p_{0n}})\right).$$ To prove the selection consistency of EBIC, or mathematically, $$P\left(\min_{s:|s|\leq kp_{0n},s\neq s_{0n}}\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})\right)\to 0\;\text{as}\;n\to +\infty,$$ it suffices to show that inequality (\[compare\]) holds with a probability converging to 0 as the sample size goes to infinity uniformly for all $s\in \mathcal{A}_0\cup \mathcal{A}_1$. This is completed by dealing with $s\in \mathcal{A}_0$ and $\mathcal{A}_1$ separately.
\(I) [*Case 1: $s\in \mathcal{A}_1$*]{}. In this case, inequality (\[compare\]) implies that $$\label{compare1}
\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\geq -p_{0n}(\ln n/2+\gamma \ln p_n).$$ Therefore, if we can show $$\label{compare1res}
P\left(\sup_{s\in \mathcal{A}_1}\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\geq -p_{0n}(\ln n/2+\gamma \ln p_n)\right)\to 0\;\text{as}\;n\to +\infty,$$ then we will have $$P\left(\min_{s:s\in \mathcal{A}_1}\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})\right)\to 0\;\text{as}\;n\to +\infty.$$
The key becomes to derive the order for $\sup_{s\in \mathcal{A}_1}\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)$. For any $s\in \mathcal{A}_1,$ let $\tilde{s}=s\cup s_{0n}$ and $\breve{{\mbox{\boldmath $\beta$}}}^{\tilde{s}}$ be $\hat{{\mbox{\boldmath $\beta$}}}^s$ augmented with zeros corresponding to the elements in $\tilde{s}\backslash s.$ It can be seen that $$\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)=\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{s_{0n}}\right)\leq \ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right),\;\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)=\ln L_n\left(\breve{{\mbox{\boldmath $\beta$}}}^{\tilde{s}}\right),$$ which leads to $$\label{the1ine1}
\sup_{s\in \mathcal{A}_1}\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\leq \sup_{s\in \mathcal{A}_1}\ln L_n\left(\breve{{\mbox{\boldmath $\beta$}}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right).$$ And also $$\|\breve{{\mbox{\boldmath $\beta$}}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\|_2\geq
\|{\mbox{\boldmath $\beta$}}^{s_{0n} \backslash s}\|_2>\min_{j\in s_{0n}}\{|{\mbox{\boldmath $\beta$}}_{j}|\}>Cn^{-1/4}.$$ The positive definiteness of $H_n({\mbox{\boldmath $\beta$}})$, or the concavity of $\ln L_n({\mbox{\boldmath $\beta$}}^{\tilde{s}})$ in ${\mbox{\boldmath $\beta$}}^{\tilde{s}}$ implies $$\label{inequ2}
\begin{split}
&\sup_{s\in \mathcal{A}_1}\ln L_n\left(\breve{{\mbox{\boldmath $\beta$}}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\\
\leq &\sup\{\ln L_n\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right):\|{\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\|_2\geq
n^{-1/4},s\in \mathcal{A}_1\}\\
\leq &
\sup\{\ln L_n\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right):\|{\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\|_2=
n^{-1/4}, s\in \mathcal{A}_1\}.
\end{split}$$
To derive the order of the right hand side in the above inequality, we take the Taylor Expansion of $\ln L_n\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)$ as follows: $$\label{equation9}
\begin{split}
&\ln L_n\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\\
=&\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)^{\tau}s_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)-\dfrac{1}{2}\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)^{\tau}H_{n1}\left({\mbox{\boldmath $\beta$}}^{\star\tilde{s}}\right)\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\\
+&\dfrac{1}{2}\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)^{\tau}H_{n0}\left({\mbox{\boldmath $\beta$}}^{\star\tilde{s}}\right)\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)
\end{split}$$ where ${\mbox{\boldmath $\beta$}}^{\star\tilde{s}}$ is between ${\mbox{\boldmath $\beta$}}^{\tilde{s}}$ and ${\mbox{\boldmath $\beta$}}_0^{\tilde{s}}.$ By condition C4 and C5, $$\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)^{\tau}H_{n1}\left({\mbox{\boldmath $\beta$}}^{\star\tilde{s}}\right)\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\geq c_1n(1-\xi)\|{\mbox{\boldmath $\beta$}}^{\tilde{s}}-{\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\|_2^2.$$ Lemma \[lemma1\] implies that, for any ${\mbox{\boldmath $\beta$}}^{\tilde{s}}$ such that $\|{\mbox{\boldmath $\beta$}}^s-{\mbox{\boldmath $\beta$}}^{s_{0n}}\|_2=n^{-1/4},$ uniformly, there exists $0<c<c_1$ such that, with probability tending to $1$ as $n$ goes to $+\infty,$ $$\label{inequ1}
\ln L_n\left({\mbox{\boldmath $\beta$}}^{\tilde{s}}\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{\tilde{s}}\right)\leq n^{-1/4}\|s_n({\mbox{\boldmath $\beta$}}_0^{\tilde{s}})\|_{+\infty}-\dfrac{c}{2}n^{1/2}(1-\xi).$$
Now we need to find out the uniform rate for the components in the score function $s_n({\mbox{\boldmath $\beta$}}_0)$. We claim that under C1-C6, $$\label{claim}
P\left(\max_{1\leq j\leq p_n}s_{n,j}^2\left({\mbox{\boldmath $\beta$}}_0\right)\geq Cn^{4/3}\right)=o(1).$$ This claim can be seen from Lemma 1 in Chen and Chen (2012). For a fixed $j$, let $a_{ni}=x_{i,j}h^{'}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)/\sqrt{\sum\limits_{i=1}^n\sigma_i^2 x_{i,j}^2\left(h^{'}\left({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0\right)\right)^2}.$ From Condition C6, we have $$\begin{split}
P\left(s_{nj}\left({\mbox{\boldmath $\beta$}}_0\right)\geq Cn^{2/3}\right)
=&P\left(\sum\limits_{i=1}^na_{ni}(y_i-{\mbox{\boldmath $\mu$}}_i)>Cn^{2/3}/\sqrt{\sum\limits_{i=1}^n\sigma_i^2 x_{i,j}^2\left(h^{'}({\mbox{\boldmath $x$}}_i^{\tau}{\mbox{\boldmath $\beta$}}_0)\right)^2}\right)\\
\leq & P\left(\sum\limits_{i=1}^na_{ni}(y_i-{\mbox{\boldmath $\mu$}}_i)>Cn^{1/6}\right)\leq \exp(-Cn^{1/3}).
\end{split}$$ The first inequality holds because of the boundedness of $x_{i,j}$ and $h^{'}.$ Consequently, when $\ln p_n=o(n^{1/3}),$ which is satisfied by C1, we have $$\sum\limits_{j=1}^{p_n}P\left(s_{nj}\left({\mbox{\boldmath $\beta$}}_0\right)
\geq Cn^{2/3}\right)=\exp(\ln p_n-Cn^{1/3})=o(1).$$ This completes the proof of the claim (\[claim\]).
Therefore, the right hand side of (\[inequ1\]) is less than $ c_1 n^{5/12}-c_2n^{1/2}$, which is less than $-Cn^{1/2}$ for some constant $C>0$. Combined with inequalities (\[the1ine1\]) and (\[inequ2\]) , this leads to $$\sup_{s\in \mathcal{A}_1}\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\leq -Cn^{1/2}.$$
Since under C1, $p_{0n}\ln n=o(n^{1/3}), p_{0n}\ln p_n=o(n^{1/3}),$ we proved inequality (\[compare1res\]).
\(II) [*Case 2: $s\in \mathcal{A}_0$*]{}. Let $m=|s|-\nu(s_{0n})$, Lemma 1 in Luo and Chen (2011) implies that, asymptotically, as $n\to +\infty,$ $\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})$ if and only if $$\label{compare2}
\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\geq
m[0.5\ln n+\gamma\ln p_n].$$ Therefore, it suffices to show $$\label{compare2res}
P\left(\sup_{s\in\mathcal{A}_0}\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\geq
m[0.5\ln n+\gamma\ln p_n]\right)\to 0\;\text{as}\;n\to \infty$$ to obtain $$P\left(\min_{s:s\in \mathcal{A}_0}\mbox{EBIC}_{\gamma}(s)\leq \mbox{EBIC}_{\gamma}(s_{0n})\right)\to 0\;\text{as}\;n\to +\infty.$$
Note that Lemma \[lemma1\] implies $$\begin{split}
\label{inequ3}
&\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^{s_{0n}}\right)\leq \ln L_n\left(\hat{{\mbox{\boldmath $\beta$}}}^s\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^{s_{0n}}\right))\\
=& (\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)^{\tau}s_n({\mbox{\boldmath $\beta$}}_0^s)-\dfrac{1}{2}(\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)^{\tau}H_n(\tilde{{\mbox{\boldmath $\beta$}}}^s)(\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)\\
\leq & (\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)^{\tau}s_n({\mbox{\boldmath $\beta$}}_0^s)-\dfrac{1-\epsilon}{2}(\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)^{\tau}H_{n1}(\tilde{{\mbox{\boldmath $\beta$}}}^s)(\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s),
\end{split}$$ where $\xi$ is any arbitrarily small positive constant. The applicability of the conclusion in C5 to simplify the right hand side of this inequality requires $\sup_{s\in \mathcal{A}_0}\|\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s\|_2$ be approaching 0 as $n$ goes to infinity. We claim that under conditions C1-C6, uniformly for $s\in\mathcal{A}_0,$ we have $$\label{inequ4}
\|\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s\|_2=O_p(n^{-1/3}).$$ We will show this claim in the following. For any unit vector $u,$ let ${\mbox{\boldmath $\beta$}}^s={\mbox{\boldmath $\beta$}}_0^s+n^{-1/3}{\mbox{\boldmath $u$}}.$ Denote $$\mathcal{T}=\Big\{\max_{s\in \mathcal{A}_0,\|{\mbox{\boldmath $u$}}\|_2=1}{\mbox{\boldmath $u$}}^{\tau}H_{n0}\left({\mbox{\boldmath $\beta$}}^s\right){\mbox{\boldmath $u$}}\leq Cp_{0n}n^{2/3}\Big\},$$ then Lemma \[lemma1\] implies $$\label{equation7}
\begin{split}
&P\left(\ln L_n\left({\mbox{\boldmath $\beta$}}^s\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^s\right)>0:\;\; \text{for some}\;\;u, s\in \mathcal{A}_0\right)\\
\leq &P\left(\ln L_n\left({\mbox{\boldmath $\beta$}}^s\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^s\right)>0:\;\; \text{for some}\;\;u, s\in \mathcal{A}_0| \mathcal{T}\right)+o(1).
\end{split}$$ On $\mathcal{T},$ When $n$ is large enough, for all $s\in \mathcal{A}_0,$ uniformly, we have $$\begin{split}
\ln L_n\left({\mbox{\boldmath $\beta$}}^s\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^s\right)=&n^{-1/3}{\mbox{\boldmath $u$}}^{\tau}s_n\left({\mbox{\boldmath $\beta$}}_0^s\right)-\dfrac{1}{2}n^{1/3}{\mbox{\boldmath $u$}}^{\tau}\left(n^{-1}H_{n1}\left(\tilde{{\mbox{\boldmath $\beta$}}}^s\right)\right){\mbox{\boldmath $u$}}\\
&-\dfrac{1}{2}n^{-2/3}\left({\mbox{\boldmath $u$}}^{\tau}H_{n0}\left(\tilde{{\mbox{\boldmath $\beta$}}}^s\right){\mbox{\boldmath $u$}}\right)\\
=&n^{-1/3}{\mbox{\boldmath $u$}}^{\tau}s_n\left({\mbox{\boldmath $\beta$}}_0^s\right)-c_1(1-\xi)n^{1/3}/2+O(p_{0n})\\
\leq & n^{-1/3}{\mbox{\boldmath $u$}}^{\tau}s_n\left({\mbox{\boldmath $\beta$}}_0^s\right)-cn^{1/3}
\end{split}$$ Hence, for some positive constant $c,$ we have $$\begin{split}
&P\left(\ln L_n\left({\mbox{\boldmath $\beta$}}^s\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^s\right)>0:\;\; \text{for some}\;\;{\mbox{\boldmath $u$}}\right)\\
\leq &P\left({\mbox{\boldmath $u$}}^{\tau}s_n\left({\mbox{\boldmath $\beta$}}_0^s\right)\geq cn^{2/3}:\;\; \text{for
some}\;\;{\mbox{\boldmath $u$}}\right)\\
\leq &\sum\limits_{j\in s}P\left(s_{n,j}\left({\mbox{\boldmath $\beta$}}_0^s\right)\geq
cn^{2/3}\right)+\sum\limits_{j\in s}P\left(-s_{n,j}\left({\mbox{\boldmath $\beta$}}_0^s\right)\geq cn^{2/3}\right)
\end{split}$$ From (\[claim\]), we know that $\sum\limits_{i\in \mathcal{A}_0}\sum\limits_{j\in
s}P\left(s_{n,j}\left({\mbox{\boldmath $\beta$}}_0^s\right)\geq cn^{2/3}\right)=o(1).$ The same for the second term. Therefore, $$\label{equation8}
P\left(\ln L_n\left({\mbox{\boldmath $\beta$}}^s\right)-\ln L_n\left({\mbox{\boldmath $\beta$}}_0^s\right)>0:\;\; \text{for some}\;\;{\mbox{\boldmath $u$}}, s\in \mathcal{A}_0\right)=o(1).$$ Because $\ln L_n\left({\mbox{\boldmath $\beta$}}^s\right)$ is a concave function for any ${\mbox{\boldmath $\beta$}}^s,$ the maximum likelihood estimator $\hat{{\mbox{\boldmath $\beta$}}}^s$ exists and falls within a $n^{-1/3}$ neighborhood of ${\mbox{\boldmath $\beta$}}_0^s$ uniformly for $s\in
\mathcal{A}_0.$ Thus, we have $P\left(\|\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s\|_2=O(n^{-1/3})\right)\rightarrow 1.$
Now we can apply C5, the right hand side of (\[inequ3\]) can be upper bounded by $$\begin{split}
& (\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)^{\tau}s_n({\mbox{\boldmath $\beta$}}_0^s)-\dfrac{(1-\xi)(1-\epsilon)}{2}(\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)^{\tau}H_{n1}({\mbox{\boldmath $\beta$}}_0^s)(\hat{{\mbox{\boldmath $\beta$}}}^s-{\mbox{\boldmath $\beta$}}_0^s)\\
\leq & \dfrac{1}{2(1-\epsilon)}s_n^{\tau}({\mbox{\boldmath $\beta$}}_0^s)\{H_{n1}({\mbox{\boldmath $\beta$}}_0^s)\}^{-1} s_n({\mbox{\boldmath $\beta$}}_0^s)
\end{split}$$ where $\epsilon$ is an arbitrarily small positive value. Hence, the left hand side of (\[compare2res\]) is no more than $$\label{equation10}
\begin{split}
&P\left(\dfrac{1}{2(1-\epsilon)}s_n^{\tau}({\mbox{\boldmath $\beta$}}_0^s)\{H_{n1}({\mbox{\boldmath $\beta$}}_0^s)\}^{-1} s_n({\mbox{\boldmath $\beta$}}_0^s)\geq
m[0.5\ln n+\gamma\ln p_n]\right)\\
\leq &|\mathcal{A}_0|\exp(-m(1-\epsilon)[0.5\ln n+\gamma\ln p_n])\\
\leq & \exp\left(m[(\ln (p_n-p_{0n}) -(1-\epsilon)\gamma\ln p_n-\dfrac{(1-\epsilon)}{2}\ln n]\right)
\end{split}$$ It converges to 0 when $\gamma>\dfrac{1}{1-\epsilon}[1-\dfrac{\ln n}{2\ln p_n}]$.
[3]{}
Akaike, H.(1973). Information theory and an extension of the maximum likelihood principle. [*Second International Symposium on Information Theory*]{}, Akademiai Kiado, 267- 281.
Bogdan, M, Ghosh, J. K, Doerge, R. W. (2004). Modifying the Schwarz Bayesian information criterion to locate multiple interacting quantitative trait loci. [*Genetics*]{}, 2004. [**167**]{}, 989 - 999.
Chen, J. , Chen, Z. (2008). Extended Bayesian information criteria for model selection with large model spaces. [*Biometrika.*]{} [**95**]{}, 759-771.
Chen, J, , Chen, Z. (2012). Extended BIC for small-n-large-p sparse GLM. Statistical Sinica.
Luo, S. and Chen, Z.(2011). Extended BIC for linear regression models with diverging number of relevant features and high or ultra-high feature spaces. Available from http://www.stat.nus.edu.sg/ stachenz/.
Czado, C. and Munk, A. (2000). Noncanonical links in generalized linear models - when is the effort justified? [*J. Stat. Plan. Infer*]{}, [**87**]{}, 317-345.
Fan, J. Q. and Li, R. (2001). Variable selection via non-concave penalized likelihood and its oracle properties. [*J. Am. Stat. Assoc.*]{} [**96**]{}, 1348-1360.
Fan, J.Q. and Song, R. (2010). Sure Independence Screening in Generalized Linear Models with NP-dimensionality. [*Ann. Stat*]{}, [**38**]{}, 3567-3604.
Golub, T.R., Slonim, D.K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J.P., Coller, H., et al (1999). Molecular Classification of Cancer: Class Discovery and Class Prediction by Gene Expression Monitoring. [*Science*]{}, [**286**]{}, 531-537.
Huang, J., Horowitz, J. L., and Wei, F. R. (2010). Variable selection in nonparametric additive models. [*Annals of Statistics*]{}, [**38(4)**]{} :2282- 2313.
Lee, K.E., Sha, N.J., Dougherty, E.R., Vannucci, M. and Mallick, B.K.(2003). Gene selection: a Bayesian variable selection approach. [*Bioinformatices*]{}, [**19**]{}, 90-97.
Li, W. and Chen, Z. (2009). Multiple interval QTL mapping for trait distribution with a spike. [*Genetics*]{}, [**182**]{}, 337-342.
Liao, J.G and Chin, K.V. (2007). Logistic regression for disease classification using microarray data: model selection in a large $p$ small $n$ case. [*Bioinformatics*]{}, [**23**]{}, 1945-1951.
Luo, S. and Chen, Z. (2011). Sequential Lasso for feature selection with ultra-high dimensional feature space. arXiv:1107.2734v1
McCullagh, P. and Nelder, J. A. (1989). Generalized linear models. Second Edition. Chapman and Hall, London.
Stone, M. (1974). Cross-validatory choice and assessment of statistical predictions (with discussion). [*J. Roy. Statist. Soc. B (Methodological)*]{} [**39**]{}, 111-147.
Schwarz, G. (1978). Estimating the dimension of a model. [*Ann. Statist.*]{} [**6**]{}, 461-464.
Tibshirani, R. (1996). Regression shrinkage and selection via the LASSO. [*J. Roy. Statist. Soc. B (Methodological)*]{} [**58**]{}, 267-288.
Tropp, J.A. (2004). Greed is good: Algorithmic results for sparse approximation. [*IEEE Transactions on Information Theory*]{}, [**50**]{}, 1–21.
Tropp, J.A. and Gilbert, A.C. (2007). Signal recovery from random measurements via orthogonal matching pursuit. [*IEEE Transactions on Information Theory*]{}, [**53**]{}, 4655–4666.
Wang, H. (2009). Forward Regression for Ultra-High Dimensional Variable Screening. [*J. Am. Stat. Assoc.*]{}[**104**]{}, 1512-1524.
Wang, H., Li, B. and Leng, C. (2009). Shrinkage tuning parameter selection with a diverging number of parameters. [*J. R. Statist. Soc. B* ]{} [**71**]{}, 671-683.
Wedderburn, R.W.M. (1976). On the existence and uniqueness of the maximum likelihood estimates for certain generalized linear models. [*Biometrika*]{}, [**63**]{}, 27-32.
Zhao, J. and Chen, Z. (2012). A Two-Stage Penalized Logistic Regression Approach to Case-Control Genome-Wide Association Studies. [*Journal of Probability and Statistics*]{}. doi:10.1155/2012/642403
Zou, H. and Hastie, T. (2005). Regularization and variable selection via the elastic net [*Journal of the Royal Statistical Society: Series B*]{} [**67 (2)**]{}, 301–320.
-------- ----- -------------- -------------- -------------- -------------- -------------- -------------- -------------- --------------
$\rho$ $n$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$
0 100 0.736 0.375 0.735 0.362 0.646 0.193 0.481 0.074
(0.281) (0.292) (0.284) (0.291) (0.382) (0.228) (0.453) (0.141)
200 0.930 0.272 0.918 0.223 0.879 0.127 0.862 0.078
(0.220) (0.252) (0.253) (0.215) (0.311) (0.147) (0.337) (0.108)
500 0.971 0.408 0.963 0.371 0.939 0.079 0.936 0.026
(0.135) (0.181) (0.163) (0.152) (0.231) (0.119) (0.238) (0.062)
0.3 100 0.708 0.407 0.708 0.398 0.621 0.196 0.471 0.081
(0.298) (0.296) (0.298) (0.306) (0.384) (0.230) (0.442) (0.152)
200 0.933 0.281 0.924 0.239 0.889 0.143 0.855 0.083
(0.202) (0.248) (0.232) (0.212) (0.303) (0.161) (0.344) (0.111)
500 0.969 0.428 0.959 0.354 0.938 0.047 0.933 0.014
(0.130) (0.169) (0.177) (0.138) (0.238) (0.091) (0.247) (0.048)
0.5 100 0.712 0.401 0.711 0.383 0.632 0.201 0.451 0.080
(0.293) (0.295) (0.294) (0.292) (0.385) (0.223) (0.447) (0.146)
200 0.929 0.281 0.923 0.243 0.881 0.128 0.858 0.084
(0.219) (0.257) (0.236) (0.223) (0.313) (0.130) (0.343) (0.110)
500 0.967 0.434 0.959 0.371 0.939 0.043 0.933 0.006
(0.142) (0.166) (0.168) (0.147) (0.235) (0.085) (0.249) (0.031)
0.7 100 0.674 0.432 0.674 0.414 0.606 0.244 0.430 0.092
(0.291) (0.289) (0.291) (0.287) (0.365) (0.241) (0.432) (0.144)
200 0.931 0.292 0.926 0.248 0.888 0.148 0.874 0.112
(0.196) (0.246) (0.218) (0.207) (0.295) (0.146) (0.314) (0.125)
500 0.970 0.427 0.966 0.365 0.937 0.032 0.934 0.010
(0.134) (0.173) (0.150) (0.150) (0.234) (0.072) (0.240) (0.038)
-------- ----- -------------- -------------- -------------- -------------- -------------- -------------- -------------- --------------
: The PDR and FDR of the forward selection procedure with EBIC under simulation setting 1 (the PDR and FDR are averaged over 200 replicates, the numbers in parenthesis are standard errors) []{data-label="simutable1"}
-------- ----- -------------- -------------- -------------- -------------- -------------- -------------- -------------- --------------
$\rho$ $n$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$
0.3 100 0.662 0.424 0.660 0.409 0.594 0.233 0.492 0.132
(0.272) (0.287) (0.276) (0.286) (0.350) (0.237) (0.392) (0.195)
200 0.931 0.256 0.926 0.231 0.891 0.111 0.881 0.068
(0.199) (0.245) (0.212) (0.222) (0.281) (0.137) (0.295) (0.101)
500 0.973 0.401 0.967 0.339 0.946 0.041 0.941 0.018
(0.127) (0.173) (0.149) (0.134) (0.209) (0.089) (0.217) (0.055)
0.5 100 0.571 0.489 0.570 0.478 0.521 0.304 0.442 0.189
(0.259) (0.274) (0.261) (0.276) (0.303) (0.265) (0.337) (0.230)
200 0.918 0.272 0.910 0.239 0.888 0.121 0.869 0.081
(0.204) (0.256) (0.230) (0.231) (0.267) (0.148) (0.293) (0.122)
500 0.970 0.402 0.964 0.351 0.946 0.056 0.942 0.021
(0.129) (0.183) (0.148) (0.153) (0.199) (0.115) (0.212) (0.062)
-------- ----- -------------- -------------- -------------- -------------- -------------- -------------- -------------- --------------
: The PDR and FDR of the forward selection procedure with EBIC under simulation setting 2 (the PDR and FDR are averaged over 200 replicates, the numbers in parenthesis are standard errors) []{data-label="simutable2"}
----- -------------- -------------- -------------- -------------- -------------- -------------- -------------- --------------
$n$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$ $\mbox{PDR}$ $\mbox{FDR}$
100 0.586 0.506 0.586 0.484 0.524 0.332 0.387 0.198
(0.258) (0.252) (0.258) (0.253) (0.316) (0.252) (0.366) (0.239)
200 0.796 0.414 0.791 0.386 0.767 0.285 0.746 0.221
(0.261) (0.282) (0.274) (0.273) (0.311) (0.247) (0.334) (0.228)
500 0.946 0.479 0.936 0.416 0.912 0.195 0.896 0.171
(0.167) (0.165) (0.197) (0.150) (0.248) (0.185) (0.269) (0.176)
----- -------------- -------------- -------------- -------------- -------------- -------------- -------------- --------------
: The PDR and FDR of the forward selection procedure with EBIC under simulation setting 3 (the PDR and FDR are averaged over 200 replicates, the numbers in parenthesis are standard errors) []{data-label="simutable2"}
---- ------------------------------- ------------------------------ ------------------------- ------------------------------ ------------------------------ ----------------- ------------------------------ ------------------------------ --------------------- ---------------------
1 2 3 4 5 6 7 8 9 10
lo $1834^{\ast \triangle\star}$ 4438 4951 $6539^{\star}$ 155 2181 $1882^{\ast \triangle\star}$ 6472 65 1953
pr $1834^{\ast \triangle\star}$ 4438 4951 155 5585 5466 706 $7119^{\star}$ 3119 4480
ca $1882^{\ast \triangle\star}$ 4951 $6281^{\star}$ 4499 4443 $ 6539^{\star}$ 5107 $1834^{\ast \triangle\star}$ 4480 6271
cl $ 1834^{\ast \triangle\star}$ $6855^{\ast \triangle\star}$ 4377 5122 2830 4407 4780 6309 $ 4973^{\star}$ 715
11 12 13 14 15 16 17 18 19 20
lo 3692 706 1787 $5191^{\star}$ 1239 3119 2784 1078 3631 6308
pr $ 6201^{\triangle}$ 490 6895 $1882^{\ast \triangle\star}$ 1809 2855 3123 $ 4211^{\ast}$ $ 2020^{\ast\star}$ 3631
ca 6378 3631 $2111^{\star}$ $ 6201^{\triangle}$ $ 6373^{\star}$ 1800 4780 321 $4107^{\triangle}$ $1779^{\triangle} $
cl 5376 930 1800 $1882^{\ast\triangle \star}$ 5794 4399 $4389^{\star} $ 922 1962 4267
21 22 23 24 25 26 27 28 29 30
lo $ 6373^{\star}$ $1909^{\star}$ 4153 $ 1685^{\triangle}$ $ 6855^{\ast\triangle\star}$ 7073 5539 2830 4819 6347
pr 5823 1953 $1745^{\triangle\star}$ 65 997 $ 1928^{\star}$ 3307 1787 538 5539
ca 6277 1544 $ 5254^{\star}$ $ 1928^{\star}$ $ 1745^{\triangle\star}$ 3163 7073 310 $ 4389^{\star}$ 5146
cl 1926 4229 $ 5254^{\star}$ 770 2141 6923 7073 2828 $ 4847^{\star}$ 698
31 32 33 34 35 36 37 38 39 40
lo 1081 1095 5328 4279 4373 5737 4366 5280 3307 284
pr 4107 2385 1087 $1909^{\star}$ 5376 5552 6005 1604 3391 5442
ca 1927 885 3137 2258 4334 6657 2733 5336 5972 6167
cl 1779 $1928^{\star}$ 4049 876 6857 6347 $ 6376^{\star}$ 2361 4664 758
41 42 43 44 45 46 47 48 49 50
lo 6676 4291 1945 4079 3722 668 782 $ 4196^{\star}$ 25 $ 4389^{\star} $
pr 6702 6309 $2348^{\star}$ 4282 4925 6167 2323 1779 5122 $ 3847^{\star} $
ca 4229 $ 4328^{\star}$ 715 4149 $ 5191^{\star}$ 6283 200 6702 5794 4190
cl 3631 6308 4499 4480 5971 6510 5300 3475 3932 6801
---- ------------------------------- ------------------------------ ------------------------- ------------------------------ ------------------------------ ----------------- ------------------------------ ------------------------------ --------------------- ---------------------
: Analysis of Leukemia Data: the top 50 genes selected by the forward selection procedure with the four links: logit (lo), probit (pr), cauchit (ca) and cloglog (cl)[]{data-label="gene1"}
Link Function Selected Genes Maximum Likelihood
--------------- -------------------- --------------------
logit $ 1834, \ \ 4438$ -2.296e-08
probit $1834, \ \ 4438$ -3.022e-08
cauchit $1882, \ \ 4951$ -2.122e-06
cloglog $1834, \ \ 6855$ -6.908e-08
: Analysis of Leukemia Data: the final selected genes by EBIC[]{data-label="gene2"}
| 2023-12-28T01:27:04.277712 | https://example.com/article/3954 |
#10000=@"/others.js;sourcefile"
files(#10000,"/others.js","others","js",0)
#10001=@"/;folder"
folders(#10001,"/","")
containerparent(#10001,#10000)
#10002=@"loc,{#10000},0,0,0,0"
locations_default(#10002,#10000,0,0,0,0)
hasLocation(#10000,#10002)
#20000=@"global_scope"
scopes(#20000,0)
#20001=@"script;{#10000},1,1"
#20002=*
lines(#20002,#20001,"with(a) {","
")
#20003=@"loc,{#10000},1,1,1,9"
locations_default(#20003,#10000,1,1,1,9)
hasLocation(#20002,#20003)
#20004=*
lines(#20004,#20001,"}","
")
#20005=@"loc,{#10000},2,1,2,1"
locations_default(#20005,#10000,2,1,2,1)
hasLocation(#20004,#20005)
#20006=*
lines(#20006,#20001,"debugger;","
")
#20007=@"loc,{#10000},3,1,3,9"
locations_default(#20007,#10000,3,1,3,9)
hasLocation(#20006,#20007)
#20008=*
lines(#20008,#20001,"var x = 23, y;","")
#20009=@"loc,{#10000},4,1,4,14"
locations_default(#20009,#10000,4,1,4,14)
hasLocation(#20008,#20009)
numlines(#20001,4,4,0)
#20010=*
tokeninfo(#20010,7,#20001,0,"with")
#20011=@"loc,{#10000},1,1,1,4"
locations_default(#20011,#10000,1,1,1,4)
hasLocation(#20010,#20011)
#20012=*
tokeninfo(#20012,8,#20001,1,"(")
#20013=@"loc,{#10000},1,5,1,5"
locations_default(#20013,#10000,1,5,1,5)
hasLocation(#20012,#20013)
#20014=*
tokeninfo(#20014,6,#20001,2,"a")
#20015=@"loc,{#10000},1,6,1,6"
locations_default(#20015,#10000,1,6,1,6)
hasLocation(#20014,#20015)
#20016=*
tokeninfo(#20016,8,#20001,3,")")
#20017=@"loc,{#10000},1,7,1,7"
locations_default(#20017,#10000,1,7,1,7)
hasLocation(#20016,#20017)
#20018=*
tokeninfo(#20018,8,#20001,4,"{")
#20019=@"loc,{#10000},1,9,1,9"
locations_default(#20019,#10000,1,9,1,9)
hasLocation(#20018,#20019)
#20020=*
tokeninfo(#20020,8,#20001,5,"}")
hasLocation(#20020,#20005)
#20021=*
tokeninfo(#20021,7,#20001,6,"debugger")
#20022=@"loc,{#10000},3,1,3,8"
locations_default(#20022,#10000,3,1,3,8)
hasLocation(#20021,#20022)
#20023=*
tokeninfo(#20023,8,#20001,7,";")
#20024=@"loc,{#10000},3,9,3,9"
locations_default(#20024,#10000,3,9,3,9)
hasLocation(#20023,#20024)
#20025=*
tokeninfo(#20025,7,#20001,8,"var")
#20026=@"loc,{#10000},4,1,4,3"
locations_default(#20026,#10000,4,1,4,3)
hasLocation(#20025,#20026)
#20027=*
tokeninfo(#20027,6,#20001,9,"x")
#20028=@"loc,{#10000},4,5,4,5"
locations_default(#20028,#10000,4,5,4,5)
hasLocation(#20027,#20028)
#20029=*
tokeninfo(#20029,8,#20001,10,"=")
#20030=@"loc,{#10000},4,7,4,7"
locations_default(#20030,#10000,4,7,4,7)
hasLocation(#20029,#20030)
#20031=*
tokeninfo(#20031,3,#20001,11,"23")
#20032=@"loc,{#10000},4,9,4,10"
locations_default(#20032,#10000,4,9,4,10)
hasLocation(#20031,#20032)
#20033=*
tokeninfo(#20033,8,#20001,12,",")
#20034=@"loc,{#10000},4,11,4,11"
locations_default(#20034,#10000,4,11,4,11)
hasLocation(#20033,#20034)
#20035=*
tokeninfo(#20035,6,#20001,13,"y")
#20036=@"loc,{#10000},4,13,4,13"
locations_default(#20036,#10000,4,13,4,13)
hasLocation(#20035,#20036)
#20037=*
tokeninfo(#20037,8,#20001,14,";")
#20038=@"loc,{#10000},4,14,4,14"
locations_default(#20038,#10000,4,14,4,14)
hasLocation(#20037,#20038)
#20039=*
tokeninfo(#20039,0,#20001,15,"")
#20040=@"loc,{#10000},4,15,4,14"
locations_default(#20040,#10000,4,15,4,14)
hasLocation(#20039,#20040)
toplevels(#20001,0)
#20041=@"loc,{#10000},1,1,4,14"
locations_default(#20041,#10000,1,1,4,14)
hasLocation(#20001,#20041)
#20042=@"var;{x};{#20000}"
variables(#20042,"x",#20000)
#20043=@"var;{y};{#20000}"
variables(#20043,"y",#20000)
#20044=*
stmts(#20044,7,#20001,0,"with(a) {\n}")
#20045=@"loc,{#10000},1,1,2,1"
locations_default(#20045,#10000,1,1,2,1)
hasLocation(#20044,#20045)
stmt_containers(#20044,#20001)
#20046=*
exprs(#20046,79,#20044,0,"a")
hasLocation(#20046,#20015)
enclosing_stmt(#20046,#20044)
expr_containers(#20046,#20001)
literals("a","a",#20046)
#20047=@"var;{a};{#20000}"
variables(#20047,"a",#20000)
bind(#20046,#20047)
#20048=*
stmts(#20048,1,#20044,1,"{\n}")
#20049=@"loc,{#10000},1,9,2,1"
locations_default(#20049,#10000,1,9,2,1)
hasLocation(#20048,#20049)
stmt_containers(#20048,#20001)
#20050=*
stmts(#20050,16,#20001,1,"debugger;")
hasLocation(#20050,#20007)
stmt_containers(#20050,#20001)
#20051=*
stmts(#20051,18,#20001,2,"var x = 23, y;")
hasLocation(#20051,#20009)
stmt_containers(#20051,#20001)
#20052=*
exprs(#20052,64,#20051,0,"x = 23")
#20053=@"loc,{#10000},4,5,4,10"
locations_default(#20053,#10000,4,5,4,10)
hasLocation(#20052,#20053)
enclosing_stmt(#20052,#20051)
expr_containers(#20052,#20001)
#20054=*
exprs(#20054,78,#20052,0,"x")
hasLocation(#20054,#20028)
enclosing_stmt(#20054,#20051)
expr_containers(#20054,#20001)
literals("x","x",#20054)
decl(#20054,#20042)
#20055=*
exprs(#20055,3,#20052,1,"23")
hasLocation(#20055,#20032)
enclosing_stmt(#20055,#20051)
expr_containers(#20055,#20001)
literals("23","23",#20055)
#20056=*
exprs(#20056,64,#20051,1,"y")
hasLocation(#20056,#20036)
enclosing_stmt(#20056,#20051)
expr_containers(#20056,#20001)
#20057=*
exprs(#20057,78,#20056,0,"y")
hasLocation(#20057,#20036)
enclosing_stmt(#20057,#20051)
expr_containers(#20057,#20001)
literals("y","y",#20057)
decl(#20057,#20043)
#20058=*
entry_cfg_node(#20058,#20001)
#20059=@"loc,{#10000},1,1,1,0"
locations_default(#20059,#10000,1,1,1,0)
hasLocation(#20058,#20059)
#20060=*
exit_cfg_node(#20060,#20001)
hasLocation(#20060,#20040)
successor(#20051,#20054)
successor(#20057,#20056)
successor(#20056,#20060)
successor(#20055,#20052)
successor(#20054,#20055)
successor(#20052,#20057)
successor(#20050,#20051)
successor(#20044,#20046)
successor(#20048,#20050)
successor(#20046,#20048)
successor(#20058,#20044)
numlines(#10000,4,4,0)
filetype(#10000,"javascript")
| 2024-07-26T01:27:04.277712 | https://example.com/article/6290 |
NOTE: This disposition is nonprecedential.
