Datasets:

tomekkorbak

/

pii-pile-chunk3-1100000-1150000

like 0

[ "How to Liberate Yourself from Life and Death\n\nThe subtlety of liberating oneself from life and death in “The Treasury of the True Dharma Eye” is that Buddha Sakyamuni had held a flower in his hand as he smiled in the Lingshan Mountain Assembly. ", "Only his first disciple, Mahakasyapa understood why and gave a faint smile. ", "Buddha said, “I possess the true Dharma eye, the marvellous mind of Nirvana, the true form of the formless, and the subtle dharma gate that does not rest on words or letters, but is a special understanding outside of the scriptures”.", "\n\nMahakasyapa later explained his understanding directly to Ananda, who gave it to Shanavasa, and all the way to Bodhidharma, the twenty-eighth Patriarch of Buddhism.", "\n\nBodhidharma took Zen Buddhism to China and was regarded as the first Chinese Zen Buddhist Patriarch. ", "He eventually passed them to Huike, the second Patriarch, who passed them to Sengcan, the third Patriarch, then to Daoxin, the fourth Patriarch, and to Hongren, the fifth Patriarch.", "\n\nWhen Master Hongren told about them, he was met with some trouble because he found that the real successor should be the unknown handyman Huineng in the monastery instead of the highly reputed and admirable professor Master Shenxiu.", "\n\nIt would be very unconvincing to all if everything passed directly to Huineng. ", "In a desperate way, he said “The lives and deaths of mortals are matters of huge importance, but you only pursue the land of promise without seeking to be away from the bitter sea of life and death. ", "If you lose your nature, then how can blessings bring you salvation? ", "Both of you, write me a stanza. ", "He who understands what the Essence of Mind is will be given the robe (the insignia of the Patriarchate) and the Dharma (the ultimate teaching of the Zen school), and I shall make him the Sixth Patriarch”. ", "With a small trick, he finally gave his treasures to Master Huineng.", "\n\nMaster Huineng was the sixth and final Patriarch of Zen. ", "The Treasury of the True Dharma Eye and the robe and begging bowl were lost after him.", "\n\nI used to joke that I am the seventh Patriarch of Zen, and that I have written “On Zen by the seventh Patriarch of Zen one, two, three, four, and five”, which are the most heavily weighted five articles of all my writings.", "\n\nNow the question, as instructed in Buddha’s “Treasury of the True Dharma Eye”, this “Subtle Dharma Gate”, “does not rest on words or letters but is a special message outside of the scriptures” becomes how to “transfer from mind to mind”. ", "If I were to tell it with words, then I would be rebelling against the teachings of Buddha. ", "So, if not “expressing with words”, how can we know how to liberate ourselves from the samsara of life and death?", "\n\nTo make the best of both worlds, I can only “slide over the water”. ", "Whether you can be liberated from life and death all depends on your level of praising Tao, your destiny, and your root of wisdom.", "\n\nThere is no life or death in LIFE. ", "The life and death seen by the world is an illusion.", "It is the evolved deduction of the carrier of LIFE. ", "LIFE has nothing to do with time, so LIFE has no limitations of time and is beyond all ages. ", "The nature of LIFE is nonmaterial structure; the form rendered by LIFE is decided by its nonmaterial structure; its nonmaterial structure decides the form rendered by it. ", "Consciousness originates from structure, and in turn controls structure. ", "Human consciousnesses make people, animal consciousnesses make animals, and if you develop your consciousness to that of a Celestial Beings or a Buddha, then you will become a Celestial Being or a Buddha.", "\n\nLIFE is a cycle of reincarnations; the death we commonly see is not the death of LIFE itself, but the phenomenon of LIFE transformation. ", "LIFE travels from one dimension into another, from one world into another, through “The Gate of Life and Death”. ", "When a LIFE crosses that gate, from this field, we see it as as “death”, but from the other field, it is “life”.", "\n\n“All dharmas are marked with emptiness; they neither begin nor end, are neither immaculate nor defiled, and neither complete nor deficient. ", "Therefore, in emptiness there are neither forms, feelings, perceptions, impulses, nor consciousness; neither eyes, ears, noses, tongues, bodies, or minds; neither sights, sounds, smells, tastes, touchables, or any sensations, and so on until we have form. ", "There are no mind-consciousness elements, no ignorance, no extinction of ignorance, and so on, until we have form. ", "There is no decay and death, no extinction of decay and death; no suffering, no origination, no stopping, no path; no cognition, no attainment and no non-attainment. ", "Therefore, it is because of their non-attainmentness, that Bodhisattvas, through having relied on the “Perfection of Wisdom”, dwell without thought-coverings. ", "In the absence of thought-coverings, they have “Not been made to tremble, have overcome what can upset, and in the end, have attained Nirvana”; “to be free from life and death”. ", "When you are liberated from life and death, you can attain Nirvana.", "\n\nIf you understand the truth above, then you can be liberated from the samsara of life and death. ", "The problem is that as mortals, we have fleshy eyes and mortal stocks; as we cannot see higher dimensional space and worlds, we are not fully convinced of the above truths. ", "Then what?", "\n\nIt is easy! ", "Follow the guide and verify, step by step.", "\n\nWhat are those things that hinder us from liberating from the samsara of life and death?", "\n\nThe answers are greed, anger, ignorance, arrogance, and suspicion.", "\n\nGreed is the want to always possess more out of self-interest.", "\n\nAnger is to detest, blame, and envy.", "\n\nIgnorance is the belief that you are always right and never wrong.", "\n\nArrogance is self-importance, pretentiousness, disdain, defiance, and the lack of a gracious, cherishing heart.", "\n\nSuspicion is being full of doubts and not facing the facts; it is hypocritical, false, and self-deceiving.", "\n\nOvercoming greed, anger, ignorance, arrogance, and suspicion will enable you to understand this truth and will liberate you from the samsara of life and death. ", "The reason is very simple and easy to do, but putting it into real practice is difficult.", "\n\nAfter being liberated from life and death, one also needs to understand where to go after “death”. ", "If you are heading to the lower world, then you will be miserable." ]

{ "pile_set_name": "Pile-CC" }

[ 0.004081632653061225, 0.013157894736842105, 0.012875536480686695, 0.012048192771084338, 0, 0.011049723756906077, 0.01282051282051282, 0.012345679012345678, 0, 0, 0, 0.009708737864077669, 0.014705882352941176, 0.01694915254237288, 0.023255813953488372, 0, 0.004166666666666667, 0.010869565217391304, 0, 0, 0.007692307692307693, 0, 0, 0, 0, 0, 0, 0.00980392156862745, 0, 0, 0, 0, 0, 0, 0, 0.006289308176100629, 0.0056179775280898875, 0.014925373134328358, 0, 0, 0, 0, 0, 0, 0, 0.015625, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Charlie.", "\n\nFirstly it is the ship that is at fault in this case. ", "While we dwell on the feds response to this incident lets keep in mind that under the Canada Shipping Act it is the ship that has the responsibility to report this discharge and activate its response organization which in the case of the west coast is WCMRC. ", "They apparently failed to notice their release or failed to bother to provide notice and activate their RO. ", "It came down to the CCG acting on a notice of the Port to inspect and activate WCMRC. ", "The fact that night ops were conducted and to a degree were successful in collecting alot of the bunker is a testament to the expertise of WCMRC. ", "Of course if the conditions had been rougher all best would be off. ", "With respect to EC I appreciate the attention the loss of our group has had but to be clear in these cases EC Emergencies would never have co-ordinated the clean-up. ", "That is the duty of the responsible vessel, its agent of the CCG if the vessel is unwilling, unable or unknown..in this case unwilling appears to be the situation. ", "The EC group's responsibility was to co-ordinate the science to support the response. ", "The regional folks that were redistributed to other programs were regional experts, had relationships with other environmental and resource protection agencies and understood the vulnerbilities of the region. ", "We collaborated to ensure that the responsible vessel or the CCG had the best possible information to ensure and effective response was undertaken. ", "The folks now in Montreal while are still some of the best in the world lack the regional knowledge; in some cases, the regional relationships; in some cases, but more so the direction to play the role they did in the past.", "\n\nBack to English Bay. ", "Be thankful the conditions were what they were. ", "It could have been considerably worse.", "\n\nTake this all with a grain of salt, I am just a former emergencies officer." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.125, 0, 0.003861003861003861, 0.009259259259259259, 0.023255813953488372, 0.00684931506849315, 0, 0.012048192771084338, 0.006097560975609756, 0.011627906976744186, 0, 0.006756756756756757, 0, 0, 0, 0, 0 ]

[ "3. ", "Den humanitære situation i Camp Ashraf\n- Før afstemningen\nCharles Tannock\n(EN) Fru formand! ", "Det ser ud, som der er sket en fejl i den tekst, der er offentliggjort på internettet om Parlamentets tjenestegrene. ", "Den er ukorrekt formuleret og ikke i overensstemmelse med den tekst, som faktisk blev fremsat i det fælles beslutningsforslag af min gruppe og andre. ", "Jeg ved ikke, om De er blevet informeret om dette, og om De kan tage det i betragtning, men teksten i punkt 2 burde lyde: \"idet man for så vidt angår alle personer, der bor i Camp Ashraf, respekterer disses individuelle ønsker for deres fremtid;\". ", "Det er ikke det, der faktisk er offentliggjort, og det er det, der burde stå i teksten.", "\nFormanden\nHr. ", "Tannock! ", "Jeg er blevet informeret, og alle de sproglige rettelser vil blive foretaget.", "\nEfter afstemningen\nHans-Peter Martin\n(DE) Fru formand! ", "Jeg vil gerne henlede Deres opmærksomhed på, at bag mig, blandt de ultra-højreradikale, er der folk, som ikke er medlemmer, og så vidt jeg kan se, bruger de også stemmekortene.", "\n(Tumult)\nFormanden\nHr. ", "Martin! ", "Det vil blive undersøgt.", "\n" ]

{ "pile_set_name": "EuroParl" }

[ 0, 0.03260869565217391, 0.008547008547008548, 0, 0.016129032258064516, 0.034482758620689655, 0.06666666666666667, 0.1111111111111111, 0.025974025974025976, 0.03571428571428571, 0.011363636363636364, 0.08333333333333333, 0, 0.041666666666666664, 0 ]

[ "If you wanted to keep playing Far Cry 3 after it ended...\n\nFar Cry 4 is basically a slightly better continuation of Far Cry 3. ", "Sure the theme changed, the game mechanics changed a little, and there is a new cast of characters, but if you suffered from mild amnesia you'd think you were still playing Far Cry 3: same wacky antagonist, same hunt-for-your-gear mechanics, same wide-open world for sniping bandits and jumping off mountains. ", "Because of this, don't expect to be blown away with anything new or unusual. ", "Instead, the game is great fun if you loved Far Cry 3 and want to keep exploring a world with the same mechanics but new goals; for this reason I greatly enjoy Far Cry 4. ", "There are elephants to ride, ultralight helicopters to pilot (this ends the challenge of climbing up radio towers), and breath-taking scenery. ", "If the graphics improved much from Far Cry 3, as a casual gamer I cannot tell. ", "But there is more to do and more to see, and this Nepali-esk open world is a fascinating back-drop for gameplay. ", "Having been to Nepal myself, I can say that this game gives me flash backs and feels very realistic in this respect; no, I was not running around with an RPG in Nepal, but the aspects of religion and culture in-game are very similar to what I experienced traveling in the villages. ", "The town-life of tacky modern concrete homes and ugly 80s style businesses have, fortunately, been left out of the game. ", "So if you're ready to pick up where Far Cry 3 left off, grab your cheetah skin ammo pouch, and your kukuri and head to Far Cry 4. ", "It's worth exploring, and provides plenty of new opportunities to do the same things you loved in Far Cry 3.Read full review\n\nVerified purchase: Yes | Condition: New" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.007874015748031496, 0, 0, 0.005847953216374269, 0, 0.012658227848101266, 0, 0.0035460992907801418, 0, 0.007692307692307693, 0 ]