United States Court of Appeals
for the Federal Circuit
______________________
EBAY INC. AND MICROSOFT CORPORATION,
Plaintiffs-Appellees,
AND
CABELAS INC.,
Plaintiff-Appellee,
v.
KELORA SYSTEMS, LLC,
Defendant-Appellant.
------------------------------------
KELORA SYSTEMS, LLC,
Plaintiff-Appellant,
v.
TARGET CORPORATION, AMAZON.COM, INC.,
OFFICE DEPOT,INC., COSTCO WHOLESALE
CORPORATION, HEWLETT-PACKARD COMPANY,
AUDIBLE, INC., AND ZAPPOS.COM, INC.,
Defendants-Appellees,
AND
DELL, INC.,
Defendant-Appellee,
AND
NEWEGG INC.,
Defendant-Appellee.
______________________
2012-1474, -1475, -1476
______________________
Appeal from the United States District Court for the
Northern District of California in No. 11-CV-1548, Judge
Claudia Wilken.
______________________
JUDGMENT
______________________
ROBERT D. BECKER, Manatt, Phelps & Phillips, LLP, of
Palo Alto, California, argued for the defendant-appellant,
Kelora Systems, LLC. With him on the brief were
RONALD S. KATZ and SHAWN G. HANSEN.
CONSTANTINE L. TRELA, JR., Sidley Austin, LLP, of
Chicago, Illinois, argued for all plaintiffs-appellees and
defendants-appellees. With him on the brief were
RICHARD A. CEDEROTH and THEODORE W. CHANDLER, of
Los Angeles, California, for defendants-appellees, eBay,
Inc. et al. Also on the brief were GREGORY P. SITRICK,
Quarles & Brady LLP, of Phoenix, Arizona; CHRISTOPHER
J. FAHY, of Chicago, Illinois; JEFFREY L. FILLERUP,
McKenna Long & Aldridge, LLP, of San Francisco, Cali-
fornia, for defendants-appellees, Cabela’s Inc.; JONATHAN
S. FRANKLIN, Fulbright & Jaworski, L.L.P., of Washing-
ton, DC; DAN D. DAVISON, of Dallas, Texas; RICHARD S.
ZEMBEK and DANIEL S. LEVENTHAL, of Houston, Texas;
GILBERT A. GREENE and SHEILA KADURA, of Austin, Texas,
for defendants-appellees, Target, et al.; JOSEPH A.
MICALLEF and SCOTT M. BORDER, Sidley Austin, LLP, of
Washington, DC, for defendant-appellee, Dell, Inc.;
KIMBALL R. ANDERSON and KATHLEEN B. BARRY, of Win-
ston & Strawn LLP, of Chicago, Illinois; KENT E.
BALDAUF, JR., BRYAN P. CLARK and DANIEL H. BREAN, The
Webb Law Firm, of Pittsburgh, Pennsylvania, for defend-
ant-appellee, Newegg.
______________________
THIS CAUSE having been heard and considered, it is
ORDERED and ADJUDGED:
PER CURIAM (NEWMAN, PLAGER, and PROST, Circuit Judg-
es).
AFFIRMED. See Fed. Cir. R. 36.
ENTERED BY ORDER OF THE COURT
March 19, 2013 /s/ Jan Horbaly
Date Jan Horbaly
Clerk
| 2024-03-04T01:27:04.277712 | https://example.com/article/6403 |
Pages
Friday, May 8, 2009
In a previous post, I described my experiences with upgrading from Ubuntu 8.10 to 9.04. The previous post also provides some cautionary notes on upgrading from the ext3 to ext4 filesystems. This post describes the process of configuring 9.04 from scratch, after downloading the ISO file and burning it to CD. (For future troubleshooting purposes, you may also want to download and burn the "alternate" ISO file.)The basic installation was pretty simple: insert the CD, boot the computer, and follow the instructions. The main exception was the partitioning step, especially if the machine had several partitions. I defer to other websites that provide details on the basic installation.
In my first try, I started by installing and configuring Firefox extensions, but that was very time-consuming, so I decided to save that for later, in case I would have to re-do my installation. What had forced me to start over in my installation was related to compiz, so I decided to start there, this time, and make sure that part was OK before proceeding with the rest.
The specific problem I had run into had come up when I was following the advice at 10 Tips for After You Install or Upgrade Ubuntu. The gist of it is that I tried installing fusion-icon, wound up with the black screen problem that lots of people seemed to be having, went through a whole hassle (documented elsewhere), and decided not to use fusion-icon. On my next try, I also decided not to use compiz, which was also causing unexpected behavior in my system. I also wasn't using wine. Therefore, the 10 Tips, modified for 9.04 and combined with some other tips, so as to do things in the best order, came out as follows:
System > Administration > Update Manager > Check. (This one would ideally be postponed until you've done a couple of these other steps, but it may insist upon being run early in the process, in which case you may want to repeat it later.) Install updates. Restart if advised, and then run Check again, until there's nothing left to update.
Applications > Add/Remove > Show All Available Applications. Then search for "restricted extras." Check the box next to "Ubuntu restricted extras." Click Apply Changes > Apply.
System > Administration > Hardware Drivers. I was using an nVidia graphics card, and here I saw that my system was not using nVidia drivers, and that I did have a couple options to choose from. I chose to activate the recommended driver. I had to reboot before it would take effect.
System > Administration > Software Sources. Go to the Ubuntu Software tab > Download From > Other > Select Best Server > Choose Server. Also, go to the Third-Party Software tab and add other stable repositories. (On that webpage, under the "Install packages" heading, where it says "Display sources.list entries for" choose "The Jaunty Jackalope." Then copy the lines from the text box immediately below that heading. For instance, I copied and pasted these two lines, one at a time, into the dialog box that said,"Enter the complete APT line of the repository that you want to add as source":
(Those are each one-line commands.) I had to click "Add" after each one in order to be able to install the next one. Then click Close. This called for a reload of current software information. If you don't get a "Reload" option when you click Close, go back into Third-Party Software and unclick and then re-click some item and try again.
Remove Partition Icons from Desktop. A mere tweak, but while we're doing the 10 Tips, it's easy. Alt-F2 > gconf-editor > Run > apps/nautilus/desktop. Unclick volumes_visible. Close the Configuration Editor.
System > Administration > Synaptic Package Manager. Search for each of these items and mark for installation when it comes up: cups-pdf; firestarter; flashplugin-installer; gparted; ntfs-config; p7zip-full; pysdm; and sun-java6-jre. (If numerous items come up in response to your search, click on the Package heading to sort them alphabetically. Also install other related packages, if given the option.) Some of these may ask if you want to "Mark additional required changes?" Click "Mark" and go on to the next one. Then click Apply. (I initially installed, but decided not to keep, compizconfig-settings-manager and emerald. They appeared to be generating multiple problems for others and were not functioning well on my machine.) Some of these programs may already be shown as being installed on your system. If so, no problem.
Next, I closed that and ran Update Manager once more. I went to System > Administration > Firestarter to configure the Firestarter firewall. I had second thoughts after installing it; it seemed that some people had problems with it. It was also said to be a security risk -- something for special needs, not like a Windows firewall that would be highly recommended for general use. I thought about removing it via Synaptic or the command line, but it didn't seem to be bothering me now, so I let it alone.
Then it was time to install some Ubuntu programs that weren't available, or didn't install well, via Synaptic. Installing these called for use of Ubuntu's command line -- which, if you are an accurate typist, can be manageable. These programs were of two kinds. First, there was the previously downloaded program that was too big to download again unless necessary. An example of this was my copy of VMware Workstation 6.5, which was 340MB and had cost me $189.
Downloads typically came in some kind of compressed format, so I had to decompress them before I could use them. To decompress them, I had to run Ubuntu's Places > Computer menu pick. This opened File Browser, which worked like Windows Explorer. In File Browser, I navigated to the folder where I had saved my downloaded .bin file. File Browser's Location field gave me the path for this folder. I copied that path into Ubuntu's Terminal program (Applications > Accessories > Terminal). (If you're used to using Ctrl-C and Ctrl-V to copy and paste, you may have better luck by using the right-click options instead.) Once I was in the right folder in Terminal, I typed "cd [pathname]" which, in my case, was as follows:
cd "/media/CURRENT/Miscellany/Ubuntu Programs"
About quotation marks: in this post (indeed, in my posts generally), don't type them if they just bracket the command. In the previous sentence, for example, you would type the quotation marks in the indented command (i.e., cd "/media/CURRENT etc.), but not the quotation marks in the "cd [pathname]" example. I had to use quotation marks in the indented example because that pathname contains a space (between "Ubuntu" and "Programs"); this space would confuse the CD command otherwise.
At this point, in Terminal, I typed "sudo -i" so that I could execute commands as root (i.e., as administrator). Then the commands I used to decompress these files were as follows:
BIN Files. (The example used here is GoogleEarthLinux.bin, although this program is regularly updated and not that big, and is therefore better installed by a different method that brings you the current version, as described below.) For BIN files, I used this procedure: (1) Type "chmod +x" followed by the .bin filename. Example: chmod +x GoogleEarthLinux.bin. (2) Type "./" followed immediately by the .bin filename. Example: ./GoogleEarthLinux.bin. (If "./" doesn't work, try "sh" -- with no space after ./ but a space after sh). (3) Designate "/home/ray" (with your own username in place of ray) as the installation directory.
BUNDLE Files. Same steps as BIN files.
DEB Files. Right-click on the filename and use GDebi. Click on its "Install Package" button. It seems to know already where it wants to install the files -- not necessarily in or under the directory where the .deb file itself is located.
TAR Files. To install a TAR.GZ file: Copy to /home/ray (replacing "ray" with your username), navigate there in Terminal, and then use this command format: tar -vxf filename.tar.gz (or possibly tar xvfz instead). To uncompress the files (or to get the files out of a tarball), use this format: tar xvf filename.tar. If you have a .tar.bz2 file, use this format: tar yxf filename.tar.bz2.
To install Google Earth, I didn't use a previous download (see above). Instead, I typed this:
wget http://dl.google.com/earth/client/current/GoogleEarthLinux.bin
sh GoogleEarthLinux.bin
(That "wget" is supposed to be on the same line as the URL that follows it.)
I got an error message when I tried to start Google Earth:
Google Earth detected an error while trying to authenticate. Please check the following:
That link didn't work for me. I did find advice to rename the libcrypto.so.0.9.8 file in the google-earth directory (which, by default, was /opt/google-earth) to something else, but that didn't solve the problem this time, so I changed it back to its original name. The solution, for me, was to type "sudo apt-get install lib32nss-mdns." The other problem was that I had to replace the entries in My Places in Google Earth; the ones that I had previously installed (which were still visible after the reinstallation) would cause the program to crash.
Next program: Firefox. Firefox was included with Ubuntu. Updating it depended on the situation. On one machine, I had wiped the partition and was installing Ubuntu from scratch. In that case, I had to fiddle with Firefox extensions. Before wiping and reinstalling, though, I had previously installed the InfoLister extension. This add-on had created an HTML file listing my currently installed extensions. I had kept a copy of that HTML file, and now I opened it. Although the HTML file contained links directly to webpages containing information and downloads for the various extensions, I had found that the fastest way to reinstall these extensions was just to open the Mozilla addons webpage and search for and install them one at a time. (It was not necessary to restart Firefox each time I marked an addon for installation.) I also went to the Categories > Plugins webpage, there at Mozilla, and downloaded the latest versions of the plugins I thought I would be needing. To get YouTube and other videos to play, I tried the alpha version of 64-bit Adobe Flash Player 10. One addon (Snap Links Plus) was available only in a manually installed .xpi form, so I went into Firefox and chose File > Open File and indicated that one for installation. To see what plugins I had installed, I typed "about:plugins" in the Firefox address bar (also accessible by Ctrl-L). I also had to configure the Preferences for a number of add-ons individually (Firefox Tools > Addons). On another computer, by contrast, I was installing Ubuntu 9.04 on top of 8.04, without first reformatting the partition. This kept a bunch of the things I had already installed, including my Firefox extensions. Some were not compatible with 9.04, but otherwise Firefox seemed to run pretty well.
Next, I wanted to make some adjustments to the system. First, I didn't want all those various prior Ubuntu kernels to be listed in the GRUB menu at startup. To edit this, I typed "sudo gedit /boot/grub/menu.lst" and put # symbols in front of each line that I didn't want to appear in the GRUB menu.
I also wanted Ubuntu to mount NTFS drives automatically at bootup. This involved a fair amount of screwing around, on the system where I had installed Ubuntu 9.04 without first uninstalling or formatting the partition where 8.04 was installed. I have detailed those efforts in a separate post.
That was pretty much it, for the update installation -- the one where I installed 9.04 on top of 8.04. For the installation from scratch, I had some additional problems. Here are some brief notes on those:
My dual-boot system was screwed up. When I booted, I got GRUB Error 12. The solution was to remove "makeactive" from the Windows XP entry in /boot/grub/menu.lst, and use GParted to give WinXP the boot flag.
If you may be rearranging your drive partitions (e.g., swapping hard drives), you may want to change the partition references in fstab to refer to UUIDs (which stay with the partition) rather than partition numbers (e.g., sda1) which will change when you rearrange partitions. To do this, open gparted (System > Administration > Partition Editor). Then, in Terminal, type "sudo blkid" to get UUID information for each drive. Type "sudo gedit /etc/fstab" to edit the fstab file. Change each line in fstab that refers to a fixed location, so that it refers to the device's UUID instead. For example, if fstab contains a line that begins with "/dev/sda5" and if blkid tells you that the UUID for that device is 500D33F91G01, then you might want to move the /dev/sda5 to a previous line as a comment, and replace it with the UUID. (Everything after the /dev/sda5 on that line would remain unchanged.) So the line that used to read like this:
/dev/sdaa5 /media/DRIVENAME ntfs-3g [etc.]might now look like this:# Entry for /dev/sdaa5 :UUID=500D33F91G01 /media/DRIVENAME ntfs-3g [etc.]Next: in Nautilus (i.e., File Browser), go to Edit > Preferences > Behavior and make sure the "Always open in browser windows" box is checked.
I found a solution to a networking problem in which Ubuntu was unable to connect to the Internet.
In one of my installation attempts, I also had to fix a keyboard problem. The solution was to use an alternate keymap code.
Although I didn't actually use it, I got a tip that said I could designate programs to open automatically at startup by selecting System > Preferences > Sessions.
In response to error: "Unable to lock the download directory," use "sudo pkill apt" OR "sudo killall dpkg."
There's no limit to the number of other things that can be installed and other tweaks that can be made. But the next big step, for me, was installing VMware.
7
comments:
I forgot to mention: the upgrade installation described in this post was on a different machine from the upgrade installation described in the other post. I don't know why it went so much easier for this machine.
Another program to install in Synaptic: xfe. It's a Windows Explorer look-alike. There are others worth noting (e.g., GNOME Commander), but at present this appears to be the best replacement for Ubuntu's Nautilus program, for my purposes.
My shutdown button led to two options: log off or switch user. I wanted it to have shutdown and reset options. To change this, I made changes to the panel (or taskbar) where the shutdown button was located. Specifically, I right-clicked on a part of the panel where I would get the option of "Add to Panel." I chose that option and went down until I got to the Shut Down option. Then I closed out of that and right-clicked on the former shutdown button to remove it. Basically, Ubuntu or I had installed a logoff button when what I really wanted was a shutdown button. | 2023-10-12T01:27:04.277712 | https://example.com/article/8085 |
Prime Minister Julia Gillard's new ministry was sworn-in in Canberra this morning, but star recruit Bob Carr was not in the ministerial group photo at Government House.
The former NSW premier and soon-to-be foreign minister has to wait for a joint sitting of the NSW Parliament to approve his Senate spot before he can join his new colleagues.
New Foreign Minister Bob Carr will not be sworn in with his colleagues today. Credit:Andrew Meares
While the NSW Labor Party selects casual vacancies for the Senate, the Constitution requires that the appointments are approved by the NSW Parliament.
The Senate vacancy was created when Senator Mark Arbib resigned last week in the wake of the Labor leadership ballot. | 2024-01-28T01:27:04.277712 | https://example.com/article/8616 |
What a Republican Future Would Mean for Women’s Health
By Emilie Openchowski
Posted on September 6, 2012, 6:46 am
Last week at the 2012 Republican National Convention, the party made its official stance on women’s health perfectly clear: Outlawing abortion is much more important than protecting a woman’s fundamental right to quality, affordable health care, her ability to have a safe pregnancy, and her access to family planning.
By writing and approving what many—and even some on the right—are calling “the most conservative platform in modern history,” the Republican party has closely and undeniably aligned itself with the most conservative elements of its supporters. Aside from the steps backward that the platform takes on gay rights, immigration reform, gun control, and tax reform, the attacks on women’s rights generally and access to abortion specifically show that the party is continuing to embrace an extreme agenda. In a country where 55 million women are registered to vote—a number growing at a rate of about 1 million per year—the question is how far out of touch that agenda might be this year.
The most discussed detail of the platform (in terms of women’s rights) is the position that a human life amendment needs to be added to the U.S. Constitution. This action would make abortion illegal under any circumstances—no exceptions whatsoever—and is widely unpopular with the vast majority of all Americans. In fact, only 13 percent of Americans, and just 20 percent of those who identify themselves as Republicans, believe there should be an all-out ban on abortion of this scope and magnitude.
The platform similarly endorses federal “legislation to make clear that the Fourteenth Amendment’s protections apply to unborn children,” which would make an embryo or fetus the legal equal of its mother and would grant it a legal right to be gestated and born, even in the case of danger to the mother’s life. The platform also supports “the appointment of judges who respect traditional family values and the sanctity of innocent human life”—code for a commitment to overturning Roe v. Wade, among other things.
The Republican platform goes on to acknowledge and praise “the many States that have passed laws for informed consent [and] mandatory waiting periods prior to an abortion.” This should come as no surprise, considering the head of the platform committee, Virginia Gov. Bob McDonnell, supported a law in his state requiring invasive transvaginal ultrasounds prior to getting an abortion. (The law that ended up passing in Virginia requires an abdominal ultrasound instead, regardless of medical necessity.)
In contrast, the Democratic National Party Platform for 2012 pledges to uphold Roe v. Wade, supports “a woman’s right to make decisions regarding her pregnancy, including a safe and legal abortion,” and argues that “there is no place for politicians or government to get in the way” of a woman’s decision to get an abortion. The position that politicians should not be making extremely personal health care decisions on behalf of women is one that President Barack Obama promoted following the controversy surrounding Rep. Todd Akin’s (R-MO) comments regarding “legitimate rape.”
The Democratic platform, on the other hand, pledges full support for family planning services by continuing “to stand up to Republican efforts to defund Planned Parenthood health centers.” It also recognizes that these facilities educate men and women on their sexual health and well-being and enables those individuals and couples to prevent and plan pregnancies, which in turn can “help reduce the number of unintended pregnancies and thereby also reduce the need for abortions.”
It was not enough, however, for the Republican platform to pledge an end to these vital women’s health services and programs. It also promises to repeal the Affordable Care Act, also known as Obamacare, which makes health care—including maternity care and preventive services for women such as mammograms, Pap smears, and contraception—available and affordable for women across the country. Obamacare has helped women in numerous ways since being enacted, at a minimum by ensuring that women don’t get charged higher premiums than men for the exact same coverage for no reason other than gender. If the law is, in fact, repealed, all of the progress that has been made to increase access and affordability of health care in this country will be erased.
Taken together, the message in the official Republican party platform for women is clear: Your access to care and ability to have a safe, healthy pregnancy is not as important as the desire to ban abortion and family planning services. In one fell swoop, the party has shown its determination to cut women off from the vital programs, services, and protections that all of us deserve.
For a party that is so focused on individual liberty and not letting politicians make decisions for us, its platform certainly does not embody those values—at least not when it comes to women making health decisions about their own bodies.
Emilie Openchowski is an Assistant Editor at the Center for American Progress Action Fund. | 2023-10-21T01:27:04.277712 | https://example.com/article/1208 |
Share This Story!
Autopsy shows unarmed teen repeatedly shot
President Barack Obama said he was sending his attorney general to meet with U.S. law enforcement authorities investigating the fatal shooting by police of an unarmed 18-year-old black man, who suffered a bullet wound to his right arm that may have occurred when he put his hands up or when his back was turned to the shooter, according to a pathologist hired by the teen's family said Monday.
FERGUSON, Mo. — President Barack Obama said he was sending his attorney general to meet with U.S. law enforcement authorities investigating the fatal shooting by police of an unarmed 18-year-old black man, who suffered a bullet wound to his right arm that may have occurred when he put his hands up or when his back was turned to the shooter, according to a pathologist hired by the teen's family said Monday.
But the pathologist said the independent team that examined Michael Brown can't be sure yet exactly how the wounds were inflicted, citing the need for more information.
The autopsy determined that he was shot at least six times, including twice in the head, according to the pathologists and the family's attorneys. Another autopsy conducted by St. Louis County also found Brown was shot six to eight times, and that he was hit in the head and chest.
In Washington, Obama said in a news conference that Attorney General Eric Holder to Ferguson would arrive Wednesday in Ferguson.
The Aug. 9 shooting touched off rancorous protests in Ferguson, a St. Louis suburb where police have used riot gear and tear gas. Gov. Jay Nixon ordered the National Guard to Ferguson to restore order Monday, while lifting a midnight-to-5 a.m. curfew that had been in place for two days.
Obama said he told Nixon he wanted to ensure the use of National Guard reservists to help calm tensions must be limited in scope, and said he would be monitoring that operation in the coming days to see whether the guard's involvement was helping or hurting.
Brown's death heightened racial tensions between the predominantly black community and the mostly white Ferguson Police Department. Civil rights activists have compared the shooting to other racially charged cases, especially the 2012 death of Trayvon Martin, the unarmed black teenager shot by Florida neighborhood watch organizer who was later acquitted of murder. Both cases have fueled nationwide debates on the treatment of young black men in America.
Police have said little about the encounter between Brown and the white officer, except to say that it involved a scuffle in which the officer was injured and Brown was shot. Witnesses say the teenager had his hands in the air as the officer fired multiple rounds.
Forensic pathologist Shawn Parcells, who assisted former New York City chief medical examiner Dr. Michael Baden during the independent autopsy, said a graze wound on Brown's right arm could have occurred in several ways. The teen may have had his back to the shooter, or he could have been facing the shooter with his hands above his head or in a defensive position in front of his face.
"But we don't know," Parcells said.
Baden said one of the bullets entered the top of Brown's skull, suggesting his head was bent forward when he suffered the fatal injury. The pathologists said Brown, who also was shot four times in the right arm, could have survived the other bullet wounds.
Suzanne McCune, the administrator of the St. Louis County medical examiner's office, said the county's autopsy found Brown was hit in the head and chest but she would not confirm whether he was hit elsewhere on his body. Full findings of the county's autopsy aren't expected for about two weeks.
Family attorney Benjamin Crump said the family wanted the additional autopsy because they feared results of the county's examination could be biased. Crump declined to release copies of the report to the media.
"They could not trust what was going to be put in the reports about the tragic execution of their child," he said during Monday's news conference with Parcells and Baden. "It verifies that the witness accounts were true: that he was shot multiple times."
He said Brown's mother "had the question any mother would have: Was my child in pain. Dr. Baden shared with her in his opinion, he did not suffer." He also noted that Brown had abrasions on his face from where he fell to the ground, but "otherwise no evidence of a struggle."
Baden said there was no gun-power residue on Brown's body, indicating he was not shot at close range. However, Baden said he did not have access to Brown's clothing, and that it was possible the residue could be on the clothing.
A grand jury could begin hearing evidence Wednesday to determine whether the officer, Darren Wilson, should be charged in Brown's death.
The U.S. Justice Department already had deepened its civil rights investigation into the shooting. A day earlier, officials said 40 FBI agents were going door-to-door gathering information in the neighborhood where Brown was shot.
Holder has ordered a federal medical examiner to perform another autopsy.
Obama, during a brief pause in his summer vacation, said Holder would meet with FBI and other officials carrying out an independent federal investigation.
The president expressed sympathy for the "passions and anger" sparked by the death of Brown, but said giving in to that anger through looting and attacks on police only stirs tensions and leads to further chaos. He said overcoming the mistrust endemic between many communities and their local police would require Americans to "listen and not just shout."
"That's how we're going to move forward together, by trying to unite each other and understand each other and not simply divide ourselves from one another," Obama told reporters at the White House. "We're going to have to hold tight to those values."
In this photo taken with a fisheye lens, people leave a McDonald's restaurant after taking refuge from tear gas Sunday, Aug. 17, 2014, as they staged a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
Police wait to advance after tear gas was used to dispersed a crowd Sunday, Aug. 17, 2014, during a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
Protesters take refuge in a McDonald's restaurant after police fired tear gas to disperse a crowd Sunday, Aug. 17, 2014, during a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
Police wait to advance after tear gas was used to disperse a crowd Sunday, Aug. 17, 2014, during a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
People run from tear gas after police dispersed a crowd Sunday, Aug. 17, 2014, as they staged a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
A woman tries to recover after being hit by tear gas after police dispersed a crowd Sunday, Aug. 17, 2014, during a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
A law enforcement officer on a tactical vehicle watches after a device was fired to disperse a crowd Sunday, Aug. 17, 2014, during a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
A protester stands in the street after police fired tear gas to disperse a crowd Sunday, Aug. 17, 2014, during a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
Police wait to advance after tear gas was used to disperse a crowd Sunday, Aug. 17, 2014, druing a protest for Michael Brown, who was killed by a police officer last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP)
Protesters run when the police shoot tear gas in Ferguson, Mo., Sunday, Aug. 17, 2014. Protests over the killing of 18-year-old Michael Brown by a white police officer have entered their second week. (Photo: J.B. Forbes/AP)
Rev. Al Sharpton (left) speaks with the parents of Michael Brown, Michael Brown Sr. and Lesley McSpadden, during a rally at Greater Grace Church, Sunday, Aug. 17, 2014, for their son who was killed by police last Saturday in Ferguson, Mo. (Photo: Charlie Riedel/AP) | 2024-03-16T01:27:04.277712 | https://example.com/article/1653 |
Frédérique Dumas
Frédérique Dumas (born May 18, 1963) is a French film producer and the CEO of Studio 37, the film production subsidiary of Orange.
Biography
Studies
Frédérique Dumas studied at the Institut Libre for International Relations Studies (Panthéon-Assas University), and holds a bachelor's degree in information/communication.
Film career
From 1989 to 1993, Frédérique Dumas was a film consultant for the French Ministry of Culture. At the same time, she was holding a director of development position at Polygram.
In 1996, she created NoéProductions, and IngaFilms in 2004, two independent film production companies based in Paris, France. In parallel, she was President of the Bureau de Liaison des Industries Cinématographiques, the office that syndicates most of the French film unions.
In 2005, she was a member of the jury for the 20th movie festival in Paris.
Today, she is the CEO of Studio 37, the film production subsidiary of Orange.
Political career
From 1989 to 1997, she was the Cultural Affairs delegate to the mayor of Antony, France.
From 2001 to 2005, she was the media and culture spokesperson for the French political party, the UDF. Since April 2004, she was also the regional counselor of the Ile-de-France county.
Since July 2009, Frédérique Dumas is the National Secretary in charge of new media for the French political party, the Nouveau Centre.
In 2017, she was elected as a deputy to the National Assembly as a member of La République En Marche!, having left the Union of Democrats and Independents earlier in the year.
Filmography
1996: Dobermann, Jan Kounen
1998: Train de vie, Radu Mihăileanu
2001: No man's land, Danis Tanović
2001: Les portes de la gloire, Christian Merret-Palmair
2002: Inquiry into the invisible world, Jean-Michel Roux
Studio 37 coproductions
2008: My Own Love Song, Olivier Dahan
2008: The French Kissers, Riad Sattouf
2008: Lascars, Albert Pereira and Emmanuel Klotz
2008: Le Coach, Olivier Doran
2008: Cyprien, David Charhon
2008: Thelma, Louise et Chantal, Benoît Pétré
2010: Gainsbourg (Vie héroïque), Antoine Sfar
2011: ...And If We All Lived Together, Stéphane Robelin
2014: Les Gazelles, Mona Achache
Awards
1994: Golden lion Mostra de Venise, Before the rain
2001: Oscar for best foreign film, No man's land
2001: Best screenplay at the Cannes film festival, No man's land
2002: César awarded, No man's land
Sources
External links
Category:1963 births
Category:Living people
Category:Panthéon-Assas University alumni
Category:French film producers
Category:Women members of the National Assembly (France)
Category:La République En Marche politicians
Category:21st-century French women politicians
Category:Deputies of the 15th National Assembly of the French Fifth Republic
Category:Union of Democrats and Independents politicians | 2023-09-01T01:27:04.277712 | https://example.com/article/8017 |
Introduction
============
Intra-abdominal pressure (IAP) is an important parameter and prognostic indicator of the patient\'s underlying physiologic status \[[@B1]\]. Correct IAP measurement therefore is crucial. Because measurement of IAP by an indwelling catheter in the urinary bladder is simple, minimally invasive, and reproducible, it has been forwarded as the gold standard. It was thought that the highly compliant wall of the bladder acts as a passive diaphragm, and intrinsic bladder pressure did not rise when its volume is between 50 and 100 ml. However, considerable variability in the measurement technique has been noted, not only interindividual and intraindividual but also intercentre and intracentre. Variations in IAP from -6 to +30 mmHg have been noted. The measurement technique itself is also not uniform, some authors recommend injecting 50 ml saline, others up to 200 ml. The aim of the present study is to determine the optimal bladder volume for correct IAP transmission but without the risk of \'over inflation\' of the bladder and raising intrinsic intrabladder pressure (IBP).
Methods
=======
In six sedated and mechanically ventilated patients sterile saline was injected via a Foley catheter with 25 ml increments up to 300 ml. In total 13 \'insufflation\' and \'deflation\' pressure--volume (PV) curves were constructed in these patients. The male/female ratio was 5/1, age 63.8 ± 14, MODScore 8.6 ± 4, SOFA score 10 ± 4.5, APACHE II score 31 ± 11.4, SAPS II score 59.2 ± 13.2. The number of measurements in each patient was 2.3 ± 0.5. Construction of PV curves was done with the SPSS 10™ software, values are mean ± SD.
Results
=======
The values for IBP with regard to bladder volume are summarized in Table [1](#T1){ref-type="table"}. Figure [1](#F1){ref-type="fig"} plots the \'insufflation\' and \'deflation\' PV curve as a curve fit of the means of the 13 measurements. A lower inflection point (LIP) can be seen at a bladder volume of 100 ml and an upper inflection point (UIP) at a bladder volume of 250 ml. The difference in bladder pressure was 2.7 ± 3.3 mmHg between 0 and 50 ml volume, 1.7 ± 1.2 mmHg between 50 and 100 ml, 7.7 ± 5.7 mmHg between 50 and 200 ml, and 16.8 ± 13.4 mmHg between 50 and 300 ml.
{#F1}
Bladder volume (ml) 0 50 100 150 200 250 300
--------------------- ----------- --------- ----------- ------------ ------------ ------------- -------------
IBP (mmHg) 4.2 ± 3.2 6.9 ± 5 8.7 ± 5.2 11.8 ± 6.8 14.6 ± 8.9 18.2 ± 12.3 23.7 ± 16.1
Conclusions
===========
If IBP is used as an estimate for IAP the volume instilled in the bladder should be between 50 and 100 ml; however, in some patients with a low bladder compliance, intrinsic bladder pressure can be raised at low bladder volumes. Ideally a bladder PV curve should be constructed for each individual patient before using IBP as an estimation for IAP.
| 2024-03-21T01:27:04.277712 | https://example.com/article/7794 |
*g - 3089. Calculate i(113).
-38
Let s(g) = 23*g + 763. Determine s(-36).
-65
Let a(u) = 3*u**2 + 31*u - 2. Determine a(-10).
-12
Let y(q) = 6*q**2 - 32*q - 6. Give y(3).
-48
Let v(k) = -9*k**3 + 2*k**2 + 10*k + 6. Calculate v(-2).
66
Let n(d) = d**3 + 7*d**2 + 6*d - 114. Give n(0).
-114
Let z(n) = 4*n**3 + 139*n**2 + 120*n + 613. Determine z(-34).
1
Let d(a) = -a**3 + 136*a**2 + 275*a + 114. Determine d(138).
-24
Let f(l) = -48*l - 388. Calculate f(-8).
-4
Let i(q) = 1598*q + 26. What is i(0)?
26
Let p(o) = 2*o**3 + 30*o**2 + 29*o + 10. Give p(-14).
-4
Let p(z) = -z**3 - 2*z**2 + 38*z + 122. What is p(-3)?
17
Let t(m) = -8*m**3 + 59*m**2 - 8*m - 15. What is t(7)?
76
Let m(z) = 2*z**2 + 106*z - 1263. Give m(10).
-3
Let d(r) = -r**2 - 102*r - 440. Determine d(-98).
-48
Let j(i) = -i**3 + 12*i**2 - 37*i + 81. Give j(9).
-9
Let n(o) = 2*o**2 + 25*o + 53. Determine n(-14).
95
Let u(w) = -2*w + 104. Give u(16).
72
Let y(d) = 2*d**3 + 16*d**2 + 42*d + 56. Give y(-4).
16
Let b(q) = 477*q - 4944. Determine b(11).
303
Let o(q) = -237*q + 8888. What is o(37)?
119
Let n(q) = 2783*q - 33396. Give n(12).
0
Let m(s) = 3*s**2 - 41*s + 121. Determine m(8).
-15
Let g(l) = -l**3 - 10*l**2 + 36*l - 31. What is g(-13)?
8
Let h(k) = 105*k**2 + 4305*k - 2. Calculate h(-41).
-2
Let g(c) = 2*c**2 - 308*c - 2256. What is g(161)?
-2
Let b(c) = 2*c**2 - 80*c + 659. Calculate b(29).
21
Let h(c) = 16*c - 119. Give h(6).
-23
Let q(r) = -r**3 + 11*r**2 + 144*r + 145. What is q(19)?
-7
Let p(w) = -w**3 + 6*w**2 + 4*w - 46. What is p(3)?
-7
Let p(r) = -23*r + 2166. What is p(67)?
625
Let h(r) = 14*r**2 - 314*r + 8. Determine h(22).
-124
Let f(i) = 29*i + 189. Determine f(-6).
15
Let d(t) = -t**2 - 10*t + 92. What is d(-22)?
-172
Let i(y) = -9*y - 137. Determine i(-25).
88
Let g(i) = i**3 - 9*i**2 + 8*i - 66. Determine g(10).
114
Let d(c) = 85*c + 919. Give d(-11).
-16
Let a(n) = -66*n**2 - 460*n + 16. What is a(-7)?
2
Let w(o) = o**2 + 44*o + 7. What is w(0)?
7
Let j(h) = h**2 - 58*h + 91. Calculate j(58).
91
Let n(p) = p**2 - 9*p - 17. Give n(-11).
203
Let a(g) = -199*g**2 + 804*g - 23. Calculate a(4).
9
Let s(n) = n**3 - 28*n**2 + 27*n + 10. Determine s(27).
10
Let l(h) = -146*h**2 + 412*h - 3. Calculate l(3).
-81
Let t(o) = 61*o - 232. Calculate t(9).
317
Let a(t) = -3*t**3 - 174*t**2 - 181*t - 564. What is a(-57)?
6
Let y(a) = 1263*a - 44204. Give y(35).
1
Let i(j) = 10*j + 194. Calculate i(-13).
64
Let b(z) = -21*z**2 - 67*z - 4. What is b(-4)?
-72
Let m(p) = -2*p**2 + 4*p + 100. Give m(10).
-60
Let t(z) = -z**3 - 80*z**2 - 139*z - 4729. Determine t(-79).
11
Let z(m) = -47*m + 48. Calculate z(5).
-187
Let r(g) = 35*g + 954. What is r(-27)?
9
Let h(r) = -2*r**2 + 4*r - 11. What is h(8)?
-107
Let v(i) = 2*i**3 + 116*i**2 - 123*i - 52. Determine v(-59).
243
Let z(c) = 29*c**2 + 23*c - 10. Calculate z(1).
42
Let g(n) = -n - 220. Determine g(-41).
-179
Let v(q) = q**2 - 2373*q + 72606. What is v(31)?
4
Let q(r) = -r**3 + 41*r**2 - 45*r + 142. Determine q(40).
-58
Let j(t) = 94*t - 458. Determine j(5).
12
Let c(d) = -23*d**2 - 510*d + 507. What is c(1)?
-26
Let z(j) = -12*j**2 - 1517*j - 630. Give z(-126).
0
Let l(u) = 2874*u - 373629. What is l(130)?
-9
Let j(s) = 19*s**2 - 8*s - 72. What is j(-5)?
443
Let w(d) = 5*d - 159. Give w(-21).
-264
Let z(c) = -c**3 + 29*c**2 + 91*c - 16. Give z(32).
-176
Let v(m) = -m**3 - 59*m**2 + 68*m + 584. Determine v(-60).
104
Let j(b) = -b**3 + 31*b**2 + 65*b - 143. Calculate j(33).
-176
Let v(n) = n**3 - 29*n**2 + 12*n + 130. What is v(28)?
-318
Let d(r) = r - 92. Give d(48).
-44
Let u(z) = 118*z + 150. Determine u(-2).
-86
Let b(x) = 5*x**2 - 26*x - 58. Calculate b(9).
113
Let f(r) = -9*r**2 - 354*r - 121. Determine f(-39).
-4
Let j(c) = 5*c**3 + 2*c**2 + 8*c - 2. Give j(5).
713
Let n(p) = -p**3 + 6*p**2 - 4*p + 19. Calculate n(6).
-5
Let l(j) = 2*j**2 - j + 3. Give l(-8).
139
Let g(z) = -z**3 + 435*z**2 - 3832*z - 25. Calculate g(9).
-7
Let v(r) = 337*r + 7071. Determine v(-21).
-6
Let w(v) = -74*v - 655. Calculate w(-9).
11
Let h(j) = 624*j + 2735. What is h(-4)?
239
Let g(c) = -1306*c + 7818. Calculate g(6).
-18
Let g(z) = 5*z**2 - 35*z + 3. What is g(0)?
3
Let a(i) = -i**3 - 4*i**2 - 12*i + 280. Give a(5).
-5
Let j(c) = 752*c - 7524. Determine j(10).
-4
Let y(j) = 776*j - 3083. Determine y(4).
21
Let x(s) = 22*s - 82. Determine x(19).
336
Let g(l) = 21*l**3 - l**2 + 27*l - 30. What is g(1)?
17
Let b(u) = 571*u - 4559. Calculate b(8).
9
Let r(m) = -m**3 + 103*m**2 - 216*m + 33283. Determine r(104).
3
Let a(l) = -l**3 + 3*l**2 + 926*l - 58. What is a(-29)?
0
Let t(f) = f**3 + 16*f**2 + 10*f - 47. Give t(-15).
28
Let g(h) = h**2 + 7*h - 2. Determine g(-5).
-12
Let z(k) = k**3 + 24*k**2 - 49*k + 81. Calculate z(-26).
3
Let z(i) = -i**3 + 53*i**2 + 7*i + 99. Give z(53).
470
Let j(g) = -g**3 - 2*g**2 + 4*g - 155. Calculate j(0).
-155
Let r(i) = -i**2 + 19*i - 6. Calculate r(16).
42
Let v(o) = o**2 + 51*o + 259. Determine v(-8).
-85
Let o(a) = -a**3 + 44*a**2 - 227*a - 129. Determine o(38).
-91
Let g(p) = 74*p - 334. Determine g(4).
-38
Let g(z) = z**2 - 17*z - 140. Give g(0).
-140
Let t(m) = -3*m**3 - 28*m**2 + 41*m + 72. Give t(-11).
226
Let v(z) = z**3 - 52*z**2 - 56*z + 158. Give v(53).
-1
Let y(m) = -230*m + 250. What is y(0)?
250
Let b(z) = -3*z**2 + 42*z - 32. Calculate b(15).
-77
Let b(y) = y**3 + 73*y**2 + 1304*y - 42. Calculate b(-32).
214
Let b(h) = -6*h**2 + 468*h - 457. What is b(77)?
5
Let g(t) = 12*t**2 - 2632*t - 4409. Calculate g(221).
11
Let m(n) = -23*n - 579. What is m(-23)?
-50
Let k(g) = -2*g**2 - 87*g - 926. Calculate k(-22).
20
Let c(l) = -l**2 - 171*l - 48. Give c(0).
-48
Let j(u) = 371*u - 2983. Give j(8).
-15
Let l(n) = 9*n**2 - 160*n + 161. Give l(1).
10
Let o(f) = -f**3 - 19*f**2 + 2*f - 16. Give o(-19).
-54
Let x(q) = 2*q**3 + 21*q**2 + 36*q + 510. Give x(-11).
-7
Let f(l) = -l + 90. What is f(16)?
74
Let s(x) = -x**3 - 37*x**2 + 248*x + 65. Calculate s(6).
5
Let f(o) = -20*o + 544. Determine f(41).
-276
Let y(w) = -5*w**2 - 24*w - 26. Determine y(-2).
2
Let k(f) = -1051*f + 28364. Give k(27).
-13
Let s(v) = 39*v - 546. What is s(14)?
0
Let y(k) = 189*k + 782. What is y(-4)?
26
Let b(c) = c**2 - 12*c - 2260. Give b(54).
8
Let c(o) = 3*o**3 + 8*o**2 - 19*o - 10. What is c(2)?
8
Let l(u) = -1062*u - 13816. What is l(-13)?
-10
Let a(v) = -4769*v + 28611. What is a(6)?
-3
Let j(t) = -17*t - 89. Calculate j(6).
-191
Let p(w) = -50*w**3 + 499*w**2 + 7*w - 10. Give p(10).
-40
Let o(n) = -3863*n + 11583. Calculate o(3).
-6
Let r(a) = -a**3 + 10*a**2 + 6*a + 203. What is r(12)?
-13
Let z(l) = l**3 - 79*l**2 - 592*l - 864. Determine z(86).
-4
Let b(m) = -m**3 - 18*m**2 - 12*m - 181. What is b(-18)?
35
Let b(f) = -21*f + 45. What is b(11)?
-186
Let x(o) = -74*o + 2738. Give x(37).
0
Let w(g) = g - 2. Give w(45).
43
Let u(d) = -2*d**2 + 83*d + 37. What is u(40)?
157
Let u(n) = -3*n**2 - 111*n + 1046. What is u(8)?
-34
Let d(p) = -154*p - 452. What is d(-3)?
10
Let u(d) = -4*d**3 - 28*d**2 - 2*d - 44. Determine u(-5).
-234
Let h(b) = -143*b - 346. What is h(-5)?
369
Let p(m) = -15*m**2 + 80*m + 333. What is p(-4)?
-227
Let w(j) = -j**3 + 16*j**2 - 77*j + 116. What is w(9)?
-10
Let j(n) = -n**3 + 19*n**2 - 12*n - 110. Calculate j(18).
-2
Let n(t) = 119*t + 2017. Give n(-17).
-6
Let x(h) = -15*h + 87. Give x(12).
-93
Let x(y) = -1632*y**2 + 13060*y + 16. What is x(8)?
48
Let u(a) = -a**3 - 50*a**2 - 169*a + 610. Give u(-46).
-80
Let s(x) = 18*x**2 + 6*x + 1. Calculate s(2).
85
Let y(k) = k**3 - 22*k**2 + 15*k + 119. Determine y(21).
-7
Let z(v) = v - 48. Determine z(16).
-32
Let h(y) = y**3 + 56*y**2 + 301*y + 51. What is h(-50)?
1
Let y(x) = x**2 + 30*x - 78. Calculate y(-26).
-182
Let u(a) = 360*a + 3237. Determine u(-9).
-3
Let z(s) = -76*s**3 + 117*s**2 + 119*s + 1. Calculate z(-1).
75
Let w(c) = -378*c - 1512. What is w(-4)?
0
Let s(a) = 101*a - 2770. Give s(27).
-43
Let l(y) = y**2 + 23*y + 103. Determine l(-19).
27
Let f(i) = 5*i**2 - 268*i - 2455. Determine f(-8).
9
Let f(z) = -z**3 + 12*z**2 + 11*z - 144. Calculate f(10).
166
Let l(i) = i**2 + 77*i - 858. Determine l(10).
12
Let c(k) = k**2 - 107*k + 735. Calculate c(6).
129
Let j(o) = -23*o**2 - 115*o + 3. Calculate j(-4).
95
Let d(i) = -i**2 - 39*i + 1811. Give d | 2024-01-14T01:27:04.277712 | https://example.com/article/9138 |
After fighting the longest war in its history, the US stands at the brink of defeat in Afghanistan. How could this be possible? How could the world’s sole superpower have battled continuously for more than 16 years – deploying more than 100,000 troops at the conflict’s peak, sacrificing the lives of nearly 2,300 soldiers, spending more than $1tn (£740bn) on its military operations, lavishing a record $100bn more on “nation-building”, helping fund and train an army of 350,000 Afghan allies – and still not be able to pacify one of the world’s most impoverished nations? So dismal is the prospect of stability in Afghanistan that, in 2016, the Obama White House cancelled a planned withdrawal of its forces, ordering more than 8,000 troops to remain in the country indefinitely.
In the American failure lies a paradox: Washington’s massive military juggernaut has been stopped in its steel tracks by a small pink flower – the opium poppy. Throughout its three decades in Afghanistan, Washington’s military operations have succeeded only when they fit reasonably comfortably into central Asia’s illicit traffic in opium – and suffered when they failed to complement it.
It was during the cold war that the US first intervened in Afghanistan, backing Muslim militants who were fighting to expel the Soviet Red Army. In December 1979, the Soviets occupied Kabul in order to shore up their failing client regime; Washington, still wounded by the fall of Saigon four years earlier, decided to give Moscow its “own Vietnam” by backing the Islamic resistance. For the next 10 years, the CIA would provide the mujahideen guerrillas with an estimated $3bn in arms. These funds, along with an expanding opium harvest, would sustain the Afghan resistance for the decade it would take to force a Soviet withdrawal. One reason the US strategy succeeded was that the surrogate war launched by the CIA did not disrupt the way its Afghan allies used the country’s swelling drug traffic to sustain their decade-long struggle.
Despite almost continuous combat since the invasion of October 2001, pacification efforts have failed to curtail the Taliban insurgency, largely because the US simply could not control the swelling surplus from the country’s heroin trade. Its opium production surged from around 180 tonnes in 2001 to more than 3,000 tonnes a year after the invasion, and to more than 8,000 by 2007. Every spring, the opium harvest fills the Taliban’s coffers once again, funding wages for a new crop of guerrilla fighters.
At each stage in its tragic, tumultuous history over the past 40 years – the covert war of the 1980s, the civil war of the 90s and its post-2001 occupation – opium has played a central role in shaping the country’s destiny. In one of history’s bitter ironies, Afghanistan’s unique ecology converged with American military technology to transform this remote, landlocked nation into the world’s first true narco-state – a country where illicit drugs dominate the economy, define political choices and determine the fate of foreign interventions.
During the 1980s, the CIA’s secret war against the Soviet occupation of Afghanistan helped transform the Afghani-Pakistani borderlands into a launchpad for the global heroin trade. “In the tribal area,” the US state department reported in 1986, “there is no police force. There are no courts. There is no taxation. No weapon is illegal … Hashish and opium are often on display.” By then, the process of guerrilla mobilisation to fight the Soviet occupation was long under way. Instead of forming its own coalition of resistance leaders, the CIA had relied on Pakistan’s powerful Inter-Services Intelligence agency (ISI) and its Afghan clients, who soon became key players in the burgeoning cross-border opium traffic.
The CIA looked the other way while Afghanistan’s opium production grew from about 100 tonnes annually in the 1970s to 2,000 tonnes by 1991. In 1979 and 1980, just as the CIA effort was beginning to ramp up, a network of heroin laboratories opened along the Afghan-Pakistan frontier. That region soon became the world’s largest heroin producer. By 1984, it supplied a staggering 60% of the US market and 80% of the European. Inside Pakistan, the number of heroin addicts surged from near zero (yes, zero) in 1979 to 5,000 in 1980, and 1.3 million by 1985 – a rate of addiction so high the UN termed it “particularly shocking”.
Facebook Twitter Pinterest A farmer sowing poppy seeds in Nangarhar province, Afghanistan. Photograph: Sean Smith/The Guardian
According to a 1986 state department report, opium “is an ideal crop in a war-torn country since it requires little capital investment, is fast growing and is easily transported and traded”. Moreover, Afghanistan’s climate was well suited to growing poppies. As relentless warfare between CIA and Soviet surrogates took its toll, Afghan farmers began to turn to opium “in desperation”, since it produced “high profits” that could cover rising food prices. At the same time, the state department reported that resistance elements took up opium production and trafficking “to provide staples for [the] population under their control and to fund weapons purchases”.
As the mujahideen guerrillas gained ground against the Soviet occupation and began to create liberated zones inside Afghanistan in the early 1980s, the resistance helped fund its operations by collecting taxes from peasants who grew the lucrative opium poppies, particularly in the fertile Helmand valley. Caravans carrying CIA arms into that region for the resistance often returned to Pakistan loaded down with opium – sometimes, reported the New York Times, “with the assent of Pakistani or American intelligence officers who supported the resistance”.
Charles Cogan, a former director of the CIA’s Afghan operation, later spoke frankly about the agency’s choices. “Our main mission was to do as much damage as possible to the Soviets,” he told an interviewer in 1995. “We didn’t really have the resources or the time to devote to an investigation of the drug trade. I don’t think that we need to apologise for this … There was fallout in term of drugs, yes. But the main objective was accomplished. The Soviets left Afghanistan.”
Over the longer term, the US intervention produced a black hole of geopolitical instability that would never again be sealed or healed. Afghanistan could not readily recover from the unprecedented devastation it suffered in the years of the first American intervention. As the Soviet-Afghan war wound down between 1989 and 1992, the Washington-led alliance essentially abandoned the country, failing either to sponsor a peace settlement or finance reconstruction.
While Washington turned away from Afghanistan to other foreign policy hotspots in Africa and the Persian Gulf, a vicious civil war broke out in a country that had already suffered, between 1979 and 1989, some 1.5 million dead, about 10% of the country’s population. During the years of civil strife among the many well-armed warlords the CIA had left primed to fight for power, Afghan farmers raised the only crop that ensured instant profits: the opium poppy. Having multiplied twentyfold during the covert-war era of the 1980s, the opium harvest would more than double again during the civil war of the 1990s.
In this period of turmoil, opium’s ascent is best understood as a response to severe damage from two decades of destructive warfare. With the return of some three million refugees to a war-ravaged land, the opium fields were an employment godsend, requiring nine times as many labourers to cultivate as wheat, the country’s traditional staple. In addition, only opium merchants were capable of accumulating capital rapidly enough to be able to provide poor poppy farmers with much-needed cash advances, which often provided more than half their annual income. That credit would prove critical to the survival of many impoverished villagers.
In the civil war’s first phase, from 1992 to 1994, ruthless local warlords combined arms and opium in a countrywide struggle for power. Later, Pakistan threw its backing behind a newly arisen Pashtun force, the Taliban. After seizing Kabul in 1996 and taking control of much of the country, the Taliban regime encouraged local opium cultivation, offering government protection to the export trade and collecting much-needed taxes on both the opium harvested and the heroin manufactured. UN opium surveys showed that, during the Taliban’s first three years in power, Afghanistan’s opium crop accounted for 75% of world production.
In July 2000, however, as a devastating drought entered its second year and hunger spread across Afghanistan, the Taliban government suddenly ordered a ban on all opium cultivation, in an apparent appeal for international acceptance. A subsequent UN crop survey of 10,030 villages found that this prohibition had reduced the harvest by 94%.
Three months later, in September 2000, the Taliban sent a delegation to UN headquarters in New York to trade upon the country’s continuing drug prohibition in a bid for diplomatic recognition. Instead, the UN imposed new sanctions on the regime for protecting Osama bin Laden. The US, on the other hand, actually rewarded the Taliban with $43m in humanitarian aid, even as it seconded UN criticism over Bin Laden. Announcing this aid in May 2001, secretary of state Colin Powell praised “the ban on poppy cultivation, a decision by the Taliban that we welcome”, but still urged the regime to end “their support for terrorism; their violation of internationally recognised human rights standards, especially their treatment of women and girls”.
After largely ignoring Afghanistan for a decade, Washington “rediscovered” the country in the aftermath of the 9/11 terrorist attacks. In October 2001, the US began bombing the country, and then, with the support of British forces, launched an invasion spearheaded by local warlords. The Taliban regime collapsed with a speed that surprised many government officials. In retrospect, it seems likely that its opium prohibition was a crucial factor.
To an extent not generally appreciated, Afghanistan had, for two full decades, devoted a growing share of its resources – capital, land, water and labour – to the production of opium and heroin. By the time the Taliban banned cultivation, its agriculture had become little more than an opium monocrop. The drug trade accounted for most of its tax revenues, much of its export income, and a significant share of its employment.
Facebook Twitter Pinterest British troops patrol Helmand province in southern Afghanistan. Photograph: Getty
The Taliban’s sudden opium eradication proved to be an act of economic suicide that brought an already weakened society to the brink of collapse. A 2001 UN survey found that the ban had “resulted in a severe loss of income for an estimated 3.3 million people”, about 15% of the population. In this context, it became, according to the UN, “easier for western military forces to persuade rural elites and the population to rebel against the regime”.
In little more than a month, the lethal US bombing campaign, combined with ground attacks by its warlord allies, smashed the Taliban’s weakened defenses. But the longer-term US strategy would plant the seeds, quite literally, for the Taliban’s surprising revival just four years later.
While the American bombing campaign raged throughout October 2001, the CIA shipped $70m in cash into the country to mobilise its old cold war coalition of tribal warlords for the fight against the Taliban, an expenditure President George W Bush would later hail as one of history’s biggest “bargains”. To capture Kabul and other key cities, the CIA put its money behind the leaders of the Northern Alliance, an ethnic Tajik force that had fought the Soviets in the 1980s and then resisted the Taliban government in the 1990s. They, in turn, had long dominated the drug traffic in the area of north-east Afghanistan that they controlled during the Taliban years. The CIA also turned to a group of rising Pashtun warlords along the Pakistan border who had been active as drug smugglers in the south-eastern part of the country. As a result, when the Taliban collapsed, the groundwork had already been laid for the resumption of opium cultivation and the drug trade on a major scale.
Once Kabul and the provincial capitals were taken, the CIA quickly ceded operational control to allied military forces and civilian officials. In the years to come, those forces’ inept drug-suppression programmes would cede the heroin traffic’s growing profits first to the warlords and, in later years, largely to Taliban guerrillas. In a development without historical precedent, illicit drugs would be responsible for 62% of the country’s 2003 gross domestic product (GDP).
But for the first few years of the occupation, according to a 2007 New York Times report, defense secretary Donald Rumsfeld reportedly “dismissed growing signs that drug money was being funnelled to the Taliban”, while the CIA and the military “turned a blind eye to drug-related activities by prominent warlords”.
In late 2004, after nearly two years of outsourcing opium control to its British allies and police training to the Germans, the White House was suddenly confronted with troubling CIA intelligence suggesting that the escalating drug trade was fuelling a revival of the Taliban. Backed by George W Bush, secretary of state Colin Powell then urged a forceful counter-narcotics strategy for parts of rural Afghanistan, including the same kind of aggressive aerial defoliation then being used against Colombia’s illicit coca crop. But the US ambassador to Afghanistan, Zalmay Khalilzad, resisted this approach, seconded by his local ally Ashraf Ghani, then the country’s finance minister (and, since 2014, its president), who warned that such an eradication program would mean “widespread impoverishment” in the country, without $20bn in foreign aid to create a “genuine alternative livelihood”. As a compromise, Washington came to rely on private contractors such as DynCorp to train Afghan teams to eradicate drugs. By 2005, however, that effort had, according to New York Times correspondent Carlotta Gall, already become “something of a joke”.
By 2007, the UN’s Afghanistan Opium Survey found that the country’s then-record opium harvest of approxinamtely 8,200 tonnes provided 93% of the world’s illicit heroin supply. Significantly, the UN stated that Taliban guerrillas have “started to extract from the drug economy resources for arms, logistics, and militia pay”. In 2008, the rebels reportedly collected $425m in “taxes” levied on the opium traffic, and with every harvest they made enough funds to recruit a new crop of young fighters from the villages. Each of those prospective guerrillas could count on monthly payments of $300 – far above the wages they would have made as agricultural laborers.
To contain the spreading insurgency, Washington decided to commit 40,000 more US combat troops to Afghanistan in mid-2008, raising allied forces to 70,000. Recognising the crucial role of opium revenues in Taliban recruitment, the allied command was also fielding specialist teams that used development aid to encourage drug-suppression efforts in poppy-rich provinces. It was a fortuitous moment. That record harvest in 2007 had created an opium surplus that depressed prices, while simultaneous food shortages made wheat a competitive crop. As farmers used foreign aid to plant food crops in key areas of Helmand and Nangarhar provinces, the country’s poppy cultivation slipped from a record 200,000 hectares (494,000 acres) in 2007 to just 123,000 two years later – still sufficient, however, to sustain the Taliban. Meanwhile, inept and heavy-handed attempts to suppress the drug trade only ended up increasing opposition to the US and its allies.
By 2009, the guerrillas were expanding so rapidly that the new Obama administration opted for a “surge” of US troop strength to 102,000 in a bid to cripple the Taliban. After months of rising deployments, President Obama’s big breakthrough strategy was officially launched in the darkness before dawn on 13 February 2010, at Marja, a remote market town in Helmand province. As waves of helicopters descended on its outskirts spitting up clouds of dust, hundreds of marines sprinted through fields of sprouting opium poppies toward the village’s mud-walled compounds. Though their targets were the local Taliban guerrillas, the marines were in fact occupying one of the capitals of the global heroin trade.
A week later, Gen Stanley McChrystal choppered into town with Karim Khalili, Afghanistan’s vice-president. They were there for the media rollout of new-look counter-insurgency tactics that were, the general told reporters, certain to pacify villages such as Marja. The local opium traders, however, had other ideas. “If they come with tractors,” one Afghan widow announced to a chorus of supportive shouts from her fellow farmers, “they will have to roll over me and kill me before they can kill my poppy”. Speaking by satellite telephone from the region’s opium fields, one US embassy official told me: “You can’t win this war without taking on drug production in Helmand province.”
Facebook Twitter Pinterest Men smoking heroin in Quetta, Pakistan, near the border with Afghanistan. Photograph: Reuters
By attacking the guerrillas but failing to eradicate the opium harvest that funded new insurgents every spring, Obama’s surge soon faltered. Amid the rapid drawdown of allied forces to meet Obama’s politically determined deadline of December 2014 for “ending” all combat operations, a marked reduction in air operations allowed the Taliban to launch mass-formation offensives, which killed record numbers of Afghan army troops and police.
At the time, John Sopko, the special inspector for Afghanistan, offered a telling explanation for the Taliban’s survival. Despite the expenditure of a staggering $7.6bn on “drug eradication” programs during the previous decade, he concluded that, “by every conceivable metric, we’ve failed. Production and cultivation are up, interdiction and eradication are down, financial support to the insurgency is up, and addiction and abuse are at unprecedented levels in Afghanistan”.
As the 2014 opium crop was harvested, fresh UN figures suggested that production levels were approaching the country’s 2007 high. In May 2015, having watched this flood of drugs enter the global market as US counter-narcotics spending climbed to $8.4bn, Sopko tried to translate these developments into a comprehensible all-American image. “Afghanistan,” he said, “has roughly 500,000 acres, or about 780 square miles, devoted to growing opium poppy. That’s equivalent to more than 400,000 US football fields – including the end zones”.
During Afghanistan’s 2015 fighting season, the Taliban decisively seized the combat initiative, and opium seemed ever more deeply embedded in its operations. In October 2015, the UN released a map showing that the Taliban had “high” or “extreme” control in more than half the country’s rural districts. Within a month, the Taliban unleashed offensives countrywide that were aimed at seizing and holding territory. Not surprisingly, the strongest attacks came in the poppy heartland of Helmand province, where half the country’s opium crop was then grown.
In 2016, 15 years after Afghanistan was “liberated”, and in a significant reversal of the Obama administration’s drawdown policies, Washington launched a mini-surge by “hundreds” of new US troops into Helmand province to deny insurgents the “economic prize” of the world’s most productive poppy fields. Despite support from US airpower and 700 special-operations troops, in February and March 2016 embattled Afghan government forces retreated from two more districts, leaving the Taliban largely in control of 10 of the province’s 14 districts.
With its forces demoralised and the Taliban fielding aggressive fighters equipped with night-vision and sophisticated weapons, US airstrikes became the Afghan government’s last, tenuous line of defence. And in a tacit admission of failure, the Obama administration ended its planned withdrawal in June 2016, allowing US forces to move beyond advising and rejoin actual combat, and announcing, a month later, that 8,400 troops would remain there for the foreseeable future.
In Helmand and other strategic provinces, the Afghan army seemed to be losing a war that was now driven – in ways that eluded most observers – by a battle for control of the country’s opium profits. In Helmand province, both Taliban rebels and provincial officials are locked in a struggle for control of the lucrative drug traffic. “Afghan government officials have become directly involved in the opium trade”, the New York Times reported in February 2016. In so doing, they expanded “their competition with the Taliban … into a struggle for control of the drug traffic”, while imposing “a tax on farmers practically identical to the one the Taliban uses”. In a process that implicated virtually the entire government, provincial officials then passed a portion of their illicit profits “up the chain, all the way to officials in Kabul … ensuring that the local authorities maintain support from higher-ups and keeping the opium growing”.
Simultaneously, a UN security council investigation found that the Taliban had systematically tapped “into the supply chain at each stage of the narcotics trade” – collecting a 10% tax on opium cultivation in Helmand, fighting for control of heroin laboratories and acting as “the major guarantors for the trafficking of raw opium and heroin out of Afghanistan”. No longer simply taxing the traffic, the Taliban was so deeply and directly involved that, according to the New York Times, it “has become difficult to distinguish the group from a dedicated drug cartel”.
These dismal trends persisted throughout 2017, as the Afghan opium harvest nearly doubled to 9,000 tonnes, well above the previous peak of 8,200 tonnes in 2007. Inside wartorn Helmand province, the poppy area increased by 79% to 144,000 hectares, representing 44% of the country’s total crop. In November, convinced that opium is providing 60% of the Taliban’s funds for wages and weapons, the US command – emboldened and expanded by Donald Trump’s decision to “win” the Afghan war – dispatched, for the first time ever, F-22 fighters and B-52 bombers to destroy 10 of the Taliban’s heroin laboratories in Helmand, a small share of the country’s 500 drug refineries.
For the foreseeable future, opium will likely remain entangled in the rural economy, the Taliban insurgency, and government corruption whose sum is the Afghan conundrum.
The failure of America’s intervention in Afghanistan offers broader insight into the limits to its global power. The persistence of both opium cultivation and the Taliban insurgency suggest the degree to which the policies that Washington has imposed upon Afghanistan since 2001 have reached a dead end. For most people worldwide, economic activity, the production and exchange of goods, is the prime point of contact with their government. When, however, a country’s most significant commodity is illegal, then political loyalties naturally shift to the economic networks that move that product safely and secretly from fields to foreign markets, providing protection, finance and employment at every stage. “The narcotics trade poisons the Afghan financial sector and fuels a growing illicit economy,” John Sopko explained in 2014. “This, in turn, undermines the Afghan state’s legitimacy by stoking corruption, nourishing criminal networks and providing significant financial support to the Taliban and other insurgent groups.”
The fortune-teller of Kabul | May Jeong Read more
After 16 years of continuous warfare, Washington is faced with the same choice it had back in 2010, when Obama’s generals airlifted those marines into Marja. Just as it has been over the past decade and a half, the US can remain trapped in the same endless cycle. As snow melts from the mountain slopes and poppy plants rise from the soil every spring, there will be a new batch of teenage recruits from impoverished villages ready to fight for the rebel cause.
Even for this troubled land and its dauntingly complex policy problem, however, there are alternatives. Investing even a small portion of all that misspent military funding in the country’s agriculture can produce more economic options for the millions of farmers who depend upon the opium crop for employment. Ruined orchards could be rebuilt, ravaged flocks repopulated, wasted seed stocks regrown and wrecked snow-melt irrigation systems – which once sustained a diverse agriculture before these decades of war – repaired. If the international community continues to nudge the country’s dependence on illicit opium downward through sustained rural development, then maybe Afghanistan will cease to be the planet’s leading narco-state – and just maybe the annual cycle of violence could at long last be broken.
Adapted from In the Shadows of the American Century by Alfred W McCoy, which will be published in the UK by Oneworld on 25 January
• Follow the Long Read on Twitter at @gdnlongread, or sign up to the long read weekly email here. | 2023-11-15T01:27:04.277712 | https://example.com/article/6541 |
Supreme Court of Florida
____________
No. SC18-118
____________
IN RE: AMENDMENTS TO THE FLORIDA RULES OF CRIMINAL
PROCEDURE — 2018 REGULAR-CYCLE REPORT.