[ "INTRODUCTION {#SEC1}\n============\n\nRecently, analyses of human transcriptome revealed that protein-coding transcripts only account for a small portion of the whole-genome ([@B1]). ", "Surprisingly, many of the transcripts in human transcriptome are long noncoding RNAs (lncRNAs) with lengths of more than 200 nucleotides ([@B2]). ", "For a long time, the functionality of lncRNAs was frequently disputed ([@B3]) because of their low cross-species conservation, low expression levels and high tissue specificity. ", "However, due to the fast development of lncRNAs, accumulating studies have reported that lncRNAs have important and diverse functions ([@B4]); thus, the dysfunction of lncRNAs is associated with some diseases, such as cardiovascular disease ([@B5]) and cancer ([@B6]). ", "We previously built the long non-coding RNA disease database (LncRNADisease, <http://www.cuilab.cn/lncrnadisease>) ([@B7]), which shows that more than 200 diseases are associated with lncRNAs and more than 250 lncRNAs have roles in at least one disease. ", "Thus, one emerging opinion is that lncRNAs could be novel molecules for disease diagnosis and therapy ([@B8]). ", "Currently, a large number of lncRNAs have been identified. ", "For example, the NONCODE database ([@B9]) and the MiTranscriptome database ([@B10]) have collected more than 90 000, and 60 000 human lncRNAs, respectively. ", "Given the importance and the large number of lncRNAs, there is an increasing need to identify which lncRNAs are associated with which diseases on a genome-wide scale. ", "However, at present, the relationship between most of the lncRNAs and most of the human diseases remains unknown. ", "Therefore, it becomes important to develop bioinformatics methods to predict lncRNA-disease associations.", "\n\nHence, we built the lncRNA disease database (LncRNADisease) and presented a method to predict lncRNA-disease associations based on the genomic locus of lncRNAs ([@B7],[@B11]). ", "Recently, several studies presented bioinformatics methods based on co-expression of lncRNA and protein-coding genes for predicting the lncRNAs involved in lung cancer ([@B12]), human disease ([@B13]) and esophageal squamous cell carcinoma ([@B14]). ", "In addition, a Laplacian Regularized Least Squares based method which integrated lncRNA-disease association data from the LncRNADisease database and lncRNA expression profile was developed ([@B15]). ", "More recently, several network-based methods have been developed ([@B16]--[@B20]). ", "The above presented methods collectively provide valuable help in dissecting the associations between lncRNAs and human diseases. ", "However, limitations exist in the above methods. ", "For example, regarding the genomic locus based methods, it is difficult to set a suitable genomic distance threshold. ", "Also, lncRNAs and their neighbor genes may not always be functionally related. ", "Moreover, only a small fraction of lncRNAs have neighbor protein-coding genes. ", "In the case of the co-expression based methods, there are three major limitations. ", "Firstly, only a small number of lncRNAs have matched tissue expression data with protein-coding genes. ", "Secondly, some lncRNAs do not have co-expressed genes. ", "Thirdly, co-expression does not always mean co-function. ", "For the network-based methods, the major limitation is that they only focus on a limited number of lncRNAs (∼260) with known disease associations and cannot be applied to most of the human lncRNAs. ", "Therefore, novel methods that are efficient and applicable in a large-scale are needed.", "\n\nIt is known that lncRNAs could exert their functions by interacting with miRNAs ([@B21],[@B22]). ", "The human miRNA-disease associations have been collected and annotated in a large scale in our Human microRNA disease database (HMDD) database since 2007 ([@B23],[@B24]). ", "Therefore, it seems possible to predict lncRNA-disease associations by enrichment analysis of the miRNAs interacting with the given lncRNAs in specific disease-associated miRNA sets. ", "We previously presented a miRNA enrichment analysis tool ([@B25]), TAM and confirmed its usefulness in mining miRNA-related knowledge ([@B26]). ", "In a recent study, Chen revealed that integrating the HMDD data (human miRNA-disease associations) and the starBase data (miRNA--lncRNA interactions) can indeed infer lncRNA-disease associations ([@B27]). ", "However, two major limitations exist in the study. ", "Firstly, the lncRNA--miRNA interaction data the author used is from the starBase database ([@B21]), which included only the experimentally supported data set. ", "This makes Chen\\'s method only feasible in a very small fraction of lncRNAs and human diseases. ", "The reason is that the lncRNA--miRNA interactions in starBase only contain 1114 lncRNAs, which only cover ∼1.2% (∼1114/90000) of the total human lncRNAs. ", "Therefore, Chen\\'s method cannot be applied to ∼98.8% of the total human lncRNAs. ", "Moreover, the lncRNA--miRNA interactions in starBase only contain 132 miRNAs, which only cover ∼23.1% (132/572) of the total miRNAs in the HMDD database. ", "This will also largely restrict the application of Chen\\'s method. ", "Secondly, Chen\\'s study did not provide web-based or standalone software for users, which also greatly limit the application of the method. ", "Based on the above observations, our study developed a standalone tool, LncDisease, to predict lncRNA-disease associations based on disease enrichment analysis of the miRNAs interacting with the given lncRNA. ", "For a given lncRNA sequence, LncDisease first predicted the potential miRNAs interacting with the given lncRNA. ", "Next, LncDisease performed enrichment analysis for the predicted miRNAs on the disease-associated miRNA sets, which are derived from our HMDD database ([@B23],[@B24]). ", "Afterward, LncDisease predicted the significant diseases as the potential diseases associated with the given lncRNA. ", "Finally, to validate the accuracy of LncDisease, we selected the 12 most significant lncRNAs predicted to be associated with breast cancer for further biological experiments in two breast cancer cell lines, MCF7 and MDA-MB-231, respectively. ", "Moreover, four lncRNAs predicted to be associated with hypertension were also validated in human vascular smooth muscle cells (VSMCs) stimulated with angiotensin II (Ang II). ", "The results showed that 11 (91.7%) of the 12 predicted-breast-cancer-associated lncRNAs were significantly deregulated in both breast cancer cell lines. ", "Also, 3 (75.0%) of the 4 predicted hypertension-associated lncRNAs were significantly deregulated in Ang II-treated human VSMCs. ", "In addition, we predicted the diseases associated with the lncRNA GAS5 and literature mining showed that 66.7% of the predicted diseases have literature evidence. ", "These results suggest that LncDisease could be a useful tool in predicting the lncRNA-disease associations.", "\n\nMATERIALS AND METHODS {#SEC2}\n=====================\n\nThe data used in this study {#SEC2-1}\n---------------------------\n\nWe downloaded the sequence data of human lncRNAs from the lncipedia database ([@B28]) (<http://www.lncipedia.org/>) and the miRNA sequence data from the miRBase database. ", "Also, we downloaded the human miRNA-disease association data set from the HMDD database ([@B23],[@B24]).", "\n\nPredicting lncRNA--miRNA interactions {#SEC2-2}\n-------------------------------------\n\nCurrently, there is no computational tool or pipeline developed for the prediction of lncRNA--miRNA interactions. ", "According to current knowledge, miRNAs regulate lncRNAs through the same mechanism of regulating mRNAs, which is mainly based on the base pairing of target RNA sequences and the seed regions of miRNAs ([@B29]). ", "Given that TargetScan and miRanda represent two of the most popular and efficient computational tools for miRNA target prediction ([@B30]), in our study, LncDisease used TargetScan ([@B31]) and miRanda ([@B32]) to predict the lncRNA--miRNA interactions. ", "In addition, the users can use the union or intersection of the predictions by the two tools. ", "For TargetScan, the criteria for target prediction and ranking include stringent seed pairing, site number, site type and site context; whereas for miRanda, the criteria include moderately stringent seed pairing and site number ([@B30]). ", "From this, we can conclude that TargetScan has more stringent criteria than miRanda. ", "Therefore, under normal circumstances, miRanda will predict more miRNA targets and more binding sites than TargetScan.", "\n\nPredicting lncRNA-associated disease {#SEC2-3}\n------------------------------------\n\nGiven that the accuracy of the current miRNA target predictions tools (including TargetScan) is not high ([@B30]), we cannot predict that the diseases associated with the lncRNA-binding miRNAs are the potential associated diseases of the given lncRNA. ", "Because the predicted targets could be true targets with higher probability than random predictions ([@B30]), statistical enrichment analysis becomes a useful solution to predict associated diseases of a given lncRNA. ", "This study used the TAM method ([@B25]), which was previously developed to discover novel knowledge for a group of inputted miRNAs by performing hypergeometric test based enrichment analysis of the inputted miRNAs in a number of miRNA sets. ", "miRNA sets were defined as a group of miRNAs with similar or the same biological meaning ([@B24]). ", "For example, the miRNAs associated with breast cancer are grouped into the breast cancer miRNA set. ", "Assuming that the number of miRNAs included in all miRNA sets is *P*; the number of miRNAs in miRNA set A is *S*; the number of input miRNAs included in the *P* total miRNAs is *HP*; and the number of input miRNAs included in the *S* miRNAs of miRNA set A is *HS*, we then calculated the probability of HS miRNAs of interest in the miRNA set A using Equation ([1](#M1){ref-type=\"disp-formula\"}): $$\\documentclass[12pt]{minimal}\n\\usepackage{amsmath}\n\\usepackage{wasysym} \n\\usepackage{amsfonts} \n\\usepackage{amssymb} \n\\usepackage{amsbsy}\n\\usepackage{upgreek}\n\\usepackage{mathrsfs}\n\\setlength{\\oddsidemargin}{-69pt}\n\\begin{document}\n}{}\\begin{equation*} {\\rm P}({\\rm x} = {\\rm HS}) = \\frac{{{\\rm C}_{{\\rm HP}}^{{\\rm HS}} \\times {\\rm C}_{{\\rm P} - {\\rm HP}}^{{\\rm S} - {\\rm HS}} }}{{{\\rm C}_{\\rm P}^{\\rm S} }} \\end{equation*}\\end{document}$$ where the symbol 'C' is the combination operation. ", "Thus, we calculated the statistical significance of the enrichment of the input miRNAs in miRNA set A using Equation ([2](#M2){ref-type=\"disp-formula\"}): $$\\documentclass[12pt]{minimal}\n\\usepackage{amsmath}\n\\usepackage{wasysym} \n\\usepackage{amsfonts} \n\\usepackage{amssymb} \n\\usepackage{amsbsy}\n\\usepackage{upgreek}\n\\usepackage{mathrsfs}\n\\setlength{\\oddsidemargin}{-69pt}\n\\begin{document}\n}{}\\begin{equation*} {\\rm P}({\\rm enrichment}) = \\sum\\nolimits_{{\\rm h} = {\\rm HS}}^{\\rm S} {{\\rm P}({\\rm x} = {\\rm h})} \\end{equation*}\\end{document}$$\n\nFinally, the *P-*values for all miRNA sets were adjusted by *Bonferroni* correction. ", "The flowchart of LncDisease is shown in Figure [1](#F1){ref-type=\"fig\"}. ", "In total, LncDisease collected 372 disease-associated miRNA sets based on the miRNA-disease association data set in the HMDD database. ", "One disease-associated miRNA set is defined as a group of miRNAs that is associated with one disease. ", "For example, the total miRNAs that are associated with breast cancer are assigned to the breast cancer miRNA set. ", "LncDisease works according to the following flow. ", "For a given lncRNA sequence, LncDisease first predicts the miRNAs interacting with the given lncRNA. ", "Next, LncDisease performs enrichment analysis of the predicted miRNAs in the 372 disease-associated miRNA sets based on the TAM method. ", "Moreover, LncDisease outputs the enrichment significance of the predicted miRNAs in each disease-associated miRNA set. ", "Finally, we may take the significant results as the potential diseases associated with the inputted lncRNA.", "\n\n{#F1}\n\nBreast cancer cell culture and reagents {#SEC2-4}\n---------------------------------------\n\nThe human breast cancer cell lines MCF7 and MDA-MB-231 were purchased from ATCC (Manassas, VA, USA) and both were cultured using Dulbecco\\'s modified eagle medium (DMEM) (Invitrogen, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS) (Atlanta Biologicals, Flowery Branch, GA, USA). ", "The human mammary epithelial cell line HMEC was purchased from Lonza (Allendale, NJ, USA), and cultured in Mammary Epithelial Cell Growth Medium MEGM (Lonza) containing BulletKit (Lonza) with serum-free.", "\n\nRNA isolation {#SEC2-5}\n-------------\n\nTotal RNA was extracted by Trizol reagent (Invitrogen). ", "Cells were harvested and dissolved in 1 ml of Trizol reagent and then 200 μl of 1-bromo-3-chloropropane solution was added (Molecular Research Center, Inc. Cincinnati, OH, USA) and mixed thoroughly by inverting the tube until well-blended. ", "After the centrifugation, 14 000 rpm for 15 min at 4°C, the upper aqueous phase was removed to a new 1.5 ml tube, an equal volume of isopropanol (Sigma-Aldrich, St Louis, MO, USA) for precipitation subsequently. ", "Extracted RNA was dissolved in nuclease-free water after washing the pellets using 75% ethanol twice, and then the RNA concentration was determined by Nanodrop (Thermo, Worcester, MA, USA).", "\n\nQuantitative real-time PCR {#SEC2-6}\n--------------------------\n\nThe total RNA was used to synthesize cDNA by a high capacity cDNA reverse transcriptase kit (Applied Biosystems, Foster City, CA, USA). ", "The relative mRNAs expression of lncRNAs was determined by quantitative real-time PCR (qRT-PCR), and the reaction mixtures was consisted of 10  μl 2x SYBR master mix (Roche, Indianapolis, IN, USA), 2  μl synthesized forward primer and reverse primer mixture, 1  μl cDNA and 7 μl nuclease-free water. ", "The RT-PCR was performed on a Stratagene Mx3000p with the following cycling conditions: 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 59°C for 30 s, 72°C for 30 s. After finishing 40 cycles, a final extension at 72°C for 7 min was performed. ", "Quantitative values were obtained as threshold PCR cycle number (*Ct*) when the increase in the fluorescent signal of PCR product showed exponential amplification. ", "Target lncRNA level was normalized to that of housekeeping gene in the same sample. ", "In brief, the relative expression level of the target gene compared with that of a housekeeping gene was calculated as 2^−Δ*Ct*^, where Δ*Ct = Ct*~target\\ lncRNA~ − *Ct~housekeeping\\ gene~*. ", "The ratio of the relative expression of the target gene in treated cells or cancer cells to that of untreated cells or normal cells was then calculated as 2^−ΔΔ*Ct*^, where ΔΔCt = Δ*Ct*~treated\\ cell~ -- *Ct~control\\ cell~*. ", "Each sample was measured in duplicate or triplicate for each experiment. ", "Moreover, melting and amplification curves for each PCR product were analyzed to ensure the specificity of the amplification product ([@B33],[@B34]).", "\n\nParameters were: 95°C for 10 min, and then 40 cycles of 95°C for 10 s and 58°C for 35 s. GAPDH was taken as the endogenous control. ", "The comparative cycle threshold (CT) method was used to compute the relative quantification of lncRNAs in human breast cancer cells by comparing them with the normal cells. ", "The primer sequences used for qRT-PCR in the study are listed in Tables [1](#tbl1){ref-type=\"table\"} and [2](#tbl2){ref-type=\"table\"}.", "\n\n###### The 12 candidate breast-cancer-associated lncRNAs and their primers for qRT-PCR validation experiments\n\n Primers Primer sequence (5′ to 3′)\n ------------------ ----------- ----------------------------\n lnc-CEP170--1:2 Sense TGCGAGATTGAGATGATGA\n Antisense GCTGAGAACTTACCAGAGT\n lnc-CHAD-1:1 Sense GTGATGGAGCAAGACTGT\n Antisense GGCTGAAGTGTTGAAGGA\n lnc-GGCT-1:4 Sense TGACAAGAGGAGGAAGGAA\n Antisense TGCTGAGATTATAGGTGTGAG\n lnc-IL5RA-4:1 Sense AAGAGGAGCCAGCACTTC\n Antisense AGCCACTGTCCTGATGAAT\n lnc-PARN-7:2 Sense AGGTGCTGGAGTCAAGAA\n Antisense GGTGTGGTTGGTAGGAAG\n lnc-PPHLN1--1:1 Sense CACACCAAGACGGACTATC\n Antisense GAATACTGAAGATGCTGACTG\n lnc-PSCA-1:1 Sense AGACGAGGCTAATCACTGT\n Antisense GGCGGTTGTAAGAGGATG\n lnc-SCN5A-1:1 Sense CCAGGTCAGGTATCATAATAAG\n Antisense CAGTTGTCAAGTAAGCAGTT\n lnc-SMARCA5--3:1 Sense AGTTAGACCATAATGCCTCT\n Antisense GTGTCAATGTGTTACCTTCA\n lnc-USP8--2:3 Sense GGTAGCAGGTAGGTGTGA\n Antisense GTGAAGACATTACTATCCTCCT\n lnc-PPHLN1--1:2 Sense CACACCAAGACGGACTATC\n Antisense GAATACTGAAGATGCTGACTG\n lnc-WBSCR16--1:1 Sense TCAGTACACCATCCATCCA\n Antisense AAGAGTTGAGCAGAGTTCC\n GAPDH Sense TTGGCTACAGCAACAGGGTG\n Antisense GGTCTACATGGCAACTGTGAG\n\n###### The 4 candidate hypertension-associated lncRNAs and their primers for qRT-PCR validation experiments\n\n Primers Primer sequence (5′ to 3′)\n ------------------- ----------- ----------------------------\n lnc-C16orf95--1:5 Sense ACATCCAGAACAGGCAAAGC\n Antisense AATGTTAGGTCTCCCAGCCC\n lnc-RASA1--3:9 Sense GGGACGAACAGCGTGACAAT\n Antisense TGCAGTCACCTCATGTCCAAAA\n lnc-SLC17A9--1:1 Sense GATCACTTGAGCCCAGGAGT\n Antisense GACAGGGTCTTTCTCCGTCA\n lnc-SPATA9--1:2 Sense ATTTGACCCATGTAACGCGG\n Antisense CAGTGCGTTTGGGAATGTCA\n β-actin Sense GGTGGGAATGGGTCAGAAGG\n Antisense GTACATGGCTGGGGTGTTGA\n\nVSMC stimulated with Ang II {#SEC2-7}\n---------------------------\n\nOne popular way of mimicking hypertension in cells is by treating VSMCs with Ang II, a key mediator of hypertension ([@B35]); hence, we treated human VSMC cell line T/G HA-VSMC with 0.5 M Ang II for 24 h. Then, the expression levels of the four predicted hypertension-associated lncRNAs, lnc-C16orF95--1:5, lnc-RASA1--3:9, lnc-SLC17A9--1:1 and lnc-SPATA9--1:2, were determined using qRT-PCR analysis. ", "The primer sequences are listed in Table [2](#tbl2){ref-type=\"table\"}.", "\n\nStatistical analysis {#SEC2-8}\n--------------------\n\nThe qRT-PCR result data were presented as mean ± S.E.M. The statistical significance of differences between groups was analyzed by *t*-test.", "\n\nRESULTS AND DISCUSSION {#SEC3}\n======================\n\nThe LncDisease standalone software {#SEC3-1}\n----------------------------------\n\nAs shown in Figure [2](#F2){ref-type=\"fig\"}, the users can copy and paste the sequence(s) of one or multiple lncRNAs in FASTA format into the 'LncRNAs Input' panel. ", "An alternative solution for inputting the lncRNA sequences is to load the file containing the sequences in FASTA format by clicking the 'Import' button. ", "After inputting the lncRNA sequences, the users can then click the 'Predict' button to run LncDisease. ", "During the running process, the status of LncDisease will be shown in the 'Log' panel. ", "When LncDisease finishes the task, the prediction results will be shown in the 'Results' panel. ", "The users can rank the predicted lncRNA-disease entries by using several items, such as lncRNA name, disease name and the significance (*P*-value). ", "In addition, the users can output the prediction results into a file by clicking the 'Save All' button.", "\n\n{#F2}\n\nValidation of putative lncRNAs associated with breast cancer {#SEC3-2}\n------------------------------------------------------------\n\nTo evaluate the accuracy of the predictions of LncDisease, we selected the 12 most significant predicted lncRNAs associated with breast cancer to explore the differential expression by biological experiments. ", "qRT-PCR analysis was used to determine the level of lncRNAs in breast cancer cells (MCF7 and MDA-MB-231) and HMEC cells. ", "For each lncRNA, we compared its expression level in MCF7 with that in the control cell (HMEC) using *t*-test. ", "In addition, we also compared the expression level of each lncRNA in MDA-MB-231 with that in HMEC. ", "But we did not compare the expression level of each lncRNA in MCF7 with that in MDA-MB-231. ", "We found that 11 (91.7%) of the 12 selected lncRNAs had a significantly elevated level in both breast cancer cell lines compared with HMEC cells (Figure [3](#F3){ref-type=\"fig\"}). ", "The results suggest that these putative lncRNAs could indeed be involved in breast cancer, which further suggests that the presented method has a reliable accuracy.", "\n\n{#F3}\n\nValidation of putative lncRNAs associated with hypertension {#SEC3-3}\n-----------------------------------------------------------\n\nTo evaluate the accuracy of the predictions of LncDisease, four predicted lncRNAs associated with hypertension were selected to further explore the differential expression by biological experiments. ", "qRT-PCR analysis was used to determine the level of lncRNAs in Ang II-treated VSMCs and we found that 3 (75.0%) of the 4 selected lncRNAs exhibited a significantly decreased expression after treatment with Ang II (Figure [4](#F4){ref-type=\"fig\"}). ", "The results suggest that these putative lncRNAs could indeed be involved in hypertension, which further suggests that the presented method has a reliable accuracy.", "\n\n{#F4}\n\nLiterature mining for diseases predicted to be associated with the lncRNA GAS5 {#SEC3-4}\n------------------------------------------------------------------------------\n\nWe predicted six diseases (liver cirrhosis, hepatocellular carcinoma, fibrosis, kidney diseases, Duchenne muscular dystrophy and lung cancer) which are significantly associated with the lncRNA GAS5 (*P* \\< 0.01). ", "By literature mining, we found that literature supports four of these diseases, hepatocellular carcinoma (*P* = 1.11e-3) ([@B36]--[@B39]), fibrosis (*P* = 1.17e-3) ([@B40]), kidney diseases (*P* = 3.16e-3) ([@B41],[@B42]) and lung cancer (*P* = 9.76e-3) ([@B43],[@B44]). ", "For liver cirrhosis, we did not find any evidence linking it to GAS5. ", "Given that GAS5 is significantly associated with hepatocellular carcinoma and liver fibrosis, two diseases highly associated with liver cirrhosis, it is reasonable to suggest that GAS5 may also be associated with liver cirrhosis. ", "The results collectively suggest that the presented method is valuable in predicting lncRNA-disease associations.", "\n\nCurrent limitations and future perspectives {#SEC3-5}\n-------------------------------------------\n\nLncRNAs are one class of crucial non-coding molecules, which play critical roles in some biological processes. ", "Therefore, their dysfunctions are associated with a variety of human diseases. ", "LncRNAs represent potential new molecules for disease diagnosis and therapy. ", "Recently, a large number of human lncRNAs have been identified. ", "For example, the NONCODE database and the MiTranscriptome have collected more than 90 000 human lncRNAs and 60 000 human lncRNAs, respectively. ", "However, for most of the human lncRNAs, their relations with human diseases remain unknown. ", "Given the large number of lncRNAs and their important functions, it becomes critically important to identify the relations between lncRNAs and diseases. ", "For this purpose, we presented a sequence-based method, LncDisease, to predict associations between lncRNAs and human diseases through disease enrichment analysis of the miRNAs interacting with the given lncRNAs. ", "Moreover, a biological experiment confirmed that the presented method has a reliable accuracy. ", "However, several limitations exist in the current method. ", "Firstly, the exact mechanism by which miRNAs regulate lncRNAs is not clear. ", "This makes the prediction of lncRNA targets of miRNAs to have high false positives and high false negatives. ", "Secondly, the miRNA-disease association data set is far from completeness. ", "For example, the disease number is 372, which is greatly less than the total number of human diseases. ", "As more precise knowledge of miRNA--lncRNA interaction and more miRNA-disease association data become available, LncDisease will be improved continuously. ", "Thirdly, miRNA target prediction currently has high false positives. ", "When better miRNA target prediction tools become available in the future, LncDisease will be improved. ", "In addition, it is interesting that the 11 predicted breast cancer lncRNAs are all up-regulated in breast cancer while the 3 predicted hypertension lncRNAs are all down-regulated in hypertension. ", "The reasons why these lncRNAs predicted by LncDisease show the same change in direction remains unknown. ", "Further explorations are needed to find out whether these lncRNAs have special relations with disease-associated miRNAs. ", "Finally, although the above limitations exist, we believe that LncDisease is a convenient tool for researchers to dissect the relations between lncRNAs and diseases in a large-scale, which could be helpful in identifying potential lncRNAs for disease diagnosis and therapy.", "\n\nFUNDING {#SEC4}\n=======\n\nNational Basic Research program of China \\[2012CB517506 to Q.C.\\]; National High Technology Research and Development Program of China \\[2014AA021102 to Q.C.\\]; National Natural Science Foundation of China \\[91339106 to Q.C., 81422006 to Q.C.\\]; NIH/NCI R01 \\[1R01CA192395 to Y.X.\\]; American Cancer Society Research Scholar \\[RSG-13--265--01-RMC to Y.X.\\]; NIH/NCI R21 \\[1R21CA160280 and 1R21CA182754 to Y.X.\\]. ", "Funding for open access charge: National High Technology Research and Development Program of China \\[2014AA021102\\].", "\n\n*Conflict of interest statement*. ", "None declared.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.005555555555555556, 0.00684931506849315, 0.0056179775280898875, 0.011152416356877323, 0.011811023622047244, 0.009009009009009009, 0, 0.025477707006369428, 0, 0, 0, 0.011235955056179775, 0.012, 0.005025125628140704, 0.024096385542168676, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.020202020202020204, 0.011695906432748537, 0, 0.013888888888888888, 0.014634146341463415, 0, 0.006289308176100629, 0.010416666666666666, 0, 0.012195121951219513, 0.006493506493506494, 0.014925373134328358, 0.007142857142857143, 0.004784688995215311, 0.008928571428571428, 0.023809523809523808, 0.008547008547008548, 0.004132231404958678, 0, 0, 0, 0, 0.009345794392523364, 0.010238907849829351, 0.028846153846153848, 0, 0.009478672985781991, 0.015748031496062992, 0, 0.008403361344537815, 0.011764705882352941, 0.00847457627118644, 0.0029498525073746312, 0.0045871559633027525, 0.004149377593360996, 0.010101010101010102, 0, 0.0022497187851518562, 0.004784688995215311, 0.0136986301369863, 0.014814814814814815, 0, 0, 0.02, 0.009900990099009901, 0.022058823529411766, 0.008403361344537815, 0, 0, 0.010660980810234541, 0.009852216748768473, 0.020618556701030927, 0.004166666666666667, 0, 0.026455026455026454, 0.014778325123152709, 0.006666666666666667, 0.00398406374501992, 0.012195121951219513, 0, 0, 0, 0, 0.020134228187919462, 0, 0, 0, 0.0034734282737061478, 0, 0, 0.006600660066006601, 0, 0.009708737864077669, 0.011494252873563218, 0.010416666666666666, 0, 0, 0, 0.004901960784313725, 0.008264462809917356, 0.009009009009009009, 0, 0, 0.005555555555555556, 0, 0, 0, 0.002770083102493075, 0.004032258064516129, 0, 0, 0, 0, 0.025830258302583026, 0, 0.008695652173913044, 0, 0, 0, 0, 0, 0.013888888888888888, 0, 0, 0.004694835680751174, 0, 0, 0, 0, 0, 0, 0.0064516129032258064, 0, 0.009708737864077669, 0, 0.009523809523809525, 0, 0.003663003663003663, 0.018223234624145785, 0.008620689655172414, 0, 0, 0 ]