[July 19, 2018]
PER CURIAM.
The Florida Bar’s Criminal Procedure Rules Committee (Committee) has
filed its regular-cycle report of proposed amendments to the Florida Rules of
Criminal Procedure, in accord with Florida Rule of Judicial Administration
2.140(b). We have jurisdiction1 and adopt the amendments as discussed below.
BACKGROUND
The Committee proposes amending the following rules and forms: 3.010
(Scope); 3.025 (State and Prosecuting Attorney Defined); 3.030 (Service and
Filing of Pleadings, Papers, and Documents); 3.130 (First Appearance); 3.131
(Pretrial Release); 3.172 (Acceptance of Guilty or Nolo Contendere Plea); 3.180
1. See art. V, § 2(a), Fla. Const.
(Presence of Defendant); 3.190 (Pretrial Motions); 3.191 (Speedy Trial); 3.203
(Defendant’s Intellectual Disability as a Bar to Imposition of the Death Penalty);
3.213 (Continuing Incompetency to Proceed, Except Incompetency to Proceed
with Sentencing: Disposition); 3.217 (Judgment of Not Guilty by Reason of
Insanity: Disposition of Defendant); 3.218 (Commitment of a Defendant Found
Not Guilty by Reason of Insanity); 3.219 (Conditional Release); 3.220
(Discovery); 3.240 (Change of Venue); 3.330 (Determination of Challenge for
Cause); 3.470 (Proceedings on Sealed Verdict); 3.590 (Time for and Method of
Making Motions; Procedure; Custody Pending Hearing); 3.600 (Grounds for New
Trial); 3.610 (Motion for Arrest of Judgment; Grounds); 3.691 (Post-Trial
Release); 3.692 (Petition to Seal or Expunge); 3.704 (The Criminal Punishment
Code); 3.710 (Presentence Report); 3.770 (Procedure When Pregnancy is Alleged
as Cause For Not Pronouncing Death Sentence); 3.810 (Commitment of
Defendant; Duty of Sheriff); 3.850 (Motion to Vacate, Set Aside, or Correct
Sentence); 3.986(c) (Forms Related to Judgment and Sentence; Form for Charges,
Costs, and Fees); 3.986(d) (Forms Related to Judgment and Sentence; Form for
Sentencing); 3.986(e) (Forms Related to Judgment and Sentence; Form for Order
of Probation); 3.986(f) (Forms Related to Judgment and Sentence; Form for
Community Control); 3.986(g) (Forms Related to Judgment and Sentence; Form
for Restitution Order); 3.989(a) (Affidavit, Petition, and Order to Expunge or Seal
-2-
Forms; Affidavit in Support of Petition); 3.989(b) (Affidavit, Petition, and Order to
Expunge or Seal Forms; Order to Expunge); 3.989(c) (Affidavit, Petition, and
Order to Expunge or Seal Forms; Order to Seal); 3.989(d) (Affidavit, Petition, and
Order to Expunge or Seal Forms; Petition to Expunge or Seal); 3.989(e) (Affidavit,
Petition, and Order to Expunge or Seal Forms; Petition to Expunge; Human
Trafficking Victim); and 3.989(g) (Affidavit, Petition, and Order to Expunge or
Seal Forms; Order to Expunge; Human Trafficking Victim).2 In addition, new rule
3.9876 (Motion for Correction of Sentence) is proposed. Following the filing of
the report and the Court’s publication of the proposals in The Florida Bar News,
comments were filed by the Florida Public Defender Association (FPDA) and
Public Defender Blaise Trettis.
After reviewing the Committee’s proposals and considering the comments
filed and the Committee’s response thereto, we adopt the proposed amendments to
rules 3.010, 3.025, 3.030, 3.131, 3.180, 3.190, 3.191, 3.203, 3.213, 3.217, 3.218,
3.219, 3.220, 3.240, 3.330, 3.470, 3.590, 3.600, 3.610, 3.691, 3.692, 3.704, 3.710,
3.770, 3.810, 3.850, 3.986, 3.9876, and 3.989. With modification, we also adopt
2. The Committee originally proposed amending rule 3.111 (Providing
Counsel to Indigents). However, upon concerns raised by the Committee’s clerk
representatives pertaining to that proposal, the Committee requested that the Court
withdraw the proposal to amend rule 3.111. By this opinion we grant that request.
-3-
the proposed amendments to rule 3.130. We reject the Committee’s proposal to
amend rule 3.172. The notable changes to the rules are summarized below.
AMENDMENTS
The Committee proposes amending rule 3.130 (First Appearance) in
pertinent part, to add new subdivision (b)(2) (Advice to Defendant; Use of Video
Recording to Provide Notice of Rights), to require that the judge confirm that
defendants, if advised of their rights by a pre-recorded video, had an opportunity to
view and understand the rights explained in the video recording. Based upon the
comment by the FPDA, however, we modify the Committee’s proposal to provide
as follows: “If the defendant was advised of the rights listed in subdivisions
(b)(1)(A)-(b)(1)(C) by pre-recorded video, the judge shall confirm separately with
each individual defendant that such defendant had an opportunity to view and
understands the rights explained in the video recording.” As modified, greater
personal interaction between the judge and each individual defendant will be
encouraged.
Subdivision (k) (Summons on Misdemeanor Charge) of rule 3.131 (Pretrial
Release) is amended to require that the summons state “the title of the hearing to
be conducted” after “the nature of the offense.” This change will assist defendants
who may have multiple cases that are proceeding know the type of hearing for
which he or she is summoned.
-4-
The Committee proposes amending subdivision (c)(7) (Determination of
Voluntariness; Terms of Plea Agreement) of rule 3.172 (Acceptance of Guilty or
Nolo Contendere Plea), to require that the terms of the plea agreement include the
amount of time credited for time previously served and an explanation to the
defendant that any credit for time served not included in the time specified would
be a waiver of the defendant’s right to such credit. While the Committee’s
proposal was based upon a referral from the Court that the Committee “propose
language adding a provision to subdivision (c) concerning the trial court advising
the defendant on the issue of credit for time served when determining the
voluntariness of a plea of guilty or nolo contendere,” we decline to amend rule
3.172 as proposed. Instead, we agree with the comment from the FPDA that
unintended consequences of the amendment may include impairment of plea
bargaining, uninformed waivers, conflict with precedent, and an increase of
judicial labor.
Rule 3.180 (Presence of Defendant) is amended to resolve a conflict
between rule 3.130 (First Appearance) and rule 3.180, by permitting a defendant to
appear at the first appearance either physically or by electronic audiovisual device,
as contemplated under rule 3.130.
Rule 3.191(l)(5) (Speedy Trial) is amended to correct the conjunction from
“and” to “or” in the list of “exceptional circumstances” for which the trial court
-5-
may order an extension of the time period for bringing a defendant to trial, as the
trial court does not have to find more than one circumstance to grant an extension.
In regard to rule 3.213 (Continuing Incompetency to Proceed, Except
Incompetency to Proceed with Sentencing: Disposition), the Committee originally
proposed numerous changes. Following the comment by the FPDA, however, the
Committee revised its proposal to amend rule 3.213 in its entirety. As amended,
rule 3.213 is reorganized for clarity, to make it easier to determine the dismissal
schedule within the rule. In addition, new subdivision (a)(3) (Dismissal without
Prejudice during Continuing Incompetency) adds the provision for dismissal after
three years if the charge is not listed in section 916.145(1), Florida Statutes
(Dismissal of charges), as enacted in chapter 2016-135, section 3, Laws of Florida.
In addition to technical changes to rule 3.704 (The Criminal Punishment
Code), new subdivisions (d)(24)(A)-(d)(24)(B) are added in response to chapter
2014-4, Laws of Florida, which amended section 921.0024, Florida Statutes, to
provide that sentence points be multiplied by 2.0 for specified sex offenses
committed by an adult upon a minor under certain circumstances, unless
application of the multiplier results in the lowest permissible sentence exceeding
the statutory maximum.
Rule 3.710(a) (Presentence Report; Cases in Which Court Has Discretion) is
amended to clarify the rule by adding that, in addition to probation, a statutorily
-6-
required mandatory minimum sentence may be imposed without a presentence
investigation upon a defendant found guilty of a first felony offense or found guilty
of a felony while under the age of eighteen. In addition, the term “shall” is
replaced by “may,” because the sentence of probation or mandatory minimum is
discretionary. Lastly, the language added to the end of subdivision (a), “The
requirements of this subdivision are not applicable to a subsequent violation of
probation proceeding,” is based upon Barber v. State, 293 So. 2d 710 (Fla. 1974).
Rule 3.986 (Forms Related to Judgment and Sentence) is amended to
simplify the rule by deleting the lists of costs, special provisions, and general
provisions, and to require the court to insert these items. Following are changes to
specific provisions of the rule. Under subdivision (c) (Form for Charges, Costs,
and Fees), the checklist of charges/costs/fees is deleted and is replaced with the
following directive: “[Insert list of mandatory fines, discretionary fines, and
restitution, if any.]” In subdivision (d) (Form for Sentencing), the list of special
provisions is deleted and instead is replaced with the following: “[Include all
findings, sentencing enhancements, and mandatory minimum provisions, as
authorized by law and pronounced at sentencing.]” A number of changes are made
to subdivision (e) (Form for Order of Probation). First, the checklist of conditions
of probation and special conditions is deleted, and is replaced with “GENERAL
CONDITIONS: [List the general conditions of probation pursuant to section
-7-
948.03, Florida Statutes.]” and “SPECIAL CONDITIONS: [List the special
conditions of probation as orally pronounced and authorized by law.]” In addition,
below the space for “Other,” the paragraph pertaining to rescinding or modifying
any of the conditions of probation is modified. Also, we delete the sentence “(This
paragraph applies only if section 1 or section 2 is checked.)” under subdivision (e).
Last, in subdivision (g) (Form for Restitution Order), the checklist of restitution
options is deleted and replaced by the text “[Include all restitution and findings, as
authorized by law and pronounced at sentencing.].”
Finally, we adopt a new form, rule 3.9876 (Motion for Correction of
Sentence), which was suggested to the Committee by the Florida Supreme Court
Criminal Court Steering Committee. The new form pertains to rule 3.800(a)
motions, including those for correction of an illegal sentence, an incorrect
sentencing scoresheet, or an erroneous sexual predator designation. The form is
written in a “question-and-answer format,” similar to the format previously
approved by the Court for rule 3.9875 (Motion for Jail Credit). See In re
Amendments to Fla. Rules of Crim. Pro., 185 So. 3d 1169 (Fla. 2015).
CONCLUSION
Accordingly, we amend the Florida Rules of Criminal Procedure as reflected
in the appendix to this opinion. New language is indicated by underscoring, and
deletions are indicated by struck-through type. The committee notes are offered
-8-
for explanation only and are not adopted as an official part of the rules. The
amendments shall become effective January 1, 2019, at 12:01 a.m.
It is so ordered.
CANADY, C.J., and PARIENTE, LEWIS, QUINCE, POLSTON, LABARGA,
and LAWSON, JJ., concur.
THE FILING OF A MOTION FOR REHEARING SHALL NOT ALTER THE
EFFECTIVE DATE OF THESE AMENDMENTS.
Original Proceeding – Florida Rules of Criminal Procedure
Sheila Ann Loizos, Chair, Jacksonville, Florida, Judge Jon Berkley Morgan, Past
Chair, Criminal Procedure Rules Committee, Kissimmee, Florida, Joshua E.
Doyle, Executive Director, and Heather Savage Telfer, Staff Liaison, The Florida
Bar, Tallahassee, Florida,
for Petitioner
Blaise Trettis, Public Defender, Eighteenth Judicial Circuit, Viera, Florida, Carlos
J. Martinez, Public Defender, and John Eddy Morrison, Assistant Public Defender,
Eleventh Judicial Circuit, Miami Florida,
Responding with Comments
-9-
APPENDIX
RULE 3.010. SCOPE
These rules shall govern the procedure in all criminal proceedings in state
courts including proceedings involving direct and indirect criminal contempt,
proceedings under rule 3.850, and vehicular and pedestriancriminal traffic offenses
insofar as providedthese rules are made applicable by section III, the Florida Rules
of Practice and Procedure for Traffic Courts. These rules shall not apply to direct
or indirect criminal contempt of a court acting in any appellate capacity. These
rules shall not apply to rules 3.811 and 3.812. These rules shall be known as the
Florida Rules of Criminal Procedure and may be cited as Fla. R. Crim. P.
Committee Notes
[No Changes]
RULE 3.025. STATE AND PROSECUTING ATTORNEY DEFINED
Whenever the terms “state,” “state attorney,” “prosecutor,” “prosecution,”
“prosecuting officer,” or “prosecuting attorney” are used in these rules, they shall
be construed to mean the prosecuting authority representing the sState of Florida.
Committee Notes
[No Changes]
RULE 3.030. SERVICE AND FILING OF PLEADINGS, PAPERS, AND
DOCUMENTS
(a) Service. Every pleading subsequent to the initial indictment or
information on which a defendant is to be tried unless the court otherwise orders,
and every order not entered in open court, every written motion unless it is one
about which a hearing ex parte is authorized, and every written notice, demand,
and similar document shall be served on each party in conformity with Florida
Rule of Judicial Administration 2.516.; however, n Nothing herein shall be
construed to require that a plea of not guilty shall be in writing.
- 10 -
(b) Filing. All documents that are “court records” as defined in the
Florida Rules of Judicial Administration must be filed with the clerk in
accordanceFilings of all pleadings and documents shall comply with Florida Rules
of Judicial Administration 2.5202.505, 2.515, and 2.525.
(c) [No Changes]
Committee Notes
[No Changes]
RULE 3.130. FIRST APPEARANCE
(a) Prompt First Appearance. Except when previously released in a
lawful manner, every arrested person shall be taken before a judicial officerjudge,
either in person or by electronic audiovisual device in the discretion of the court,
within 24 hours of arrest. In the case of a child in the custody of juvenile
authorities, against whom an information or indictment has been filed, the child
shall be taken for a first appearance hearing within 24 hours of the filing of the
information or indictment. The chief judge of the circuit for each county within the
circuit shall designate 1 or more judicial officersjudges from the circuit court, or
county court, to be available for the first appearance and proceedings. The state
attorney or an assistant state attorney and public defender or an assistant public
defender shall attend the first appearance proceeding either in person or by other
electronic means. First appearance hearings shall be held with adequate notice to
the public defender and state attorney. An official record of the proceedings shall
be maintained. If the defendant has retained counsel or expresses a desire to and is
financially able, the attendance of the public defender or assistant public defender
is not required at the first appearance, and the judge shall follow the procedure
outlined in subdivision (c)(2).
(b) Advice to Defendant.
(1) Notice of Charges and Rights. At the defendant’s first
appearance the judge shall immediately inform the defendant of the charge,
including an alleged violation of probation or community control, and provide the
defendant with a copy of the complaint. The judge shall also adequately advise the
defendant that:
- 11 -
(1A) the defendant is not required to say anything, and that
anything the defendant says may be used against him or her;
(2B) if unrepresented, that the defendant has a right to counsel,
and, if financially unable to afford counsel, that counsel will be appointed; and
(3C) the defendant has a right to communicate with counsel,
family, or friends, and if necessary, will be provided reasonable means to do so.
(2) Use of Video Recording to Provide Notice of Rights. If the
defendant was advised of the rights listed in subdivisions (b)(1)(A)–(b)(1)(C) by
pre-recorded video, the judge shall confirm separately with each individual
defendant that such defendant had an opportunity to view and understands the
rights explained in the video recording.
(c) [No Change]
(d) Pretrial Release. The judicial officerjudge shall proceed to determine
conditions of release pursuant to rule 3.131. For a defendant who has been arrested
for violation of his or her probation or community control by committing a new
violation of law, the judicial officerjudge:
(1) Mmay order the offender to be taken before the court that
granted the probation or community control if the offender admits the violation; or
(2) Iif the offender does not admit the violation at first appearance
hearing, the judicial officerjudge may commit and order the offender to be brought
before the court that granted probation or community control, or may release the
offender with or without bail to await further hearing, notwithstanding section
907.041, Florida Statutes, relating to pretrial detention and release. In determining
whether to require or set the amount of bail, the judicial officerjudge may consider
whether the offender is more likely than not to receive a prison sanction for the
violation.
Committee Notes
[No Changes]
- 12 -
RULE 3.131. PRETRIAL RELEASE
(a) Right to Pretrial Release. Unless charged with a capital offense or an
offense punishable by life imprisonment and the proof of guilt is evident or the
presumption is great, every person charged with a crime or violation of municipal
or county ordinance shall be entitled to pretrial release on reasonable conditions.
As a condition of pretrial release, whether such release is by surety bail bond or
recognizance bond or in some other form, the defendant shall refrain from any
contact of any type with the victim, except through pretrial discovery pursuant to
the Florida Rules of Criminal Procedure and shall comply with all conditions of
pretrial release as ordered by the court. Upon motion by the defendant when bail is
set, or upon later motion properly noticed pursuant to law, the court may modify
the condition precluding victim contact if good cause is shown and the interests of
justice so require. The victim shall be permitted to be heard at any proceeding in
which such modification is considered, and the state attorney shall notify the
victim of the provisions of this subsectionsubdivision and of the pendency of any
such proceeding. If no conditions of release can reasonably protect the community
from risk of physical harm to persons, assure the presence of the accused at trial, or
assure the integrity of the judicial process, the accused may be detained.
(b)-(g) [No Changes]
(h) Bail after Recommitment. If the defendant applies to be admitted to
bail after recommitment, the court that recommitted the defendant shall determine
conditions of release, if any, subject to the limitations of subdivision (b) above.
(i)-(j) [No Changes]
(k) Summons on Misdemeanor Charge. When a complaint is filed
charging the commission of a misdemeanor only and the judge deems that process
should issue as a result, or when an indictment or information on which the
defendant is to be tried charging the commission of a misdemeanor only, and the
person named in it is not in custody or at large on bail for the offense charged, the
judge shall direct the clerk to issue a summons instead of a capias unless the judge
has reasonable ground to believe that the person will not appear in response to a
summons, in which event an arrest warrant or a capias shall be issued with the
amount of bail endorsed on it. The summons shall state substantially the nature of
the offense, the title of the hearing to be conducted, and shall command the person
against whom the complaint was made to appear before the judge issuing the
- 13 -
summons or the judge having jurisdiction of the offense at a time and place stated
in it.
(l) [No Changes]
Committee Notes
[No Changes]
Court Comment
[No Changes]
RULE 3.180. PRESENCE OF DEFENDANT
(a) Presence of Defendant. In all prosecutions for crime the defendant
shall be present:
(1)-(3) [No Changes]
(4) at the beginning of the trial during the examination,
challenging, impanelling, and swearing of the jury;
(5)-(9) [No Changes]
(b) Presence; dDefinition. Except as permitted by rule 3.130 relating to
first appearance hearings, Aa defendant is present for purposes of this rule if the
defendant is physically in attendance for the courtroom proceeding, and has a
meaningful opportunity to be heard through counsel on the issues being discussed.
(c)-(e) [No Changes]
Committee Notes
[No Changes]
- 14 -
RULE 3.190. PRETRIAL MOTIONS
(a)-(b) [No Changes]
(c) Time for Moving to Dismiss. Unless the court grants further time,
the defendant shall move to dismiss the indictment or information either before or
at arraignment. The court in its discretion may permit the defendant to plead and
thereafter to file a motion to dismiss at a time to be set by the court. Except for
objections based on fundamental grounds, every ground for a motion to dismiss
that is not presented by a motion to dismiss within the time hereinabove provided
herein, shall be considered waived. However, the court may at any time entertain a
motion to dismiss on any of the following grounds:
(1)-(4) [No Changes]
(d) [No Changes]
(e) Effect of Sustaining a Motion to Dismiss. If the motion to dismiss is
sustained, the court may order that the defendant be held in custody or admitted to
bail for a reasonable specified time pending the filing of a new indictment or
information. If a new indictment or information is not filed within the time
specified in the order, or within such additional time as the court may allow for
good cause shown, the defendant, if in custody, shall be discharged therefrom,
unless some other charge justifies a continuation in custody. If the defendant has
been released on bail, the defendant and the sureties shall be exonerated; if money
or bonds have been deposited as bail, the money or bonds shall be refunded.
(f)-(j) [No Changes]
Committee Notes
[No Changes]
RULE 3.191. SPEEDY TRIAL
(a)-(c) [No Changes]
(d) Custody. For purposes of this rule, a person is taken into custody:
- 15 -
(1) when the person is arrested as a result of the conduct or
criminal episode that gave rise to the crime charged,; or
(2) when the person is served with a notice to appear in lieu of
physical arrest.
(e)-(i) [No Changes]
(j) Delay and Continuances; Effect on Motion. If trial of the accused
does not commence within the periods of time established by this rule, a pending
motion for discharge shall be granted by the court unless it is shown that:
(1)-(4) [No Changes]
If the court finds that discharge is not appropriate for reasons under subdivisions
(j)(2), (j)(3), or (j)(4), the pending motion for discharge shall be denied, provided,
however, that trial shall be scheduled and commence within 90 days of a written or
recorded order of denial.
(k) [No Changes]
(l ) Exceptional Circumstances. As permitted by subdivision (i) of this
rule, the court may order an extension of the time periods provided under this rule
when exceptional circumstances are shown to exist. Exceptional circumstances
shall not include general congestion of the court’s docket, lack of diligent
preparation, failure to obtain available witnesses, or other avoidable or foreseeable
delays. Exceptional circumstances are those that, as a matter of substantial justice
to the accused or the state or both, require an order by the court. These
circumstances include:
(1)-(4) [No Changes]
(5) a showing that a delay is necessary to accommodate a
codefendant, when there is reason not to sever the cases to proceed promptly with
trial of the defendant; andor
(6) [No Changes]
(m)-(p) [No Changes]
- 16 -
Committee Notes
1972 Amendment-1992 Amendment [No Changes]
2018 Amendment. In light of the ruling in Smart v. State, 179 So. 3d 477 (Fla. 4th
DCA 2015), as well as the precedent cited therein, the committee notes that the
reference to the swearing in of trial jury panel for voir dire examination contained
in the Florida Rule of Criminal Procedure 3.191(c) relates to the giving of the oath
contained in Florida Rule of Criminal Procedure 3.300(a). The oath is not required
to be given in any particular location or by any particular official.
RULE 3.203. DEFENDANT’S INTELLECTUAL DISABILITY AS A
BAR TO IMPOSITION OF THE DEATH PENALTY
(a) [No Changes]
(b) Definition of Intellectual Disability. As used in this rule, the term
“intellectual disability” means significantly subaverage general intellectual
functioning existing concurrently with deficits in adaptive behavior and manifested
during the period from conception to age 18. The term “significantly subaverage
general intellectual functioning,” for the purpose of this rule, means performance
that is two2 or more standard deviations from the mean score on a standardized
intelligence test authorized by the Department of Children and Family
ServicesFamilies in rule 65G-4.011 of the Florida Administrative Code. The term
“adaptive behavior,” for the purpose of this rule, means the effectiveness or degree
with which an individual meets the standards of personal independence and social
responsibility expected of his or her age, cultural group, and community.
(c) Motion for Determination of Intellectual Disability as a Bar to
Execution:; Contents; Procedures.
(1) [No Changes]
(2) The motion shall state that the defendant is intellectually
disabled and, if the defendant has been tested, evaluated, or examined by one1 or
more experts, the names and addresses of the experts. Copies of reports containing
the opinions of any experts named in the motion shall be attached to the motion.
The court shall appoint an expert chosen by the state attorney if the state attorney
- 17 -
so requests. The expert shall promptly test, evaluate, or examine the defendant and
shall submit a written report of any findings to the parties and the court.
(3) If the defendant has not been tested, evaluated, or examined by
one1 or more experts, the motion shall state that fact and the court shall appoint
two2 experts who shall promptly test, evaluate, or examine the defendant and shall
submit a written report of any findings to the parties and the court.
(4)-(5) [No Changes]
(d)-(i) [No Changes]
RULE 3.213. CONTINUING INCOMPETENCY TO PROCEED,
EXCEPT INCOMPETENCY TO PROCEED WITH
SENTENCING:; DISPOSITION
(a) Dismissal without Prejudice during Continuing Incompetency.
After a determination that a person is incompetent to stand trial or
proceed with a probation or community control violation hearing, the charge(s):
(1) If at any time after 5 years following a determination that a
person is incompetent to stand trial or proceed with a probation or community
control violation hearing when charged with a felony, or 1 year when charged with
a misdemeanor, the court, after hearing, determines that the defendant remains
incompetent to stand trial or proceed with a probation or community control
violation hearing, that there is no substantial probability that the defendant will
become mentally competent to stand trial or proceed with a probation or
community control violation hearing in the foreseeable future, and that the
defendant does not meet the criteria for commitment, it shall dismiss the charges
against the defendant without prejudice to the state to refile the charges should the
defendant be declared competent to proceed in the future. shall be dismissed 1 year
after a finding if the charge is a misdemeanor;
(2) If the incompetency to stand trial or to proceed is due to
intellectual disability or autism, the court shall dismiss the charges within a
reasonable time after such determination, not to exceed 2 years for felony charges
and 1 year for misdemeanor charges, unless the court specifies in its order the
- 18 -
reasons for believing that the defendant will become competent within the
foreseeable future and specifies the time within which the defendant is expected to
become competent. The dismissal shall be without prejudice to the state to refile
should the defendant be declared competent to proceed in the future. shall be
dismissed no later than 2 years after a finding if incompetency is due to intellectual
disability or autism;
(3) may be dismissed 3 years after a finding, unless a charge is
listed in section 916.145, Florida Statutes; or
(4) shall be dismissed after a finding that the defendant has remained
incompetent for 5 continuous and uninterrupted years;
provided that the court finds that the defendant remains incompetent to stand trial
or proceed with a probation or community control violation hearing unless the
court in its order specifies its reasons for believing that the defendant is expected to
become competent to proceed. A dismissal under this rule shall be without
prejudice to the state to refile the charge(s) should the defendant be declared
competent to proceed in the future.
(b) Commitment or Treatment during Continuing Incompetency.
(1) If at any time after 5 years following a determination that a
person is incompetent to stand trial or proceed with a probation or community
control violation hearing when charged with a felony, or 1 year when charged with
a misdemeanor, the court, after hearing, determines that the defendant remains
incompetent to stand trial or proceed with a probation or community control
violation hearing, that there is no substantial probability that the defendant will
become mentally competent to stand trial or proceed with a probation or
community control violation hearing in the foreseeable future, and that the
defendant does meet the criteria for commitment, the court shall dismiss the
charges against the defendant and commit the defendant to the Department of
Children and Family Services for involuntary hospitalization or residential services
solely under the provisions of law or may order that the defendant receive
outpatient treatment at any other facility or service on an outpatient basis subject to
the provisions of those statutes. In the order of commitment, the judge shall order
that the administrator of the facility notify the state attorney of the committing
circuit no less than 30 days prior to the anticipated date of release of the defendant.
If charges are dismissed pursuant to this subdivision, the dismissal shall be without
prejudice to the state to refile the charges should the defendant be declared
- 19 -
competent to proceed in the future. If the defendant meets the criteria for
commitment under section 394.467, Florida Statutes, the court shall commit the
defendant to the Department of Children and Families for involuntary
hospitalization solely under the provisions of law. If the defendant meets the
criteria of section 394.4655, Florida Statutes, the court may order that the
defendant receive outpatient treatment at any other facility or service on an
outpatient basis subject to the provisions of those statutes. In the order of
commitment, the judge shall order that the administrator of an inpatient facility
notify the state attorney of the committing circuit no less than 30 days prior to the
anticipated date of release of the defendant.
(2) [No Changes]
(c) [No Changes]
Committee Notes
[No Changes]
RULE 3.217. JUDGMENT OF NOT GUILTY BY REASON OF
INSANITY:; DISPOSITION OF DEFENDANT
(a) [No Changes]
(b) Treatment, Commitment, or Discharge after Acquittal. When a
person is found not guilty of the offense or is found not to be in violation of
probation or community control by reason of insanity, if the court then determines
that the defendant presently meets the criteria set forth by law, the court shall
commit the defendant to the Department of Children and Family ServicesFamilies
or shall order outpatient treatment at any other appropriate facility or service, or
shall discharge the defendant. Any order committing the defendant or requiring
outpatient treatment or other outpatient service shall contain:
(1)-(3) [No Changes]
Committee Notes
- 20 -
[No Changes]
RULE 3.218. COMMITMENT OF A DEFENDANT FOUND NOT
GUILTY BY REASON OF INSANITY
(a) Commitment; 6-Month Report. The Department of Children and
Family ServicesFamilies shall admit to an appropriate facility a defendant found
not guilty by reason of insanity under rule 3.217 and found to meet the criteria for
commitment for hospitalization and treatment and may retain and treat the
defendant. No later than 6 months from the date of admission, the administrator of
the facility shall file with the court a report, and provide copies to all parties, which
shall address the issues of further commitment of the defendant. If at any time
during the 6-month period, or during any period of extended hospitalization that
may be ordered under this rule, the administrator of the facility shall determine that
the defendant no longer meets the criteria for commitment, the administrator shall
notify the court by such a report and provide copies to all parties. The procedure
for determinations of the confidential status of reports is governed by Rule of
Judicial Administration 2.420.
(b)-(c) [No Changes]
Committee Notes
[No Changes]
RULE 3.219. CONDITIONAL RELEASE
(a) [No Changes]
(b) Defendant’s Failure to Comply. If it appears at any time that the
defendant has failed to comply with the conditions of release, or that the
defendant’s condition has deteriorated to the point that inpatient care is required, or
that the release conditions should be modified, the court, after hearing, may modify
the release conditions or, if the court finds the defendant meets the statutory
- 21 -
criteria for commitment, may order that the defendant be recommitted to the
Department of Children and Family ServicesFamilies for further treatment.
(c) [No Changes]
Committee Notes
[No Changes]
RULE 3.220. DISCOVERY
(a)-(c) [No Changes]
(d) Defendant’s Obligation.
(1) If a defendant elects to participate in discovery, either through
filing the appropriate notice or by participating in any discovery process, including
the taking of a discovery deposition, the following disclosures shall be made:
(A) Within 15 days after receipt by the defendant of the
Discovery Exhibit furnished by the prosecutor pursuant to subdivision (b)(1)(A) of
this rule, the defendant shall furnish to the prosecutor a written list of the names
and addresses of all witnesses whom the defendant expects to call as witnesses at
the trial or hearing. When the prosecutor subpoenas a witness whose name has
been furnished by the defendant, except for trial subpoenas, the rules applicable to
the taking of depositions shall apply.
(B) Within 15 days after receipt of the prosecutor’s
Discovery Exhibit the defendant shall serve a written Discovery Exhibit which
shall disclose to and permit the prosecutor to inspect, copy, test, and photograph
the following information and material that is in the defendant’s possession or
control:
(i) the statement of any person listed in subdivision
(d)(1)(A), other than that of the defendant;
- 22 -
(ii) reports or statements of experts, that the defendant
intends to use as a witness at a trial or hearing, made in connection with the
particular case, including results of physical or mental examinations and of
scientific tests, experiments, or comparisons; and
(iii) any tangible papers or objects that the defendant intends to use in the
hearing or trial.
(2)-(3) [No Changes]
(e)-(g) [No Changes]
(h) Discovery Depositions.
(1)-(4) [No Changes]
(5) Depositions of Law Enforcement Officers. Subject to the
general provisions of subdivision (h)(1), law enforcement officers shall appear for
deposition, without subpoena, upon written notice of taking deposition delivered at
the physical address of the law enforcement agency or department, or an e-mail or
other address designated by the law enforcement agency or department, five5 days
prior to the date of the deposition. Law enforcement officers who fail to appear for
deposition after being served notice as required by the rule may be adjudged in
contempt of court.
(6) [No Changes]
(7) Defendant’s Physical Presence. A defendant shall not be
physically present at a deposition except on stipulation of the parties or as provided
by this rule. The court may order the physical presence of the defendant on a
showing of good cause. The court may consider:
(A) the need for the physical presence of the defendant to
obtain effective discovery,;
(B) the intimidating effect of the defendant’s presence on the
witness, if any,;
(C) any cost or inconvenience which may result,; and
- 23 -
(D) any alternative electronic or audio/visual means
available.
(8) [No Changes]
(i) Investigations Not to Be Impeded. Except as is otherwise provided
as to matters not subject to disclosure or restricted by protective orders, neither the
counsel for the parties nor other prosecution or defense personnel shall advise
persons having relevant material or information, (except the defendant), to refrain
from discussing the case with opposing counsel or showing opposing counsel any
relevant material, nor shall they otherwise impede opposing counsel’s investigation
of the case.
(j) Continuing Duty to Disclose. If, subsequent to compliance with the
rules, a party discovers additional witnesses or material that the party would have
been under a duty to disclose or produce at the time of the previous compliance,
the party shall promptly disclose or produce the witnesses or material in the same
manner as required under these rules for initial discovery. This duty includes any
additional recorded or unrecorded statements of any person disclosed under
subdivisions (b)(1)(A) or (d)(1)(A) of this rule that materially alter a written or
recorded statement previously provided under these rules.
(k) [No Changes]
(l ) Protective Orders.
(1) [No Changes]
(2) Motion to Terminate or Limit Examination. At any time
during the taking of a deposition, on motion of a party or of the deponent, and
upon a showing that the examination is being conducted in bad faith or in such
manner as to unreasonably annoy, embarrass, or oppress the deponent or party, the
court in which the action is pending or the circuit court where the deposition is
being taken may:
(1A) terminate the deposition,;
(2B) limit the scope and manner of the taking of the
deposition,;
- 24 -
(3C) limit the time of the deposition,;
(4D) continue the deposition to a later time,;
(5E) order the deposition to be taken in open court,; and, in
addition, may
(6F) impose any sanction authorized by this rule.
If the order terminates the deposition, it shall be resumed thereafter only
upon the order of the court in which the action is pending. Upon demand of any
party or deponent, the taking of the deposition shall be suspended for the time
necessary to make a motion for an order.