[ "Delhi’s Chief Minister Arvind Kejriwal might be heading for trouble in the Chief Secretary assault case after a Hindustan Times report has claimed that the Delhi police is likely to book him for criminal conspiracy in this matter. ", "As per the report, a chargesheet would be filed at the Tis Hazari court in this regard by next week.", "\n\nAs per an India Today report, besides Kejriwal, Delhi’s deputy Chief Minister Manish Sisodia and 11 other AAP MLAs are also likely to be part of the chargesheet.", "\n\nOn the stroke of midnight of 19 February, when the national capital slept, AAP MLAs were very much awake at Kejriwal’s residence to attend a meeting where Chief Secretary Anshu Prakash too was invited.", "\n\nThe meeting though bore witness to extraordinary scenes as when Prakash raised questions regarding AAP government’s excess spending on advertisements, Kejriwal’s aides got enraged and allegedly proceeded to assault him.", "\n\nThese version of events were also corroborated by Kejriwal’s aide VK Jain who was reported as claiming that he found AAP MLAs Amanatullah Khan and Prakash Jarwal assaulting the Chief Secretary, when he returned from a washroom break.", "\n\nEven though Kejriwal has not yet been named as an accused in the FIR, or arrested for the matter, he has ended up getting questioned by the Delhi police on two occasions. ", "One of the aspects which the Delhi police wanted to probe in this regards was whether the assault was pre-planned.", "\n\nThe news of the chargesheet filing incidentally comes a few days after Kejriwal staged a high profile dharna at the lieutenant governor’s residence, while alleging that IAS officers working under him were on a four month long strike, which started following the alleged assault on the chief secretary.", "\n\nThe IAS association though had rubbished these allegations and in turn asserted how victimised and threatened they were feeling." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.008658008658008658, 0.01, 0.012269938650306749, 0.014778325123152709, 0.00904977375565611, 0.02127659574468085, 0.011560693641618497, 0, 0.006600660066006601, 0.007692307692307693 ]

[ "Rhabdomyosarcoma of the head and neck in children.", "\nThe purpose of this study was to determine the rhabdomyosarcoma types involving the head and neck (H&N) region in children and their immunophenotype. ", "Anatomic pathology archives at Texas Children's Hospital were searched for all rhabdomyosarcoma cases over a 20-year period. ", "One-hundred and thirty-seven cases were identified, with 50 being H&N cases. ", "The cases were typed according to the Intergroup Rhabdomyosarcoma Study (IRS) criteria. ", "Immunocytochemistry for myogenic and non-myogenic markers was performed on all H&N cases. ", "Electron micrographs from cases (n=32) where ultrastructural examination had been performed at the time of original diagnosis were reviewed. ", "Children with H&N rhabdomyosarcomas had a mean age of 5.3 years (median 4 years). ", "There was a male predilection (1.7M:1.0F). ", "Primary tumor sites were: face NOS (18%), orbit/periorbital (16%), nasal cavity/nose (14%), lymph nodes (12%), paranasal sinuses (10%), parameningeal (10%), parotid gland (6%), neck (6%), infratemporal fossa/zygoma (2%), buccal mucosa (2%), palate (2%), and larynx (2%). ", "Metastatic disease at diagnosis (33% of all cases) occurred in the bone marrow (11%), cerebrospinal fluid (6%), peritoneal fluid (6%), lung (4%), parietal pleura (2%), pleural fluid (2%) and pericardial fluid (2%). ", "Rhabdomyosarcoma types (IRS criteria) were: embryonal (60%), alveolar (classic and solid subtypes, 28%), botryoid (4%), undifferentiated (4%), spindle cell (2%) and anaplastic (2%). ", "Immunocytochemical findings were: polyclonal desmin (96%); myogenin (96%); muscle-specific actin (74%), smooth muscle actin (12%). ", "Nonmyogenic markers included: vimentin (100%), CD99 (16%), p53 (16%), pancytokeratin (10%), NSE (8%), LCA (6%), CD20 (6%), EMA (2%), and NB-84 (0%, neuroblastoma). ", "Undifferentiated sarcoma expressed only vimentin. ", "By ultrastructural examination, 44% had readily identified z-bands and myofilaments, 37% had infrequent to rare myofilaments and z-bands, and 19% had myotubular intermediate filaments. ", "Distribution of H&N rhabdomyosarcoma IRS types is similar to that for all primary sites, with the exception that embryonal types are modestly increased while alveolar type is mildly decreased. ", "There are many non-myogenic immunocytochemical markers that cross-react with rhabdomyosarcoma. ", "Differentiation between favorable and unfavorable rhabdomyosarcoma types is important for appropriate therapy, and predicting prognosis and survival." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.02, 0.006622516556291391, 0.008, 0.012987012987012988, 0.022727272727272728, 0.011111111111111112, 0.014184397163120567, 0.012195121951219513, 0, 0.007380073800738007, 0.004651162790697674, 0.016483516483516484, 0.007633587786259542, 0.03048780487804878, 0, 0, 0.010362694300518135, 0, 0 ]

[ "**Acknowledgements:** Funding was provided by the Alberta Ministry of Health and Wellness (AHW) and (in kind) by the former Capital Health region of the Alberta Health Services (AHS). ", "Drs. ", "Dan Sosin of the US CDC in Atlanta, Maura Ricketts of the Canadian Medical Association, Stephen Gabos of the AHW, and Gerry Predy of the AHS provided valuable advice and discussions. ", "Drs. ", "Gabos and Predy also reviewed an earlier version of this paper. ", "Further support by participating partners was provided by Health Link Alberta, the Department of Emergency Medicine of the University of Alberta, the emergency department of the Edmonton Area hospitals, the Alberta Provincial Laboratory for Public Health, DynaLifeDX Diagnostics Inc., the Edmonton Public School District, the Edmonton Catholic School District and the Parkland School Division \\# 70. ", "The contributions of Ms. Laurette Phimester (project manager) and our supporting organizations are also acknowledged.", "\n\n**Disclaimer:** The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of the Centers for Disease Control and Prevention, USA, the Alberta Ministry of Health and Wellness or the Alberta Health Services. ", "The mention of a company or its product does not constitute an official endorsement of the company or its product.", "\n\n**Conflict of Interest:** None to declare.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.016304347826086956, 0, 0.03825136612021858, 0, 0.015625, 0.02, 0.008547008547008548, 0.010948905109489052, 0, 0, 0 ]

[ "// /***************************************************************************\n// Aaru Data Preservation Suite\n// ----------------------------------------------------------------------------\n//\n// Filename : Info.cs\n// Author(s) : Natalia Portillo <claunia@claunia.com>\n//\n// Component : Apple DOS filesystem plugin.", "\n//\n// --[ Description ] ----------------------------------------------------------\n//\n// Identifies the Apple DOS filesystem and shows information.", "\n//\n// --[ License ] --------------------------------------------------------------\n//\n// This library is free software; you can redistribute it and/or modify\n// it under the terms of the GNU Lesser General Public License as\n// published by the Free Software Foundation; either version 2.1 of the\n// License, or (at your option) any later version.", "\n//\n// This library is distributed in the hope that it will be useful, but\n// WITHOUT ANY WARRANTY; without even the implied warranty of\n// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", "See the GNU\n// Lesser General Public License for more details.", "\n//\n// You should have received a copy of the GNU Lesser General Public\n// License along with this library; if not, see <http://www.gnu.org/licenses/>.", "\n//\n// ----------------------------------------------------------------------------\n// Copyright © 2011-2020 Natalia Portillo\n// ****************************************************************************/\n\nusing System.", "Text;\nusing Aaru.", "CommonTypes;\nusing Aaru.", "CommonTypes.", "Interfaces;\nusing Aaru.", "Helpers;\nusing Claunia.", "Encoding;\nusing Schemas;\nusing Encoding = System.", "Text.", "Encoding;\n\nnamespace Aaru.", "Filesystems\n{\n public sealed partial class AppleDOS\n {\n public bool Identify(IMediaImage imagePlugin, Partition partition)\n {\n if(imagePlugin.", "Info.", "Sectors !", "= 455 &&\n imagePlugin.", "Info.", "Sectors !", "= 560)\n return false;\n\n if(partition.", "Start > 0 ||\n imagePlugin.", "Info.", "SectorSize !", "= 256)\n return false;\n\n int spt = imagePlugin.", "Info.", "Sectors == 455 ? ", "13 : 16;\n\n byte[] vtocB = imagePlugin.", "ReadSector((ulong)(17 * spt));\n _vtoc = Marshal.", "ByteArrayToStructureLittleEndian<Vtoc>(vtocB);\n\n return _vtoc.catalogSector < spt && _vtoc.maxTrackSectorPairsPerSector <= 122 &&\n _vtoc.sectorsPerTrack == spt && _vtoc.bytesPerSector == 256;\n }\n\n public void GetInformation(IMediaImage imagePlugin, Partition partition, out string information,\n Encoding encoding)\n {\n Encoding = encoding ?? ", "new Apple2();\n information = \"\";\n var sb = new StringBuilder();\n\n int spt = imagePlugin.", "Info.", "Sectors == 455 ? ", "13 : 16;\n\n byte[] vtocB = imagePlugin.", "ReadSector((ulong)(17 * spt));\n _vtoc = Marshal.", "ByteArrayToStructureLittleEndian<Vtoc>(vtocB);\n\n sb.", "AppendLine(\"Apple DOS File System\");\n sb.", "AppendLine();\n\n sb.", "AppendFormat(\"Catalog starts at sector {0} of track {1}\", _vtoc.catalogSector, _vtoc.catalogTrack).", "\n AppendLine();\n\n sb.", "AppendFormat(\"File system initialized by DOS release {0}\", _vtoc.dosRelease).AppendLine();\n sb.", "AppendFormat(\"Disk volume number {0}\", _vtoc.volumeNumber).AppendLine();\n sb.", "AppendFormat(\"Sectors allocated at most in track {0}\", _vtoc.lastAllocatedSector).AppendLine();\n sb.", "AppendFormat(\"{0} tracks in volume\", _vtoc.tracks).AppendLine();\n sb.", "AppendFormat(\"{0} sectors per track\", _vtoc.sectorsPerTrack).AppendLine();\n sb.", "AppendFormat(\"{0} bytes per sector\", _vtoc.bytesPerSector).AppendLine();\n\n sb.", "AppendFormat(\"Track allocation is {0}\", _vtoc.allocationDirection > 0 ? \"", "forward\" : \"reverse\").", "\n AppendLine();\n\n information = sb.", "ToString();\n\n XmlFsType = new FileSystemType\n {\n Bootable = true,\n Clusters = imagePlugin.", "Info.", "Sectors,\n ClusterSize = imagePlugin.", "Info.", "SectorSize,\n Type = \"Apple DOS\"\n };\n }\n }\n}" ]

{ "pile_set_name": "Github" }

[ 0.009009009009009009, 0, 0.008264462809917356, 0.004878048780487805, 0.015151515151515152, 0.012578616352201259, 0.00904977375565611, 0.058823529411764705, 0.08333333333333333, 0.08333333333333333, 0.043478260869565216, 0, 0.02040816326530612, 0, 0, 0.005780346820809248, 0.2, 0, 0.027777777777777776, 0.2, 0, 0, 0, 0.2, 0, 0, 0.2, 0, 0, 0, 0.0043859649122807015, 0.01652892561983471, 0.2, 0, 0, 0, 0, 0, 0.03333333333333333, 0, 0, 0.009433962264150943, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.2, 0.0196078431372549, 0.2, 0 ]

[ "Nick Clegg and Theresa May are heading for a confrontation over the future of Britain's anti-terror laws in the aftermath of the controversy over the detention of the partner of the Guardian journalist Glenn Greenwald.", "\n\nAs Europe's human rights watchdog warned that the treatment of David Miranda could have a \"chilling effect\" on press freedom, senior Liberal Democrat sources indicated they were prepared to press for major revisions to the Terrorism Act 2000.", "\n\nThe Lib Dem move was flatly rejected by the home secretary, who ruled out any further changes to the act beyond proposals announced before the detention of Miranda.", "\n\nBut the home secretary received a blow when the 47-strong Council of Europe, which polices human rights on the continent, wrote a strongly worded letter to May about the detention of Miranda.", "\n\nThorbjorn Jagland, the general secretary, asked May how the treatment of Miranda and the British government demand for the Guardian to destroy hard drives containing leaked NSA files were compatible with Britain's obligations under the European Convention on Human Rights. \"", "These measures, if confirmed, may have a potentially chilling effect on journalists' freedom of expression as guaranteed by Article 10 of the European Convention on Human Rights [ECHR],\" he wrote. \"", "I would therefore be grateful to you if you could provide information on these reports and comment on the compatibility of the measures taken with the UK's obligations under the convention.\"", "\n\nThe intervention by the Council of Europe is a significant boost for Miranda, whose lawyers will on Thursday ask the high court for an interim injunction to prevent the police or government using, copying or sharing any of the data they may have taken from his laptop, phone and other electronic equipment they seized at Heathrow.", "\n\nThe London law firm Bindmans will argue that the Metropolitan police misused schedule 7 of the Terrorism Act 2000. ", "This allows police to detain an individual at a port or airport even if they have no grounds for suspicion about their behaviour.", "\n\nMiranda's lawyers, who received another boost when former lord chancellor Lord Falconer said there was no legal basis for the detention, say the Met had no powers to detain a transit passenger who had not formally entered the UK. ", "They will also say the police action marked a \"grave and manifestly disproportionate interference\" with Miranda's rights under the ECHR.", "\n\nMay endorsed the police action, in contrast to Clegg who said he would await the outcome of a judgment by David Anderson QC, the independent reviewer of anti-terrorism legislation. ", "The Lib Dems also disagreed with May's response to the decision by David Cameron and Clegg to instruct cabinet secretary Sir Jeremy Heywood to demand that the Guardian destroy hard drives containing NSA documents leaked by the whistleblower Edward Snowden.", "\n\nIn the first official confirmation of Heywood's involvement, Clegg said he endorsed this decision because of national security fears and to allow the Guardian to be able to continue to publish stories from NSA files stored outside the UK. ", "May cast doubt on the Guardian's assertion that other copies exist.", "\n\nSenior Lib Dem sources said they were looking \"with great interest\" at the call by Anderson for parliament to reassess whether police should be allowed to detain individuals if they have no suspicions about their activity.", "\n\nAnderson has also raised questions about the way electronic equipment can be confiscated from those who are detained. ", "A senior Lib Dem source said: \"We will look at the suggestion that we should do more with great interest.\"", "\n\nAnderson, who described the detention of Miranda as \"unusual\", held a meeting with the Met on Tuesday to discuss the case. ", "He is not expected to make any statements before next week.", "\n\nMay told Radio 4 she supported the police action in detaining Miranda. \"", "It is absolutely right if the police believe somebody has in their possession highly sensitive stolen information that could help terrorists, that could lead to a loss of lives – it is right the police should act. ", "I believe schedule 7 of this act enables the police to do that. ", "It gives them the framework for that.\" ", "Clegg's response was much more cautious response from Clegg. ", "A spokesman said: \"The independent reviewer of terrorism legislation is already looking into the circumstances around the detention.\"", "\n\nA new poll found that voters felt by 50% to 33% that police acted unreasonably in declining to return Miranda's electronic equipment when he was released. ", "But the YouGov poll also found strong support (66% to 22%) for schedule 7, which allows police to detain someone at a port or airport even if they have no suspicion that they are a terrorist.", "\n\nNearly half of those questioned (44%) thought the police action was inappropriate, however, because Miranda is not involved in terrorism, while 37% agreed that it was appropriate to detain him.", "\n\nThe poll found support – by 42% to 33% – for the act to be changed so that individuals can only be detained where there is \"a 'reasonable suspicion' of involvement in terrorism\". ", "It also found that people marginally supported – by 42% to 38% – the decision by the Guardian to publish secret NSA files leaked by the US whistleblower Edward Snowden.", "\n\nAccording to the poll, people marginally supported – by 43% to 40% – Cameron's decision to instruct Heywood to demand that the Guardian surrender or destroy hard drives containing the documents.", "\n\n• This article was amended on 22 August 2013. ", "An editing error led to the earlier version referring to \"the UK or Northern Ireland\" in the eighth paragraph; Northern Ireland is part of the UK." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.013761467889908258, 0.00819672131147541, 0, 0.0051813471502590676, 0.0036231884057971015, 0.005050505050505051, 0, 0.006024096385542169, 0, 0, 0.004310344827586207, 0.014705882352941176, 0.01092896174863388, 0.0234375, 0.012448132780082987, 0.014925373134328358, 0.008928571428571428, 0.008333333333333333, 0.009433962264150943, 0.008, 0, 0.013513513513513514, 0, 0, 0, 0.01639344262295082, 0, 0, 0.005235602094240838, 0, 0, 0.017857142857142856, 0.01020408163265306, 0, 0 ]

[ "DUE TO THE COVID-19 PANDEMIC AND HIGH VOLUME, ORDERS MAY BE DELAYED UP TO A WEEK OR TWO. ", "WE ARE WORKING AS HARD AS POSSIBLE TO CATCH UP. ", "PLEASE EMAIL ALL QUESTIONS TO SALES@TRIMBENDER.COM OR CALL 800-422-1943WE WILL RESPOND AS PROMPTLY AS POSSIBLE." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011235955056179775, 0, 0.018018018018018018 ]

[ "This job offer is expired\n\nAdvantage Integrated Solutions\n\n\n\n\n\nSenior Web Developer\n\n\n\n\n\nSalary Range: $90k-$130 DOE\n\n\n\n\n\nAdvantage Integrated Solutions is seeking a full-time Senior Web Developer to join our team, in Denver or remotely. ", "Our main office is located in Downtown Denver, with personnel in Atlanta and other cities, and clients across the U.S. This position requires a driven, focused, and highly competent team member who is skilled at working with others remotely.", "\n\n\n\n\n\nAdvantage builds custom, cloud-based business apps on Quick Base, ServiceNow and other web platforms and products, with the consulting that goes with client-based development. ", "We also do some product development. ", "Some of our team works out of our Denver WeWork office, others work remotely from home. ", "We have a very flexible, modern, professional work environment and culture, serving emerging and leading companies across industries. ", "You will work on multiple projects/clients, so desire for variety and compatibility with that is desirable. ", "Travel is minimal to negligible.", "\n\n\n\n\n\nAs a senior web developer, you will coordinate with our consultants, developers, and occasionally clients on their needs, technical solutions, and develop cutting-edge cloud applications. ", "You will learn and engage with new and exciting technologies, work on diverse projects, and become a valued member of our development team.", "\n\n\n\n\n\nLocation\n\nDenver, CO, or remote candidates with exceptional communication practices.", "\n\n\n\n\n\nExperience\n\n5+ years with Bachelor’s degree (in Engineering, Computer Science or related field) or equivalent experience\n\n\n\n\n\n4+ years of immersion in front end frameworks such as Angular, AngularJS, or React\n\n\n\n\n\n3+ years of exposure to the Ruby and Ruby on Rails environments\n\n\n\n\n\nTo Apply\n\nPlease send resume and inquiry to [email protected]\n\nTechnical Requirements\n\n4-5 years in AngularJS(1.5+)/Angular(5.0+)/React\n\n\n\n\n\n3-4 years in Ruby and Ruby on Rails\n\n\n\n\n\n2-3 years in NodeJS\n\n\n\n\n\n2+ years in jQuery\n\n\n\n\n\n2+ years in promise-based asynchronous JS programming\n\n\n\n\n\n3+ years in HTML/CSS\n\n\n\n\n\nRegular exposure to AWS cloud (EC2, Lambda, S3, SQS Queue)\n\n\n\n\n\nGit/GitHub source control\n\n\n\n\n\nExperience with SQL outside of an ORM. ", "Database design is a major bonus.", "\n\n\n\n\n\nExperience with multiple persistence layers such as MySql, Firebase, Oracle, etc..\n\n\n\n\n\nPrimary Skills\n\nRapidly adaptable to new projects, industries, and technologies\n\n\n\n\n\nComfortable working multiple projects concurrently with frequent pivots\n\n\n\n\n\nProject design and estimation\n\n\n\n\n\nProvide creative and effective solutions inline with estimates\n\n\n\n\n\nFrank, focused, and complete communication to audiences with/without technical fluency\n\n\n\n\n\nSelf-motivated, self-learner\n\n\n\n\n\nComfortable picking up unfamiliar languages/tools/libraries on short notice\n\n\n\n\n\nCan maintain unfamiliar codebases with short notice\n\n\n\n\n\nExceptional debugger and investigator\n\n\n\n\n\nSecondary skills" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.01098901098901099, 0, 0.011363636363636364, 0, 0, 0, 0, 0, 0.011111111111111112, 0.016238159675236806, 0, 0.002932551319648094 ]

[ "Kh_shop\n\nIn china,we do the ebay business more than 8 years. ", "So We are extra attention to our quality products, carefully handle customers' packages,...read more\n\nKh_shop\n\nIn china,we do the ebay business more than 8 years. ", "So We are extra attention to our quality products, carefully handle customers' packages, quickly ship customers' packages and our customer service. ", "Communication is the key to make everything work efficiently. ", "Please feel free to contact us!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.01639344262295082, 0.006134969325153374, 0, 0, 0 ]

[ "Q:\n\nwhat is the fastest way to assign data array items to range values\n\nI am developing an excel client to a SQL server data base.", "\nWhen I select data from the data base to the client records are saved in arrays. ", "These arrays are then \"injected\" into Excel sheets using an array of variant. ", "\nThis technique is far faster than assigning individual cell values BUT seems to fail in some specific context.", "\nWhen the data value is vbNullString the range cell corresponding to the item is not assigned. ", "Worst if the first item is vbNullString, none of the items are saved to the range. ", "\nMy guess is that the vbNullString is translated to null as a variant and the variant array has the wrong dimension.", "\nIs there any other explanation ?", "\nFor instance \nByRef loTable As ListObject,\nByRef sItems() As String\n\nare parameters of a sub executing the following code where\nloTable is an Excel Table (ListObject) and sItems the data I want to assign to the range of the Excel Table loTable \nDim lCount as Long\nDim vItems() as Variant\nlCount = UBound(sItems)-LBound(sItems)+1\n'size vItems as a 2D array - required to fetch a range\nIf (lCount > 0) Then ReDim vItems(1 To lCount, 1 To 1)\n'copy string to variant\nDim i As Integer\nFor i = LBound(sItems) To UBound(sItems)\n vItems(i, 1) = sItems(i)\nNext i\nDim olrs As ListRows\nSet olrs = loTable.", "ListRows\nWith loTable\n If (lCount > 0) Then\n If (Not (.DataBodyRange Is Nothing)) Then .DataBodyRange.", "Delete\n olrs.", "Add\n If (lCount = 1) Then\n olrs(olrs.", "Count).Range.", "Cells(1, 1).Value = sItems(LBound(sItems))\n Else\n .DataBodyRange.", "Resize(lCount, 1).Value = vItems\n End If\n Else\n .DataBodyRange.", "Delete\n End If\nEnd With 'loTable\n\nI come to the question : have you tried such a range (of a table) value assignment and how to cope with null items in an array for a fast assignment.", "\nLooping over the array items and adding one by one just takes for ever.", "\n\nA:\n\nWould something like this help?", "\n'Declarations section\nPrivate Const gsPROVIDER as String = [Provider]\nPrivate Const gsDATA_SOURCE as String = [Source]\nPrivate Const gsINITIAL_CATALOG as String = [Catalog]\nPrivate Const gsUSER_ID as String = [User ID]\nPrivate Const gsPASSWORD as String = [Password]\n\nPrivate Sub Test\n Dim rsData As Object\n Dim sConnect As String\n Dim sSQL As String\n\n sConnect = \"Provider=\" & gsPROVIDER & _\n \"Data Source=\" & gsDATA_SOURCE & _\n \"Initial Catalog=\" & gsINITIAL_CATALOG & _\n \"User ID=\" & gsUSER_ID & _\n \"Password=\" & gsPASSWORD\n sSQL = 'SQL in a string\n\n Set rsData = CreateObject(\"ADODB.Recordset\")\n rsData.", "Open sSQL, sConnect\n\n If Not rsData.", "EOF Then\n Worksheets(1).ListObjects(loTable).DataBodyRange.", "CopyFromRecordset rsData\n Else\n MsgBox \"No data found!\", ", "vbCritical, \"Error!\"", "\n End If\n\n rsData.", "Close\n Set rsData = Nothing\nEnd Sub\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.007692307692307693, 0, 0, 0, 0, 0, 0, 0, 0.01001669449081803, 0, 0.05, 0, 0, 0, 0.0125, 0.005376344086021506, 0, 0, 0.00145985401459854, 0, 0.015151515151515152, 0, 0, 0, 0 ]

[ "Millennialism\n\nMillennialism (from millennium, Latin for \"a thousand years\"), or chiliasm (from the Greek equivalent), is a belief advanced by some religious denominations that a Golden Age or Paradise will occur on Earth prior to the final judgment and future eternal state of the \"World to Come\".", "\n\nChristianity and Judaism have both produced messianic movements which featured millennialist teachings - such as the notion that an earthly kingdom of God was at hand. ", "These millenarian movements often led to considerable social unrest..\n\nSimilarities to millennialism appear in Zoroastrianism, which identified successive thousand-year periods, each of which will end in a cataclysm of heresy and destruction, until the final destruction of evil and of the spirit of evil by a triumphant king of peace at the end of the final millennial age. \"", "Then Saoshyant makes the creatures again pure, and the resurrection and future existence occur\" (Zand-i Vohuman Yasht 3:62).", "\n\nScholars have also linked various other social and political movements, both religious and secular, to millennialist metaphors.", "\n\nJudaism\n\nMillennialist thinking first emerged in Jewish apocryphal literature of the tumultuous intertestamental period (200 BCE to 100 CE),\nproducing writings such as the Psalm 46, the Book of Enoch, the Book of Jubilees, Esdras, Book of Daniel, and the additions to Daniel.", "\n\nPassages within these texts, including 1 Enoch 6-36, 91-104, 2 Enoch 33:1, and Jubilees 23:27, refer to the establishment of a \"millennial kingdom\" by a messianic figure, occasionally suggesting that this kingdom would endure for a thousand years. ", "However, the actual number of years given for the duration of the kingdom varied. ", "In 4 Ezra 7:28-9, for example, the kingdom lasts only 400 years.", "\n\nThis notion of the millennium no doubt helped some Jews to cope with the socio-political conflicts that they faced. ", "This concept of the millennium served to reverse the previous period of evil and suffering, rewarding the virtuous for their courage while punishing evil-doers, with a clear separation of those who are good from those who are evil. ", "The vision of a thousand-year period of bliss for the faithful, to be enjoyed here in the physical world as \"heaven on earth\", exerted an irresistible power over the imagination of Jews in the inter-testamental period as well as on early Christians. ", "Millennialism, which had already existed in Jewish thought, received a new interpretation and fresh impetus with the development of Christianity.", "\n\nGerschom Scholem profiles medieval and early modern Jewish millennialist teachings in his book Sabbatai Sevi, the mystical messiah, which focuses on the 17th-century movement centered on the self-proclaimed messiahship (1648) of Sabbatai Zevi\n(16261676).", "\n\nChristianity\n\nChristian millennialist thinking is primarily based upon the Book of Revelation, specifically , which describes the vision of an angel who descended from heaven with a large chain and a key to a bottomless pit, and captured Satan, imprisoning him for a thousand years:\n\nThe Book of Revelation then describes a series of judges who are seated on thrones, as well as his vision of the souls of those who were beheaded for their testimony in favor of Jesus and their rejection of the mark of the beast. ", "These souls:\n\nThus, John of Patmos characterizes a millennium where Christ and the Father will rule over a theocracy of the righteous. ", "While there are an abundance of biblical references to such a kingdom of God throughout the Old and New Testaments, this is the only reference in the Bible to such a period lasting one thousand years.", "\n\nEarly church\n\nDuring the first centuries after Christ, various forms of chiliasm (millennialism) were to be found in the Church, both East and West. ", "It was a decidedly majority view at that time, as admitted by Eusebius, himself an opponent of the doctrine:\n\nNevertheless, strong opposition later developed from some quarters, most notably from Augustine of Hippo. ", "The Church never took a formal position on the issue at any of the ecumenical councils, and thus both pro and con positions remained consistent with orthodoxy. ", "The addition to the Nicene Creed was intended to refute the perceived Sabellianism of Marcellus of Ancyra and others, a doctrine which includes an end to Christ's reign and which is explicitly singled out for condemnation by the council [Canon #1]. ", "The Catholic Encyclopedia notes that the 2nd century proponents of various Gnostic beliefs (themselves considered heresies) also rejected millenarianism.", "\n\nMillennialism was taught by various earlier writers such as Justin Martyr, Irenaeus, Tertullian, Commodian, Lactantius, Methodius, and Apollinaris of Laodicea in a form now called premillennialism. ", "According to religious scholar Rev. Dr. Francis Nigel Lee, \"Justin's 'Occasional Chiliasm' sui generis which was strongly anti-pretribulationistic was followed possibly by Pothinus in A.D. 175 and more probably (around 185) by Irenaeus\". ", "Justin Martyr, discussing his own premillennial beliefs in his Dialogue with Trypho the Jew, Chapter 110, observed that they were not necessary to Christians:\n\nMelito of Sardis is frequently listed as a second century proponent of premillennialism. ", "The support usually given for the supposition is that \"Jerome [Comm. ", "on Ezek. ", "36] and Gennadius [De Dogm. ", "Eccl., ", "Ch. ", "52] both affirm that he was a decided millenarian.\"", "\n\nIn the early third century, Hippolytus of Rome wrote:\n\nAround 220, there were some similar influences on Tertullian, although only with very important and extremely optimistic (if not perhaps even postmillennial) modifications and implications. ", "On the other hand, \"Christian Chiliastic\" ideas were indeed advocated in 240 by Commodian; in 250 by the Egyptian Bishop Nepos in his Refutation of Allegorists; in 260 by the almost unknown Coracion; and in 310 by Lactantius. ", "Into the late fourth century, Bishop Ambrose of Milan had millennial leanings (Ambrose of Milan. ", "Book II. ", "On the Belief in the Resurrection, verse 108). ", "Lactantius is the last great literary defender of chiliasm in the early Christian church. ", "Jerome and Augustine vigorously opposed chiliasm by teaching the symbolic interpretation of the Revelation of St. John, especially chapter 20.", "\n\nIn a letter to Queen Gerberga of France around 950, Adso of Montier-en-Der established the idea of a \"last World Emperor\" who would conquer non-Christians before the arrival of the Antichrist.", "\n\nReformation and beyond\n\nChristian views on the future order of events diversified after the Protestant reformation (c.1517). ", "In particular, new emphasis was placed on the passages in the Book of Revelation which seemed to say that as Christ would return to judge the living and the dead, Satan would be locked away for 1000 years, but then released on the world to instigate a final battle against God and his Saints (). ", "Previous Catholic and Orthodox theologians had no clear or consensus view on what this actually meant (only the concept of the end of the world coming unexpectedly, \"like a thief in a night\", and the concept of \"the antichrist\" were almost universally held). ", "Millennialist theories try to explain what this \"1000 years of Satan bound in chains\" would be like.", "\n\nVarious types of millennialism exist with regard to Christian eschatology, especially within Protestantism, such as Premillennialism, Postmillennialism, and Amillennialism. ", "The first two refer to different views of the relationship between the \"millennial Kingdom\" and Christ's second coming.", "\n\nPremillennialism sees Christ's second advent as preceding the millennium, thereby separating the second coming from the final judgment. ", "In this view, \"Christ's reign\" will be physically on the earth.", "\n\nPostmillennialism sees Christ's second coming as subsequent to the millennium and concurrent with the final judgment. ", "In this view \"Christ's reign\" (during the millennium) will be spiritual in and through the church.", "\n\nAmillennialism basically denies a future literal 1000 year kingdom and sees the church age metaphorically described in Rev. 20:1–6 in which \"Christ's reign\" is current in and through the church.", "\n\nThe Catholic Church strongly condemns millennialism as the following shows:\n\nUtopianism\n\nThe early Christian concept had ramifications far beyond strictly religious concern during the centuries to come, as it was blended and enhanced with ideas of utopia.", "\n\nIn the wake of early millennial thinking, the Three Ages philosophy developed. ", "The Italian monk and theologian Joachim of Fiore (died 1202) claimed that all of human history was a succession of three ages:\n the Age of the Father (the Old Testament)\n the Age of the Son (the New Testament)\n the Age of the Holy Spirit (the age begun when Christ ascended into heaven, leaving the Paraclete, the third person of the Holy Trinity, to guide)\n\nIt was believed that the Age of the Holy Spirit would begin at around 1260, and that from then on all believers would be living as monks, mystically transfigured and full of praise for God, for a thousand years until Judgment Day would put an end to the history of our planet.", "\n\nThe New Age movement was also highly influenced by Joachim of Fiore's divisions of time, and transformed the Three Ages philosophy into astrological terminology. ", "The Age of the Father was recast as the Age of Aries, the Age of the Son became the Age of Pisces, and the Age of the Holy Spirit was called the Aquarian New Age. ", "The current so-called \"Age of Aquarius\" will supposedly witness the development of a number of great changes for humankind, reflecting the typical features of millennialism.", "\n\nJehovah's Witnesses\n\nJehovah's Witnesses believe that Christ will rule from heaven for 1,000 years as king over the earth, assisted by 144,000 holy ones.", "\n\nThe Church of Almighty God\n\nAlso known as Eastern Lightning, The Church of Almighty God mentions in its teachings the Age of Millennial Kingdom, which will follow the catastrophes prophesied in the Book of Revelation.", "\n\nBaha'i Faith\n\nBahá'u'lláh mentioned in the Kitáb-i-Íqán that God will renew the \"City of God\" about every thousand years, and specifically mentioned that a new Manifestation of God would not appear within 1000 years (1893-2893) of Bahá'u'lláh's message, but that the authority of Bahá'u'lláh's message could last up to 500,000 years.", "\n\nTheosophy\nThe Theosophist Alice Bailey taught that Christ (in her books she refers to the powerful spiritual being best known by Theosophists as Maitreya as The Christ or The World Teacher, not as Maitreya) would return “sometime after AD 2025”, and that this would be the New Age equivalent of the Christian concept of the Second Coming of Christ.", "\n\nNazism\n\nThe most controversial interpretation of the Three Ages philosophy and of millennialism in general is Adolf Hitler's \"Third Reich\" (\"Drittes Reich\"), which in his vision would last for a thousand years to come (\"Tausendjähriges Reich\"), but which ultimately only lasted for 12 years (1933–1945).", "\n\nThe phrase \"Third Reich\" was originally coined by the German thinker Arthur Moeller van den Bruck, who in 1923 published a book titled Das Dritte Reich. ", "Looking back at German history, he distinguished two separate periods, and identified them with the ages of the 12th century Italian theologian Joachim of Fiore:\n\nthe Holy Roman Empire (beginning with Charlemagne in AD 800) – (the \"First Reich\") – The Age of the Father and\nthe German Empire – under the Hohenzollern dynasty (1871–1918) (the \"Second Reich\") – The Age of the Son.", "\n\nAfter the interval of the Weimar Republic (1918–1933), during which constitutionalism, parliamentarism and even pacifism ruled, these were then to be followed by:\n\nthe \"Third Reich\" – The Age of the Holy Ghost.", "\n\nAlthough van den Bruck was unimpressed by Hitler when he met him in 1922 and did not join the Nazi Party, the phrase was nevertheless adopted by the Nazis to describe the totalitarian state they wanted to set up when they gained power, which they succeeded in doing in 1933. ", "Later, however, the Nazi authorities banned the informal use of \"Third Reich\" throughout the German press in the summer of 1939, instructing it to use more official terms such as \"German Reich\", \"Greater German Reich\", and \"National Socialist Germany\" exclusively.", "\n\nDuring the early part of the Third Reich many Germans also referred to Hitler as being the German Messiah, especially when he conducted the Nuremberg Rallies, which came to be held at a date somewhat before the Autumn Equinox in Nuremberg, Germany.", "\n\nIn a speech held on 27 November 1937, Hitler commented on his plans to have major parts of Berlin torn down and rebuilt:\n\n[...] einem tausendjährigen Volk mit tausendjähriger geschichtlicher und kultureller Vergangenheit für die vor ihm liegende unabsehbare Zukunft eine ebenbürtige tausendjährige Stadt zu bauen [...].", "\n\n[...] to build a millennial city adequate [in splendour] to a thousand year old people with a thousand year old historical and cultural past, for its never-ending [glorious] future [...]\n\nAfter Adolf Hitler's unsuccessful attempt to implement a thousand-year-reign, the Vatican issued an official statement that millennial claims could not be safely taught and that the related scriptures in Revelation (also called the Apocalypse) should be understood spiritually. ", "Catholic author Bernard LeFrois wrote:\n\n: Since the Holy Office decreed (July 21, 1944) that it cannot safely be taught that Christ at His Second Coming will reign visibly with only some of His saints (risen from the dead) for a period of time before the final and universal judgment, a spiritual millennium is seen in Apoc. ", "20:4–6. ", "St. John gives a spiritual recapitulation of the activity of Satan, and the spiritual reign of the saints with Christ in heaven and in His Church on earth.", "\n\nSocial movements\nMillennial social movements are a specific form of millenarianism that are based on some concept of a one thousand-year cycle. ", "Sometimes the two terms are used as synonyms, but this is not entirely accurate for a purist. ", "Millennial social movements need not be religious, but they must have a vision of an apocalypse that can be utopian or dystopian. ", "Those who are part of millennial social movements are \"prone to be violent,\" with certain types of millennialism connected to violence. ", "The first is progressive, where the \"transformation of the social order is gradual and humans play a role in fostering that transformation.\" ", "The second is catastrophic millennialism which \"deems the current social order as irrevocably corrupt, and total destruction of this order is necessary as the precursor to the building of a new, godly order.\" ", "However the link between millennialism and violence may be problematic, as new religious movements may stray from the catastrophic view as time progresses.", "\n\nSee also\n Christian eschatological views\n Christian Zionism\n Council of Ephesus\n Cult of the Holy Spirit\n Immanentize the eschaton\n Millenarianism\n Millennial Day Theory\n Preterism\n The Pursuit of the Millennium\n\nReferences\n\nBibliography\n\n Barkun, Michael. ", " Disaster and the Millennium (Yale University Press, 1974) ()\n Case, Shirley J. The Millennial Hope, The University of Chicago Press, 1918.", "\n Cohn, Norman. ", "The Pursuit of the Millennium: Revolutionary Millenarians and Mystical Anarchists of the Middle Ages, (2nd ed. ", "Yale U.P., 1970).", "\n Desroches, Henri, Dieux d'hommes. ", "Dictionnaire des messianismes et millénarismes de l'ère chrétienne, The Hague: Mouton, 1969,\n Ellwood, Robert. \"", "Nazism as a Millennialist Movement\", in Catherine Wessinger (ed.), ", "Millennialism, Persecution, and Violence: Historical Cases (Syracuse University Press, 2000). ( ", "or )\n Fenn, Richard K. The End of Time: Religion, Ritual, and the Forging of the Soul (Pilgrim Press, 1997). ( ", "or )\n Hall, John R. Apocalypse: From Antiquity to the Empire of Modernity, (Cambridge, UK: Polity 2009). ", " ( [pb] and )\n Kaplan, Jeffrey. ", "Radical Religion in America: Millenarian Movements from the Far Right to the Children of Noah (Syracuse University Press, 1997). ( ", "or )\n Landes, Richard. ", "Heaven on Earth: The Varieties of the Millennial Experience, (Oxford University Press 2011)\n Pentecost, J. Dwight. ", "Things to Come: A study in Biblical Eschatology(Zondervan, 1958) and .", "\n Redles, David. ", "Hitler's Millennial Reich: Apocalyptic Belief and the Search for Salvation (New York University Press, 2005). ( ", "or )\n Stone, Jon R., ed. ", "Expecting Armageddon: Essential Readings in Failed Prophecy (Routledge, 2000). ()", "\n Underwood, Grant. (", "1999) [1993]. ", "The Millenarian World of Early Mormonism. ", "Urbana: University of Illinois Press. ", "\n Wessinger, Catherine. ", "ed. ", " The Oxford Handbook of Millennialism (Oxford University Press, 2011) 768 pp.", "  online review\n Wistrich, Robert. ", "Hitler’s Apocalypse: Jews and the Nazi Legacy (St. Martin's Press, 1985). ()", "\n\nExternal links\n\nCatholic Encyclopedia \"Millennium and Millenarianism\"\n\nCategory:Book of Revelation\nCategory:Christian eschatology\nCategory:Christian terminology" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0.011764705882352941, 0, 0.016129032258064516, 0, 0.0036101083032490976, 0, 0, 0.015625, 0, 0, 0, 0, 0.0078125, 0, 0, 0, 0.006622516556291391, 0.013888888888888888, 0.00625, 0.008032128514056224, 0, 0.015, 0.008403361344537815, 0.008032128514056224, 0, 0.1111111111111111, 0, 0, 0, 0, 0, 0.008849557522123894, 0.020618556701030927, 0, 0, 0, 0.02112676056338028, 0.010309278350515464, 0, 0, 0.003861003861003861, 0, 0.011428571428571429, 0, 0, 0, 0, 0, 0, 0.0038910505836575876, 0, 0.0015748031496062992, 0, 0, 0, 0, 0.0091324200913242, 0.005952380952380952, 0.005714285714285714, 0.003278688524590164, 0.012903225806451613, 0.002638522427440633, 0, 0.010830324909747292, 0.003787878787878788, 0.016, 0.01557632398753894, 0.002136752136752137, 0.006153846153846154, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.003861003861003861, 0.02877697841726619, 0.0625, 0, 0.058823529411764705, 0.027777777777777776, 0.008928571428571428, 0.029850746268656716, 0.010416666666666666, 0.018018018018018018, 0.009523809523809525, 0.03125, 0.007633587786259542, 0.043478260869565216, 0.017391304347826087, 0, 0.058823529411764705, 0.026785714285714284, 0.08, 0, 0, 0, 0, 0.02631578947368421, 0.041666666666666664, 0, 0.012987012987012988, 0.02857142857142857, 0.013157894736842105, 0 ]