(m) [No Changes]
(n) Sanctions.
(1)-(2) [No Changes]
(3) Every request for discovery or response or objection, including
a notice of deposition made by a party represented by an attorney, shall be signed
by at least 1 attorney of record, as defined by Florida Rule of Judicial
Administration 2.505, in the attorney’s individual name, whose address shall be
stated. A party who is not represented by an attorney shall sign the request,
response, or objection and list his or her address. The signature of the attorney
constitutes a certification that the document complies with Florida Rule of Judicial
Administration 2.515. The signature of the attorney or party constitutes a
certification that the signer has read the request, response, or objection and that to
the best of the signer’s knowledge, information, or belief formed after a reasonable
inquiry it is:
(A)-(C) [No Changes]
If a request, response, or objection is not signed, it shall be stricken unless it
is signed promptly after the omission is called to the attention of the party making
the request, response, or objection, and a party shall not be obligated to take any
action with respect to it until it is signed.
- 25 -
If a certification is made in violation of this rule, the court, on motion or on
its own initiative, shall impose on the person who made the certification, the firm
or agency with which the person is affiliated, the party on whose behalf the
request, response, or objection is made, or any or all of the above an appropriate
sanction, which may include an order to pay the amount of the reasonable expenses
incurred because of the violation, including a reasonable attorney’s fee.
(o) [No Changes]
Committee Notes
1968 Adoption-1998 Amendment [No Changes]
2018 Amendment. The amendments to subdivision (j) are a clarification of
the rule based on Scipio v. State, 928 So. 2d 1138 (Fla. 2006), and Washington v.
State, 151 So. 3d 544 (Fla. 1st DCA 2014).
Court Commentary
[No Changes]
RULE 3.240. CHANGE OF VENUE
(a)-(e) [No Changes]
(f) Transmittal of Documents. The clerk shall enter on the
minutesdocket the order of removal and transmit to the court to which the cause is
removed a certified copy of the order of removal and of the record and proceedings
and of the undertakings of the witnesses and the accused.
(g) [No Changes]
(h) Multiple Defendants. If there are several defendants and an order is
made removing the cause on the application of one1 or more but not all of them,
the other defendants shall be tried and all proceedings had against them in the
county in which the cause is pending in all respects as if no order of removal had
been made as to any defendant.
- 26 -
(i) [No Changes]
(j) Prosecuting Attorney’s Obligation. The prosecuting attorney of the
court to which the cause is removed may amend the information, or file a new
information,. andAny such new information shall be entitled in the county into
which the trial is hadthe cause is removed, but the allegations as to the place of
commission of the crime shall refer to the county in which the crime was actually
committed.
Committee Notes
[No Changes]
RULE 3.330. DETERMINATION OF CHALLENGE FOR CAUSE
The court shall determine the validity of a challenge of an individual juror
for cause. In making such determination the juror challenged and any other
material witnesses, produced by the parties, may be examined onunder oath by
either party. The court may consider also any other evidence material to such
challenge.
Committee Notes
[No Changes]
RULE 3.470. PROCEEDINGS ON SEALED VERDICT
The court may, with the consent of the prosecuting attorney and the
defendant, direct the jurors that if they should agree upon a verdict during a
temporary adjournment of the court, the foreperson and each juror shall sign the
same, and the verdict shall be sealed in an envelope and delivered to the officer
having charge of the jury, after which the jury may separate until the next
convening of the court reconvenes. When the court authorizes the rendition of a
sealed verdict, it shall admonish the jurors not to make any disclosure, of any kind,
concerning it or to speak with other persons concerning the causecase, until their
verdict shall have been rendered in open court. The officer shall, forthwith, deliver
- 27 -
the sealed verdict to the clerk. When the jurors have reassembled in open court, the
envelope shall be opened by the court or clerk, and the same proceedings shall be
had as in the receiving of othermust be received in the same manner as unsealed
verdicts.
Committee Notes
[No Changes]
RULE 3.590. TIME FOR AND METHOD OF MAKING MOTIONS;
PROCEDURE; CUSTODY PENDING HEARING
(a) Time for Filing in Noncapital Cases. In cases in which the state does
not seek the death penalty, a motion for new trial or a motion in arrest of judgment,
or both, may be made, either orally in open court or in writing and filed with the
clerk’s office, within 10 days after the rendition of the verdict or the finding of the
court. A timely motion may be amended to state new grounds without leave of
court prior to expiration of the 10-day period and in the discretion of the court at
any other time before the motion is determined.
(b) Time for Filing in Capital Cases Where the Death Penalty Is an
Issue. A motion for new trial or a motion in arrest of judgment, or both, or for a
new penalty phase hearing may be made within 10 days after written final
judgment of conviction and sentence of life imprisonment or death is filed. The
motion may address grounds which arose in the guilt phase and the penalty phase
of the trial. Separate motions for the guilt phase and the penalty phase may be
filed. The motion or motions may be amended without leave of court prior to the
expiration of the 10-day period, and in the discretion of the court, at any other time
before the motion is determined.
(c) [No Changes]
(d) Written Motions. The motion may be in writing, filed with the clerk;
it shall state the grounds on which it is based. A copy of a written motion shall be
served on the prosecuting attorney. When the court sets a time for the hearing
thereon, the clerk may notify counsel for the respective parties or the attorney for
the defendant may serve notice of hearing on the prosecuting officerattorney.
- 28 -
(e) Custody Pending Motion. Until the motion is disposed of, aA
defendant who is not already at liberty on bail shall remain in custody and not be
allowed liberty on bail unless the court, on good cause shown (if the offense for
which the defendant is convicted is bailable), permits the defendant to be released
on bail until the motion is disposed ofthe court disposes of the motion. If the
defendant is already at liberty on bail that is deemed by the court to be good and
sufficient, itthe court may permit the defendant to continue at large on such bail
until the motion for new trial is heard and disposed ofthe court disposes of the
motion.
Committee Notes
[No Changes]
RULE 3.600. GROUNDS FOR NEW TRIAL
(a) Grounds for Granting. The court shall grant a new trial only if any
of the following grounds is established.:
(1) Tthe jurors decided the verdict by lot.;
(2) Tthe verdict is contrary to law or the weight of the evidence.; or
(3) Nnew and material evidence, which, if introduced at the trial
would probably have changed the verdict or finding of the court, and which the
defendant could not with reasonable diligence have discovered and produced at the
trial, has been discovered.
(b) Grounds for Granting if Prejudice is Established. The court shall
grant a new trial if any of the following grounds is established, providing
substantial rights of the defendant were prejudiced thereby.because:
(1) Tthe defendant was not present at any proceeding at which the
defendant’s presence is required by these rules.;
(2) Tthe jury received any evidence out of court, other than that
resulting from an authorized view of the premises.;
- 29 -
(3) Tthe jurors, after retiring to deliberate upon the verdict,
separated without leave of court.;
(4) Aany juror was guilty of misconduct.;
(5) Tthe prosecuting attorney was guilty of misconduct.;
(6) Tthe court erred in the decision of any matter of law arising
during the course of the trial.;
(7) Tthe court erroneously instructed the jury on a matter of law or
refused to give a proper instruction requested by the defendant.; or
(8) Ffor any other cause not due to the defendant’s own fault, the
defendant did not receive a fair and impartial trial.
(c) [No Changes]
Committee Notes
[No Changes]
RULE 3.610. MOTION FOR ARREST OF JUDGMENT; GROUNDS
The court shall grant a motion in arrest of judgment only on 1 or more of the
following groundsif:
(a) Tthe indictment or information on which the defendant was tried is so
defective that it will not support a judgment of conviction.;
(b) Tthe court is without jurisdiction of the cause.;
(c) Tthe verdict is so uncertain that it does not appear therefrom that the
jurors intended to convict the defendant of an offense offor which the defendant
could be convicted under the indictment or information under which the defendant
was tried.; or
- 30 -
(d) Tthe defendant was convicted of an offense for which the defendant
could not be convicted under the indictment or information under which the
defendant was tried.
Committee Notes
[No Changes]
RULE 3.691. POST-TRIAL RELEASE
(a) When Authorized. All personsA defendant who havehas been
adjudicated guilty of the commission of any non-capital offense or for which bail is
prohibited under section 903.133, Florida Statutes, not capital, may be released,
pending review of the conviction, at the discretion of either the trial or appellate
court, applying the principles enunciated in Younghans v. StateYounghans v. State,
90 So. 2d 308 (Fla. 1956), provided that no person. No defendant may be admitted
to bail on appeal from a conviction of a felony unless the defendant establishes that
the appeal is taken in good faith, on grounds fairly debatable, and not frivolous.
However, in no case shall bail be granted if such personthe defendant has
previously been convicted of a felony, the commission of which occurred prior to
the commission of the subsequent felony, and the person’sdefendant’s civil rights
have not been restored or if other felony charges are pending against the
persondefendant and probable cause has been found that the persondefendant has
committed the felony or felonies at the time the request for bail is made.
(b) [No Change]
(c) Review of Denial. An order by a trial court denying bail to a
persondefendant pursuant to the provisions of subdivision (a) may be reviewed by
motion to the appellate court and the motion shall be advanced on the calendar of
the appellate court for expeditious review.
(d) Conditions of Release. If the defendant is released after conviction
and onpending appeal, the conditions shall be:
(1) the defendant will duly prosecute the appeal; and
- 31 -
(2) the defendant will surrender himself or herself in execution of
the judgment or sentence on its being affirmed or modified or on the appeal being
dismissed; or in case the judgment is reversed and the cause remanded for a new
trial, the defendant will appear in the court to which the cause may be remanded
for a new trial, that the defendant will appear in the court to which the cause may
be remanded and submit to the orders and process thereof and will not depart the
jurisdiction of the court without leave.
(e) Approval of Bond. The court shall approve the sufficiency and
adequacy of the bond, its security, and sureties, prior to the release of the
defendant. However, in no case may an original appearance bond be continued for
an appeal.
Committee Notes
[No Changes]
RULE 3.692. PETITION TO SEAL OR EXPUNGE
(a) Requirements of Petition.
(1) All relief sought by reason of sections 943.0585–943.059,
Florida Statutes, shall be by written petition, filed with the clerk. The petition shall
state the grounds on which it is based and the official records to which it is
directed, and shall be supported by an affidavit of the party seeking relief, which
affidavit shall state with particularity the statutory grounds and the facts in support
of the motion. A petition seeking to seal or expunge nonjudicial criminal history
records must be accompanied by a certificate of eligibility issued to the petitioner
by the Florida Department of Law Enforcement. A copy of the completed petition
and affidavit shall be served on the prosecuting attorney and the arresting
authority. Notice and hearing shall be as provided in rule 3.590(c).
(2) All relief sought by reason of section 943.0583, Florida
Statutes, shall be by written petition, filed with the clerk. The petition shall state
the grounds on which it is based and the official records to which it is directed;
shall be supported by the petitioner’s sworn statement attesting that the petitioner
is eligible for such an expunction; and to the best of his or her knowledge or belief
that the petitioner does not have any other petition to expunge or any petition to
- 32 -
seal pending before any court; and shall be accompanied by official documentation
of the petitioner’s status as a victim of human trafficking, if any exists. A petition
to expunge, filed under section 943.0583, Florida Statutes, is not required to be
accompanied by a certificate of eligibility from the Florida Department of Law
Enforcement. A copy of the completed petition, sworn statement, and any other
official documentation of the petitioner’s status as a victim of human trafficking,
shall be served on the prosecuting attorney and the arresting authority. Notice and
hearing shall be as provided in rule 3.590(c).
(b) State’s Response; Evidence. The state may traverse or
demurprosecuting attorney and arresting agency may respond to the petition and
affidavit. The court may receive evidence on any issue of fact necessary to the
decision ofrule on the petition.
(c)-(d) [No Changes]
(e) Clerk’s Duties. In regard to the official records of the court, including
the court file of the cause, the clerk shall:
(1) [No Changes]
(2) seal the entries and records, or certified copies thereof, together
with the court file and retain the same in a nonpublic index, subject to further order
of the court (see Johnson v. State, 336 So. 2d 93 (Fla. 1976)); and
(3) [No Changes]
(f) Costs. All costs of certified copies involved herein shall be borne by
the movant, unless the movant is indigentPetitioner shall bear all costs of certified
copies unless petitioner is indigent.
Committee Notes
[No Changes]
RULE 3.704. THE CRIMINAL PUNISHMENT CODE
(a) [No Changes]
- 33 -
(b) Purpose and Construction. The purpose of the 1998 Criminal
Punishment Code, and the principles it embodies, are set out in subsection
921.002(1), Florida Statutes. Existing case law construing the application of
sentencing guidelines will continue as precedent unless in conflict with the
provisions of this rule or the 1998 Criminal Punishment Code.
(c) Offense Severity Ranking.
(1) [No Changes]
(2) Felony offenses not listed in section 921.0022 are assigned a
severity level in accordance with section 921.0023, Florida Statutes, as follows:
(A) Aa felony of the third degree within offense level 1.;
(B) Aa felony of the second degree within offense level 4.;
(C) Aa felony of the first degree within offense level 7.;
(D) Aa felony of the first degree punishable by life within
offense level 9.; or
(E) Aa life felony within offense level 10.
An offense does not become unlisted and subject to the provisions of section
921.0023 because of a reclassification of the degree of felony under section
775.0845, section 775.087, section 775.0875, or section 794.023, Florida Statutes,
or any other law that provides an enhanced penalty for a felony offense.
(d) General Rules and Definitions.
(1) One or more Criminal Punishment Code scoresheets must be
prepared for each offender covering all offenses pending before the court for
sentencing, including offenses for which the offender may qualify as an habitual
felony offender, an habitual violent felony offender, a violent career criminal, or a
prison releasee reoffender. The office of the stateprosecuting attorney must prepare
the scoresheets and present them to defense counsel for review as to accuracy. If
sentences are imposed under section 775.084, or section 775.082(9), Florida
Statutes, and the Criminal Punishment Code, a scoresheet listing only those
- 34 -
offenses sentenced under the Criminal Punishment Code must be filed in addition
to any sentencing documents filed under section 775.084 or section 775.082(9).
(2) [No Changes]
(3) If an offender is before the court for sentencing for more than
one felony and the felonies were committed under more than one1 version or
revision of the guidelines or Criminal Punishment Code, separate scoresheets must
be prepared and used at sentencing. The sentencing court may impose such
sentence concurrently or consecutively.
(4)-(6) [No Changes]
(7) “Primary offense” means the offense at conviction pending
before the court for sentencing for which the total sentence points recommend a
sanction that is as severe as, or more severe than, the sanction recommended for
any other offense committed by the offender and pending before the court at
sentencing. Only one1 count of one offense before the court for sentencing shall be
classified as the primary offense.
(8) [No Changes]
(9) “Victim injury” is scored for physical injury or death suffered
by a person as a direct result of any offense pending before the court for
sentencing. Except as otherwise provided by law, the sexual penetration and sexual
contact points will be scored as follows. Sexual penetration points are scored if an
offense pending before the court for sentencing involves sexual penetration. Sexual
contact points are scored if an offense pending before the court for sentencing
involves sexual contact, but no penetration. If the victim of an offense involving
sexual penetration or sexual contact without penetration suffers any physical injury
as a direct result of an offense pending before the court for sentencing, that
physical injury must be scored in addition to any points scored for the sexual
contact or sexual penetration.
Victim injury must be scored for each victim physically injured and for each
offense resulting in physical injury whether there are one1 or more victims.
However, victim injury must not be scored for an offense for which the offender
has not been convicted.
- 35 -
Victim injury resulting from one1 or more capital offenses before the court
for sentencing must not be included upon any scoresheet prepared for non-capital
offenses also pending before the court for sentencing. This does not prohibit the
scoring of victim injury as a result of the non-capital offense or offenses before the
court for sentencing.
(10) Unless specifically provided otherwise by statute, attempts,
conspiracies, and solicitations must be indicated in the space provided on the
Criminal Punishment Code scoresheet and must be scored at one1 severity level
below the completed offense.
Attempts, solicitations, and conspiracies of third-degree felonies located in
offense severity levels 1 and 2 must be scored as misdemeanors. Attempts,
solicitations, and conspiracies of third-degree felonies located in offense severity
levels 3, 4, 5, 6, 7, 8, 9, and 10 must be scored as felonies one1 offense level
beneath the incomplete or inchoate offense.
(11) An increase in offense severity level may result from a
reclassification of felony degrees under sections 775.0845, 775.087, 775.0875, or
794.023, Florida Statutes. Any such increase must be indicated in the space
provided on the Criminal Punishment Code scoresheet.
(12) A single assessment of thirty30 prior serious felony points is
added if the offender has a primary offense or any additional offense ranked in
level 8, 9, or 10 and one1 or more prior serious felonies. A ‘prior serious felony’ is
an offense in the offender’s prior record ranked in level 8, 9, or 10 and for which
the offender is serving a sentence of confinement, supervision, or other sanction or
for which the offender’s date of release from confinement, supervision, or other
sanction, whichever is later, is within 3 years before the date the primary offense or
any additional offenses were committed. Out of state convictions wherein the
analogous or parallel Florida offenses are located in offense severity level 8, 9, or
10 must be considered prior serious felonies.
(13) If the offender has one1 or more prior capital felonies, points
must be added to the subtotal sentence points of the offender equal to twice the
number of points the offender receives for the primary offense and any additional
offense. Out-of-state convictions wherein the analogous or parallel Florida
offenses are capital offenses must be considered capital offenses for purposes of
operation of this section.
- 36 -
(14) [No Changes]
(15) “Legal status points” are assessed when an offender:
(A) Eescapes from incarceration;
(B) Fflees to avoid prosecution;
(C) Ffails to appear for a criminal proceeding;
(D) Vviolates any condition of a supersedeas bond;
(E) Iis incarcerated;
(F) Iis under any form of a pretrial intervention or diversion
program; or
(G) Iis under any form of court-imposed or post-prison
release community supervision and commits an offense that results in conviction.
Legal status violations receive a score of 4 sentence points and are scored when the
offense committed while under legal status is before the court for sentencing.
Points for a legal status violation must only be assessed once regardless of the
existence of more than one1 form of legal status at the time an offense is
committed or the number of offenses committed while under any form of legal
status.
(16) Community sanction violation points occur when the offender
is found to have violated a condition of:
(A) Pprobation;
(B) Ccommunity Ccontrol; or
(C) Ppretrial intervention or diversion.
Community sanction violation points are assessed when a community
sanction violation is before the court for sentencing. Six community sanction
violation points must be assessed for each violation or if the violation results from
a new felony conviction, 12 community sanction violation points must be assessed.
For violations occurring on or after March 12, 2007, if the community sanction
- 37 -
violation that is not based upon a failure to pay fines, costs, or restitution is
committed by a violent felony offender of special concern as defined in s.ection
948.06, Florida Statutes, twelve12 community sanction violation points must be
assessed or if the violation results from a new felony conviction, 24 community
sanction points must be assessed. Where there are multiple violations, points may
be assessed only for each successive violation that follows a continuation of
supervision, or modification or revocation of the community sanction before the
court for sentencing and are not to be assessed for violation of several conditions
of a single community sanction. Multiple counts of community sanction violations
before the sentencing court may not be the basis for multiplying the assessment of
community sanction violation points.
(17) Possession of a firearm, semiautomatic firearm, or a machine
gun during the commission or attempt to commit a crime will result in additional
sentence points. Eighteen sentence points are assessed if the offender is convicted
of committing, or attempting to commit, any felony other than those enumerated in
subsection 775.087(2), Florida Statutes, while having in his or her possession a
firearm as defined in subsection 790.001(6), Florida Statutes. Twenty-five sentence
points are assessed if the offender is convicted of committing or attempting to
commit any felony other than those enumerated in subsection 775.087(3), Florida
Statutes, while having in his or her possession a semiautomatic firearm as defined
in subsection 775.087(3), Florida Statutes, or a machine gun as defined in
subsection 790.001(9), Florida Statutes. Only one1 assessment of either 18 or 25
points can be made.
(18) “Subtotal sentence points” are the sum of the primary offense
points, the total additional offense points, the total victim injury points, the total
prior record points, any legal status points, community sanction points, prior
serious felony points, prior capital felony points, and points for possession of a
firearm or semiautomatic weapon.
(19) [No Changes]
(20) If the primary offense is a violation of the Law Enforcement
Protection Act under subsection 775.0823(2), (3), or (4), Florida Statutes, the
subtotal sentence points are multiplied by 2.5. If the primary offense is a violation
of subsection 775.0823(5), (6), (7), (8), or (9), Florida Statutes, the subtotal
sentence points are multiplied by 2.0. If the primary offense is a violation of
section 784.07(3) or 775.0875(1), Florida Statutes, or the Law Enforcement
- 38 -
Protection Act under subsection 775.0823(10) or (11), Florida Statutes, the subtotal
sentence points are multiplied by 1.5.
(21) If the primary offense is grand theft of the third degree of a
motor vehicle and the offender’s prior record includes three3 or more grand thefts
of the third degree of a motor vehicle, the subtotal sentence points are multiplied
by 1.5.
(22) [No Changes]
(23) If the primary offense is a crime of domestic violence as
defined in section 741.28, Florida Statutes, which was committed in the presence
of a child under 16 years of age who is a family household member as defined in
section 741.28(2), Florida Statutes, with the victim or perpetrator, the subtotal
sentence points are multiplied by 1.5.
(24) (A) Adult on minor sex offense. The subtotal sentence points
are multiplied by 2.0 if:
(i) the offender was 18 years of age or older and the
victim was younger than 18 years of age at the time the offender committed the
primary offense; and
(ii) the primary offense was committed on or after
October 1, 2014, and is a violation of:
a. section 787.01(2) (kidnapping) or 787.02(2)
(false imprisonment), Florida Statutes, if in the course of committing the
kidnapping or false imprisonment the defendant committed a sexual battery under
chapter 794, Florida Statutes, or a lewd act under section 800.04 or 847.0135(5),
Florida Statutes, against the victim;
b. section 787.01(3)(a)2. or (3)(a)3., Florida
Statutes, (kidnapping of a child under 13 with a sexual battery or lewd act);
c. section 787.02(3)(a)2. or (3)(a)3., Florida
Statutes, (false imprisonment of a child under 13 with a sexual battery or lewd act);
d. section 794.011, Florida Statutes, (sexual
battery), excluding section 794.011(10);
- 39 -
e. section 800.04, Florida Statutes, (lewd or
lascivious offenses); or
f. section 847.0135(5), Florida Statutes, (lewd
or lascivious exhibition using a computer).
(B) Notwithstanding subdivision (d)(24)(A), the court may
not apply the multiplier and must sentence the defendant to the statutory maximum
sentence if applying the multiplier results in the lowest permissible sentence
exceeding the statutory maximum sentence for the primary offense under chapter
775, Florida Statutes.
(25) “Total sentence points” are the subtotal sentence points or the
enhanced subtotal sentence points.
(256) The lowest permissible sentence is the minimum sentence that
may be imposed by the trial court, absent a valid reason for departure. The lowest
permissible sentence is any nonstate prison sanction in which the total sentence
points equals or is less than 44 points, unless the court determines within its
discretion that a prison sentence, which may be up to the statutory maximums for
the offenses committed, is appropriate. When the total sentence points exceeds 44
points, the lowest permissible sentence in prison months must be calculated by
subtracting 28 points from the total sentence points and decreasing the remaining
total by 25 percent. The total sentence points must be calculated only as a means of
determining the lowest permissible sentence. The permissible range for sentencing
must be the lowest permissible sentence up to and including the statutory
maximum, as defined in section 775.082, Florida Statutes, for the primary offense
and any additional offenses before the court for sentencing. The sentencing court
may impose such sentences concurrently or consecutively. However, any sentence
to state prison must exceed 1 year. If the lowest permissible sentence under the
Code exceeds the statutory maximum sentence as provided in section 775.082,
Florida Statutes, the sentence required by the Code must be imposed. If the total
sentence points are greater than or equal to 363, the court may sentence the
offender to life imprisonment. The sentence imposed must be entered on the
scoresheet.
(267) For those offenses having a mandatory minimum sentence, a
scoresheet must be completed and the lowest permissible sentence under the Code
calculated. If the lowest permissible sentence is less than the mandatory minimum
- 40 -
sentence, the mandatory minimum sentence takes precedence. If the lowest
permissible sentence exceeds the mandatory sentence, the requirements of the
Criminal Punishment Code and any mandatory minimum penalties apply.
Mandatory minimum sentences must be recorded on the scoresheet.
(278) Any downward departure from the lowest permissible sentence,
as calculated according to the total sentence points under section 921.0024, Florida
Statutes, is prohibited unless there are circumstances or factors that reasonably
justify the downward departure. Circumstances or factors that can be considered
include, but are not limited to, those listed in subsection 921.0026(2), Florida
Statutes.
(A) If a sentencing judge imposes a sentence that is below the
lowest permissible sentence, it is a departure sentence and must be accompanied by
a written statement by the sentencing court delineating the reasons for the
departure, filed within 7 days after the date of sentencing. A written transcription
of orally stated reasons for departure articulated at the time sentence was imposed
is sufficient if it is filed by the court within 7 days after the date of sentencing. The
sentencing judge may also list the written reasons for departure in the space
provided on the Criminal Punishment Code scoresheet.
(B) The written statement delineating the reasons for
departure must be made a part of the record. The written statement, if it is a
separate document, must accompany the scoresheet required to be provided to the
Department of Corrections under subsection 921.0024(6), Florida Statutes.
If a split sentence is imposed, the total sanction (incarceration and
community control or probation) must not exceed the term provided by general law
or the maximum sentence under the Criminal Punishment Code.
(289) If the lowest permissible sentence under the criminal
punishment code is a state prison sanction but the total sentencing points do not
exceed 48 points (or 54 points if six6 of those points are for a violation of
probation, community control, or other community supervision that does not
involve a new crime), the court may sentence the defendant to probation,
community control, or community supervision with mandatory participation in a
prison diversion program, as provided for in s.ection 921.00241, Florida Statutes,
if the defendant meets the requirements for that program as set forth in section
921.00241, Florida Statutes.
- 41 -
(2930) If the total sentence points equal 22 or less, the court
must sentence the offender to a nonstate prison sanction unless it makes written
findings that a nonstate prison sanction could present a danger to the public.
(301) Sentences imposed after revocation of probation or community
control must be imposed according to the sentencing law applicable at the time of
the commission of the original offense.
Committee Note
[No Changes]
RULE 3.710. PRESENTENCE REPORT
(a) Cases In Which Court Has Discretion. In all cases in which the
court has discretion as to what sentence may be imposed, the court may refer the
case to the Department of Corrections for investigation and recommendation. No
sentence or sentences other than probation or the statutorily required mandatory
minimum shallmay be imposed on any defendant found guilty of a first felony
offense or found guilty of a felony while under the age of 18 years, until after such
investigation has first been made and the recommendations of the Department of
Corrections received and considered by the sentencing judge. The requirements of
this subdivision are not applicable to a subsequent violation of probation
proceeding.
(b) [No Changes]
Committee Notes
1972 Adoption-2004 Amendment [No Changes]
2018 Amendment. The amendment modifies subdivision (a). The rule makes clear
that a report is not required prior to sentencing in violation of probation
proceedings following the ruling in Barber v. State, 293 So. 2d 710 (Fla. 1974).
- 42 -
RULE 3.770. PROCEDURE WHEN PREGNANCY IS ALLEGED AS
CAUSE FOR NOT PRONOUNCING DEATH SENTENCE
When pregnancy of a female defendant is alleged as the cause for not
pronouncing the death sentence, the court shall postpone the pronouncement of
sentence until after it has decided the truth of that allegation. If necessary in order
to arrive at such a decision, it shall immediately fix a time for a hearing to
determine whether the defendant is pregnant and shall appoint not exceeding 3
competent disinterested physicians to examine the defendant as to herthe
defendant’s alleged pregnancy and to testify at the hearing as to whether shethe
defendant is pregnant. Other evidence regarding whether the defendant is pregnant
may be introduced at the hearing by either party. If the court decides that the
defendant is not pregnant, it shall proceed to pronounce sentence. If it decides that
shethe defendant is pregnant, it shall commit herthe defendant to prison until it
appears that shethe defendant is not pregnant and shall then pronounce sentence
upon her.
Committee Notes
[No Changes]
RULE 3.810. COMMITMENT OF DEFENDANT; DUTY OF SHERIFF
On pronouncement of a sentence imposing a penalty other than a fine only
or death, the court shall, unless the execution of the sentence is suspended or
stayed, and, in such case, on termination of the suspension or stay,
forthwithimmediately commit the defendant to the custody of the sheriff. under a
commitment to which shall be attached a certified copy of the sentence and, unless
both are contained in the same instrument if the sentence is imprisonment in the
state prison, a certified copy of the judgment of conviction and a certified copy of
the indictment or information, and the sheriff shall thereupon, within a reasonable
time, if the sheriff is not the proper official to execute the sentence, transfer the
defendant, together with the commitment and attached certified copies, The
commitment documents must include certified copies of the sentence, the judgment
of conviction, and the indictment or information. If the sheriff is not the proper
official to execute the sentence, the sheriff will transfer the prisoner, with certified
copies of the commitment documents to the custody of the official whose duty it is
- 43 -
to execute the sentence and shall take from that person a receipt for the defendant
and make a return thereofthat will be returned to the court.
Committee Notes
[No Changes]
RULE 3.850. MOTION TO VACATE,; SET ASIDE,; OR CORRECT
SENTENCE
(a) Grounds for Motion. The following grounds may be claims for relief
from judgment or release from custody by a person who has been tried and found
guilty or has entered a plea of guilty or nolo contendere before a court established
by the laws of Florida:
(1) Tthe judgment was entered or sentence was imposed in
violation of the Constitution or laws of the United States or the State of Florida.;
(2) Tthe court did not have jurisdiction to enter the judgment.;
(3) Tthe court did not have jurisdiction to impose the sentence.;
(4) Tthe sentence exceeded the maximum authorized by law.;
(5) Tthe plea was involuntary.; or
(6) Tthe judgment or sentence is otherwise subject to collateral
attack.
(b) Time Limitations. A motion to vacate a sentence that exceeds the
limits provided by law may be filed at any time. No other motion shall be filed or
considered pursuant to this rule if filed more than 2 years after the judgment and
sentence become final unless it alleges that:
(1) the facts on which the claim is predicated were unknown to the
movant or the movant’s attorney and could not have been ascertained by the
exercise of due diligence, and the claim is made within 2 years of the time the new
facts were or could have been discovered with the exercise of due diligence, or;
- 44 -
(2) the fundamental constitutional right asserted was not
established within the period provided for herein and has been held to apply
retroactively, and the claim is made within 2 years of the date of the mandate of the
decision announcing the retroactivity,; or
(3) [No Changes]
(c) Contents of Motion. The motion must be under oath stating that the
defendant has read the motion or that it has been read to him or her, that the
defendant understands its content, and that all of the facts stated therein are true
and correct. The motion must include the certifications required by subdivision (n)
of this rule and must also include an explanation of:
(1)-(7) [No Changes]
This rule does not authorize relief based on grounds that could have or
should have been raised at trial and, if properly preserved, on direct appeal of the
judgment and sentence. If the defendant is filing a newly discovered evidence
claim based on recanted trial testimony or on a newly discovered witness, the
defendant shall include an affidavit from that person as an attachment to his or her
motion. For all other newly discovered evidence claims, the defendant shall attach
an affidavit from any person whose testimony is necessary to factually support the
defendant’s claim for relief. If the affidavit is not attached to the motion, the
defendant shall provide an explanation why the required affidavit could not be
obtained.
(d) Form of Motion. Motions shall be typewritten or hand-written in
legible printed lettering, in blue or black ink, double-spaced, with margins no less
than 1 inch on white 8 1/2- by- 11 inch paper. No motion, including any
memorandum of law, shall exceed 50 pages without leave of the court upon a
showing of good cause.
(e) [No Changes]
(f) Procedure; Evidentiary Hearing; Disposition. On filing of a motion
under this rule, the clerk shall forward the motion and file to the court. Disposition
of the motion shall be in accordance with the following procedures, which are
intended to result in a single, final, appealable order that disposes of all claims
raised in the motion.
- 45 -
(1)-(2) [No Changes]
(3) Timely Motions Containing Some Insufficient Claims. If the
motion sufficiently states one1 or more claims for relief and it also attempts but
fails to state additional claims, and the motion is timely filed under this rule, the
court shall enter a nonappealable order granting the defendant 60 days to amend
the motion to sufficiently state additional claims for relief. Any claim for which the
insufficiency has not been cured within the time allowed for such amendment shall
be summarily denied in an order that is a nonfinal, nonappealable order, which
may be reviewed when a final, appealable order is entered.
(4) Motions Partially Disposed of by the Court Record. If the
motion sufficiently states one1 or more claims for relief but the files and records in
the case conclusively show that the defendant is not entitled to relief as to one1 or
more claims, the claims that are conclusively refuted shall be summarily denied on
the merits without a hearing. A copy of that portion of the files and records in the
case that conclusively shows that the defendant is not entitled to relief as to one1 or
more claims shall be attached to the order summarily denying these claims. The
files and records in the case are the documents and exhibits previously filed in the
case and those portions of the other proceedings in the case that can be transcribed.
An order that does not resolve all the claims is a nonfinal, nonappealable order,
which may be reviewed when a final, appealable order is entered.
(5)-(8) [No Changes]
(g)-(m) [No Changes]
(n) Certification of Defendant; Sanctions. No motion may be filed
pursuant to this rule unless it is filed in good faith and with a reasonable belief that
it is timely, has potential merit, and does not duplicate previous motions that have
been disposed of by the court.
(1)-(2) [No Changes]
(3) Conduct prohibited under this rule includes, but is not limited
to, the following: the filing of frivolous or malicious claims; the filing of any
motion in bad faith or with reckless disregard for the truth; the filing of an
application for habeas corpus subject to dismissal pursuant to subdivision (m); the
willful violation of any provision of this rule; and the abuse of the legal process or
procedures governed by this rule.