[ "(ANSA) - Rome, September 26 - The cabinet of Premier Matteo Renzi decided Monday a national referendum over whether to accept or reject the government's constitutional reform law will be held December 4. ", "The reform has already been approved by parliament, but Italy's Constitution says any laws amending the Charter must be ratified by popular referendum if they were approved by less than a two-thirds majority in each house of parliament.", "\n\nPremier Matteo Renzi has staked his political credibility on pushing the reform through and could quit if he loses the referendum on the revamp of the country's political machinery, which includes reducing the Senate into a leaner assembly of local-government representatives with limited powers to cut costs and streamline Italy's notoriously ponderous method of passing legislation.", "\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.00980392156862745, 0, 0.0051813471502590676, 0 ]

[ "You have entered a password containing uncommon characters and you are now unable to log into your account.", "\n\nYou have simply forgotten your password.", "\n\nResolution\n\nTo reset your password:\n\n1. ", "Make sure you are fully logged out of your Unity Account. ", "If you are asked for your old password to confirm any changes, this means you are currently still logged into your Account. ", "You will need to log out before you can reset the password." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0.017241379310344827, 0.008064516129032258, 0 ]

[ "1. ", "Introduction {#sec1}\n===============\n\nProtonated nicotine amide adenine dinucleotide (NADH) produced in the course of photosynthetic energy conversion can be considered as the biological equivalent of solar hydrogen as a fuel.^[@ref1]^ As a versatile two-electron reductant, this co-factor is an essential component for many biocatalytic and bioinspired substrate transformation processes, requiring competent electron input for chemical bond formation.^[@ref2]−[@ref4]^ For example, the assimilation of atmospheric CO~2~ to produce liquid carbon-based fuels such as methanol can be achieved via an enzymatic reduction sequence based on NADH.^[@ref5]^ A variety of biomimetic asymmetric hydrogenation reactions also critically depends on the availability of this class of redox co-factors.^[@ref6],[@ref7]^ For many of these potential applications, however, a permanent addition of the native co-factor as a sacrificial reductant remains costly and impractical. ", "Therefore, a sustainable recycling method for nicotine amide adenine dinucleotide (NAD^+^) and related model compounds based on a renewable energy source is a highly desirable feature.^[@ref8]−[@ref11]^ Here, we report about the efficient nonenzymatic regeneration of native NADH and the functional nucleotide co-factor analogue BNADH (protonated *N*-benzyl-3-carbamoyl-pyridinium) powered by red light, using a water-soluble tin(IV)chlorin complex as a novel chlorophyll-like photosensitizer for solar chemistry.", "\n\nBecause of their excellent stability properties and a preference for mediating multielectron transfer processes,^[@ref12]−[@ref14]^ tin porphyrins are very attractive candidates for the sensitization of artificial photosynthetic reactions based on earth-abundant components. ", "Some of their water-soluble derivatives have been successfully involved in pioneering studies on the photogeneration of hydrogen under visible-light irradiation.^[@ref15],[@ref16]^ The photochemical formation of different aromatic ring-reduced hydroporphyrin species is a common observation under these conditions.^[@ref17],[@ref18]^ In this context, the occurrence of tin chlorins (SnC), which are stable 2,3-dihydroporphyrin derivatives of their porphyrin parent compounds (SnP), has been considered as an undesirable side reaction, which could no longer be coupled to hydrogen production.^[@ref15],[@ref19]^ In combination with a suitable hydride transfer mediator, however, the chlorin species SnC, which exhibits attractive chlorophyll-type spectral features, including an enhanced red light-absorption capability, becomes accessible as a photocatalyst for the accumulation and transfer of hydrogen equivalents. ", "This novel approach allows the harvesting of low-energy photons for a more efficient solar energy conversion, while, at the same time, solving the putative difficulties of a gradual chlorin accumulation. ", "The axial coordination sphere of the central metal of such photosensitizers may be easily varied independently for further modifications of the systems such as immobilization or coupling to other functional subunits including co-catalysts, depending on the nature of the substituents X.^[@ref13],[@ref14],[@ref20]−[@ref24]^ Moreover, in a wavelength-controllable process, the readily accessible tin porphyrin precursor complexes SnP, which can be considered as the long-term stable resting states of this class of multielectron transfer photosensitizers under ambient conditions, can be conveniently transformed in situ to the corresponding hydrogenated chlorin species SnC (Scheme [1](#sch1){ref-type=\"scheme\"}).^[@ref25]^ Here, we show that the metallochlorin complexes obtained may then be selectively excited with red light for photocatalytic (B)NADH formation (Scheme [2](#sch2){ref-type=\"scheme\"}).", "\n\n{#sch1}\n\n![", "Photocatalytic System for the Reduction of BNAD^+^ Applying Tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-chlorin (SnC) as a Red-Light Responsive Multielectron Transfer Sensitizer Able To Recycle the Selective Hydride Transfer Mediator \\[Cp\\*Rh(bpy)H\\]^+^ in Neutral Aqueous Solution](ic-2013-01611v_0014){#sch2}\n\n2. ", "Results and Discussion {#sec2}\n=========================\n\n2.1. ", "Synthesis and Characterization of the Tin Porphyrin Precursor Complex {#sec2.1}\n--------------------------------------------------------------------------\n\nThe starting material tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-porphyrin (SnP with X = Cl, Scheme [1](#sch1){ref-type=\"scheme\"}) was prepared and characterized according to the reported literature procedure.^[@ref26]^ Depending on the specific synthesis and purification conditions of such compounds, different metalloporphyrin derivatives containing an undesired mixture of axially bound ligands X such as chloro and hydroxy groups may sometimes be formed and isolated.^[@ref27],[@ref28]^ Moreover, under reductive conditions, the axial chloro ligands bound to the high-valent central metal of tin(IV) porphyrins have been shown to become labile against hydrolysis.^[@ref29]^ For our investigations with water-soluble tin porphyrin derivatives, the actual nature of the axially bound ligands X was therefore additionally studied via solid-state ^119^Sn NMR of the isolated compounds (Figure [1](#fig1){ref-type=\"fig\"}), where only one resonance occurred, at −588.3 ppm. ", "A comparison of the chemical shift of this signal with the literature data for the closely related tetraphenylporphyrin complex Sn(TPP)Cl~2~ in CDCl~3~ (δ = −589 ppm) leads to the conclusion that, in our SnP samples, two chloride ligands are attached to the tin(IV) central atom.^[@ref30],[@ref31]^ More importantly, the corresponding ^119^Sn NMR chemical shift was also observed in neutral aqueous solution of the SnP compound at 298 K. This finding clearly indicates that, at neutral pH, the complex is not immediately hydrolyzed to form a dihydroxo tin species with X = OH. ", "In order to further study the conditions required for such an axial ligand exchange, subsequently, 10 μL of KOH (*c* = 2 mol/L) were added, and a broadened and downfield-shifted (deshielded) ^119^Sn resonance occurred at −585.5 ppm. ", "At this stage of the reaction, the increased line width of the ^119^Sn resonance peak might reflect a higher asymmetry around the ^119^Sn metal center and, therefore, indicate the occurrence of a stepwise exchange process of the axial chloro ligands against hydroxyl groups, as observed previously by mass spectroscopy with related main group metalloporphyrin complexes.^[@ref32]^ After the addition of further 10 μL of the concentrated KOH solution, finally a chemical shift at −579.1 ppm was reached. ", "The sharp peak at −579.1 ppm indicates the complete exchange of two axial chloro ligands by hydroxide ions.^[@ref30],[@ref31]^\n\n{#fig1}\n\nAdditional ^1^H NMR experiments in neutral aqueous solution also showed no evidence for axially attached hydroxide ligands, since there were no proton resonances found between 0 and −10 ppm.^[@ref28]^ Only under more-alkaline conditions (pH 12, Figure [2](#fig2){ref-type=\"fig\"}) could a gradual evolution of a single proton signal at −3.85 ppm be observed, indicating the occurrence of an exchange process from chloride to hydroxide ligation. ", "Despite of the enormous stability typical for high-valent tin porphyrins,^[@ref14],[@ref33]^ further addition of KOH finally led to a demetalation of the SnP compound. ", "As a consequence, the ^119^Sn signal at −579.1 ppm fully vanished, while at the bottom of the NMR tube, a solid gray precipitate was formed, which was not further characterized.", "\n\n{#fig2}\n\nThe pH-dependent exchange processes of axial ligands X in SnP in aqueous solution were also studied by ultraviolet--visible light (UV-vis) spectroscopy (see the [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "In the pH range of 6--10, the 422-nm Soret-band absorption maximum of the tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-porphyrin complex with X = Cl remained essentially constant. ", "At pH \\>10, the spectroscopic titration experiments resulted in a small bathochromic shift of the Soret-band to 424 nm, which, consistent with our proton NMR data, is interpreted as the formation of the dihydroxo species with X = OH. ", "In acidic solution (at pH 4--6), we could verify a reversible protonation step of the dichloro-substituted tin(IV) complex of the *meso*-tetrakis(*N*-methylpyridinium)-porphyrin cation as indicated by a hypsochromic shift of the Soret band, which has been previously described and tentatively interpreted in the literature as a process occurring at one of the central porphyrin nitrogen atoms.^[@ref34]^\n\nTaking together all these results, we have evidence that the photocatalyst precursor SnP studied in our system is initially carrying axial chloro ligands (X = Cl), since the pH value in all experiments carried out in buffered aqueous systems was kept between pH 7 and pH 9 in order to maintain the stability of the investigated nucleotide co-factors. ", "Under the photocatalytic reaction conditions reported here, however, the intermediate formation of aromatic ring-reduced species will certainly allow an exchange of axially bound chloride with other ligands such as hydroxide.^[@ref29]^ Interestingly, even a direct inner-sphere interaction with the rhodium co-catalyst in the axial coordination sphere of the tin complex cannot be excluded, as will be discussed later.", "\n\n2.2. ", "Formation of the Tin Chlorin Photosensitizer {#sec2.2}\n-------------------------------------------------\n\nUpon visible-light irradiation in the presence of suitable electron donors (Scheme [1](#sch1){ref-type=\"scheme\"}), the water-soluble tin(IV)-complex of *meso*-tetrakis(*N*-methylpyridinium)-porphyrin (SnP) can be selectively reduced under ambient conditions to generate the tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-(2,3-dihydroporphyrin) or the chlorin derivative SnC (Scheme [1](#sch1){ref-type=\"scheme\"}). ", "This clean and rapid transformation, which can be driven to completeness, is easily followed by UV--vis spectroscopy and characterized by the occurrence of several isosbestic points (see the [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "Upon irradiation with green light in the presence of dioxygen, a photochemical quantum yield of φ = 4 × 10^--3^ was obtained for the chlorin formation process, using 0.01 M EDTA as an electron donor (298 K; light-emitting diode (LED) wavelength of 525 nm). ", "A more efficient route to obtain the chlorin species is the photochemical reduction with sodium sulfite added as an electron donor in basic aqueous solution, which is also carried out under ambient conditions. ", "Following this approach, a very promising quantum yield of up to φ = 0.34 could be achieved for the in situ generation of the photosensitizer SnC. Sulfate was identified as the oxidation product of the sacrificial two-electron donor sulfite (for more details, see the [Supporting Information](#notes-1){ref-type=\"notes\"}).", "\n\nAs expected for this class of compounds,^[@ref35]−[@ref37]^ reducing one of the pyrrole rings of the SnP precursor complex to form the metallochlorin (2,3-dihydroporphyrin) derivative SnC results in characteristic effects on the absorption band pattern in the visible spectrum (see Figure [3](#fig3){ref-type=\"fig\"}).", "\n\n{#fig3}\n\nThe tin chlorin compound displays a strong absorption peak in the red spectral region (Q~*y*~-band), and several less pronounced absorptions at wavelengths of \\<600 nm, which resembles the spectrum of native chlorophyll derivatives such as Chl *b* (also shown in Figure [3](#fig3){ref-type=\"fig\"}). ", "With regard to the SnP precursor, this enhanced red-light-harvesting feature of the corresponding tin chlorin complex SnC is also reflected by the deep green color of the photosensitizer in solution. ", "Such a sufficiently red-shifted threshold wavelength (here, with an absorption onset at λ~thr~ = 660 nm or *E* = 1.88 eV) can be regarded as one of the key requirements for potential solar energy conversion applications such as artificial photosynthesis.^[@ref2],[@ref38]^ It should also be mentioned, in this context, that, in contrast to the natural chlorophylls, which display quite similar spectral features but an adaptation to biological energy conversion conditions, the biomimetic photosensitizers reported here are characterized by an excellent water-solubility and turned out to be extremely robust against demetalation and degradation processes.", "\n\n2.3. ", "Photocatalytic Reduction of Nucleotide Co-factor Analogues {#sec2.3}\n---------------------------------------------------------------\n\nThe artificial photosynthetic production of *N*-benzyl-1,4-dihydro nicotine amide (BNADH) was powered by green- or red-light irradiation and carried out under an argon atmosphere (see Scheme [2](#sch2){ref-type=\"scheme\"}). ", "For this purpose, buffered aqueous solutions of the oxidized nucleotide co-factor model BNAD^+^ (1 mM) containing a catalytic amount of the SnC photosensitizer (typically in the micromolar range) were mixed with an excess of sacrificial electron donors such as TEOA or EDTA. ", "The concentrations of all components were kept low enough to be able to follow the photocatalytic process spectroscopically under continuous-wave irradiation without any further dilution steps. ", "As an additional redox mediator, the rhodium complex \\[Cp\\*Rh(bpy)Cl\\]Cl was added. ", "In aqueous solution,^[@ref39]^ the complex \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ is formed (Scheme [2](#sch2){ref-type=\"scheme\"}), which has already been extensively studied as an electrocatalyst for regioselective NAD^+^ hydrogenation.^[@ref10]^ This selective catalytic process involves the participation of a hydrido-rhodium intermediate \\[Cp\\*Rh(bpy)H\\]^+^ exclusively generating the enzymatically active 1,4-NADH form of the reduced co-factor.^[@ref10],[@ref39],[@ref40]^ Recently, it has been shown that such rhodium complexes can also be incorporated in light-driven redox systems based on different types of sensitizers.^[@ref9],[@ref41]−[@ref43]^ Here, we are employing this type of redox mediator to enable a photocatalytic reduction of the nucleotide co-factor model compound BNAD^+^,^[@ref44]^ which was added to the system as chloride salt in buffered aqueous solution.", "\n\n![", "Spectral changes observed during visible-light irradiation (λ \\> 530 nm, 298 K, 1 cm cell) of an anaerobic aqueous solution containing 1 mM BNAD^+^, \\[Cp\\*Rh(bpy)H~2~O\\]^2+^, EDTA, and a small amount of the tin chlorin complex SnC as the photosensitizer (6 × 10^--6^ M). ", "Inset: Luminescence and excitation spectra of the BNADH photoproduct accumulated in the course of the photocatalytic process (the asterisk marks artifacts due to minor SnC reabsorption and fluorescence).](ic-2013-01611v_0004){#fig4}\n\nIn the presence of SnC as a sensitizer, a photocatalytic accumulation of the two-electron reduced compound BNADH was indicated by a new absorption band between 320 and 360 nm (ε = 7240), which continuously increased under steady-state irradiation with visible light (Figure [4](#fig4){ref-type=\"fig\"}). ", "No such reaction was observed in darkness or without SnC or the rhodium mediator present. ", "After the photolysis experiments, luminescence measurements showed a broad new emission band at 470 nm upon excitation of the sample at 340 nm, which could also be verified by the corresponding excitation spectrum (Figure [4](#fig4){ref-type=\"fig\"}). ", "These findings can also be ascribed to a successful photochemical synthesis of BNADH.^[@ref45]^\n\nIn the experiment shown, the total increase of the product absorption band corresponds to ∼15% conversion of the oxidized BNAD^+^ co-factor initially added (1 mM). ", "Therefore, it is clear that the reaction is catalytic, both in terms of the tin chlorin photosensitizer (6 μM, log ε = 4.25 at the Q~*y*~-band maximum),^[@ref25]^ as well as the rhodium co-catalyst present in solution. ", "From the spectroscopic data of the photolysis shown in Figure [4](#fig4){ref-type=\"fig\"}, a lower limit for the average turnover number (TON) of BNADH molecules produced per each photosensitizer molecule (the minimum number of turnovers completed up to this point)^[@ref46]^ can be estimated as TON(SnC) = 28. ", "We also measured the quantum yield of this process using selective red-light (Q~*y*~-band) excitation (see the [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "A value of φ = 3 × 10^--4^ was obtained for the BNADH formation reaction monitored by the increase of UV absorption (298 K, LED: 623 nm). ", "This value (calculated here as a lower limit by assuming only one mole of incident photons required per mole of product molecule formed)^[@ref47]^ is in the order of magnitude of other photocatalytic co-factor recycling systems reported recently, which were powered by blue-light radiation.^[@ref43],[@ref48]^\n\nFrequently, the formation of the reduced nicotinic acid moiety of nucleotide co-factors and related model compounds such as BNADH is only characterized by the type of diagnostic electronic spectral features reported above. ", "Typically, an appearance of the optical absorbance band at 340 nm and sometimes also the corresponding luminescence signal at ∼470 nm are utilized for the quantification of NADH derivatives in bioanalytical assays. ", "Under abiotic conditions, however, following these spectroscopic signatures alone could be misleading, since other reaction products such as biocatalytically inactive isomeric forms or undesired co-factor dimerization products with similar spectroscopic features might also be obtained. ", "Therefore, the usefulness of potential NADH regeneration systems is sometimes verified with an appropriate enzymatic assay, where the reduced co-factor is consumed and thus indirectly monitored via substrate conversion. ", "We also did so within the case of artificial photosynthetic NADH production, and the results are presented in the next sections. ", "For an unambiguous direct quantification of the accumulated model compound BNADH, a combination of different analytical methods was chosen here. ", "It has been shown previously that the regioselective reduction of synthetic nucleotide co-factor substitutes such as BNAD^+^ to the corresponding 1,4-dihydro form can be analyzed using high-performance liquid chromatography (HPLC), nuclear magnetic resonance (NMR), and electrospray ionization--mass spectroscopy (ESI-MS).^[@ref48],[@ref49]^ Therefore, we also decided to apply an additional high-performance liquid chromatography/high-resolution mass spectroscopy (HPLC/HRMS)-based detection method for the confirmation and characterization of the obtained photoreduction products. ", "The details of these further control experiments are described in the [Supporting Information](#notes-1){ref-type=\"notes\"}.", "\n\n2.4. ", "Photocatalytic Reduction of Natural NAD^+^ Co-factors {#sec2.4}\n----------------------------------------------------------\n\nThe application of the artificial photosynthetic co-factor recycling system described above was extended to study also the visible-light-driven reduction of natural NAD^+^ under slightly different conditions, which were systematically varied to get more insight into the mechanistic details of the process. ", "Long-wavelength irradiation was performed with a 150 W xenon lamp equipped with suitable cutoff filters or with a high-power LED setup (see the [Supporting Information](#notes-1){ref-type=\"notes\"}) and approached in three different ways. ", "First, experiments were starting directly from the tin porphyrin precursor complex SnP in nitrogen-saturated solution, which allowed us to gain more insight into the oxygen-sensitive steps of the tin chlorin formation sequence summarized in Scheme [1](#sch1){ref-type=\"scheme\"}. ", "In another set of experiments, the photolysis was performed with the tin chlorin photosensitizer SnC produced via photochemical reduction with EDTA under ambient conditions prior to the addition of other reagents to the sample and purging with argon. ", "The third variation of photocatalytic reaction conditions was based on the use of anaerobic aqueous SnC solutions obtained from sulfite reduced SnP already described in the previous sections.", "\n\nAn experiment starting directly from photoexcited SnP in the presence of EDTA as the electron donor is shown in Figure [5](#fig5){ref-type=\"fig\"}. ", "Note that the rhodium complex added as an additional redox mediator shows a characteristic absorption pattern in the 300--320 nm range. ", "At the beginning of the reaction, a rapid depletion of the metalloporphyrin Soret bands and Q-bands at 423 and 556 nm, and the rising of a broad new NIR-band with a maximum at 840 nm is observed. ", "In agreement with the typical behavior reported for other tin porphyrins in the literature,^[@ref19]^ these spectral variations indicate that, in the first reaction sequence, the air-sensitive *meso*-hydrated tin(IV)-phlorin (5,24-dihydroporphyrin) derivative^[@ref19],[@ref50]^ is formed as a primary reduction product of SnP in deaerated solution, which then rearranges to form the oxygen-stable metallochlorin species SnC. In aerobic solution, only the overall SnC formation process can be monitored under steady-state irradiation conditions, according to Scheme [1](#sch1){ref-type=\"scheme\"} (see the [Supporting Information](#notes-1){ref-type=\"notes\"}).", "\n\n![", "UV--vis and NIR spectral changes of a solution containing SnP, NAD^+^, EDTA, and \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ under N~2~ in 0.1 M phosphate buffer pH 7.4, using a 150 W xenon lamp light source with a 530-nm cutoff filter. ", "The initially increasing absorbance at 840 nm indicates that tin-phlorin species^[@ref50]^ are formed first under these conditions. ", "After a few minutes, the chlorin complex SnC and also higher reduced tetrahydroporphyrin species accumulate. ", "Irradiation of these compounds then starts to accelerate the reduction of NAD^+^ to NADH visible at 340 nm. ", "The results shown correspond to a turnover number of TON \\> 72 for co-factor photoreduction based on the initial amount of SnP.](ic-2013-01611v_0005){#fig5}\n\nIt turned out that several additional cross-reactions are possible, which could be explored separately by a selective excitation of the steady-state chromophore mixture present in solution using different cut-off filters or LED-light sources, providing nearly monochromatic wavelengths. ", "When, for example, a 530-nm cutoff filter is used as shown in Figure [5](#fig5){ref-type=\"fig\"}, the Q-bands of SnP are also excited, and a product-consuming back reaction of NADH competing with the sacrificial electron donor EDTA can take place, thus forming NAD^+^ and reduced tin porphyrin species. ", "Such a photoreduction of tin porphyrins with NADH as a donor, which has been reported previously in earlier work,^[@ref16]^ can explain the apparent lag-phase of NADH production in the systems starting with SnP instead of SnC as the photosensitizer. ", "Furthermore, depending on the type and excess of sacrificial electron donor applied under photocatalytic conditions, also a certain amount of a higher reduced metalloporphyrin species carrying partially or fully protonated tetrahydroporphyrin ligands may accumulate as an additional side product besides the desired tin chlorin complex SnC. In Figure [5](#fig5){ref-type=\"fig\"}, such a process is reflected by the rising Q~*y*~-band pattern in the 600--650 nm region. ", "While the SnC derivative shows a maximum at ∼633 nm, the additional peak rising at 612 nm can be tentatively attributed to the presence of a tin(IV)-complex carrying an adjacent tetrahydroporphyrin or *meso*-tetrakis(*N*-methylpyridinium)-isobacteriochlorin type of ligand.^[@ref35],[@ref36]^ As will be shown below, however, at slightly higher pH, this reversible pyrrole ring protonation process^[@ref36]^ involving the 7,8-position of the chlorin ligand can be suppressed to a significant extent. ", "Despite all of these inevitable complications consuming some of the reduction equivalents, a new absorption band at 340 nm is clearly rising under photostationary conditions (Figure [5](#fig5){ref-type=\"fig\"}), which indicates the reduction of NAD^+^ to NADH. ", "A lower limit of TON \\> 72 for the turnover number achieved was calculated from the tin-porphyrin-derived maximum amount of SnC photosensitizer that can be present in the reaction mixture. ", "This value was estimated from the optical spectra, assuming the molar absorption coefficient of NADH at 340 nm to be ε = 6300 mol^--1^ cm^--1^ (taken from literature data).^[@ref45]^\n\nLater experiments with SnC as the photocatalyst obtained directly from the sulfite-reduced SnP species with either EDTA or TEOA as a donor resulted in comparable or higher NADH yields. ", "As an example, in Figure [6](#fig6){ref-type=\"fig\"}, the photolysis of such a tin-chlorin-containing aqueous solution with a very small excess of EDTA as the electron donor is shown.^[@ref51]^ There are still significant amounts of the initial porphyrin precursor SnP visible (in the present case, up to 40%, upon estimation by the residual absorbance at 556 nm). ", "The remaining metalloporphyrin absorption bands usually disappear within 1 min of steady-state photolysis in all observed cases, because of the photochemical formation of different reduced porphyrin species, as already discussed above.", "\n\n![", "UV-vis spectral changes of a solution containing 7.5 μM SnC obtained by sulfite reduction of SnP; 1 mM NAD^+^; 0.01 M EDTA and 7.7 × 10^--5^ M \\[Cp\\*Rh(bpy)OH\\]^+^ under argon in 0.1 M phosphate buffer pH 8.8; 150 W Xe lamp with 590 nm cutoff filter; 298 K. Note that, in contrast to Scheme [2](#sch2){ref-type=\"scheme\"}, water ligands bound to the rhodium site (p*K*~a~ = 8.2)^[@ref39]^ are deprotonated at pH 8.8. ", "After 25 h of irradiation, almost no more changes of the spectra are observed (the trace with the highest amount of NADH was recorded at 48 h). ", "Numbers shown for % conversion are given relative to the total initial amount of NAD^+^. TON(SnC) = 30.](ic-2013-01611v_0006){#fig6}\n\nDuring photolysis of a solution containing only 0.01 M EDTA as a sacrificial donor, the reaction sensitized by SnC typically reaches a plateau slightly above 20% of conversion of the initial amount of NAD^+^ (see inset of Figure [6](#fig6){ref-type=\"fig\"}). ", "Interestingly, almost identical equilibrium conditions were found, when the excitation wavelength was further red-shifted (610 nm cutoff filter) to avoid an irradiation of any remaining SnP. It could be assumed that, under the conditions of very low excess of EDTA, as shown in Figure [6](#fig6){ref-type=\"fig\"}, the photocatalytic process is presumably limited by the amount of the primary reductant. ", "Therefore, we decided also to vary the type and concentrations of sacrificial electron donors. ", "Indeed, when larger amounts of EDTA were present, the product accumulation proceeded faster and much higher conversion yields of more than 70% NADH were readily achieved within a single run (see Figure [7](#fig7){ref-type=\"fig\"}). ", "A similar performance was also observed with TEOA as the electron donor under otherwise identical conditions ([Supporting Information](#notes-1){ref-type=\"notes\"}). ", "These findings suggest that a more-pronounced reductive quenching of the excited-state SnC sensitizer, thought to be responsible for initiating the subsequent co-factor reduction process, is reached with a larger excess of electron donor.", "\n\n![", "UV-vis and NIR spectral changes of a solution containing 7.5 μM SnC obtained by sulfite reduction of SnP; 1 mM NAD^+^; 1 M EDTA, and 7.7 × 10^--5^ M \\[Cp\\*Rh(bpy)OH\\]^+^ under argon in 0.1 M phosphate buffer pH 8.8; 150 W Xe lamp with 610 nm cutoff filter; 298 K; 73% conversion to NADH and TON(SnC) = 97 are reached.](ic-2013-01611v_0007){#fig7}\n\nAs an additional control experiment to further support the successful accumulation of NADH, in some cases, the time-dependent changes in luminescence spectra were also followed in the course of the photocatalytic process (Figure [8](#fig8){ref-type=\"fig\"}). ", "These data are consistent with the co-factor conversion profiles obtained from UV-vis spectroscopy.", "\n\n![", "Luminescence spectra of a solution containing 7.5 μM SnC; 1 mM NAD^+^; 15 w/v% TEOA and 7.7 × 10^--5^ M \\[Cp\\*Rh(bpy)OH\\]^+^ under argon in 0.1 M phosphate buffer pH 8.8; 150 W Xe lamp with 610 nm cutoff filter; increasing luminescence upon excitation at 340 nm exhibiting a maximum at λ~max~ = 470 nm indicates the reduction of NAD^+^ to NADH.](ic-2013-01611v_0008){#fig8}\n\nFrom the linear region of the irradiation time profiles typically observed within the first hours of exposure to red light (Figure [9](#fig9){ref-type=\"fig\"}), an initial turnover frequency of TOF \\> 20 h^--1^ can be estimated, which corresponds to a calculated space-time-yield of 2.5 g L^--1^ d^--1^ of NADH in these cuvette-based laboratory-scale experiments.^[@ref52]^ Nevertheless, very promising absolute product formation quantum yield values between 1% and 2% were obtained for the artificial photosynthetic formation of NADH. ", "As an example, in Figure [9](#fig9){ref-type=\"fig\"}, the initial reaction period of photocatalytic product accumulation with SnC as a sensitizer, \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ in its deprotonated form as a redox mediator and TEOA as a sacrificial electron donor is shown together with the spectral variations observed. ", "These data correspond to a NADH-production quantum yield of φ = 0.014 (298 K, LED: 592 nm). ", "In this context, it is worthwhile to compare this value with the absolute quantum efficiencies determined for the photoaccumulation of reduced chemical species in natural photosynthetic systems, which are typically reaching maximum values of φ = 0.01--0.06 in a comparable spectral region.