- 46 -
The court, upon its own motion or on the motion of a party, may determine
whether a motion has been filed in violation of this rule. The court shall issue an
order setting forth the facts indicating that the defendant has or may have engaged
in prohibited conduct. The order shall direct the defendant to show cause, within a
reasonable time limit set by the court, why the court should not find that the
defendant has engaged in prohibited conduct under this rule and impose an
appropriate sanction. Following the issuance of the order to show cause and the
filing of any response by the defendant, and after such further hearing as the court
may deem appropriate, the court shall make a final determination of whether the
defendant engaged in prohibited conduct under this subsectionsubdivision.
(4)-(5) [No Changes]
Committee Notes
[No Changes]
Court Commentary
[No Changes]
RULE 3.986. FORMS RELATED TO JUDGMENT AND SENTENCE
(a)-(b) [No Changes]
(c) Form for Charges, Costs, and Fees.
In the Circuit Court,
Judicial Circuit, in and for
County, Florida
Division
Case Number
State of Florida
v.
- 47 -
Defendant
CHARGES/COSTS/FEES
The defendant is hereby ordered to pay the following sums if checked:
$50.00 pursuant to section 938.03, Florida Statutes (Crimes Compensation Trust
Fund).
$3.00 as a court cost pursuant to section 938.01, Florida Statutes (Criminal Justice
Trust Fund).
$2.00 as a court cost pursuant to section 938.15, Florida Statutes (Criminal Justice
Education by Municipalities and Counties).
A fine in the sum of $ pursuant to section 775.0835, Florida Statutes. (This
provision refers to the optional fine for the Crimes Compensation Trust Fund and is not
applicable unless checked and completed. Fines imposed as part of a sentence to section
775.083, Florida Statutes, are to be recorded on the sentence page(s).)
A sum of $ pursuant to section 938.27, Florida Statutes
(Prosecution/Investigative Costs).
A sum of $ pursuant to section 938.29, Florida Statutes (Public
Defender/Appointed Counsel Fees).
Restitution in accordance with attached order.
$201 pursuant to section 938.08, Florida Statutes (Funding Programs in Domestic
Violence).
A sum of $ for the cost of collecting the DNA sample required by section
943.325, Florida Statutes.
Other
[Insert list of mandatory fines, discretionary fines, and restitution, if any.]
DONE AND ORDERED in open court in County, Florida, on .....(date)......
Judge
- 48 -
(d) Form for Sentencing.
Defendant Case Number OBTS Number
SENTENCE
(As to Count )
The defendant, being personally before this court, accompanied by the defendant’s
attorney of record, , and having been adjudicated guilty herein, and the court having given
the defendant an opportunity to be heard and to offer matters in mitigation of sentence, and to
show cause why the defendant should not be sentenced as provided by law, and no cause being
shown,
(Check one if applicable)
and the court having on .....(date)..... deferred imposition of sentence until this date
and the court having previously entered a judgment in this case on ..........(date)..........
now resentences the defendant
and the court having placed the defendant on probation/community control and having
subsequently revoked the defendant’s probation/community control
It Is The Sentence Of The Court That:
The defendant pay a fine of $ , pursuant to section 775.083, Florida Statutes, plus
$ as the 5% surcharge required by section 938.04, Florida Statutes.
The defendant is hereby committed to the custody of the Department of Corrections.
The defendant is hereby committed to the custody of the Sheriff of County,
Florida
The defendant is sentenced as a youthful offender in accordance with section 958.04,
Florida Statutes.
To Be Imprisoned (check one; unmarked sections are inapplicable):
For a term of natural life.
For a term of .
Said SENTENCE SUSPENDED for a period of subject to conditions set forth in
this order.
- 49 -
If “split” sentence complete the appropriate paragraph
Followed by a period of on probation/community control under the supervision of
the Department of Corrections according to the terms and conditions of supervision set forth in a
separate order entered herein.
However, after serving a period of imprisonment in the balance of the
sentence shall be suspended and the defendant shall be placed on probation/community control
for a period of under supervision of the Department of Corrections according to the terms
and conditions of probation/community control set forth in a separate order entered herein.
In the event the defendant is ordered to serve additional split sentences, all incarceration portions
shall be satisfied before the defendant begins service of the supervision terms.
SPECIAL PROVISIONS
(As to Count )
By appropriate notation, the following provisions apply to the sentence imposed:
Mandatory/Minimum Provisions:
Firearm
It is further ordered that the 3–year minimum imprisonment provision of section
775.087(2), Florida Statutes, is hereby imposed for the sentence specified in this count.
Drug Trafficking
It is further ordered that the mandatory minimum imprisonment provision of
section 893.135(1), Florida Statutes, is hereby imposed for the sentence specified in this
count.
Controlled Substance Within 1,000 Feet of School
It is further ordered that the 3-year minimum imprisonment provision of section
893.13(1)(c)1, Florida Statutes, is hereby imposed for the sentence specified in this count.
Habitual Felony Offender
The defendant is adjudicated a habitual felony offender and has been sentenced to an
extended term in accordance with the provisions of section 775.084(4)(a), Florida
Statutes. The requisite findings by the court are set forth in a separate order or stated on
the record in open court.
Habitual Violent Felony Offender
- 50 -
The defendant is adjudicated a habitual violent felony offender and has been sentenced to
an extended term in accordance with the provisions of section 775.084(4)(b), Florida
Statutes. A minimum term of year(s) must be served prior to release. The requisite
findings of the court are set forth in a separate order or stated on the record in open court.
Law Enforcement Protection Act
It is further ordered that the defendant shall serve a minimum of years before release
in accordance with section 775.0823, Florida Statutes. (Offenses committed before
January 1, 1994.)
Capital Offense
It is further ordered that the defendant shall serve no less than 25 years in accordance
with the provisions of section 775.082(1), Florida Statutes. (Offenses committed before
October 1, 1995.)
Short-Barreled Rifle, Shotgun, Machine Gun
It is further ordered that the 5–year minimum provisions of section 790.221(2), Florida
Statutes, are hereby imposed for the sentence specified in this count. (Offenses
committed before January 1, 1994.)
Continuing Criminal Enterprise
It is further ordered that the 25–year minimum sentence provisions of section 893.20,
Florida Statutes, are hereby imposed for the sentence specified in this count. (Offenses
committed before January 1, 1994.)
Taking a Law Enforcement Officer’s Firearm
It is further ordered that the 3–year mandatory minimum imprisonment provision of
section 775.0875(1), Florida Statutes, is hereby imposed for the sentence specified in this
count. (Offenses committed before January 1, 1994.)
Sexual Offender/Sexual Predator Determinations:
Sexual Predator
The defendant is adjudicated a sexual predator as set forth in section 775.21, Florida
Statutes.
Sexual Offender
The defendant meets the criteria for a sexual offender as set forth in section
943.0435(1)(a)1a., b., c., or d, Florida Statutes.
Age of Victim
- 51 -
The victim was years of age at the time of the offense.
Age of Defendant
The defendant was years of age at the time of the offense.
Relationship to Victim
The defendant is not the victim’s parent or guardian.
Sexual Activity [Section 800.04(4), Florida Statutes]
The offense did did not involve sexual activity.
Use of Force or Coercion [Section 800.04(4), Florida Statutes]
The sexual activity described herein did did not involve the use of
force or coercion.
Use of Force or Coercion/unclothed Genitals [Section 800.04(5), Florida Statutes]
The molestation did did not involve unclothed genitals or genital
area.
The molestation did did not involve the use of force or coercion.
Other Provisions:
Criminal Gang Activity
The felony conviction is for an offense that was found, pursuant to section 874.04,
Florida Statutes, to have been committed for the purpose of benefiting, promoting, or
furthering the interests of a criminal gang.
[Include all findings, sentencing enhancements, and mandatory minimum provisions, as
authorized by law and pronounced at sentencing.]
Retention of Jurisdiction
The court retains jurisdiction over the defendant pursuant to section 947.16(4), Florida
Statutes (1983).
Jail Credit
- 52 -
It is further ordered that the defendant shall be allowed a total of days as credit for
time incarcerated before imposition of this sentence.
CREDIT FOR TIME SERVED
IN RESENTENCING AFTER
VIOLATION OF PROBATION
OR COMMUNITY CONTROL
It is further ordered that the defendant be allowed days time served between date of
arrest as a violator following release from prison to the date of resentencing. The
Department of Corrections shall apply original jail time credit and shall compute and
apply credit for time served and unforfeited gain time previously awarded on case/count
. (Offenses committed before October 1, 1989.)
It is further ordered that the defendant be allowed days time served between date of
arrest as a violator following release from prison to the date of resentencing. The
Department of Corrections shall apply original jail time credit and shall compute and
apply credit for time served on case/count . (Offenses committed between October 1,
1989, and December 31, 1993.)
The Court deems the unforfeited gain time previously awarded on the above case/count
forfeited under section 948.06(7), Florida Statutes.
The Court allows unforfeited gain time previously awarded on the above case/count.
(Gain time may be subject to forfeiture by the Department of Corrections under section
944.28(1), Florida Statutes.)
It is further ordered that the defendant be allowed days time served between date of
arrest as a violator following release from prison to the date of resentencing. The
Department of Corrections shall apply original jail time credit and shall compute and
apply credit for time served only pursuant to section 921.0017, Florida Statutes, on
case/count . (Offenses committed on or after January 1, 1994.)
Consecutive/Concurrent as to Other Counts
It is further ordered that the sentence imposed for this count shall run (check one)
consecutive to concurrent with the sentence set forth in count of this case.
Consecutive/Concurrent as to Other Convictions
It is further ordered that the composite term of all sentences imposed for the counts specified in
this order shall run (check one) consecutive to concurrent with (check one) the following:
any active sentence being served.
- 53 -
specific sentences:
In the event the above sentence is to the Department of Corrections, the Sheriff of
County, Florida, is hereby ordered and directed to deliver the defendant to the Department of
Corrections at the facility designated by the department together with a copy of this judgment
and sentence and any other documents specified by Florida Statute.
The defendant in open court was advised of the right to appeal from this sentence by
filing notice of appeal within 30 days from this date with the clerk of this court and the
defendant’s right to the assistance of counsel in taking the appeal at the expense of the state on
showing of indigency.
In imposing the above sentence, the court further recommends
DONE AND ORDERED in open court at County, Florida, on .....(date)......
Judge
(e) Form for Order of Probation.
In the Court,
of County, Florida
Case Number
State of Florida
v.
Defendant
ORDER OF PROBATION
This cause coming on this day to be heard before me, and you, the defendant,
, being now present before me, and you having
- 54 -
(check one)
entered a plea of guilty to
entered a plea of nolo contendere to
been found guilty by jury verdict of
been found guilty by the court trying the case without a jury of the offense(s) of
SECTION 1: Judgment Of Guilt
The Court hereby adjudges you to be guilty of the above offense(s).
Now, therefore, it is ordered and adjudged that the imposition of sentence is hereby
withheld and that you be placed on probation for a period of under the supervision of
the Department of Corrections, subject to Florida law.
SECTION 2: Order Withholding Adjudication
Now, therefore, it is ordered and adjudged that the adjudication of guilt is hereby
withheld and that you be placed on probation for a period of under the supervision of the
Department of Corrections, subject to Florida law.
SECTION 3: Probation During Portion Of Sentence
It is hereby ordered and adjudged that you be
committed to the Department of Corrections
confined in the County Jail
for a term of with credit for jail time. After you have served of the term you
shall be placed on probation for a period of under the supervision of the Department of
Corrections, subject to Florida law.
confined in the County Jail
for a term of with credit for jail time, as a special condition of probation.
- 55 -
It is further ordered that you shall comply with the following conditions of probation
during the probationary period.:
(1) Not later than the fifth day of each month, you will make a full and truthful report
to your officer on the form provided for that purpose.
(2) You will pay the State of Florida the amount of $ per month toward
the cost of your supervision, unless otherwise waived in compliance with Florida Statutes.
(3) You will not change your residence or employment or leave the county of your
residence without first procuring the consent of your officer.
(4) You will not possess, carry, or own any firearm. You will not possess, carry, or
own any weapons without first procuring the consent of your officer.
(5) You will live without violating the law. A conviction in a court of law shall not be
necessary for such a violation to constitute a violation of your probation.
(6) You will not associate with any person engaged in any criminal activity.
(7) You will not use intoxicants to excess or possess any drugs or narcotics unless
prescribed by a physician. Nor will you visit places where intoxicants, drugs, or other dangerous
substances are unlawfully sold, dispensed, or used.
(8) You will work diligently at a lawful occupation, advise your employer of your
probation status, and support any dependents to the best of your ability, as directed by your
officer.
(9) You will promptly and truthfully answer all inquiries directed to you by the court
or the officer, and allow your officer to visit in your home, at your employment site, or
elsewhere, and you will comply with all instructions your officer may give you.
(10) You will pay restitution, costs, and/or fees in accordance with the attached orders.
(11) You will report in person within 72 hours of your release from confinement to the
probation office in County, Florida, unless otherwise instructed by your officer.
(This condition applies only if section 3 on the previous page is checked.) Otherwise, you must
report immediately to the probation office located at .
(12) You shall submit to the drawing of blood or other biological specimens as
required by section 943.325, Florida Statutes.
(13) You shall submit to the taking of a digitized photograph as required by section
948.03, Florida Statutes.
- 56 -
SPECIAL CONDITIONS
You must undergo a (drug/alcohol) evaluation and, if treatment is deemed necessary, you
must successfully complete the treatment.
You will submit to urinalysis, breathalyzer, or blood tests at any time requested by your
officer, or the professional staff of any treatment center where you are receiving treatment, to
determine possible use of alcohol, drugs, or controlled substances. You shall be required to pay
for the tests unless payment is waived by your officer.
You must undergo a mental health evaluation, and if treatment is deemed necessary, you
must successfully complete the treatment.
You will not associate with during the period of probation.
You will not associate with other criminal gang members or associates, except as
authorized by law enforcement officials, prosecutorial authorities, or the court, for the purpose of
aiding in the investigation of criminal activity.
You will not contact during the period of probation.
You will attend and successfully complete an approved batterers’ intervention program.
GENERAL CONDITIONS: [List the general conditions of probation pursuant to section
948.03, Florida Statutes.]
SPECIAL CONDITIONS: [List the special conditions of probation as orally pronounced
and authorized by law.]
Other
(Use the space below for additional conditions as necessary.)
You are hereby placed on notice that the court may at any time rescind or modify any of
the conditions of your probation, or may extend the period of probation as authorized by law, or
may discharge you from further supervision. If you violate any of the conditions of your
probation, you may be arrested and the court may revoke your probation, adjudicate you guilty if
adjudication of guilt was withheld, and impose any sentence that it might have imposed before
placing you on probation or require you to serve the balance of the sentence. The court may
rescind or modify at any time the terms and conditions imposed by it upon the probationer.
- 57 -
It is further ordered that when you have been instructed as to the conditions of probation,
you shall be released from custody if you are in custody, and if you are at liberty on bond, the
sureties thereon shall stand discharged from liability. (This paragraph applies only if section 1 or
section 2 is checked.)
It is further ordered that the clerk of this court file this order in the clerk’s office and
provide certified copies of same to the officer for use in compliance with the requirements of
law.
DONE AND ORDERED, on .....(date)......
Judge
I acknowledge receipt of a certified copy of this order. The conditions have been
explained to me and I agree to abide by them.
.....(date)..... Probationer
Instructed by
Original: Clerk of the Court
Certified Copies: Probationer
Florida Department of Corrections,
Probation and Parole Service
(f) Form for Community Control.
In the Court,
of County, Florida
Case Number
State of Florida
v.
Defendant
ORDER OF COMMUNITY CONTROL
- 58 -
This cause coming on this day to be heard before me, and you, the defendant,
, being now present before me, and you having
(check one)
entered a plea of guilty to
entered a plea of nolo contendere to
been found guilty by jury verdict of
been found guilty by the court trying the case without a jury of the offense(s) of
SECTION 1: Judgment of Guilt
The court hereby adjudges you to be guilty of the above offense(s).
Now, therefore, it is ordered and adjudged that you be placed on community control for a
period of under the supervision of the Department of Corrections, subject to Florida law.
SECTION 2: Order Withholding Adjudication
Now, therefore, it is ordered and adjudged that the adjudication of guilt is hereby
withheld and that you be placed on Community Control for a period of under the
supervision of the Department of Corrections, subject to Florida law.
SECTION 3: Community Control During Portion Of Sentence
It is hereby ordered and adjudged that you be
committed to the Department of Corrections
confined in the County Jail
for a term of with credit for jail time. After you have served of the term, you
shall be placed on community control for a period of under the supervision of the
Department of Corrections, subject to Florida law.
confined in the County Jail
for a term of with credit for jail time, as a special condition of community control.
- 59 -
It is further ordered that you shall comply with the following conditions of community
control during the community control period.:
(1) Not later than the fifth day of each month, you will make a full and truthful report
to your officer on the form provided for that purpose.
(2) You will pay the State of Florida the amount of $ per month toward the cost
of your supervision, unless otherwise waived in compliance with Florida Statutes.
(3) You will not change your residence or employment or leave the county of your
residence without first procuring the consent of your officer.
(4) You will not possess, carry, or own any firearm. You will not possess, carry, or
own other weapons without first procuring the consent of your officer.
(5) You will live without violating the law. A conviction in a court of law shall not be
necessary for such a violation to constitute a violation of your community control.
(6) You will not associate with any person engaged in any criminal activity.
(7) You will not use intoxicants to excess or possess any drugs or narcotics unless
prescribed by a physician. Nor will you visit places where intoxicants, drugs, or other dangerous
substances are unlawfully sold, dispensed, or used.
(8) You will work diligently at a lawful occupation, advise your employer of your
community control status, and support any dependents to the best of your ability as directed by
your officer.
(9) You will promptly and truthfully answer all inquiries directed to you by the court
or your officer and allow your officer to visit in your home, at your employment site or
elsewhere, and you will comply with all instructions your officer may give you.
(10) You will report to your officer at least 4 times a week, or, if unemployed full
time, daily.
(11) You will perform hours of public service work as directed by your officer.
(12) You will remain confined to your approved residence except for one half hour
before and after your approved employment, public service work, or any other special activities
approved by your officer.
(13) You will pay restitution, costs, and/or fees in accordance with the attached orders.
- 60 -
(14) You will report in person within 72 hours of your release from confinement to the
probation office in County, Florida, unless otherwise instructed by your officer. (This
condition applies only if section 3 on the previous page is checked.) Otherwise, you must report
immediately to the probation office located at .
(15) You shall submit to the drawing of blood or other biological specimens as
required by section 943.325, Florida Statutes.
(16) You shall submit to the taking of a digitized photograph as required by section
948.101, Florida Statutes.
SPECIAL CONDITIONS
You must undergo a (drug/alcohol) evaluation, and if treatment is deemed necessary, you
must successfully complete the treatment.
You must undergo a mental health evaluation, and if treatment is deemed necessary, you
must successfully complete the treatment.
You will submit to urinalysis, breathalyzer, or blood tests at any time requested by your
officer, or the professional staff of any treatment center where you are receiving treatment, to
determine possible use of alcohol, drugs, or controlled substances. You shall be required to pay
for the tests unless payment is waived by your officer.
You will not associate with during the period of community control.
You will not associate with other criminal gang members or associates, except as
authorized by law enforcement officials, prosecutorial authorities, or the court, for the purpose of
aiding in the investigation of criminal activity.
You will not contact during the period of community control.
You will maintain an hourly accounting of all your activities on a daily log which you
will submit to your officer on request.
You will participate in self-improvement programs as determined by the court or your
officer.
You will submit to electronic monitoring of your whereabouts as required by the Florida
Department of Corrections.
You will attend and successfully complete an approved batterers’ intervention program.
Other
- 61 -
(Use the space below for additional conditions as necessary.)
GENERAL CONDITIONS: [List the general conditions of community control pursuant
to section 948.101, Florida Statutes.]
SPECIAL CONDITIONS: [List the special conditions of community control as orally
pronounced and authorized by law.]
You are hereby placed on notice that the court may at any time rescind or modify any of
the conditions of your community control, or may extend the period of community control as
authorized by law, or may discharge you from further supervision or return you to a program of
regular probation supervision. If you violate any of the conditions and sanctions of your
community control, you may be arrested, and the court may adjudicate you guilty if adjudication
of guilt was withheld, revoke your community control, and impose any sentence that it might
have imposed before placing you on community control.The court may rescind or modify at any
time the terms and conditions imposed by it upon the community controlee.
It is further ordered that when you have reported to your officer and have been instructed
as to the conditions of community control, you shall be released from custody if you are in
custody, and if you are at liberty on bond, the sureties thereon shall stand discharged from
liability. (This paragraph applies only if section 1 or section 2 is checked.)
It is further ordered that the clerk of this court file this order in the clerk’s office, and
forthwith provide certified copies of same to the officer for use in compliance with the
requirements of law.
DONE AND ORDERED, on .....(date)......
Judge
I acknowledge receipt of a certified copy of this order. The conditions have been
explained to me and I agree to abide by them.
.....(date)..... Community controller
Instructed by
Original: Clerk of the Court
Certified Copies: Community Controlee
Florida Department of Corrections,
Probation and Parole Service
- 62 -
(g) Form for Restitution Order.
In the Circuit Court,
Judicial Circuit, in and for
County, Florida
Division
Case Number
State of Florida
v.
Defendant
RESTITUTION ORDER
By appropriate notation, the following provisions apply to the sentence imposed in this
section:
Restitution is not ordered as it is not applicable.
Restitution is not ordered due to the financial resources of the defendant.
Restitution is not ordered due to .
Due to the financial resources of the defendant, restitution of a portion of the
damages is ordered as prescribed below.
Restitution is ordered as prescribed below.
Restitution is ordered for the following victim. (Victim refers to the aggrieved
party, aggrieved party’s estate, or aggrieved party’s next of kin if the aggrieved
party is deceased as a result of the offense. In lieu of the victim’s address, the
address and phone number of the prosecuting attorney, victim’s attorney, or
victim advocate may be used.)
Name of victim Name of attorney or advocate if applicable
Address
City, State, and Zip Code
Phone Number (of prosecuting attorney, victim’s attorney, or victim advocate)
- 63 -
The sum of $ for medical and related services and devices relating to physical,
psychiatric, and psychological care, including non-medical care and treatment rendered in
accordance with a recognized method of healing.
The sum of $ for necessary physical and occupational therapy and rehabilitation.
The sum of $ to reimburse the victim for income lost as a result of the offense.
The sum of $ for necessary funeral and related services if the offense resulted in
bodily injury resulting in the death of the victim.
The sum of $ for damages resulting from the offense.
The sum of $ for
It is further ordered that the defendant fulfill restitution obligations in the following
manner:
Total monetary restitution is determined to be $ to be paid at a rate of $ per (check
one) month week other (specify) and is to be paid (check one)
through the clerk of the circuit court, to the victim’s designee, or through
the Department of Corrections, with an additional 4% fee of $ for handling,
processing, and forwarding the restitution to the victim(s).
For which sum let execution issue.
[Include all restitution and findings, as authorized by law and pronounced at sentencing.]
DONE AND ORDERED at County, Florida, on .....(date)......
Judge
Original: Clerk of the Court
Certified Copy: Victim
Committee Note
[No Changes]
- 64 -
RULE 3.9876. MOTION FOR CORRECTION OF SENTENCE
MOTION FOR CORRECTION OF ILLEGAL SENTENCE, INCORRECT SENTENCING
SCORESHEET, OR ERRONEOUS SEXUAL PREDATOR DESIGNATION
FLORIDA RULE OF CRIMINAL PROCEDURE 3.800(a)
INSTRUCTIONS FOR FILING MOTION FOR CORRECTION OF SENTENCE
PURSUANT TO FLORIDA RULE OF CRIMINAL PROCEDURE 3.800(a)
READ CAREFULLY
1. The attached motion is to be used to request a correction of illegal sentence,
incorrect calculation in a sentencing scoresheet, or erroneous sexual predator designation. This
form should not be used for motions for correction of jail credit (see Fla. R. Crim. P. 3.801).
2. No successive motion for correction of incorrect calculation in a sentencing
scoresheet or the correction of erroneous sexual predator designation will be considered. If a
motion fails to allege new or different grounds for relief, and the prior determination was on the
merits, the motion may be dismissed.
3. The court records must demonstrate, on their face, that you are entitled to a
correction of sentence or that a sexual predator designation is erroneous. The records that
demonstrate that a sentence is illegal, that there is an incorrect calculation in a sentencing
scoresheet, or that a sexual predator designation is erroneous, should be attached to this motion.
4. You must complete the attached motion by filling in the blank spaces.
5. You must tell the truth and sign the attached motion. If you make a false
statement of a material fact in your motion, you may be prosecuted for perjury. You must declare
that you have read the motion for relief, or had the motion read to you, that you understand its
contents, and that all of the facts contained in the motion are true and correct. If you do not
answer YES to question 5, your motion will be rejected as incomplete.
6. You must file the attached motion in the court that imposed the sentence.
7. You are not required to pay a filing fee to file the attached motion.
In the Circuit Court of the
Judicial Circuit
in and for
County, Florida
State of Florida )
)
- 65 -
v. )
)
)
(your name) )
)
)
MOTION FOR CORRECTION OF ILLEGAL SENTENCE, INCORRECT SENTENCING
SCORESHEET, OR ERRONEOUS SEXUAL PREDATOR DESIGNATION
(hereinafter “Defendant”), in pro se fashion, respectfully moves this
Honorable Court for correction of:
___ illegal sentence; and/or
___ incorrect calculation in a sentencing scoresheet; and/or
___ erroneous sexual predator designation
pursuant to Florida Rule of Criminal Procedure 3.800(a). In support of the motion, the defendant
states the following in a question-and-answer format:
1. What are the FACT(S) that entitle you to correction of sentence?
2. Where in the court’s record is it demonstrated that you are entitled to correction of
sentence, correction of incorrect calculation in a sentencing scoresheet, or the correction of
erroneous sexual predator designation?
3. Is this the first motion you have filed requesting this correction of sentence or
removal of an erroneous sexual predator designation?
If you answered NO, how many prior motions have you filed? What was the claim in each
motion?
As to EACH motion, what was the result?
- 66 -
4. What is the correct sentence or designation that you are requesting in this motion?
5. Under penalties of perjury and administrative sanctions from the Department of
Corrections, including forfeiture of gain time if this motion is found to be frivolous or made in
bad faith, I certify that I understand the contents of the foregoing motion, that the facts contained
in the motion are true and correct, and that I have a reasonable belief that the motion is timely
filed. I certify that this motion does not duplicate previous motions that have been disposed of by
the court. I further certify that I understand English and have read the foregoing motion or had
the motion read to me, or the foregoing motion was translated completely into a language which
I understand and read to me by .....(name)....., whose address is .....(address)....., and whose
certification of an accurate and complete translation is attached to this motion.
/s/
Name
DC#
Certification of Mailing
(Must use Certification of Mailing OR Certificate of Service)
I certify that I placed this document in the hands of .....(here insert name of institution
official)..... for mailing to .....(here insert name or names and address(es) used for service)..... on
.....(date)......
/s/
Name
Address
DC#
Certificate of Service
(Must use Certification of Mailing OR Certificate of Service)
I certify that the foregoing document has been furnished to (here insert name or names,
address(es) used for service and mailing address(es)) by (e-mail) (delivery) (mail) (fax) on
.....(date)......
- 67 -
/s/
Attorney
Certification of an Accurate and Complete Translation
(To be used if translation of the motion was necessary.)
I certify that a complete and accurate translation of this motion was provided to the
Defendant in this case on .....(date)......
/s/
Name
Address
DC#
RULE 3.989. AFFIDAVIT,; PETITION,; AND ORDER TO EXPUNGE
OR SEAL FORMS
(a) Affidavit in Support of Petition.
In the Circuit Court of the
Judicial Circuit,
in and for
County, Florida
Case No.:
Division
State of Florida, )
)
Plaintiff, )
)
v. )
)
, )
)
Defendant/Petitioner )
)
AFFIDAVIT
State of Florida
- 68 -
County of
I, .....(name of defendant/petitioner)....., am the defendant/petitioner in the above-styled
cause and I do hereby swear or affirm that:
1. I fully understand the meaning of all of the terms of this affidavit.
2. I have never been adjudicated guilty of a criminal offense or a comparable
ordinance violation nor adjudicated delinquent for committing a felony or a misdemeanor
specified in section 943.051(3)(b), Florida Statutes.
3. I was arrested on .....(date)....., by .....(arresting agency)....., and I have not been
adjudicated guilty of, nor adjudicated delinquent for committing, any of the acts stemming from
that arrest or the alleged criminal activity surrounding my arrest.
4. I am eligible for the relief requested, to the best of my knowledge and belief, and
do not have any other petition to expunge or seal pending before any court.
5. I have never secured a prior records expunction or sealing under any lawunder
section 943.0585 or 943.059, Florida Statutes, or under former section 893.14, 901.33, or
943.058, Florida Statutes, or the record is otherwise eligible for expunction because it has been
sealed for at least 10 years.
6. (For use in expunction petitions only.) My record of arrest for this date has been
sealed for at least 10 years; or an indictment, information, or other charging document was not
filed against me for the above criminal transaction; or an indictment, information, or other
charging document filed against me was dismissed by the prosecutor or the court.
Petitioner
Sworn to and subscribed before me on .....(date)......
NOTARY PUBLIC, or other person
authorized to administer an oath
Printed, typed, or stamped
commissioned name of Notary Public
Personally known .......... or produced identification ...........
Type of identification produced ....................
- 69 -
My commission expires:
(b) Order to Expunge.
In the Circuit Court of the
Judicial Circuit,
in and for
County, Florida
Case No.:
Division
State of Florida, )
)
Plaintiff, )
)
v. )
)
, )
)
Defendant/Petitioner )
)
ORDER TO EXPUNGE UNDER
SECTION 943.0585, FLORIDA STATUTES,
AND FLORIDA RULE OF CRIMINAL PROCEDURE 3.692
THIS CAUSE having come on to be heard before me this date on a petition to expunge
certain records of the petitioner’s arrest on .....(date)....., by .....(arresting agency)....., for
.....(charges)....., and the court having heard argument of counsel and being otherwise fully
advised in the premises, the court hereby finds the following:
1. The petitioner has never previously been adjudicated guilty of a criminal offense
or a comparable ordinance violation nor adjudicated delinquent for committing a felony or a
misdemeanor specified in section 943.051(3)(b), Florida Statutes.
2. The petitioner was not adjudicated guilty of nor adjudicated delinquent for
committing any of the acts stemming from the arrest or criminal activity to which this
expunction petition pertains.
3. The petitioner has not secured a prior records expunction or sealing under section
943.0585 or 943.059, Florida Statutes, or under former section 893.14, 901.33, or 943.058,
- 70 -
Florida Statutes, or the record is otherwise eligible for expunction because it has been sealed for
at least 10 years.
4. This record has either been sealed for at least 10 years; or no indictment,
information, or other charging document was ever filed in this case against the petitioner; or an
indictment, information, or other charging document filed against the defendant was dismissed
by the prosecutor or the court.
5. A Certificate of Eligibility issued by the Florida Department of Law Enforcement
accompanied the petition for expunction of nonjudicial criminal history records. Whereupon it is
ORDERED AND ADJUDGED that the petition to expunge is granted. All court records
pertaining to the above-styled case shall be sealed in accordance with the procedures set forth in
Florida Rule of Criminal Procedure 3.692; and it is further
ORDERED AND ADJUDGED that the clerk of this court shall forward a certified copy
of this order to the (check one) ..... state attorney, ..... special prosecutor, ..... statewide
prosecutor, .....(arresting agency)....., and the Sheriff of .......... County, who will comply with the
procedures set forth in section 943.0585, Florida Statutes, and appropriate regulations of the
Florida Department of Law Enforcement, and who will further forward a copy of this order to
any agency that their records reflect has received the instant criminal history record information;
and it is further
ORDERED AND ADJUDGED that .....(arresting agency)..... shall expunge all
information concerning indicia of arrest or criminal history record information regarding the
arrest or alleged criminal activity to which this petition pertains in accordance with the
procedures set forth in section 943.0585, Florida Statutes, and Florida Rule of Criminal
Procedure 3.692.
All costs of certified copies involved herein are to be borne by the ...........
DONE AND ORDERED in Chambers at .......... County, Florida, on .....(date)......
Circuit Court Judge
- 71 -
(c) Order to Seal.
In the Circuit Court of the
Judicial Circuit,
in and for
County, Florida
Case No.:
Division
State of Florida, )
)
Plaintiff, )
)
v. )
)
, )
)
Defendant/Petitioner )
)
ORDER TO SEAL RECORDS UNDER SECTION 943.059,
FLORIDA STATUTES, AND FLORIDA RULE OF
CRIMINAL PROCEDURE 3.692
THIS CAUSE having come on to be heard before me this date on petitioner’s petition to
seal records concerning the petitioner’s arrest on .....(date)....., by the .....(arresting agency).....,
and the court having heard argument of counsel and being otherwise advised in the premises, the
court hereby finds:
1. The petitioner has never been previously adjudicated guilty of a criminal offense
or comparable ordinance violation nor adjudicated delinquent for committing a felony or a
misdemeanor specified in section 943.051(3)(b), Florida Statutes.
2. The petitioner was not adjudicated guilty of nor adjudicated delinquent for
committing any of the acts stemming from the arrest or criminal activity to which the instant
petition pertains.
3. The petitioner has not secured a prior records expunction or sealing under section
943.0585 or 943.059, Florida Statutes, or under former section 893.14, 901.33, or 943.058,
Florida Statutes.
4. A Certificate of Eligibility issued by the Florida Department of Law Enforcement
accompanied the instant petition for sealing nonjudicial criminal history records. Whereupon it is
- 72 -
ORDERED AND ADJUDGED that the petition to seal records is granted. All court
records pertaining to the above-styled case shall be sealed in accordance with the procedures set
forth in Florida Rule of Criminal Procedure 3.692; and it is further
ORDERED AND ADJUDGED that the clerk of this court shall forward a certified copy
of this order to the (check one) ..... state attorney, ..... special prosecutor, ..... statewide
prosecutor, ..... .....(arresting agency)....., and the ..... Sheriff of .......... County, who will comply
with the procedures set forth in section 943.059, Florida Statutes, and appropriate regulations of
the Florida Department of Law Enforcement, and who will further forward a copy of this order
to any agency that their records reflect has received the instant criminal history record
information; and it is further
ORDERED AND ADJUDGED that .....(arresting agency)..... shall seal all information
concerning indicia of arrest or criminal history record information regarding the arrest or alleged
criminal activity to which this petition pertains in accordance with the procedures set forth in
section 943.059, Florida Statutes, and Florida Rule of Criminal Procedure 3.692.
All costs of certified copies involved herein are to be borne by the ...........
DONE AND ORDERED in Chambers at .......... County, Florida, on .....(date)......
Circuit Court Judge
(d) Petition to Expunge or Seal.
In the Circuit Court of the
Judicial Circuit,
in and for
County, Florida
Case No.:
Division
State of Florida, )
)
Plaintiff, )
)
v. )
)
, )
- 73 -
)
Defendant/Petitioner )
)
PETITION TO EXPUNGE OR SEAL
The petitioner, .........., by and through the undersigned attorney, petitions this honorable
court, under Florida Rule of Criminal Procedure 3.692 and section ..... 943.0585, or ..... section
943.059, Florida Statutes, to .....expunge/seal..... all criminal history record information in the
custody of any criminal justice agency and the official records of the court concerning the
petitioner’s arrest on .....(date)....., by .....(arresting agency)....., for .....(charges)....., and as
grounds therefor shows:
1. On .....(date)....., the petitioner, .........., a .....(race/sex)....., whose date of birth is
.....(date of birth)....., was arrested by .....(arresting agency)....., and charged with .....(charges)......
2. The petitioner has not been adjudicated guilty of nor adjudicated guilty of
committing any of the acts stemming from this arrest or alleged criminal activity.
3. The petitioner has not been previously adjudicated guilty of a criminal offense or
a comparable ordinance violation nor adjudicated delinquent for committing a felony or a
misdemeanor specified in section 943.051(3)(b), Florida Statutes.
4. The petitioner has not secured a prior records expunction or sealing under section
943.0585, or 943.059, Florida Statutes, or under former section 943.058, Florida Statutes, former
section 893.14, Florida Statutes, or former section 901.33, Florida Statutes, or any other law,
rule, or authority.
5. (To be used only when requesting expunction.) The petitioner’s record has been
sealed under section 943.059, Florida Statutes, or under former section 943.058, Florida Statues,
former section 893.14, Florida Statutes, or former section 901.33, Florida Statutes, for at least 10
years; or there has not been an indictment, information, or other charging document filed against
the petitioner who is the subject of this criminal history record information; or an indictment,
information, or other charging document filed against the petitioner who is the subject of this
criminal history information was dismissed by the prosecutor or the court.
6. A Certificate of Eligibility for .....expunction/sealing..... of nonjudicial criminal
history records issued by the Florida Department of Law Enforcement accompanies this petition.
WHEREFORE, the petitioner moves to .....expunge/seal..... any criminal history record
information and any official court records regarding his/her arrest by .....(arresting agency).....,
for .....(charges)....., on .....(date)......
- 74 -
I HEREBY CERTIFY that a true and correct copy of the foregoing pleading has been
served on .....(name of prosecuting authority)....., (check one) ..... State Attorney for the ..........
Judicial Circuit, in and for .......... County, ..... Special Prosecutor, ..... Statewide Prosecutor);
.....(arresting agency).....; .......... (Sheriff of county in which defendant was arrested, if different);
and the Florida Department of Law Enforcement, on .....(date)......
Name:
Address:
City/State:
Telephone Number:
E-mail Address:
Fla. Bar No.:
(e) Petition to Expunge; Human Trafficking Victim.
In the Circuit Court of the
Judicial Circuit,
in and for
County, Florida
Case No.:
Division
State of Florida, )
)
Plaintiff, )
)
v. )
)
, )
)
Defendant/Petitioner )
)
PETITION TO EXPUNGE/HUMAN TRAFFICKING VICTIM
The petitioner, .........., by and through the undersigned attorney, petitions this honorable
court, under Florida Rule of Criminal Procedure 3.692 and section 943.0583, Florida Statutes, to
expunge all criminal history record information in the custody of any criminal justice agency and
the official records of the court concerning the petitioner’s arrest and/or conviction on
- 75 -
.....(date(s))....., by .....(arresting agency and/or prosecuting authority)....., for .....(charges and/or
offenses)....., and as grounds therefor shows:
1. On .....(date(s))....., the petitioner, .........., a .....(race/sex)....., whose date of birth is
.....(date of birth)....., was arrested by .....(arresting agency)....., and charged with .....(charges).....
or was convicted by .....(name of prosecuting authority)..... of .....(offenses)......
2. The petitioner has been the victim of human trafficking, as discussed in section
787.06, Florida Statutes, and has committed, or is reported to have committed, an offense, other
than those offenses listed in section, 775.084(1)(b)1, Florida Statutes, which was committed, or
reported to have been committed, as a part of a human trafficking scheme of which he/she was
the victim or at the direction of an operator of the scheme as evidenced by the attached official
documentation of his/her status, or may be shown by clear and convincing evidence presented to
the Court.
WHEREFORE, the petitioner moves to expunge any criminal history record information
and any official court records regarding his/her arrest and/or conviction by .....(arresting agency
and/or name of prosecuting authority)....., for .....(charges and/or offenses)....., on
.....(date(s)).......
I HEREBY CERTIFY that a true and correct copy of the foregoing pleading has been
served on .....(name of prosecuting authority)....., (check one) ..... State Attorney for the ...........
Judicial Circuit, in and for .......... County, ..... Special Prosecutor, ..... Statewide Prosecutor;
.....(arresting agency).....; .......... (Sheriff of county in which defendant was arrested, if different);
and the Florida Department of Law Enforcement, on .....(date)......
Name:
Address:
City/State:
Telephone Number:
E-mail Address:
Fla. Bar No.:
Personally known .......... or produced identification ............
Type of identification produced ...........
My commission expires:
(f) [No Changes]
- 76 -
(g) Order to Expunge; Human Trafficking Victim.
In the Circuit Court of the
Judicial Circuit,
in and for
County, Florida
Case No.:
Division
State of Florida, )
)
Plaintiff, )
)
v. )
)
, )
)
Defendant/Petitioner )
)
ORDER TO EXPUNGE, HUMAN TRAFFICKING VICTIM,
UNDER SECTION 943.0583, FLORIDA STATUTES,
AND FLORIDA RULE OF CRIMINAL PROCEDURE 3.692
THIS CAUSE, having come on to be heard before me this date upon a petition to
expunge certain records of the petitioner’s arrest and/or conviction on .....(date(s))....., by
.....(arresting agency and/or name of prosecuting authority)....., for .....(charges and/or
offenses)....., and the court having heard argument of counsel and being otherwise fully advised
in the premises, the court hereby finds the following:
The petitioner has been the victim of human trafficking, as discussed in section 787.06,
Florida Statutes, and has committed, or is reported to have committed, an offense, other than
those offenses listed in section 775.084(1)(b)1, Florida Statutes, which was committed, or
reported to have been committed, as a part of a human trafficking scheme of which he/she was
the victim, or at the direction of an operator of the scheme. A conviction expunged under this
section is deemed to have been vacated due to a substantive defect in the underlying criminal
proceedings.
Whereupon it is
- 77 -
ORDERED AND ADJUDGED that the petition to expunge is granted. All court records
pertaining to the above-styled case shall be sealed in accordance with the procedures set forth in
Florida Rule of Criminal Procedure 3.692; and it is further
ORDERED AND ADJUDGED that the clerk of this court shall forward a certified copy
of this order to the (check one) ..... state attorney, ..... special prosecutor, ..... statewide
prosecutor, ..... .....(arresting agency)....., and the Sheriff of .......... County, who will comply with
the procedures set forth in section 943.0583, Florida Statutes, and appropriate regulations of the
Florida Department of Law Enforcement, and who will further forward a copy of this order to
any agency that their records reflect has received the instant criminal history record information;
and it is further
ORDERED AND ADJUDGED that .....(arresting agency)..... shall expunge all
information concerning indicia of arrest, conviction, or criminal history record information
regarding the arrest, conviction, or alleged criminal activity to which this petition pertains in
accordance with the procedures set forth in section 943.0583, Florida Statutes, and Florida Rule
of Criminal Procedure 3.692.
All costs of certified copies involved herein are to be borne by the ...........
DONE AND ORDERED in Chambers at .......... County, Florida, on .....(date)......
Circuit Court Judge
Committee Notes
[No Changes]
- 78 -
| 2024-03-14T01:27:04.277712 | https://example.com/article/8740 |
For many years, unsterile surgical cameras and optical connectors known in the art as "C" or "V" mount connectors have been used in surgery by placing them into a sterile plastic bag or drape that has a distal end including an opening for receiving the eyepiece of a sterile or disinfected endoscope. The act of coupling the sterile or disinfected endoscope through the opening in the drape to the unsterile optical connector can create contamination. That is, the interior of the drape that houses the unsterile camera and optical connector is exposed to the sterile environment of an operating room through the hole located at the distal end of the drape. When the eyepiece of the endoscope is inserted through this hole for connection to the optical connector, this hole often becomes enlarged thus enhancing the possibility of contamination travelling from the interior of the drape to the sterile operating room. The further acts of aligning the endoscope with the optical connector and sealing the distal end of the drape around the protruding distal portion of the endoscope can also result in further contamination.
My earlier U.S. Pat. No. Re. 34,002 discloses a sterilizable video camera cover which has a connector including a guideway for receiving an unsterile video camera within it in a predetermined fixed orientation. One end of the video camera cover receives a sterile mount and endoscope in a fixed position with respect to the camera. An accordion-folded sleeve is positioned on the camera cover and is extended over the trailing cables of the camera to maintain the sterile environment within the operating room even though the camera and trailing cables are unsterile.
A sterile pouch for containing a standard still picture camera for use in an operating room is shown in U.S. Pat. No. 2,537,303 to Cobb, Jr. et al. However, there is no thought in this device of connecting the camera to other optical means. Other containers for protecting cameras in varying environments are shown in U.S. Pat. No. 3,026,784 to Byers, U.S. Pat. No. 3,821,759 to Vooght and U.S. Pat. No. 2,132,549 to Wenstrom. However, none of these references are intended for use in an operating room to maintain the environment within the operating room in a sterile condition when the camera is not sterile.
There are numerous references which disclose sterile drapes or covers for isolating an unsterile camera and its trailing cables from the sterile environment of an operating room. Examples of such references include U.S. Pat. No. 5,274,500 to Dunn, U.S. Pat. No. 5,078,483 to Herzberg, U.S. Pat. No. 5,198,894 to Hicks, and U.S. Pat. No. 5,325,846 to Szabo. While each of these references may be adequate for their intended purpose, none of these references disclose a device which allows endoscopes to be freely interchanged with a single camera setup and yet maintain the required sterility of an operating room. | 2024-01-11T01:27:04.277712 | https://example.com/article/6120 |
KEARNS, Utah — A man drowned at a fitness center pool in Kearns Saturday while trying to hold his breath under water for an extended time.
Lt. Brian Lohrke of the Unified Police Department said the incident occurred just before 9 a.m. at the Kearns Oquirrh Park Fitness Center, 5624 Cougar Lane.
The deceased has been identified as 39-year-old Gabriel Crowther.
Lohrke said the man was trying to practice holding his breath for an extended time, and the lifeguards on duty were aware of the man’s intention.
Lifeguards pulled the man from the pool and performed CPR. Paramedics responded and the man was ultimately pronounced deceased.
Police said deaths of this kind are uncommon but not unheard of.
“That’s the risk you take when doing that type of stuff,” Lohrke said. | 2024-02-18T01:27:04.277712 | https://example.com/article/6576 |
Downhill upset for Austrian
FRED LIEF
AP Sports WriterPublished: February 10, 2014 9:00AM
SOCHI, Russia (AP) -- Matthias Mayer shut his eyes for a moment, his day's work over.
If he had trouble believing what had just happened as he stood before the crowd it was with good reason. The Austrian struck a big upset Sunday in one of the Olympics' marquee events, capturing the men's downhill and upending the elite of his sport.
"It's amazing to be an Olympic champion," he said.
Mayer has never finished better than fifth in a World Cup downhill. That proved no obstacle in dismissing the preordained favorites -- Aksel Lund Svindal of Norway finished fourth and Bode Miller of the U.S. eighth.
Among the eight gold medalists on Day 3 were: snowboarder Jamie Anderson, the American slopestyle queen who triumphed in her sport's Olympic debut; Irene Wust, who showed why speedskating is Dutch territory; and Russia in team figure skating, likewise an Olympic newcomer, for its first gold in Sochi.
SKIING: In a country where skiing is revered, Mayer gave Austria a jolt. A few weeks ago he was not even considered the nation's best shot for gold. But he covered the Rosa Khutor course in 2 minutes, 6.23 seconds and beat Italy's Christof Innerhofer by 0.06 seconds. Norway's Kjetil Jansrud won the bronze. Miller, who dominated the training runs, was so unnerved by the change of visibility he thought he'd have "to do something magical to win." That was left to Mayer, who enjoys good skiing bloodlines -- his father, Helmut, won a super-G silver medal at the 1988 Calgary Games.
FIGURE SKATING: With Evgeni Plushenko and a captivating Julia Lipnitskaia winning the free skates, Russia took the team event without needing to worry about the concluding ice dance. President Vladimir Putin was among those in a crowd relishing this victory as the Russians drew away from the U.S. and Canada. Plushenko's body has been battered by 12 operations and he had to convince his federation he merited a spot in Sochi. "All the fans are cheering so hard that you literally cannot do badly because they do everything with you," Plushenko said. "You get goose bumps."
SNOWBOARDING: The U.S. now has a double gold hit in slopestyle, with Anderson doing her part a day after Sage Kotsenburg. "Even though it's just another competition, the stage and the outreach that this event connects to is out of control," Anderson said. Finland's Enni Rukajarvi won the silver. The bronze went to Jenny Jones, a 33-year-old former maid at a ski resort who gave Britain its first medal in any snow sport.
SPEEDSKATING: Another royal visit, more Dutch gold. Wust gave the Netherlands its second victory by winning the 3,000. Skating before her king and queen, Wust won in 4 minutes, 0.34 seconds. Defending champ Martina Sablikova of the Czech Republic took the silver while Olga Graf won bronze for Russia's first medal of the games. Claudia Pechstein, 41 and a six-time Olympian, was fourth. Wust, her nails red, white and blue like the Dutch flag, held up three fingers, signifying her third Olympic gold medal.
CROSS-COUNTRY: Switzerland's Dario Cologna had ankle surgery in November, but that now seems ancient. He won the 30-kilometer skiathlon, pulling away at the top of the last uphill section. The three-time overall World Cup winner claimed his second Olympic gold medal. He was timed in 1 hour, 8 minutes, 15.4 seconds. Defending champion Marcus Hellner of Sweden took silver, with the bronze to Norway's Martin Johnsrud Sundby.
BIATHLON: Slovakia's Anastasiya Kuzmina matched her gold from Vancouver in the women's 7.5-kilometer sprint. Kuzmina shot flawlessly and finished in 21 minutes, 6.8 seconds. The silver medal went to Russia's Olga Vilukhina and the bronze to Ukraine's Vita Semerenko. Kuzmina's brother is Russian biathlete Anton Shipulin, who was fourth Saturday.
LUGE: Felix Loch, still only 24, did it again. The German luger won his second straight Olympic gold medal, leaving the rest of the field in his icy wake. Loch completed four runs down the Sanki Sliding Center track in 3 minutes, 27.562 seconds -- 0.476 seconds ahead of Russia's Albert Demchenko, who won the silver in his seventh Olympics. Italy's Armin Zoeggeler won the bronze, giving him a record six medals in six games.
SKI JUMPING: In control from the start, Kamil Stoch of Poland won the Olympic gold in the men's normal hill individual ski jump. Stoch had the best jump in each round, putting first ahead of the silver medalist Peter Prevc of Slovenia and bronze medalist Anders Bardal of Norway. Thomas Morgenstern of Austria, returning from serious injuries from a fall during training a month ago, was 14th. Simon Amman of Switzerland, the defending champion from Vancouver who was seeking a record fifth Olympic gold medal, finished 17th. | 2024-04-16T01:27:04.277712 | https://example.com/article/4800 |
Come on in and join the club! Get our daily Manchester United email newsletter Sign me up! Thank you for subscribing We have more newsletters Show me See our privacy notice Invalid Email
Wayne Rooney will be offered a new contract by Manchester United.
Sir Alex Ferguson has moved to kill off speculation about Rooney’s future by insisting that he wants to open negotiations with the striker about extending his current deal.
Sunday Mirror Sport understands that Rooney will not hesitate to sign on the dotted line.
The 27-year-old, who has just over two seasons years left on the five-year, £250,000-a-week contract he signed in October 2010, wants to spend the peak years of his career at Old Trafford.
Rooney’s omission from the United team eliminated from the Champions League by Real Madrid in midweek sparked reports that the England international would be sold in the summer.
But Ferguson promised that United would be making a serious intent.
“There is absolutely no issue about a new contract for Wayne,” said the United boss.
“When it is time to renegotiate with Wayne it will be done.
“We don’t want our best players to leave and Wayne is coming into his mature years.
“He got me 32 goals last season and, although he’s had issues with illness and injuries this year, and hasn’t had a long run of games, he’s already got me 14 goals.
“For people to suggest that I don’t talk to Wayne on the training ground is absolute b******s. It’s an insult to me and to Wayne.”
(Image: Shaun Botterill)
Robin van Persie has emerged as United’s top shot this season and several remarks made about Rooney’s fitness levels have been seen as a sign that Ferguson is not happy with his lifestyle choices.
There would have been no shortage of takers had United looked to recoup the £20million they paid Everton for Rooney in 2004.
But it is understood that the player would have resisted any attempt to move him abroad and is desperate to stay close to his family in the north west.
Rooney’s wife Coleen is expecting the couple’s second child and is still mourning the tragic death of her 14-year-old sister Rosie in January.
Meanwhile, Ferguson wants to bring Luka Modric back to the Premier League. | 2023-11-03T01:27:04.277712 | https://example.com/article/5052 |
List of steam locomotives in Slovenia
This page is a list of the steam locomotives in Slovenia. Numerous steam locomotives are plinthed across the country. In addition there are locomotives on display at Slovenian Railway Museum.
List
References
External links
Another List
Museum Stock List
Steam locomotives
Steam locomotives, Slovenia | 2023-11-08T01:27:04.277712 | https://example.com/article/1895 |
Q:
Read file of repeated "key=value" pairs into DataFrame
I have a txt file with data in this format. The first 3 lines repeat over and over.
name=1
grade=A
class=B
name=2
grade=D
class=A
I would like to output the data in a table format, for example:
name | grade | class
1 | A | B
2 | D | A
I am struggling to set the headers and just loop over the data. What I have tried so far is:
def myfile(filename):
with open(file1) as f:
for line in f:
yield line.strip().split('=',1)
def pprint_df(dframe):
print(tabulate(dframe, headers="keys", tablefmt="psql", showindex=False,))
#f = pd.DataFrame(myfile('file1')
df = pd.DataFrame(myfile('file1'))
pprint_df(df)
The output from that is
+-------+-----+
| 0 | 1 |
|-------+-----|
| name | 1 |
| grade | A |
| class | B |
| name | 2 |
| grade | D |
| class | A |
+-------+-----+
Not really what I am looking for.
A:
You can use pandas to read the file and process the data. You may use this:
import pandas as pd
df = pd.read_table(r'file.txt', header=None)
new = df[0].str.split("=", n=1, expand=True)
new['index'] = new.groupby(new[0])[0].cumcount()
new = new.pivot(index='index', columns=0, values=1)
new Outputs:
0 class grade name
index
0 B A 1
1 A D 2
A:
I know you have enough answers, but here is another way of doing it using dictionary:
import pandas as pd
from collections import defaultdict
d = defaultdict(list)
with open("text_file.txt") as f:
for line in f:
(key, val) = line.split('=')
d[key].append(val.replace('\n', ''))
df = pd.DataFrame(d)
print(df)
This gives you the output as:
name grade class
0 1 A B
1 2 D A
Just to get another perspective.
A:
What you could also do is read your textfile file in blocks of 3, build a nested list, and put that in a dataframe:
from itertools import zip_longest
import pandas as pd
# taken from https://docs.python.org/3.7/library/itertools.html:
def grouper(iterable, n, fillvalue=None):
"Collect data into fixed-length chunks or blocks"
# grouper('ABCDEFG', 3, 'x') --> ABC DEF Gxx"
args = [iter(iterable)] * n
return zip_longest(*args, fillvalue=fillvalue)
data = [['name', 'grade', 'class']]
with open(file, 'r') as fobj:
blocks = grouper(fobj, 3)
for b in blocks:
data.append([i.split('=')[-1].strip() for i in b])
df = pd.DataFrame(data[1:], columns=data[0])
df would directly be
name grade class
0 1 A B
1 2 D A
Note #1: Although this makes for more lines of code than a pure pandas solution, in my experience it is likely to be more efficient since it uses less pandas functions thus less overhead.
Note #2: In general I would argue that it would be better to store your input data in another format, e.g. json or csv. that would make it much more easy to read, for example with the pandas function read_csv in case of a csv file.
| 2023-10-04T01:27:04.277712 | https://example.com/article/6231 |
Q:
How to check for an amount of a certain data type in list?
I am writing an UnoPlayer.java code for a main method that has already been written out in order to test the legality of our UnoPlayer method.
I am trying to check to see if the amount of one color (a data type) in my hand is greater than the amount of the other colors.
hand is a list type!!
So, for Color.BLUE, I have this:
if (hand.contains(Color.BLUE > Color.RED && Color.GREEN && Color.YELLOW)) {
colorReturned = Color.BLUE;
}
I know that this does not work because my Color data type does not work with binary operands because they are not ints. How would I code it so that it says
//if (hand contains more Color.BLUE than the rest of the colors) {
//returns Color.BLUE }
here is the card implementation:
private UnoPlayer.Color color;
private UnoPlayer.Rank rank;
private int number;
public Card(UnoPlayer.Color color, UnoPlayer.Rank rank) {
this.color = color;
this.rank = rank;
this.number = -1;
}
public Card(UnoPlayer.Color color, int number) {
this.color = color;
this.rank = UnoPlayer.Rank.NUMBER;
this.number = number;
}
public Card(UnoPlayer.Color color, UnoPlayer.Rank rank, int number) {
this.color = color;
this.rank = rank;
this.number = number;
}
A:
The problem is that you're not using contains correctly, according to Java docs, the method contains returns a boolean variable (true or false depending on whether a value exists in the list). However you're inputting a boolean expression, when contains takes an Object as a parameter.
My suggestion to checking if a certain data type occurs the most in a list, I would first sort the list, then keep count of the highest occurring data type like so,
Collections.sort(hand);
int prev = hand.get(0);
int occursMost = hand.get(0);
int count = 1;
int maxCount = 1;
for (int i = 1; i < hand.length; i++) {
if (a.get(i) == prev)
count++;
else {
if (count > maxCount) {
popular = a.get(i-1);
maxCount = count;
}
prev = hand.get(i);
count = 1;
}
}
if(occursMost == Color.BLUE) {
colorReturned = Color.BLUE;
}
A little bit how this works, so let's say your hand looks like this
GREEN, BLUE, RED, GREEN, BLUE, BLUE
I'm not quite sure about the int values behind the colors but after sorting, the hand could looks like this,
GREEN, GREEN, RED, BLUE, BLUE, BLUE
The loop will start at green, then keep incrementing count until a different color is found. Once a different color is found, count is checked with maxCount to see if the most popular color so far has been found. Then it resets count and starts counting the occurrences of the next color in the list. At the end of the loop, the most popular color in the list should be set.
| 2023-11-24T01:27:04.277712 | https://example.com/article/3839 |
Q:
Use Java for loop and create variable from output
I'm trying to make a variable out of the result of a for loop. First of all is this possible? If it is possible how do i do it? This is my code so far:
Random r = new Random();
Random n = new Random();
int p = (int)(n.nextInt(14));
for (int i = 0; i < p; i++) {
char c = (char) (r.nextInt(26) + 'a');
System.out.println(c);}
String word = ("output of forloop goes here");
I want to put all the randomly generated letters into one word using the for loop. How do I do this?
A:
Use StringBuilder :
StringBuilder sb = new StringBuilder();
for (int i = 0; i < p; i++) {
char c = (char) (r.nextInt(26) + 'a');
sb.append(c);
}
Then you can call sb.toString() to get the resulting String.
| 2024-01-01T01:27:04.277712 | https://example.com/article/1471 |
Article number: 500404129 Product: Jump Ramp
• The Ramp from the set is now also available for universal use • Rugged Layout/Construction • Two jump-off Areas (different angles) for backflip and further jumps | 2024-02-22T01:27:04.277712 | https://example.com/article/2809 |
Mercedes-Benz World Driving Experiences To Be Won At
Easter
MILTON KEYNES, UNITED KINGDOM – Marc 15, 2013: Free Driving
Experiences for all the family are on offer to the winners of the
Mercedes-Benz World Easter Trail that starts on 30 March and runs
throughout the school holidays until 14 April.
The Easter Trail takes in all the inspiring attractions and exhibitions
at Mercedes-Benz World including View Suspended II with its 3,200 precision
crafted parts of a modern day Formula 1™ car suspended in mid air;
and Driven, the interactive zone of icons and innovations, featuring a
virtual versus reality challenge where visitors can put their driving
skills on Playstation 3’s Gran Turismo® 5 to the test and see if they
can beat the time set by Formula 1™ star, David Coulthard in a real
SLS AMG.
Not only will Easter holiday visitors find plenty to do, following the
indoor trail over three floors of Mercedes-Benz World and discovering
fascinating facts and stories from the world’s leading premium car
brand. Those who complete the trail will be entered into a prize draw to
win Driving Experiences for all the family that includes - two Little
Learners sessions for three to five year olds, two Under 16s Driving
Experiences, two adventurous 4x4 Driving Experiences and two thrilling AMG
Driving Experiences.
There’s even more to entertain the family at Mercedes-Benz World
over the Easter break. Every day the Silvers Arrows Display Team will be
putting on a breath-taking performance of awe-inspiring performance
driving. Better still, each day lucky visitors will win the chance to sit
alongside the mysterious drivers dressed in silver race suits and helmets
for an unforgettable passenger ride.
And it’s not just the Silvers Arrows Display Team drivers that get
to enjoy the purpose built circuits and Wet Skid Circle at Mercedes-Benz
World. Hot Laps on the circuits and Mud Laps across off-road terrain are
available from just £15 per passenger.
For those who want to get behind the wheel themselves a variety of
Driving Experiences are on offer. Under 16s Driving Experiences are
available every day of the school holiday. So long as they are over 1.5
metres tall and can reach the pedals, Under 16s can develop driving skills
in dual control cars, accompanied by a qualified driving coach. There is
also a 4x4 option where Under 16s can enjoy an off-road adventure through
water crossings and over extreme terrain in the latest Mercedes-Benz
M-Class.
Youngsters between three and five years old can also join in the fun
with Little Learners - a special indoor driving zone where they can drive
an electric miniature Mercedes. A 15 minute experience costs just £5.
The driving is not just for kids and teenagers. There is also a range of
thrilling driving experiences for anyone with a driving licence, including
the adrenaline rush of the AMG Driving Experience, the SLS AMG Driving
Experience and | 2023-08-07T01:27:04.277712 | https://example.com/article/1414 |
Immutable = require 'immutable'
describe 'Updater: unread', ->
beforeEach ->
@unread = require 'updater/unread'
it 'should define methods', ->
expect(@unread.check).toBeDefined()
describe 'method: check', ->
store = null
checkData = null
_teamId1 = _targetId1 = _targetId2 = unread1 = null
getCheckData = (_teamId, _targetId, unread) ->
_targetId1 = _targetId
unread = unread
unreadData = {}
unreadData[_targetId1] = unread
Immutable.fromJS
_teamId: _teamId
data: unreadData
getStore = (_teamId, _targetId) ->
notifications = {}
notifications[_teamId] = [
{_targetId: _targetId, unreadNum: 0, isMute: false}
{_targetId: _targetId2, unreadNum: 0, isMute: true}
]
Immutable.fromJS
notifications: notifications
beforeEach ->
_teamId1 = '_teamId1'
_targetId1 = '_targetId1'
_targetId2 = '_targetId2'
unread1 = 1
checkData = getCheckData(_teamId1, _targetId1, unread1)
store = getStore(_teamId1, _targetId1)
it 'should update notifications', ->
newStore = @unread.check(store, checkData)
unreadNum = newStore
.getIn ['notifications', _teamId1]
.find (n) ->
n.get('_targetId') is _targetId1
.get('unreadNum')
expect(unreadNum).toBe unread1
it 'should update teams unread', ->
newStore = @unread.check(store, checkData)
teamUnread = newStore.getIn ['teams', _teamId1, 'unread']
expect(teamUnread).toBe unread1
it 'should not update team unread if notifications is muted', ->
checkData = checkData.setIn ['data', _targetId2], 100
newStore = @unread.check(store, checkData)
teamUnread = newStore.getIn ['teams', _teamId1, 'unread']
expect(teamUnread).toBe unread1
it 'should clear unread if unread data is an empty object', ->
store = store.updateIn ['notifications', _teamId1], (notifications) ->
notifications.push Immutable.fromJS({_targetId: '_targetId3', unreadNum: 1, isMute: false})
newStore = @unread.check(store, Immutable.fromJS({_teamId: _teamId1, data: {}}))
teamUnread = newStore.getIn ['teams', _teamId1, 'unread']
expect(teamUnread).toBe 0
| 2024-06-19T01:27:04.277712 | https://example.com/article/8145 |
Miriam Jenkins
Miriam Sheppard ( Jenkins, born 10 February 1986) is a former New Zealand athlete. She was the 2009 ITU Paratriathlon World Champion in TRI3 classification. In addition, she represented New Zealand at the 2004 Summer Paralympic Games. in Athens, Greece, in swimming, as well as at the 2005 CPISRA World Games – in both swimming and track & field. Jenkins is affected by mild cerebral palsy in her left side.
Jenkins began her swimming career in 2000 at the New Zealand College Games in her hometown of Hamilton, New Zealand, where she won eight gold medals and set several national junior records. At the 2001 Paralympics New Zealand Championships she won seven gold and five silver medals in swimming and won the Halberg Trust junior scholarship prize. Jenkins was named to her first national team in 2002, competing at the British Open in Sheffield, England, and the USA Swimming National Disability Championships. In 2003 she won medals at the ISMWSF World Wheelchair Championships, and early the following year was named to New Zealand's Paralympic Team.
At the Athens 2004 Paralympic Games, Jenkins placed sixth in her heat of the S9 women's 400 m freestyle and did not qualify for the final, which was eventually won by South Africa's Natalie du Toit. She received a New Zealand University Blue award, one of only two Paralympians to do so, in 2004 while she was a student at the University of Waikato.
The following year, she won titles at the CPISRA World Games in New London, Connecticut, in the 100m freestyle, 400m freestyle and 200m individual medley, as well as the 800m track race. Additionally, Jenkins earned silvers in the 50m freestyle and 100m backstroke, and the 400m track event. Until the end of 2005, Jenkins was supported by the now-defunct Peter Snell Institute of Sport.
Jenkins was named as a member of New Zealand's first Paratriathlon team for the 2009 ITU Triathlon World Championships Grand Final in Gold Coast, Queensland, Australia. On 9 September she competed in the age-group event in the Aquathlon, and followed this with a victory three days later in the standard distance Paratriathlon race. Jenkins was the sole gold medallist on the New Zealand standard distance team (including elite), the only other gold being won by sprint distance age-group athlete, Maddie Dillon.
She competed at the 2012 ITU World Triathlon Grand Final in Auckland, New Zealand and won bronze in TRI3 classification. She was a panel member at the ITU Women's Committee Conference.
In December 2009, she was named Waikato Sportswoman of the Year and was later nominated for a Halberg award as well as for the "Performance of the Year" award at the Triathlon New Zealand 2010 Awards.
Jenkins studied at the University of Otago in Dunedin, New Zealand and worked for the New Zealand Department of Conservation.
Since August 2019, she has worked at the International Paralympic Committee as World Para Athletics Competition Coordinator.
References
External links
Category:1986 births
Category:Living people
Category:New Zealand female swimmers
Category:New Zealand female athletes
Category:Paralympic swimmers of New Zealand
Category:Paralympic athletes of New Zealand
Category:Swimmers at the 2004 Summer Paralympics
Category:University of Otago alumni
Category:University of Waikato alumni | 2024-02-11T01:27:04.277712 | https://example.com/article/8077 |
Introduction {#s1}
============
Desmoid tumors, also known as aggressive fibromatosis, are mesenchymal tumors that show marked local aggressiveness, but rarely metastasize, and do not cause disease-specific death if they are not located at anatomically critical sites [@pone.0096391-Fiore1], [@pone.0096391-Escobar1]. Extra-peritoneal desmoid tumors, which are usually sporadic in nature, occur across a wide age range, and can arise at virtually any body site. Extensive surgical resection has been the standard treatment for decades. However, radical surgical intervention and/or repeated surgery due to a high recurrence rate (range 34--53% at 5 years) [@pone.0096391-Shido1], [@pone.0096391-Ballo1] occasionally lead to significant treatment-related morbidity including amputation or significant functional impairment. Several reports have failed to demonstrate the significance of margin status in surgery for local recurrence [@pone.0096391-Shido1]--[@pone.0096391-Lev1], while spontaneous regression has also been reported [@pone.0096391-Lev1], [@pone.0096391-Gronchi1]. Several authors recently demonstrated the effectiveness of conservative treatment for desmoid tumors including radiotherapy and pharmacological treatment [@pone.0096391-Anthony1], [@pone.0096391-Nuyttens1]. Pharmacological treatment includes anti-hormone, NSAIDs, and targeted and traditional cytotoxic chemotherapies [@pone.0096391-Escobar1], [@pone.0096391-Barbier1]--[@pone.0096391-Nishida1]. However, the efficacy of these treatments cannot be predicted, and so remains a crucial problem.