^[@ref53]−[@ref55]^\n\n![", "UV--vis and NIR spectral changes of a solution containing 7.5 μM SnC; 1 mM NAD^+^; 15 w/v% TEOA (1 M) and 7.7 × 10^--5^ M \\[Cp\\*Rh(bpy)OH\\]^+^ under argon in 0.1 M phosphate buffer pH 8.8; 150 W Xe lamp with 610 nm cutoff filter; TON(SnC) = 56 after 5 h (see the [Supporting Information](#notes-1){ref-type=\"notes\"}).](ic-2013-01611v_0009){#fig9}\n\nAt the current stage, we have not yet tried to optimize the NAD^+^ to \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ ratio of the photocatalytic reaction mixtures. ", "It has been shown, however, in a recent publication describing a related blue-light powered NADH recycling system,^[@ref43]^ that up to 100% conversion yields of NAD^+^ are possible when the relative concentration of the rhodium mediator is increased. ", "Therefore, we believe that our current limit of ∼0.5 g L^--1^ NADH obtained from 1 mM NAD^+^ starting solutions (Figure [7](#fig7){ref-type=\"fig\"}) could still be further improved in a similar way.", "\n\nOne of the most significant findings in our case, however, besides the fact that the catalysis can be powered by red light, is the excellent long-term stability of the multielectron transfer sensitizer used. ", "As displayed in Figure [10](#fig10){ref-type=\"fig\"}, the starting spectrum of the green SnC complex is easily restored after driving the NADH production process to the maximum yield of a single long-term irradiation experiment. ", "Purging the anaerobic photostationary mixture of reduced metalloporphyrin derivatives with air obviously leads to a reoxidation of all intermediate photosensitizer reduction products back to the tin chlorin derivative, as indicated by the reappearing Soret-band and Q-band maxima at 430 and 636 nm (see Figure [10](#fig10){ref-type=\"fig\"}). ", "Upon subsequent addition of HCl, the overlapping 340-nm band of the acid labile photoproduct NADH^[@ref56]^ could be completely removed to better analyze also the UV region of the spectrum, where the rhodium mediator absorbs characteristically (not shown here). ", "These types of experiments support the belief that the apparently photobleached SnC is still fully intact, even after extended irradiation times with 40 h of exposure to light or longer. ", "Such a promising stability behavior of the key components of this artificial photosynthetic system will certainly open the stage for a repetitive series of long-term NAD^+^ photoreduction cycles in order to increase the total yield of the reduced co-factor. ", "Corresponding experiments to characterize the absolute TON limits^[@ref46]^ of the catalysts applied therefore still must be performed. ", "However, such long-term irradiation experiments were not yet within the scope of our work, which was more focused on the mechanistic aspects of this novel photocatalytic reaction sequence.", "\n\n{#fig10}\n\n2.5. ", "Coupling Artificial Photosynthesis of NADH to an Enzymatic Process {#sec2.5}\n-----------------------------------------------------------------------\n\nThe light energy stored in the form of NADH equivalents can be utilized for powering other endergonic substrate conversion processes in subsequent \"dark reactions\". ", "If any enzymatically accelerated steps must be involved for this purpose,^[@ref3],[@ref5]^ it is important to demonstrate that the energy-rich nicotine amide compound provided, and the reaction conditions selected, are indeed compatible with the limiting constraints of such biochemical processes. ", "As an additional confirmation of the regioselective co-factor recycling process, the photocatalytic 1,4-NADH synthesis reaction reported in this work was, therefore, also coupled to a simple enzymatic assay. ", "For this purpose, we selected the NADH-dependent yeast enzyme alcohol dehydrogenase (ADH, EC 1.1.1.1.) ", "from *Saccharomyces cerevisiae*,^[@ref57]^ which can be applied to reversibly convert different carbonyl compounds such as acetone, acetaldehyde, and butyraldehyde to the corresponding alcohols.^[@ref58]^ While interesting light-independent co-factor recycling processes to provide chiral ketone reduction products have also been reported in the literature,^[@ref59]^ it should be pointed out that we have chosen here a more simple reaction sequence to serve merely as a clear proof of principle for our concept. ", "Nevertheless, several important aspects must be considered in such a hybrid biophotocatalytic reaction system. ", "The performance of any enzymes to be coupled is usually characterized by a limited temperature and pH range and a substrate-dependent variation in efficiency. ", "Furthermore, the enzymatic process may be severely disturbed by various substances present only under abiotic reaction conditions. ", "For example, the zinc-enzyme ADH is well-known to be inhibited by Zn^2+^ chelating compounds such as 2,2′-bipyridine (bpy) and EDTA, which are at least partially present as functional components in all of the photocatalytic systems applied here (Scheme [2](#sch2){ref-type=\"scheme\"}). ", "Moreover, the natural function of several enzymes may turn out to be significantly modified or even completely inactivated when the biocatalysts are exposed to light under artificial reaction conditions.^[@ref2]^ Despite of these possible limitations, we could successfully couple the photocatalytic NADH generation process to a subsequent enzymatic alcohol production step catalyzed by ADH. ", "Different ways to provide the active photosensitizer SnC, as discussed in the sections above, were tested in the enzymatic assays. ", "The obtained alcohols were quantified by gas chromatography with acetonitrile added as an internal standard. ", "For analytical reasons, we started to monitor the formation of isopropanol qualitatively from acetone as a substrate using photochemically reduced NAD^+^ as a redox co-factor and alcohol dehydrogenase as the biocatalyst accelerating the coupled dark reaction. ", "However, it is well-known that the activity of ADH for the conversion of acetone is comparably low.^[@ref60]^ Even though it could be demonstrated that the expected biophotocatalytic reaction sequence is working properly, the best results achieved in the isopropanol production system therefore resulted only in unsatisfactory turnover numbers. ", "In contrast, the application of our photochemical system to the production of *n*-butanol from butyraldehyde (*n*-butanal) was much more successful, and turnover numbers referred to the limiting amount of tin chlorin photocatalyst of TON(SnC) \\> 100 could be readily achieved. ", "A typical example for such an enzyme-coupled photocatalytic experiment is shown in Figure [11](#fig11){ref-type=\"fig\"}. ", "For this plot, the sample was irradiated in a 1-cm cuvette sealed with a septum to directly compare these results with the reaction conditions of the other experiments shown in the previous sections. ", "Within the first 90 min of irradiation, an *n*-butanol concentration of ∼1 mM is built up, which corresponds to a turnover number of TON \\> 130 of completed photoreaction cycles up to this time. ", "This lower limit value is based on the initial concentration of the multielectron transfer sensitzer SnC and assuming a 1:1 ratio of NADH required for each two-electron reduced aldehyde molecule.^[@ref47]^\n\n{#fig11}\n\nIf NADH-based reduction equivalents are generated in the system, the reversible enzymatic process catalyzed by ADH should be able to reach the pH-dependent equilibrium between the aldehyde and alcohol substrate.^[@ref57]^ We assumed that, under the chosen reaction conditions (see the [Experimental Section](#sec4){ref-type=\"other\"}), the observed product formation rate should be limited by the quantum yield of NADH generation in the absence of the enzyme.", "\n\nThe reaction progress was followed by UV-vis spectroscopy and gas chromatography (GC) measurements. ", "In contrast to the experiments described in the previous sections, the 340-nm signal of NADH was no longer built up significantly upon photolysis in the presence of ADH. ", "The total amount of enzyme in the system was set comparably high (∼210 U) in order to guarantee sufficient catalytic activity also in the solution containing an excess of free EDTA, which may affect the active site of the ADH by competitive zinc-ion complexation, as already mentioned previously.^[@ref60]^ As can be seen (Figure [11](#fig11){ref-type=\"fig\"}), the alcohol product formation rate rapidly decreases within the first hour of irradiation, approaching an equilibrium concentration. ", "The initial rate of *n*-BuOH production is ∼2 mM h^--1^ (33 U of net \"photo-enzymatic\" activity), corresponding to a turnover frequency of TOF = 266 h^--1^, based on the SnC photosensitizer, which compared to the maximum values of light-independent systems reported in the literature is quite promising (TOF \\< 30 d^--1^).^[@ref59]^ Interestingly, this TOF value is also more than 10 times higher than the typical range of values observed in the NADH accumulation experiments described in the previous sections, where the loss of stored chemical energy by back-reactions seems to be more dominant. ", "Although the absolute quantum yield determination for monochromatic irradiation has not yet been carried out, it can already be concluded from the data shown above (see Figures [6](#fig6){ref-type=\"fig\"} and [7](#fig7){ref-type=\"fig\"}) that the permanent product formation in the presence of ADH is occurring with a mean quantum yield of φ ≈ 0.1 ± 0.05, estimated for red-light irradiation, which is within a reasonable order of magnitude, compared to the action spectra of photosynthetic systems.^[@ref55]^ We ascribe this enormous improvement in efficiency to the effect of immediately utilizing the photogenerated NADH with an additionally coupled two-electron redox process in situ as soon as it is formed. ", "This coupling competes with possible side reactions and helps to avoid a loss of the chemical energy stored caused by the limited long-term stability of the reduced co-factor. ", "It is well-known that quite similar strategies to preserve the intermediately stored reduction equivalents carried by the NADH co-factor are operating in the carbon dioxide reduction cascade (Calvin cycle) and also in the cyclic electron flow processes occurring in natural photosynthesis.^[@ref61],[@ref62]^ It is important to mention here also some of the control experiments carried out, which showed that a photolysis under the same conditions as described above (Figure [11](#fig11){ref-type=\"fig\"}), but without the enzyme and NAD^+^ present, did not lead to any observable *n*-BuOH formation. ", "Nor did a dark sample containing all functional components result in any variations of the UV--vis absorption spectra or indicate any formation of the alcohol product.", "\n\nWhile the light-driven reaction cascade discussed here is certainly not yet performed under optimized conditions, the present results clearly demonstrate that an efficient regioselective photocatalytic reduction of the nucleotide co-factor NAD^+^ required for the coupling to an enzymatic process has been achieved. ", "Other types of \"dark reactions\", which are more relevant in the context of artificial photosynthesis and solar energy conversion such as NADH-dependent abiotic CO~2~-fixation processes^[@ref2],[@ref5]^ will now also be tested with this type of biomimetic photocatalysis.", "\n\n2.6. ", "Aspects of Multielectron Transfer Sensitization and Hydride Transfer: A Tentative Reaction Mechanism {#sec2.6}\n---------------------------------------------------------------------------------------------------------\n\nIn the study presented here, a systematic variation of the reaction parameters, including pH, electron donor supply, and excitation wavelengths, has been performed in order to elucidate the conditions required for an efficient photocatalytic recycling of nucleotide co-factors. ", "It turned out that a complicated sequence of additional reactions coupling the light-induced primary processes of the photoexcited tin chlorin SnC with further electron transfer and protonation steps is necessary to enable the accumulation of NADH. ", "Nevertheless, an attempt is made here to provide a simplified mechanistic picture, which, to the best of our knowledge, is fully consistent with the available literature and all of our experimental and spectroscopic data.", "\n\nUpon irradiation with visible light absorbed only by the sensitizer, the photocatalytic process is initiated by reductive quenching of photoexcited SnC with an electron donor D. This photoinduced electron transfer process leads to the formation of the one-electron reduced tin chlorin π-radical anion SnC^•**--**^ as the first reaction intermediate (see eq [1](#eq1){ref-type=\"disp-formula\"}).In the case of similar sensitizers carrying high-valent main group central metals such as tin(IV) or antimony(V), it is well-established that such tetrapyrrole π-radical anions are metastable species,^[@ref50],[@ref63]^ which, under steady-state reaction conditions, are readily generated in degassed alkaline solution and identified by their weak Soret band at ∼400 nm and a structured band pattern in the 700--800 nm spectral region (also see Figures [6](#fig6){ref-type=\"fig\"} and [9](#fig9){ref-type=\"fig\"}). ", "The chlorin π-radical anion SnC^•**--**^ can be reversibly further reduced in a second electron transfer step to generate the tin chlorin π-dianion species SnC^2**--**^ carrying two additional electrons in the aromatic ring system of the sensitizer. ", "This process, which is considered as one of the crucial steps for coupling the initial one-electron photoreduction process to a net two-electron redox reactivity of the catalytic system, can proceed in two different ways. ", "Depending on the sensitizer concentration and the nature of the electron donor D applied, a second electron transfer step (eq [2](#eq2){ref-type=\"disp-formula\"}) or a disproportionation of the π-radical anion (eq [3](#eq3){ref-type=\"disp-formula\"}) will finally lead to the formation of the diamagnetic SnC^2--^ dianion.", "The π-dianion is able to take up one or two protons at different positions of the tetrapyrrole ring. ", "These steps are critically influenced by pH, solvent, central atom, and substitution pattern of the macrocyclic system. ", "The exact position of such a ring protonation can be clearly distinguished spectroscopically. ", "In our case (Figures [9](#fig9){ref-type=\"fig\"} and [10](#fig10){ref-type=\"fig\"}), the absence of a typical Soret band and the apparent bleaching of the entire spectrum of the sensitizer, leaving only broad, unstructured absorption bands in the 400--500 nm and 600--800 nm regions indicates the uptake of one additional proton in the *meso*-position of the macrocycle, thus forming a new compound with typical phlorin-anion characteristics.^[@ref50],[@ref64]^ A quite similar air-sensitive reduction product of a metallochlorin has been described and characterized before by Stolzenberg and co-workers.^[@ref65]^The resulting tin(IV) chlorin-phlorin anion complex SnCH^--^ containing a 2,3,10-saturated porphyrin ring chromophore (eq [4](#eq4){ref-type=\"disp-formula\"}) is thought to be the mechanistic key intermediate acting as the photochemically produced primary hydride source for the further catalytic steps involved in NADH generation (see Figure [12](#fig12){ref-type=\"fig\"}).", "\n\n![(", "a) Molecular structure of the proposed tin(IV) chlorin-phlorin anion complex SnCH^--^, which, according to the literature,^[@ref65]^ represents the most plausible tautomeric form of a two-electron ring-reduced *meso*-protonated derivative of the chlorin photosensitizer SnC. (b) Possible axial interactions of SnCH^--^ with the co-catalyst leading to SnC regeneration and rhodium-hydride complex formation, similar to the reduction pathways proposed for electrocatalysis^[@ref39]^ or the reaction of the \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ catalyst precursor with HCO~2~^--^ as the hydride source.^[@ref40]^](ic-2013-01611v_0012){#fig12}\n\nOxidation of SnCH^--^ to completely regenerate the initial tin chlorin species may occur in the presence of dioxygen (Figure [10](#fig10){ref-type=\"fig\"}) or, much more importantly, by transferring two electrons and a proton to the rhodium co-catalyst to drive the reaction sequence given below (eqs [5](#eq5){ref-type=\"disp-formula\"} and [6](#eq6){ref-type=\"disp-formula\"}). ", "The net hydride transfer process described in eq [5](#eq5){ref-type=\"disp-formula\"} continuously recycles the photoreduced SnC sensitizer for further irradiation with red light, as already indicated in the simplified picture given in Scheme [2](#sch2){ref-type=\"scheme\"}.We have also shown, in different control experiments, that the chemically generated rhodium hydride complex \\[Cp\\*Rh(bpy)H\\]^+^ is able to reduce tin porphyrins to phlorin-type species in a proton-coupled two-electron transfer process related to the back reaction of eq [5](#eq5){ref-type=\"disp-formula\"}, which additionally supports the possibility of a hydride exchange reaction sequence as proposed here (see the [Supporting Information](#notes-1){ref-type=\"notes\"}). ", "It is also interesting to note that, during the course of all of the steady-state irradiation experiments reported here, an enhanced increase of NADH is always observed after a certain lag-phase, which is finished when the absorption spectrum of the chlorin-phlorin anion SnCH^--^ is already dominating the photostationary mixture.", "\n\nThe suggested axial coordination sphere interaction between the reduced sensitizer SnCH^--^ and the rhodium co-catalyst (Figure [12](#fig12){ref-type=\"fig\"}) is fully compatible with the well-established mechanism of regioselective 1,4-NADH formation based on mixtures of \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ and sacrificial hydride sources, which intermediately bind through an O-atom to the rhodium center.^[@ref40]^ Furthermore, the close proximity and face-to face alignment of the sensitizer and co-catalyst π-electron systems, as depicted in Figure [12](#fig12){ref-type=\"fig\"}, are expected to provide a very favorable situation^[@ref66]^ for effective electron transfer from the tetrapyrrole complex donor to the rhodium site acting as the two-electron acceptor.", "\n\nIt should be kept in mind, however, that only a detailed deuterium labeling study could provide direct evidence for this plausible but, at the moment, still tentative suggestion. ", "It is also not yet clear whether a stepwise electron transfer sequence followed by protonation or a more or less concerted process is operating, although we assume that cleavage of the Rh--O bond and protonation of the Rh(I)-intermediate formed after two-electron reduction^[@ref39]^ is more probable.", "\n\nIn summary, the artificial photosynthetic NADH production described in the present work is thought to involve the photocatalytic formation of an intermediate hydride source (eq [7](#eq7){ref-type=\"disp-formula\"}) coupled to a subsequent regioselective hydride transfer reaction (eq [8](#eq8){ref-type=\"disp-formula\"}).", "\n\n3. ", "Conclusion {#sec3}\n=============\n\nWe have presented and characterized a new photocatalytic system for the regioselective two-electron reduction of nucleotide co-factors driven by light. ", "For the first time, it could be demonstrated in an abiotic system that photons in the long-wavelength region of the visible spectrum (\\>610 nm) can be exploited to power the accumulation of NADH. ", "Red-light energy could also be successfully converted using the synthetic co-factor analogue BNADH as a storage medium of reduction equivalents. ", "The light-harvesting and photocatalytic product formation process was achieved with a tin(IV) chlorin complex (SnC), which showed an excellent water solubility and long-term stability. ", "The artificial photosynthetic reaction sequence described here in detail, involving a primary electron donor, a multielectron transfer photosensitizer with a chlorophyll-type spectrum, and an additional redox-mediator catalyzing (B)NADH formation can be regarded as the first true functional model system for the overall light reactions occurring in natural photosystem I (PSI). ", "It could be shown that various sacrificial donors, even in a very low excess, can be applied to maintain the energy-storing photoinduced electron transfer and chemical bond formation chain. ", "More remarkably, the simple biomimetic process in an unprecedented way displays a very promising performance in terms of relevant efficiency criteria, including the limiting threshold energy of actinic light and the absolute quantum yield of permanent photoproduct formation. ", "Both values are indeed approaching the orders of magnitude reported for natural photosynthesis. ", "As part of our ongoing interest in bioinspired reaction cascades driven by sunlight and enzyme models,^[@ref2],[@ref13],[@ref67],[@ref68]^ we have also coupled an enzymatic dark reaction to the artificial photosynthesis of NADH. ", "It turned out that, similar to the steady-state situation in natural photoautotrophic metabolism, such a consecutive reaction cascade helps to avoid back-reactions and other limitations caused by NADH instability, which, in our case, led to an approximately 10-fold improvement of the permanent product formation efficiency. ", "Further mechanistic studies regarding the components of the photostationary reaction mixture and variations of the coupled substrate conversion routes based on photogenerated (B)NADH are currently underway.", "\n\n4. ", "Experimental Section {#sec4}\n=======================\n\n4.1. ", "Materials and Instrumentation {#sec4.1}\n----------------------------------\n\nAll chemicals, if not otherwise stated, were used as supplied. ", "Water was purified with a Milli-Q system (Millipore, Bedford, MA, USA). ", "Absolute acetonitrile was added as an internal standard for the enzymatic reactions. ", "Synthesis and characterization of the water-soluble tin-chlorin photosensitizer (SnC) and the nucleotide co-factor analogues BNAD^+^ and BNADH are described in detail in the [Supporting Information](#notes-1){ref-type=\"notes\"}. ", "The hydride transfer mediator precursor compound Cp\\*Rh(bpy)Cl\\]Cl was prepared following literature procedures.^[@ref69]^ Disodium ethylene diaminoacetate (Titriplex III) dihydrate salt p.a. (", "EDTA) was purchased from Merck and triethanolamine (98%) from ABCR Chemicals. ", "Alcohol dehydrogenase (ADH) from *Saccharomyces cerevisiae* (≥300 units/mg protein) was purchased from Aldrich, as well as β-nicotine amide adenine dinucleotide hydrate from yeast (NAD^**+**^).", "\n\nFor UV-vis-NIR absorption measurements up to 1100 nm, a Varian Cary 50 spectrophotometer was used. ", "Luminescence spectra were recorded with a Horiba Jobin Yvon FluoroLog 3 modular spectrofluorometer equipped with two double-grating monochromators. ", "Irradiation experiments were carried out on an optical bench in rectangular 1-cm quartz cuvettes. ", "As the light source for polychromatic irradiation experiments, a 150 W xenon lamp (Osram, Model XBO 150W/1) was used with an Oriel Newport universal arc lamp housing equipped with an Aspherab UV-grade fused silica condenser lens and an AMKO IR liquid filter filled with water (80 mm light pass). ", "The power supply was set to 100 W (5.6 A; 17.7 V) for all experiments. ", "To cut off short-wavelength light, suitable Schott long-pass glass color filters were used: OG 530, OG 590 and RG 610, respectively. ", "For the determination of quantum yields and for carrying out wavelength-selective irradiation experiments, different 3 W light-emitting diodes (LEDs) were used with λ~max~ = 525, 592, or 623 nm. ", "All quantum yields were measured with a home-built setup calibrated against the ferrioxalate actinometer, as described in detail in the [Supporting Information](#notes-1){ref-type=\"notes\"}.", "\n\nRoom-temperature ^1^H and ^119^Sn NMR spectra were recorded on a Bruker DRX 500 spectrometer operating at 500.13 MHz (^1^H) or at 186.4 MHz (^119^Sn). ", "Chemical shifts are either given in ppm, relative to residual solvent (H~2~O 4.7 ppm) for ^1^H, or were measured using Sn(Ph)~4~ as a secondary standard for ^119^Sn with all values reported relative to the external reference Sn(Me)~4~ (δ = 0 ppm).", "\n\n4.2. ", "General Procedure for the Photoreduction of Nucleotide Co-factors {#sec4.2}\n----------------------------------------------------------------------\n\nAll photocatalytic experiments were performed at 298 K in 1-cm quartz cuvettes with screw caps and a septum. ", "The samples were purged with nitrogen or argon, to remove most of the dioxygen from air, and were constantly stirred with a magnetic stirrer. ", "Unless otherwise stated, a typical sample for an experiment had a volume of 3.2 mL, which consisted of an aqueous EDTA or TEOA solution (10 mM--1 M) with 0.1 M sodium phosphate buffer (pH 8.8 or 7.4). ", "The catalyst concentrations were 7.5 × 10^--6^ M SnC and 7.7 × 10^--5^ M \\[Cp\\*Rh(bpy)H~2~O\\]^2+^ (at pH 7.4) or \\[Cp\\*Rh(bpy)OH\\]^+^ (at pH 8.8), respectively. (", "B)NAD^+^ (1 mM) was added to the solution, and the reaction progress was followed spectroscopically.", "\n\n4.3. ", "Catalytic Dark Reactions with NADH-Dependent Enzymes {#sec4.3}\n---------------------------------------------------------\n\nSamples for coupling artificial photosynthetic NADH production to additional biochemical processes were prepared in 1-cm quartz cuvettes sealed with a septum and consisted of a 0.1 M EDTA solution in 0.1 M aqueous sodium phosphate buffer (pH 8.8). ", "The photosensitizer and co-catalyst concentrations were 7.5 μM SnC and 7.7 × 10^--5^ M \\[Cp\\*Rh(bpy)OH\\]^+^, respectively. ", "To the argon-purged solution (*V* = 3.2 mL), 2 mg of the NAD^+^ co-factor (1 mM), 10 μL each of acetonitrile and butyraldehyde (35 mM), and 0.7 mg of lyophilized yeast alcohol dehydrogenase (ADH, Aldrich) were added. ", "The sample was then irradiated under steady-state conditions with orange-red light (590 nm cutoff filter; 298 K). ", "The reaction progress was followed and quantified by UV--vis spectroscopy and GC measurements.", "\n\nDetails on the synthesis of the compounds used, as well as further spectroscopic and experimental data including more information on HPLC/HRMS analytics, photolysis experiments, and quantum yield determination procedures. ", "This material is available free of charge via the Internet at <http://pubs.acs.org>.", "\n\nSupplementary Material\n======================\n\n###### \n\nic401611v_si_001.pdf\n\nThe authors declare no competing financial interest.", "\n\nWe would like to thank Evren Aricanli for additional measurements. ", "This manuscript is based on research supported by the Austrian Science Fund (FWF Project No. ", "P21045, \"Bio-inspired Multielectron Transfer Photosensitizers\"). ", "NMR facility funding from the European Union through the EFRE INTERREG IV ETC-AT-CZ program (Project No. ", "M00146, \"RERI-uasb\") is gratefully acknowledged. ", "G.K. also thanks the German Research Foundation (DFG No. ", "GRK1626, \"Chemical Photocatalysis\") for partial support of this work.", "\n\nSnP\n\n: water-soluble tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-porphyrin complexes of the type \\[(TMPyP)Sn(X)~2~\\]^4+^ with X = Cl or OH, derived at different pH from the starting compound dichloro-(5,10,15,20-tetrakis(*N*-methylpyridinium-4-yl)-porphyrinato)tin(IV)-tetrachloride\n\nSnC\n\n: water-soluble tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-chlorin complexes of the type \\[(TMPyC)Sn(X)~2~\\]^4+^ with X = Cl, or OH derived at different pH from dichloro-(2,3-dihydro-5,10,15,20-tetrakis(*N*-methylpyridinium-4-yl)-porphyrinato)tin(IV)-tetrachloride\n\nSnCH^--^\n\n: Tin(IV)-*meso*-tetrakis(*N*-methylpyridinium)-chlorin-phlorin-anion complex of the type \\[(TMPyCH)Sn(X)~2~\\]^3+^ with X = Cl or OH, derived by monodeprotonation of dichloro-(2,3,10,23-tetrahydro-5,10,15,20-tetrakis(*N*-methylpyridinium-4-yl)-porphyrinato)tin(IV)-tetrachloride\n\nNADH\n\n: 1,4-dihydro nicotine amide adenine dinucleotide\n\nNAD^**+**^\n\n: nicotine amide adenine dinucleotide\n\nBNADH\n\n: *N*-benzyl-1,4-dihydro nicotine amide\n\nBNAD^**+**^\n\n: *N*-benzyl-3-carbamoyl-pyridinium cation\n\nChl\n\n: chlorophyll\n\nD\n\n: sacrificial electron donor\n\n\\[Cp\\*Rh(bpy)Cl\\]Cl\n\n: chloro-\\[η^5^-(pentamethyl)cyclopentadienyl\\]-(2,2′-bipyridyl)-rhodium(III) chloride\n\n\\[Cp\\*Rh(bpy)H\\]^**+**^\n\n: Hydrido-\\[η^5^-(pentamethyl)-cyclopentadienyl\\]-(2,2′-bipyridyl)-rhodium(III) cation\n\nADH\n\n: alcohol dehydrogenase from *Saccharomyces cerevisiae*\n\nEDTA\n\n: ethylenediamine-tetraacetic-acetate sodium salts\n\nTEOA\n\n: triethanolamine\n\nHPLC\n\n: high-performance liquid chromatography\n\nHRMS\n\n: high-resolution mass spectrometry\n\nESI\n\n: electrospray ionization\n\nGC\n\n: gas chromatography\n\nNIR\n\n: near infrared\n\nQ-TOF\n\n: quadrupole time-of-flight mass spectrometer\n\nTON\n\n: turnover number\n\nTOF\n\n: turnover frequency\n\nU\n\n: unit of 1 μmol min^--1^ enzymatic activity\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0.008316008316008316, 0.007797270955165692, 0.007220216606498195, 0.007633587786259542, 0, 0.007743362831858407, 0, 0.007547169811320755, 0.0031545741324921135, 0, 0.0035335689045936395, 0.0034662045060658577, 0.008583690987124463, 0.003976143141153081, 0.015384615384615385, 0.0031746031746031746, 0.017857142857142856, 0.011299435028248588, 0, 0, 0, 0, 0.004273504273504274, 0.0026455026455026454, 0.0023923444976076554, 0, 0.0019267822736030828, 0, 0, 0, 0.003105590062111801, 0.009404388714733543, 0, 0.0029806259314456036, 0.005, 0.003048780487804878, 0, 0.0056022408963585435, 0.007272727272727273, 0, 0, 0.012658227848101266, 0, 0.014760147601476014, 0.0074487895716946, 0, 0, 0.0038314176245210726, 0.0045662100456621, 0.0064516129032258064, 0, 0.007246376811594203, 0.00749063670411985, 0.004651162790697674, 0, 0.004545454545454545, 0.007751937984496124, 0.006896551724137931, 0.00686106346483705, 0, 0, 0, 0, 0, 0, 0.005235602094240838, 0, 0, 0.01020408163265306, 0.007587253414264037, 0, 0.022935779816513763, 0.007575757575757576, 0.009174311926605505, 0.009259259259259259, 0, 0.0033112582781456954, 0.016, 0, 0.006, 0.0038461538461538464, 0, 0.016260162601626018, 0.005494505494505495, 0, 0, 0.009615384615384616, 0.006944444444444444, 0.002551020408163265, 0.0024875621890547263, 0, 0.004329004329004329, 0.006060606060606061, 0.004201680672268907, 0, 0.009900990099009901, 0, 0, 0.005494505494505495, 0.009554140127388535, 0.010869565217391304, 0.00641025641025641, 0.006122448979591836, 0.007936507936507936, 0.005076142131979695, 0, 0.008771929824561403, 0.002932551319648094, 0.003816793893129771, 0.0053475935828877, 0, 0.007352941176470588, 0, 0, 0.005434782608695652, 0.009174311926605505, 0, 0, 0.006349206349206349, 0.006711409395973154, 0, 0.02912621359223301, 0.005847953216374269, 0, 0, 0, 0.007017543859649123, 0.007653061224489796, 0.007633587786259542, 0, 0, 0.005797101449275362, 0, 0, 0, 0, 0.009569377990430622, 0.0124804992199688, 0.00980392156862745, 0.011764705882352941, 0.006072874493927126, 0.0033444816053511705, 0.005625879043600563, 0, 0.005, 0, 0, 0.011111111111111112, 0, 0, 0.008032128514056224, 0, 0.004405286343612335, 0, 0, 0, 0, 0, 0, 0.00508130081300813, 0, 0.0049800796812749, 0.0013477088948787063, 0.0030211480362537764, 0.003947368421052632, 0, 0.0033222591362126247, 0.003125, 0, 0, 0.00510204081632653, 0.006896551724137931, 0.005405405405405406, 0.005277044854881266, 0, 0, 0, 0.021834061135371178, 0.003076923076923077, 0.0048543689320388345, 0, 0, 0, 0.027777777777777776, 0, 0.0043859649122807015, 0.0051813471502590676, 0.02564102564102564, 0.015544041450777202, 0, 0, 0, 0.013513513513513514, 0.014084507042253521, 0, 0, 0, 0.013071895424836602, 0.008097165991902834, 0, 0, 0.007042253521126761, 0.009950248756218905, 0, 0, 0, 0.005405405405405406, 0, 0.009216589861751152, 0, 0.010638297872340425, 0.008928571428571428, 0.011904761904761904, 0, 0.014492753623188406, 0.010752688172043012, 0.015384615384615385, 0.009523809523809525, 0, 0.03508771929824561, 0.014492753623188406, 0.004851752021563342 ]