β-catenin plays various important roles in the tumorigenesis of desmoid tumors, and has a diagnostic potential to differentiate them from other lesions [@pone.0096391-Carlson1], [@pone.0096391-Ng1]. The nuclear accumulation of β-catenin causes activation of Wnt signaling, and in turn transcription of target genes in fibroproliferative disease [@pone.0096391-Kikuchi1]. Most desmoid tumors arise sporadically, with a minority associated with familial adenomatous polyposis (FAP), which is caused by a germline mutation of the adenomatous polyposis (APC) gene [@pone.0096391-Kikuchi1]. APC protein forms β-catenin destruction complex and is involved in the regulation of Wnt signaling. Several recent studies have reported point mutations of CTNNB1 (β-catenin) exon3. These mutations, occurring at codon 41 and 45, were found in about 64--85% of all sporadic desmoids, with p.T41A (threonine to alanine), p.S45F (serine to phenylalanine), and p.S45P (serine to proline) being the most frequent ones [@pone.0096391-Salas1]--[@pone.0096391-Dmont1]. These mutations were considered to lead to stabilization of β-catenin and tumorigenesis in desmoid tumors, suggesting that the status of CTNNB1 mutations might influence the efficacy of various treatments for patients with these tumors.
We previously reported the clinical results of consecutive patients prospectively treated with meloxicam, a cyclooxygenase-2 selective inhibitor [@pone.0096391-Nishida1], [@pone.0096391-Nishida2], [@pone.0096391-Nishida3]. The efficacy of meloxicam treatment varied among patients, indicating that biological markers are required to predict its efficacy in individual patients. Because consecutive patients were prospectively treated with the same medication, meloxicam, without other treatments, this cohort is particularly suitable to identify a biological marker predictive of the efficacy of this treatment. The aims of this study were to prospectively analyze the status of CTNNB1 mutations in consecutive patients with extra-peritoneal desmoid tumors treated with meloxicam, and to determine the significance of mutational status in predicting the efficacy of meloxicam treatment.
Materials and Methods {#s2}
=====================
Ethics statement {#s2a}
----------------
The study protocol was approved by the Institutional Review Board (IRB) of Center for Advanced Medicine and Clinical Research, Nagoya University (approval ID: 1322), and written informed consent was obtained from all participants before the study commenced. The individuals in this manuscript have given written informed consent to publish these case details
Patients and Tumor Tissues {#s2b}
--------------------------
There were 41 consecutive cases with extra-abdominal or abdominal wall desmoid tumors diagnosed in our institutions since 2003. They were all prospectively treated with meloxicam, a selective COX-2 inhibitor. Eight cases were excluded from this study. Three cases had been followed for less than 6 months, and two refused meloxicam treatment. In two cases, biopsy specimens were not available for analysis. One case was subsequently correctly diagnosed with another disease. There was no case with FAP-associated desmoid tumor. Finally, this study was composed of thirty-three consecutive patients with extra-peritoneal desmoid tumor prospectively treated with meloxicam without any other treatment previously. No patients received other medical treatments or radiotherapy during the meloxicam treatment. All thirty-three cases were histologically evaluated as having desmoid tumor by specialized pathologists.
Efficacy of meloxicam treatment {#s2c}
-------------------------------
As described in our previous study [@pone.0096391-Nishida1], meloxicam was administered orally at 10 mg/day. Baseline imaging of desmoid tumors by magnetic resonance imaging (MRI) and/or computed tomography (CT) was obtained before starting treatment. Patients treated with meloxicam were followed with physical and radiological examinations with MRI and/or CT at the outpatient unit of our institution every 3 to 6 months. The efficacy of meloxicam was evaluated according to Response Evaluation Criteria in Solid Tumors (RECIST) measured with MRI or CT at the latest follow-up or the end of meloxicam treatment. [@pone.0096391-Therasse1]. When patients were evaluated as showing a complete response (CR), they discontinued meloxicam. Patients with partial response (PR) or stable disease (SD) continued meloxicam. Patients with evaluation of PD could stop this treatment and chose other treatment modalities including low-dose chemotherapy or surgery depending on the tumor status, including location and aggressiveness. Considering that meloxicam has minimal side effects, SD status is thought to be preferable. Patients were divided into two groups, namely a favorable group (CR, PR, SD) and unfavorable group (PD). Age, gender, site, tumor size, follow-up period, and mutational status of CTNNB1 were examined as possible prognostic factors for responsiveness to meloxicam.
Mutation analysis of CTNNB1 {#s2d}
---------------------------
All patients received needle or incisional biopsy for histological diagnosis. Some of the obtained specimens were snap-frozen, and stored at −80°C for DNA and/or RNA analyses. DNA was extracted from frozen tissue or 5-µm-thick formalin-fixed, paraffin-embedded tissue by the High Pure PCR Template Preparation Kit (Roche Molecular Diagnostics, Mannheim, Germany), according to the manufacturer\'s instructions. DNA was first amplified by polymerase chain reaction (PCR) of 40 cycles at an annealing temperature of 58°C using LightCycler 480 System (Roche). To analyze the existence of point mutations in codons 41 or 45 of CTNNB1 exon 3, we designed 2 pairs of primers: forward 5′- GATTTGATGGAGTTGGACATGG-3′, reverse 5′-TCTTCCTCAGGATTGCCTT-3′, and forward 5′- TGGAACCAGACAGAAAAGCG-3′, reverse 5′- TCAGGATTGCCTTTACCACTC -3′. The expected sizes of the amplified products were 149 and 118 bp, respectively. PCR products were isolated by gel electrophoresis in 2% agarose, and amplified bands were extracted and purified using the QIAquick gel extraction kit (Qiagen, Valencia, CA). Purified products were subjected to direct sequencing using the above primers (forward), with Applied Biosystems Big Dye Terminator V3.1, and Applied Biosystems 3730x DNA analyzer (Applied Biosystems, Foster City, CA) at FASMAC Co. Ltd. (Kanagawa, Japan). All sequencing results were compared with those in the databases of NCBI-BLAST to confirm the mutation sites.
Immunohistochemistry {#s2e}
--------------------
Biopsy specimens fixed in 10% formalin and embedded in paraffin were subjected to immunohistochemical study for β-catenin. As described previously [@pone.0096391-Hamada1], the slides were incubated for overnight at 4°C with anti-human β-catenin mouse monoclonal antibody (M3539; Dako, Carpinteria, CA; dilution, 1∶200 dilution), and counterstained with hematoxylin, dehydrated, and mounted [@pone.0096391-Urakawa1]. Nuclear positivity of β-catenin was evaluated by two independent observer (S. H., N. F.) without any knowledge of the clinicopathological information, and divided into 4 groups; 0% for positive stainable cell number (negative; 0), 1% to 9% (weak; 1+), 10% to 50% (moderate; 2+) and 51% to 100% (strong; 3+) on 10 independent high-power fields. The relationship between mutation status of β-catenin and nuclear positivity of β-catenin was analyzed.
Statistical evaluation {#s2f}
----------------------
Data were analyzed using the Fisher\'s exact test for dichotomous variables to examine correlations between the efficacy of meloxicam and clinical characteristics and between the mutation status of CTNNB1 and clinicopathological characteristics. Continuous variables of age and tumor size were compared between the two groups using the Mann-Whitney U test and between the multinomial groups using one-way analysis of variance. All statistical analyses were performed using SPSS version 20. P\<0.05 was considered significant.
Results {#s3}
=======
Clinical features and efficacy of meloxicam treatment {#s3a}
-----------------------------------------------------
Of the 33 patients prospectively treated with meloxicam, 11 were male, and 22 were female. The mean age was 41.6 years (median, 37.0 years; range, 10--74 years). The anatomic distribution of the tumors was the abdominal wall in 7 patients, neck 5, forearm and back 4 each, chest wall and thigh 3 each, shoulder 2, and upper arm, calf, foot, groin and retroperitoneum one each. The diameter of the tumor ranged from 20 to 220 mm (mean, 84 mm; median, 72 mm). No patients had received radiotherapy or other treatment for desmoid tumors prior to the meloxicam treatment. The median follow up was 36.6 months (10--120 months). The median period of medication was 15.2 months (range, 3 to 113 months). Of the 33 patients evaluated, there was one patient with CR, 7 with PR, 12 with SD, and 13 with PD. Of the 13 cases with PD, three were subjected to surgical treatment, and 8 to low-dose and/or doxorubicin-based chemotherapy. There were no significant differences in gender (p = 0.46), age (p = 0.34), tumor size (p = 0.63), or site of involvement (p = 0.22) between the favorable and unfavorable groups ([Table 1](#pone-0096391-t001){ref-type="table"}).
10.1371/journal.pone.0096391.t001
###### Patient characteristics between two prognosis groups.
{#pone-0096391-t001-1}
Variables Favorable group (n = 20) Unfavorable group (n = 13) P value
---------------------------------- -------------------------- ---------------------------- ---------
Gender 0.46
Female 12 (60%) 10 (77%)
Male 8 (40%) 3 (23%)
Mean age, years (range) 36.8 (10--74) 44.6 (20--73) 0.34
Mean size, mm (range) 84.5 (23--159) 83.0 (20--220) 0.63
Median follow up, months (range) 35.0 (10--120) 36.9 (13--85) 0.83
Site 0.22
Abdominal wall 3 (15%) 4 (31%)
Other trunk 5 (25%) 4 (31%)
Extremities 10 (50%) 2 (23%)
Neck 2 (10%) 3 (15%)
Mutation status of CTNNB1 and efficacy of meloxicam treatment {#s3b}
-------------------------------------------------------------
We performed genotyping of CTNNB1 exon 3 for all the cases. Point mutations were identified in 21 of the 33 cases (64%), and occurred in only 2 codons (41 and 45). Replacement of threonine by alanine (T41A) in codon 41 was detected in 16 cases (49%). Replacement of serine by phenylalanine (S45F) in codon 45 was detected in 4 (12.1%), and replacement of serine by proline (S45P) in codon 45 was detected in one (3.0%; [Figure 1](#pone-0096391-g001){ref-type="fig"}).
{#pone-0096391-g001}
In 7 cases with desmoid tumor arising in the abdominal wall, 4 did not have mutations in exon 3 (wild type), 2 had codon 45 mutations (S45F and S45P) and one had a codon 41 mutation (T41A). In other sites, T41A was the most frequent mutation. The mean age of each mutation group was lower than that of the wild-type group, and the mean tumor size of each mutation group was larger than that of wild-type. However, there were no significant differences in gender (p = 0.67), age (p = 0.57), tumor size (p = 0.47), or site (p = 0.23) between the groups ([Table 2](#pone-0096391-t002){ref-type="table"}).
10.1371/journal.pone.0096391.t002
###### Relationship between CTNNB1 mutation status with clinical and pathological characteristics, and efficacy of meloxicam.
{#pone-0096391-t002-2}
Mutation status
-------------------------------------------------------------- ----------------- ------ ------- ------- -------
Gender (Female/Male) 7/5 12/4 2/2 1/0 0.67
Mean age, year 45.0 40.7 38.5 26.0 0.57
Mean Size, mm 74.7 82.4 106.5 118.0 0.47
Site 0.23
Abdominal wall 4 1 1 1
Other trunk 2 5 2 0
Neck 1 3 1 0
Extremities 5 7 0 0
Efficacy of meloxicam 0.053
Favorable group (CR, PR, SD) 8 11 0 1
Unfavorable group (PD) 4 5 4 0
β-catenin nuclear positivity[a](#nt102){ref-type="table-fn"} 0.035
Moderate (2+) 5 11 0 0
Strong (3+) 7 5 4 1
WT; wild type, CR; complete response, PR; partial response, SD; stable disease, PD; progressive disease.
No cases showed negative (0) or weak (1+) positive.
S41F vs other type.
In analyses of the correlation of mutation status of CTNNB1 and efficacy of meloxicam treatment, mutation status showed a trend to associate with efficacy (p = 0.053, [Table 2](#pone-0096391-t002){ref-type="table"}). Focusing on the S45F mutation, all 4 cases with 45F mutation showed PD, and no cases in the favorable group (0/20 cases) had S45F mutation (p = 0.017, [Table 3](#pone-0096391-t003){ref-type="table"}), whereas cases with T41A or wild type did not show a significant association with the efficacy of meloxicam. Representative cases are shown in [Figures 2](#pone-0096391-g002){ref-type="fig"} and [3](#pone-0096391-g003){ref-type="fig"}.
{#pone-0096391-g002}
{#pone-0096391-g003}
10.1371/journal.pone.0096391.t003
###### S45F mutation status and efficacy of meloxicam.
{#pone-0096391-t003-3}
S45F (+) S45F(−)
------------------------------ ---------- ---------
Favorable group (CR, PR, SD) 0 20
Unfavorable group (PD) 4 9
P = 0.017.
Correlation of nuclear β-catenin staining and mutation type {#s3c}
-----------------------------------------------------------
As reported previously [@pone.0096391-Hamada1], positive nuclear staining for β-catenin was observed in all 33 cases, and there was no case with weak positive staining (1+). Strong positive (3+) indicated a poor prognosis in comparison with moderate (2+) staining (p = 0.032). There was a significant correlation between the nuclear positivity of β-catenin and CTNNB1 mutation status (p = 0.035), and all four cases with S45F mutation exhibited strong positive (3+) staining ([Table 2](#pone-0096391-t002){ref-type="table"}).
Discussion {#s4}
==========
Dysregulation of the Wnt/β-catenin signaling pathway is a common molecular event in desmoid tumors [@pone.0096391-Bowley1]. The nuclear accumulation of β-catenin caused by CTNNB1 or APC mutation subsequently activates T-cell factor, which in turn causes transcription of target genes such as c-MYC and cyclin D [@pone.0096391-Bowley1], [@pone.0096391-Tajima1]. In practice, mutations of CTNNB1 exon3 gene are found in a wide variety of human cancers, and occur between codon 32 and 45, the site of phosphorylation by GSK3β or CK1α [@pone.0096391-Kikuchi1], [@pone.0096391-Oikonomou1]. Regarding desmoid tumors, β-catenin mutations are restricted to exon 3 of CTNNB1, and several larger studies have described a high frequency of mutations (64%--85%) in codons 41 and 45 [@pone.0096391-Salas1]--[@pone.0096391-Dmont1], [@pone.0096391-Colombo2]. In this study, we used not only frozen specimens but also paraffin-embedded tissue extracts, as described in other reports [@pone.0096391-Farrugia1], [@pone.0096391-Amary1]. CTNNB1 point mutations were observed in 21 of the 33 cases (64%). The majority (76%) of them were T41A mutations, whereas the others were codon 45 (S45F and S45P). These results are consistent with the results of previous reports that showed T41A to be the predominant type of mutation [@pone.0096391-Lazar1], [@pone.0096391-Huss1]. Thus these two specific mutations (T41A and S45F) may play crucial roles in the pathogenesis of desmoid tumors.
Several reports have focused on the correlation between CTNNB1 mutation type and local recurrence after surgery in desmoid tumors [@pone.0096391-Lazar1], [@pone.0096391-Dmont1], [@pone.0096391-Colombo2]. Colombo et al. reported that mutation status was the only poor prognostic factor predictive of local recurrence of desmoid tumors in an analysis of 179 surgical cases [@pone.0096391-Colombo2]. Lazar et al. showed that the five-year recurrence-free survival was significantly worse in 45F-mutated desmoids than either 41A-mutated or nonmutated ones [@pone.0096391-Lazar1]. In contrast, two other reports did not identify any association between mutation type and recurrence risk after surgery [@pone.0096391-Dmont1], [@pone.0096391-Mullen1]. Mullen et al. showed that 2-year recurrence rates in mutated tumors (64%) were slightly worse than those in wild-type (77%), although the difference failed to reach statistical significance [@pone.0096391-Mullen1].
In our study, all four cases with S45F mutation exhibited PD, indicating that S45F status is a significant poor prognosticator for meloxicam treatment. In tumors with other mutation status including T41A mutation and wild-type, the efficacy of meloxicam could not be predicted. Although several previous studies reported the predictive value of CTNNB1 mutation type for the outcome of surgical treatment, the current study analyzed for the first time the significance of CTNNB1 mutations in the prediction of efficacy for conservative treatment. Recently, several reports proposed treatment algorithms for patients with desmoid tumors, mainly based on conservative therapy including a "wait and see" policy [@pone.0096391-Bonvalot1], [@pone.0096391-Gronchi2], although molecular determinants were not described in these studies. As the current study indicated, CTNNB1 mutation type may be a possible determinant for successful conservative treatment including meloxicam treatment and "wait and see" policy.
The nuclear expression of β-catenin has increasingly been used in the differential diagnosis of spindle cell neoplasms because of the high positivity rate of desmoid tumors [@pone.0096391-Carlson1], [@pone.0096391-Bhattacharya1], [@pone.0096391-LeGuellec1]. Results of these previous reports are consistent with those of our study, showing that all cases showed equal or higher than moderate (2+) positive staining of nuclear β-catenin expression. Several previous studies reported the significance of nuclear expression of β-catenin in surgically treated patients with desmoid tumors [@pone.0096391-Lazar1], [@pone.0096391-Gebert1]. However, the results of these studies are controversial, probably because immunohistochemical assessment may depend on the various parameters such as the antibody, technique and/or observation methods selected. The staining intensity may vary at different times, and be heterogeneous in different areas of the same tumors. Our previous study for the first time demonstrated that nuclear expression of β-catenin is a significant prognosticator for conservative treatment with meloxicam [@pone.0096391-Hamada1]. The current study showed a positive correlation between nuclear β-catenin staining and S45F mutation. In contrast, Lazar et al. reported that cases with CTNNB1 S45F mutations exhibited a less intense β-catenin staining compared to those with T41A mutations [@pone.0096391-Lazar1]. Taking these findings together, although immunohistochemical evaluation serves as a useful reference to predict the outcome of surgery or conservative treatment for patients with desmoid tumors, more definitive prognosticators, including mutation type as shown in the current study, are also required.
The limitations of this study include the fact that the sample size was relatively small compared to previous mutation studies with larger numbers of cases. However, the cohort of this study is composed of prospectively treated patients with meloxicam, while no previous studies have reported the significance of CTNNB1 mutation type in conservative treatment. The results derived from this study provide meaningful information. Second, CTNNB1 mutation was analyzed only in exon 3. Other significant mutations may exist in different areas of CTNNB1. Third, due to the small number of cases, we could not analyze the relationship between mutation status and period up to onset of efficacy for meloxicam treatment. Future studies with more accumulated cases with molecular analysis will be needed to clarify the further correlation between the prognosis and mutation status.
In conclusion, we demonstrate for the first time that S45F mutation of CTNNB1 may serve as a prognostic marker in patients with sporadic desmoid tumors treated with conservative treatment with meloxicam. Given the current shift in the treatment modality for patients with desmoid to conservative treatment, the identification of prognosticators for conservative treatment is more important than ever. Mutation status of CTNNB1 may be a promising tool to predict the efficacy of conservative treatment including meloxicam.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: YN SH HU NI. Performed the experiments: SH NF KI EK. Analyzed the data: SH YN EK NI. Contributed reagents/materials/analysis tools: SH NF KI HU. Wrote the paper: SH YN NI.
| 2024-05-23T01:27:04.277712 | https://example.com/article/8333 |
679 N.W.2d 734 (2004)
STATE of Minnesota, Respondent,
v.
Darryl Lewis BERGH, Appellant.
No. A03-1577.
Court of Appeals of Minnesota.
May 18, 2004.
*735 Mike Hatch, Attorney General, St. Paul, MN; and Doug Johnson, Washington County Attorney, Heather D. Pipenhagen, Assistant Washington County Attorney, Stillwater, MN, for respondent.
Charles A. Ramsay, Ramsay, DeVore & Olson, P.A., Roseville, MN, for appellant.
Considered and decided by MINGE, Presiding Judge; SHUMAKER, Judge; and CRIPPEN, Judge.[*]
*736 OPINION
GORDON W. SHUMAKER, Judge.
Appellant challenges the district court's refusal to prohibit the use of a prior Colorado driving while intoxicated (DWI)-related driver's license revocation to enhance Minnesota impaired driving offenses. Because the prior revocation arises from a violation of appellant's Minnesota constitutional rights, the prior revocation cannot be used to enhance Minnesota offenses, and we reverse.
FACTS
The Minnesota Impaired Driving Code presents a scheme of penalties and enhanced penalties for driving, operating, or being in physical control of a motor vehicle while impaired from alcohol or other specified chemical substances. Minn.Stat. § 169A (2002). Certain qualified prior impaired driving incidents can be considered aggravating factors that permit enhancement of an impaired driving penalty. See Minn.Stat. § 169A.03, subd. 3(1) ("a qualified prior impaired driving incident within the ten years immediately preceding the current offense is an aggravating factor.").
The state charged appellant Darryl Bergh with two counts of first-degree driving while impaired, both enhanced-penalty offenses, and one count of driving after revocation of his driver's license. The state alleged that Bergh had three qualified prior impaired driving offenses that permitted enhancement of two of the current charges. See Minn.Stat. § 169A.24, subd. 1(1) (stating a person who has an impaired driving offense within ten years of three or more impaired driving incidents commits first-degree impaired driving).
Bergh had been convicted of DWI in Minnesota on June 22, 1994, and June 28, 2001. His driver's license was revoked for both offenses. Bergh does not challenge the use of these convictions as aggravating factors. He challenges the use of his DWI conviction and license revocation in Colorado on August 22, 1995, as aggravating factors as applied to the current charges. The Colorado conviction and revocation were based on a chemical test. Under Colorado law, Bergh was not entitled to consult with an attorney before deciding whether to submit to chemical testing. Bergh argued at the omnibus hearing on the current offense that the Colorado statute violated his Minnesota constitutional right to the assistance of counsel and that neither the conviction nor the license revocation from Colorado could be used as an aggravating factor in Minnesota. The district court ruled that the Colorado criminal conviction could not be used to enhance the Minnesota offenses but that the license revocation could be so used.
Bergh then submitted the matter to the court under a Lothenbach stipulation. State v. Lothenbach, 296 N.W.2d 854 (Minn.1980). The court counted the Colorado license revocation as an aggravating factor and found Bergh guilty of the enhanced offenses and of driving after revocation of his driver's license. Bergh appealed.
ISSUES
1. May an uncounseled Colorado driver's license revocation be used in Minnesota to enhance impaired driving charges when the Minnesota Constitution provides motorists with the right to consult with an attorney before deciding whether to submit to blood-alcohol testing?
2. If the state and the appellant stipulate that under Colorado law a motorist has no pre-test right to consult with an attorney, is appellant's affidavit stating that he submitted to testing without being given an opportunity to consult with counsel *737 sufficient to carry appellant's burden to produce evidence of violation of his constitutional right to counsel?
ANALYSIS
The district court's denial of Bergh's motion to prohibit the use of his Colorado license revocation to enhance his current charges raises an issue of law. State v. Othoudt, 482 N.W.2d 218, 221 (Minn.1992). This court reviews questions of law de novo. Id.
In Minnesota, a driver has a limited right to consult with an attorney before deciding whether to submit to blood-alcohol testing. Friedman v. Comm'r of Pub. Safety, 473 N.W.2d 828, 833 (Minn.1991). This right to counsel is guaranteed under article I, section 6, of the Minnesota Constitution. Id. at 833-34.
Under Colorado law, a motorist has no right to confer with counsel before deciding whether to consent to chemical testing. Calvert v. State, Dep't of Revenue, Motor Vehicle Div., 184 Colo. 214, 519 P.2d 341, 343 (1974); Zahtila v. Motor Vehicle Div., Dep't of Revenue, 39 Colo. App. 8, 560 P.2d 847, 849 (1977). Furthermore, under Colorado law, "[g]enerally, when a suspect does not submit to the test because he wants to talk to his attorney before deciding whether to take the test, it is deemed a refusal as a matter of law." Drake v. Colo. Dep't of Revenue, Motor Vehicle Div., 674 P.2d 359, 361 (Colo.1984). It is clear that the Colorado law regarding pre-test right to counsel is not in accord with the Minnesota constitution.
Prior to 1998, the seminal case on the use of a prior uncounseled conviction to enhance a current offense was State v. Nordstrom, 331 N.W.2d 901 (Minn.1983). In Nordstrom, the Minnesota Supreme Court held that a prior uncounseled criminal conviction could not be used to enhance a later misdemeanor DWI offense to the level of a gross misdemeanor unless the right to counsel had been properly waived. Id. at 905.
In State v. Dumas, we considered the question of whether the Nordstrom prohibition extends to any prior uncounseled finding to enhance a latter charge or only to situations in which "the prior finding was obtained in violation of a defendant's constitutional rights." 587 N.W.2d 299, 302 (Minn.App.1998), review denied (Feb. 24, 1999). Our conclusion was that "we read Nordstrom as prohibiting the use of a prior unconstitutionally obtained conviction to enhance a subsequent charge." Id. We also noted that "implied consent proceedings are considered criminal for purposes of a right to counsel before submitting to chemical testing." Id. at 303.
Dumas is informative but is not controlling here. In Dumas, the motorist did not claim that he was denied pre-test assistance of counsel in violation of his constitutional rights. Id. at 302. Bergh, on the other hand, claims exactly that.
This case is controlled by State v. Friedrich, 436 N.W.2d 475 (Minn.App.1989). In Friedrich, the defendants pleaded guilty in Wisconsin to first-time DWI-related offenses that carried only civil penalties and for which no right to counsel was available. Id. at 476. The defendants were later charged with enhanced DWI offenses in Minnesota based on the prior Wisconsin offenses. Id. We held that because the prior Wisconsin convictions did not comport with the Minnesota constitution, they could not be used to enhance the Minnesota charges. Id. at 478.
It should be noted that although some cases have alluded to a distinction between civil and criminal labels in determining enhancement issues, we deem such an approach to be specious. In Minnesota, *738 the entire constitutional focus is on the moment a motorist is asked to submit to a chemical test. At that moment, the limited constitutional right of assistance of counsel is triggered irrespective of what subsequent proceeding might ensue. Minnesota law does not make any distinction as to how the test results might be used. No matter if the test results are used in civil or criminal proceedings, the motorist has a constitutional right to counsel before deciding whether or not to test. That is the principle implicated here.[1]
As in Friedrich, the denial of assistance of counsel to Bergh in Colorado violates the Minnesota constitution. Because the constitutional right implicated does not depend on whether the test might be used in a criminal or civil proceeding, the constitutional violation is complete at the moment assistance of counsel is denied. Thus, Bergh's Colorado license revocation, depending as it did on Bergh's chemical test failure, violated Bergh's Minnesota constitutional right and the revocation cannot be used to enhance Bergh's current offenses.
The state raises the issue of whether Bergh produced sufficient evidence to support the conclusion that he was in fact denied assistance of counsel in Colorado. See State v. Mellett, 642 N.W.2d 779, 789 (Minn.App.2002) (holding that the defendant must come forward with some evidence that he was deprived of counsel before the state will have the burden to show the absence of a constitutional violation), review denied (Minn. July 16, 2002).
Bergh contends that the state has raised this issue improperly for the first time on appeal and thus has waived it. He also contends that he has satisfied his burden to produce the requisite evidence.
Although the state likely has waived this issue, we hold that Bergh did meet his burden of production. In his affidavit he states that he was arrested in Colorado for DWI and was not given an opportunity to consult with counsel before submitting to a blood test. These facts, which the state does not dispute, coupled with the state's stipulation that, under Colorado law, Bergh was not entitled to consult with an attorney before submitting to a test, satisfy Bergh's burden under Mellett. If this were a case solely involving Minnesota law, the affidavit would be insufficient because it does not reveal that Bergh requested assistance of counsel before his test decision. But in Colorado that request would have been futile, unless we are to speculate that the Colorado authorities would gratuitously violate Colorado law and allow Bergh to speak with a lawyer before choosing to test or not. We do not require affidavits to reflect engagement in futile acts.
DECISION
Because appellant's prior Colorado license revocation resulted from an uncounseled chemical test, it violates his Minnesota constitutional rights and may not be used to enhance appellant's current Minnesota offenses.
Reversed.
NOTES
[*] Retired judge of the Minnesota Court of Appeals, serving by appointment pursuant to Minn. Const. art. VI, § 10.
[1] This limited right arises solely under the Minnesota constitution. The Sixth Amendment right to counsel under the federal constitution is not implicated.
| 2024-07-31T01:27:04.277712 | https://example.com/article/7603 |
The Big Green Van
The Big Green Van
Big Green Van
As winter progresses life gets very tough for the homeless and struggling people of Perth. Our amazing volunteers are relentless. Rain, hail or shine they are at a Perth inner city park six evening a week where Manna distributes up to 250 meals each night.
With safety our number one priority for our volunteers and with recent unrest on the rise we have taken action and purchased ‘The Big Green Van’. From this van our volunteers can continue to serve the meals that people so desperately need.
This has not been budgeted for so we are seeking to raise the money for the van and modifications made to get the van ready for the park.
Our goal is $39,500.
We know that together we can achieve great things which is why we are looking for assistance. Can you, your family, your friends and workplace help us? This could be by way of donations and/or spreading the word. Every $ counts and is very much appreciated.
Our goal, with your help is to be able to put signage on the van that reads “Proudly Sponsored by the People of Perth”. This shows the ‘Streeties’ that everyone cares. Of course if a generous company wanted to donate a substantial amount then we can add more names (what a fantastic advertising opportunity). If you would like to know more about the corporate opportunity please contact Nicki at info@mannainc.com.au.
Please spread the word
Thanks
The Big Green Van
Manna is a caring and compassionate organisation providing hope and dignity to the hungry, lonely and underprivileged of Perth. We believe that by nourishing the homeless and vulnerable in a non-judgmental way, we give hope,raise awareness about poverty and provide better outcomes to the community
Read more
Manna is a caring and compassionate organisation providing hope and dignity to the hungry, lonely and underprivileged of Perth. We believe that by nourishing the homeless and the vulnerable in a non-judgmental and compassionate way, we give hope, raise awareness about poverty and provide better outcomes to the wider community.
From what began as the simple act of feeding a few homeless people in a park, Manna has grown to become one of the largest providers of meals for disadvantaged people here in Perth. Along the way we have seen other needs that we knew had to be addressed and so began our School Breakfast Program, Winter School Uniform program, Special functions for Seniors, as well as food hampers at Christmas time for the homeless and struggling families. The more contact we have with the community, the more we see that there is a greater need for the services we can offer.
Whilst all of these different programs are meeting the physical needs of many people, the greatest gift that Manna gives is a sense of family - love, care, respect, - a smile and hug. For many we come in contact with, from the children right through to the seniors, a hug that comes free of any expectations we have found to be worth more than gold. A relationship is formed and they become part of the Manna family… for many the only family they have right now.
Manna is a caring and compassionate organisation providing hope and dignity to the hungry, lonely and underprivileged of Perth. We believe that by nourishing the homeless and vulnerable in a non-judgmental way, we give hope,raise awareness about poverty and provide better outcomes to the community
Read more
Manna is a caring and compassionate organisation providing hope and dignity to the hungry, lonely and underprivileged of Perth. We believe that by nourishing the homeless and the vulnerable in a non-judgmental and compassionate way, we give hope, raise awareness about poverty and provide better outcomes to the wider community.
From what began as the simple act of feeding a few homeless people in a park, Manna has grown to become one of the largest providers of meals for disadvantaged people here in Perth. Along the way we have seen other needs that we knew had to be addressed and so began our School Breakfast Program, Winter School Uniform program, Special functions for Seniors, as well as food hampers at Christmas time for the homeless and struggling families. The more contact we have with the community, the more we see that there is a greater need for the services we can offer.
Whilst all of these different programs are meeting the physical needs of many people, the greatest gift that Manna gives is a sense of family - love, care, respect, - a smile and hug. For many we come in contact with, from the children right through to the seniors, a hug that comes free of any expectations we have found to be worth more than gold. A relationship is formed and they become part of the Manna family… for many the only family they have right now. | 2023-10-01T01:27:04.277712 | https://example.com/article/1640 |
Lithium prevents early cytosolic calcium increase and secondary injurious calcium overload in glycolytically inhibited endothelial cells.
Cytosolic free calcium concentration ([Ca(2+)]i) is a central signalling element for the maintenance of endothelial barrier function. Under physiological conditions, it is controlled within narrow limits. Metabolic inhibition during ischemia/reperfusion, however, induces [Ca(2+)]i overload, which results in barrier failure. In a model of cultured porcine aortic endothelial monolayers (EC), we addressed the question of whether [Ca(2+)]i overload can be prevented by lithium treatment. [Ca(2+)]i and ATP were analysed using Fura-2 and HPLC, respectively. The combined inhibition of glycolytic and mitochondrial ATP synthesis by 2-desoxy-d-glucose (5mM; 2-DG) plus sodium cyanide (5mM; NaCN) caused a significant decrease in cellular ATP content (14±1 nmol/mg protein vs. 18±1 nmol/mg protein in the control, n=6 culture dishes, P<0.05), an increase in [Ca(2+)]i (278±24 nM vs. 71±2 nM in the control, n=60 cells, P<0.05), and the formation of gaps between adjacent EC. These observations indicate that there is impaired barrier function at an early state of metabolic inhibition. Glycolytic inhibition alone by 10mM 2-DG led to a similar decrease in ATP content (14±2 nmol/mg vs. 18±1 nmol/mg in the control, P<0.05) with a delay of 5 min. The [Ca(2+)]i response of EC was biphasic with a peak after 1 min (183±6 nM vs. 71±1 nM, n=60 cells, P<0.05) followed by a sustained increase in [Ca(2+)]i. A 24-h pre-treatment with 10mM of lithium chloride before the inhibition of ATP synthesis abolished both phases of the 2-DG-induced [Ca(2+)]i increase. This effect was not observed when lithium chloride was added simultaneously with 2-DG. We conclude that lithium chloride abolishes the injurious [Ca(2+)]i overload in EC and that this most likely occurs by preventing inositol 3-phosphate-sensitive Ca(2+)-release from the endoplasmic reticulum. Though further research is needed, these findings provide a novel option for therapeutic strategies to protect the endothelium against imminent barrier failure. | 2024-06-06T01:27:04.277712 | https://example.com/article/6030 |