[ "Nota do editor\n\nO artigo abaixo foi originalmente publicado em fevereiro de 2018. ", "À época, George Soros estava em campanha aberta — publicando colunas de opinião nos principais veículos midiáticos mundiais — pela censura do Facebook, com o argumento de que a rede era \"uma ameaça à sociedade\" (tradução: a rede era uma ameaça ao monopólio das ideias progressistas).", "\n\nHoje, Soros voltou à carga e raivosamente pediu a cabeça de Mark Zuckerberg, CEO do Facebook (que também controla o WhatsApp e o Instagram), agora com um argumento bem mais direto: se estas redes sociais não forem controladas (isto é, censuradas), Trump será reeleito. ", "Sim, ele realmente disse isso — e ainda concluiu reafirmando explicitamente que \"eu defendo uma regulação governamental sobre as redes sociais\".", "\n\nEm janeiro deste ano, Soros já havia publicado uma coluna no The New York Times apresentando o mesmo argumento, com a mesma explicitude: ou o Facebook muda, ou a rede irá reeleger Trump — e assim manter os democratas, que são fartamente financiados por Soros, afastados da Casa Branca (um crime, ao que parece).", "\n\nOu seja, trata-se do mesmo argumento já apresentado em 2018: as redes de Zuckerberg (Facebook, WhatsApp e Instagram) — que foram instrumentais no Brexit e na vitória de Boris Johnson no Reino Unido —, por permitirem a divulgação de ideias conservadoras, furaram a bolha e, com isso, afetaram severamente o monopólio das ideias progressistas na mídia, monopólio este que sempre foi defendido por Soros.", "\n\nE isso está gerando resultados eleitorais que desagradam Soros.", "\n\nEste imbróglio interessa diretamente ao Brasil porque aqui, assim como lá fora, argumenta-se que as redes sociais estão sendo cruciais para a derrota da hegemonia cultural da esquerda. ", "Essa briga, sob o comando de Soros, ainda chegará aqui.", "\n\nConfira, no artigo abaixo, como tempo passou e nada mudou.", "\n\n______________________________\n\nO multimilionário George Soros, o principal financiador de todas as causas progressistas ao redor do mundo, está em campanha aberta contra as redes sociais. ", "Em um artigo para o jornal britânico The Guardian, que vem causando grande repercussão, ele alertou que a sociedade aberta corre perigo por causa das redes sociais.", "\n\n[Curiosamente, na mesma semana, alguns veículos brasileiros também defenderam a regulação das redes sociais].", "\n\nO argumento de Soros é, essencialmente, o seguinte:\n\na) as redes sociais estão sendo monopolizadas por poucas e grandes empresas, como Google e Facebook;\n\nb) tornou-se extremamente simples para essas plataformas utilizar seus enormes volumes de informação para manipular seus usuários;\n\nc) os usuários podem ser manipulados pelas redes não só em relação a suas preferências comerciais, como também em relação a suas preferências políticas;\n\nd) esta capacidade de manipulação política pode se tornar especialmente danosa caso tais \"monopólios\" privados se aliem a estados autoritários para sabotar os valores das sociedades abertas ocidentais;\n\ne) exatamente por tudo isso, os estados democráticos devem destruir as plataformas das redes sociais mediante impostos e regulações asfixiantes.", "\n\nUma parte do diagnóstico de Soros até está correta: as redes sociais de fato têm a capacidade de influenciar politicamente seus usuários e, consequentemente, de torná-los instrumentos de estados autoritários que querem insuflar sua propaganda com o propósito de impor sua ideologia específica, o que pode até destruir as bases da convivência pacífica. ", "Desconsiderar a existência deste perigo seria ingênuo e até desonesto.", "\n\nNo entanto, é igualmente ingênuo e desonesto acreditar — como faz Soros — que estes perigos podem ser resolvidos por meio de uma canetada que outorgue aos \"estados democráticos\" (na prática, apenas aqueles aprovados por Soros) a competência de controlar as plataformas das redes sociais.", "\n\nCom efeito, tal ideia não é apenas ingênua e desonesta: ela é extremamente ameaçadora.", "\n\nProblemas elementares\n\nSoros diz temer uma aliança entre governos autoritários e os grandes \"monopólios\"[1] das redes sociais, mas, ao mesmo tempo, defende entregar o controle das redes sociais a outros governos — desde que sejam \"democráticos\".", "\n\nHaverá aqueles que não vêem contradição — ou mesmo contra-indicação — nenhuma nessas sugestões: afinal, dirão eles, se as redes sociais forem administradas pelos governos e forem manipuladas a favor da democracia, então a sociedade aberta poderia até mesmo sair reforçada. ", "Ou, em outras palavras, se nós somos bons e morais, não há o que temer em utilizar nosso poder para impor o bem perante o mal.", "\n\nPor razões elementares, esta tese é totalmente problemática.", "\n\nPrimeiro, comecemos pelo mais básico de tudo: o que ocorrerá se, após tomarem o controle das redes sociais, os governos democráticos se tornarem autoritários? ", "Neste caso, a principal proposta de Soros para combater o mal irá se converter em sua principal força-motriz: querendo vetar a influência de governos autoritários sobre as redes sociais, Soros estará lhes entregando o poder em uma bandeja de prata.", "\n\nMas qual a probabilidade de um governo democrático se tornar autoritário ou quase-autoritário? ", "Enorme. ", "De um lado, há o explícito exemplo da Venezuela (e, em menor grau, de Equador e Bolívia). ", "De outro, da perspectiva do próprio Soros, governos como o de Trump e o de Viktor Orbán (Hungria) seriam quase-autoritários. ", "E há também o exemplo da França, que quase foi para Marine Le Pen, de quem Soros é inimigo declarado.", "\n\nSendo assim, a pergunta inevitável é: por acaso Soros ficaria entusiasmado se Trump, Orbán ou Le Pen passassem a controlar o Facebook e o Google? ", "É certo que não. ", "No entanto, é exatamente isso o que ele está propondo ao defender que o estado controle as redes sociais.", "\n\nA segunda razão por que esta tese é insensata: como determinar quais ideologias o governo deve tolerar em seu controle das redes sociais? ", "Se o estado irá utilizar as plataformas das redes sociais para impor 'valores corretos' aos cidadãos, será o próprio governo quem irá estabelecer a fronteira entre os valores corretos e os incorretos.", "\n\nÉ certo que Soros — progressista inflexível — tem sua opinião sobre quais são esses valores corretos. ", "Com efeito, é até mesmo provável que ele tenha sua opinião sobre o quanto as pessoas podem se desviar desses valores corretos sem que a sociedade aberta se desmorone. ", "Porém, banir de todas as redes sociais aqueles valores que o governo considere disfuncionais equivale a instaurar uma censura digital.", "\n\nAlém dos vários e óbvios perigos derivados de se outorgar ao governo o poder de censurar aquelas idéias que lhe são incômodas, resta a pergunta: como possibilitar um pensamento verdadeiramente crítico quando certos valores (no caso, os progressistas) são decretados como intocáveis ou inquestionáveis?", "\n\nSe Soros estivesse, junto a Obama, no controle das redes sociais nos EUA, teria ele dado algum tipo de cobertura midiática a Trump ou teria distorcido as redes em favor de Hillary Clinton (de quem ele é amigo fiel)? ", "E por que deveríamos supor que todas as idéias e propostas de Hillary eram preferíveis às de Trump?", "\n\nNão há espaço para preferir honestamente alguém como Trump em relação a alguém como Hillary? ", "Em que medida um governo democrático com poder de vetar várias opções políticas não irá se converter em um governo autoritário?", "\n\nEm definitivo, na mais benevolente das hipóteses, George Soros erra ao, de maneira bem intencionada, querer propor um maior controle governamental sobre as redes sociais. ", "Já na pior das hipóteses — que é a mais provável —, ele quer alimentar um alarmismo anti-redes sociais com o intuito de legitimar que os governos as controlem e as utilizem para aprofundar sua agenda progressista.", "\n\nA real intenção\n\nÉ fato que as redes sociais, ao se transformarem em meios de comunicação em massa e para as massas, se transformaram também em potenciais meios de manipulação das massas. ", "No entanto, no que isso difere da grande mídia?", "\n\nAs redes sociais são hoje o que já foram os grandes jornais, o rádio e a televisão. ", "No entanto, diferentemente do que ocorreu a essas outras tecnologias, o custo para o usuário de uma rede social é extremamente baixo: ele pode mudar de meio de comunicação, recorrer simultaneamente a vários meios de comunicação, ou até mesmo se tornar ele próprio um meio de comunicação — e tudo isso a um custo quase nulo.", "\n\nE a verdade é que, mesmo sendo suscetíveis a manipulações, as redes sociais atualmente proporcionam ao cidadão comum muito mais armas para contra-atacar o risco de manipulação das notícias do que jamais proporcionaram a imprensa escrita, o rádio e as televisões.", "\n\nSendo assim, então de onde vem este atual pânico em relação às redes sociais? ", "Dado que o eleitor sempre esteve à mercê da manipulação dos grandes meios de comunicação, e dado que a internet proporciona ao cidadão comum muito mais armas para contra-atacar essa manipulação do que jamais proporcionaram os outros meios de comunicação, então por que tantas vozes influentes estão gritando contra as redes sociais, e exatamente com a desculpa de ajudar ao cidadão comum?", "\n\nÉ fácil: porque os meios de comunicação tradicionais eram muito mais facilmente controláveis e manipuláveis pelos governos. ", "E é esse arranjo que Soros quer recriar.", "\n\nNinguém em sã consciência pode dizer que a mídia tradicional sempre foi de uma imparcialidade e ponderação inflexíveis, e que jamais espalhou notícias falsas (as 'fake news'). ", "Ao contrário: a mídia tradicional sempre foi claramente percebida pela população como um meio alinhado aos interesses dos governantes da vez.", "\n\nLogo, o estridente ataque de Soros às redes sociais busca reverter exatamente isso: ele quer recolocar as descentralizadas redes sociais sob as ordens do estado para, assim, restabelecer seu controle político sobre os meios de comunicação — e, com isso, tornar dominante o status quo progressista e social-democrata que ele sempre financiou.", "\n\n[1] O termo 'monopólio' está entre aspas porque não há monopólio nenhum neste setor. ", "Não há nenhuma regulação estatal proibindo o surgimento de redes sociais concorrentes. ", "A proibição estatal à concorrência é a definição precípua de monopólio." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.012195121951219513, 0.007067137809187279, 0.01845018450184502, 0.006944444444444444, 0.022364217252396165, 0.022332506203473945, 0.015384615384615385, 0.0106951871657754, 0.05454545454545454, 0.016666666666666666, 0.005235602094240838, 0.006097560975609756, 0.009009009009009009, 0.002531645569620253, 0.014124293785310734, 0.014285714285714285, 0.006920415224913495, 0.022727272727272728, 0.012145748987854251, 0.01090909090909091, 0, 0, 0.037267080745341616, 0.016129032258064516, 0, 0, 0.022222222222222223, 0.024, 0.0297029702970297, 0.013513513513513514, 0, 0, 0, 0.005, 0.009615384615384616, 0.005988023952095809, 0, 0, 0.013761467889908258, 0.020202020202020204, 0.010526315789473684, 0.015748031496062992, 0.005780346820809248, 0.004694835680751174, 0.005263157894736842, 0, 0, 0, 0.015151515151515152, 0, 0.005154639175257732, 0.015873015873015872, 0.025, 0.011235955056179775, 0, 0.011661807580174927, 0, 0.011494252873563218, 0 ]

[ " IN THE COURT OF APPEALS OF TENNESSEE\n AT NASHVILLE\n Assigned On Briefs December 4, 2014\n\n DONNA RAY v. ANGELA PETRO\n\n Direct Appeal from the Circuit Court for Davidson County\n No. ", "2C-4996 Carol Soloman, Judge\n\n\n No. ", "M2013-02694-COA-R3-CV - Filed January 9, 2015\n\n\nThis is a breach of contract case arising from a sub-lease between a salon owner and her\ntenant. ", "After Lessor terminated the Lease Contract, Lessee filed suit in general sessions court\nfor damages. ", "The general sessions court awarded Lessee $15,000 in damages. ", "Lessor\nappealed to circuit court, which granted competing motions for summary judgment in favor\nof both Lessor and Lessee. ", "Lessee appealed. ", "The judgment of the trial court is vacated and\nremanded, due to Tenn. R. Civ. ", "P. 56.04 deficiencies in the trial court’s order.", "\n\n Tenn. R. App. ", "P. 3 Appeal as of Right; Judgment of the Circuit Court Vacated and\n Remanded\n\nB RANDON O. G IBSON, J., delivered the opinion of the Court, in which J. S TEVEN S TAFFORD,\nP.J., W.S., and K ENNY A RMSTRONG, J., joined.", "\n\nElaine Heard, Nashville, Tennessee, for the appellant, Donna Ray.", "\n\nSean W. Lyons, Nashville, Tennessee, for the appellee, Angela Petro.", "\n\n OPINION\n\n Background\n\n Appellant Angela Petro1 (“Petro” or “Lessor”) is the owner and operator of Vanity\nSalon and Spa. ", "Appellee Donna Ray (“Ray” or “Lessee”) is an independent cosmetologist\nwho was primarily engaged in the business of providing manicures and pedicures to\ncustomers. ", "On or about July 22, 2011, Petro and Ray executed a “Lease Contract,” wherein\nPetro leased a room of approximately fifty (50) square feet in Vanity Salon and Spa to Ray.", "\n\n 1\n Angela Petro is also referred to as “Angel” Petro periodically in the record.", "\n\fAmong other things, the Lease Contract provided:\n\n 1. ", " The Lessor leases to the Lessee commencing the 22ndnday [sic] of July\n 2011, and ending on the 23rd day of July 2012, a room of approximately\n 50 square feet including a pedicure chair, stool and, [sic] sink, with\n vanity manicure table and two chairs within the room area.", "\n\n 2. ", " Lessee agrees to pay Lessor rent in the sum of One Hundred Fifty\n Dollars ($150) per week for room rental only. ", "Additional product\n usage to be paid to the Lessor by the Lessee cost plus 10%. ", "Rental\n payments are due and payable by noon on the Friday preceding the\n workweek. ", "Applicable product usage payments, if any, are due at this\n time for the previous week. ", "Rent payments not received by noon on\n Friday shall be charged a 10% late penalty to be included at the\n time the late rent is received.", "\n\n ....\n\n 11. ", " Should Lessee fail to make any payment of rent or any other\n payment required to be made to Lessee hereunder, or should\n Lessee attempt to assign the agreement or sublease the room\n without having obtained Lessor’s written consent, or should any\n other provision of this lease not be met, Lessor may, at his [sic]\n option, with or without notice or demand, terminate this\n agreement. ", "In this event, Lessee shall immediately surrender\n possession of the room to Lessor. . . .", "\n\n 12. ", " Either party may terminate agreement for any reason by providing\n to the other party thirty (30) days written notice of such intent.", "\n Lessee shall be liable to pay rent as it accrues during this period, as\n well as pay any sums due Lessor under the terms of the Agreement,\n and shall return all keys to the premises to Lessor at the expiration\n of that period.", "\n\n(Emphasis in original.)", "\n\n One of Ray’s rental payments was due on January 13, 2012. ", "Ray paid $150 in rent\nvia a check dated January 16, 2012. ", "Another rental payment was due on January 20, 2012.", "\nRay paid $150 in rent via a check dated January 21, 2012. ", "At some point on January 21,\n2012, Petro had some conversation with Ray about changing the amount of her rent.", "\n\n -2-\n\fAlthough the record on appeal is unclear about the timing of events on January 21, 2012,\nPetro also prepared two letters to Ray with the date of January 21, 2012. ", "One letter notified\nRay that “10% late fees have been assessed for January 13 and January 20, 2012.” ", "Another\nletter from Petro to Ray stated “[p]lease accept this letter as formal notification that I am\nterminating our Lease Agreement. ", "Our lease shall expire 30 days from today on February\n20, 2012.”", "\n\n Apparently Petro also sent text messages to Ray on January 21, 2012, stating\n“according to paragraph 11 of our contract . . . ", "you are in default for not making timely\npayments and also owe me late fees. [] ", "These things null paragraph 12 and give me legal\nrights to terminate our agreement immediately. [] ", "I want you out of my business today. . .”", "\nOn January 25, 2012, Petro sent another text message to Ray stating “I’m at my attorneys\n[sic] office and am fully prepared to move forward with the courts but want to give you one\nlast chance to get your things and go with no further financial obligation due to me.” ", "Ray\nresponded via text message with “I have paid through Friday,” to which Petro responded,\n“No. [] ", "I want you out. [] ", "You are in default and I am terminating our agreement right now.", "\n[] Go read paragraph 11. [] ", "You are in arrears $30 for late fees and have not made timely\npayments. ", "Get out[.]” ", "Ray responded with another text message, stating “If you have\nretained an attorney I would prefer he or she can [sic] contact me. ", "I don’t feel I owe you a\nlate fee however you still owe me 48.00 [sic] which would offset anything you feel I owe you\nin my opinion.”", "\n\n On or about August 29, 2012, Ray filed suit in the Davidson County General Sessions\ncourt against Petro for “money damages over $10,000 due to Donna Ray.” ", "On November\n20, 2012, the general sessions judge issued a letter ruling, stating:\n\n The Court finds that the language in paragraph 11 of the Lease Contract\n between the parties to be overly broad and overly burdensome. ", "To uphold\n such a clause would be unconscionable in the eyes of the Court. ", "Given that the\n Lessor held exclusive discretion as to whether to enforce paragraph 2 or\n paragraph 11 in case of a default and the Lessee could possibly never have\n opportunity to cure a default, the evidence showed that the language is\n unilaterally oppressive and frustrates the purpose of the Lease Agreement.", "\n This Court, therefore, is exercising its discretion to strike paragraph 11 from\n the Lease agreement and finds that the Defendant, Angela Petro, breached the\n Lease agreement and rules in favor of the Plaintiff Donna Ray. ", "The judgment\n for the Plaintiff is Fifteen Thousand Dollars. (", "$15,000)\n\nOn or about November 21, 2012, the general sessions court entered judgment for Ray in the\n\n\n\n -3-\n\famount of $15,000.2 Petro timely appealed to the Davidson County Circuit Court.", "\n\n On March 28, 2013, Ray filed a motion for summary judgment in the circuit court.", "\nIn that motion, Ray set forth certain facts regarding the Lease Contract. ", "She attached the\nLease Contract, copies of text messages between the parties, and Petro’s discovery responses\nas exhibits to her motion. ", "Ray did not file a statement of undisputed facts or any affidavits\nproviding testimony or authenticating the exhibits upon which she relied. ", "In her motion, Ray\nargued that, by accepting the late rental payments, Petro “forfeited her right to later assert a\nbreach of the lease based on the non-payment or late payment of the rent,” citing Woods v.\nForest Hill Cemetery, 192 S.W.2d 987 (Tenn. 1946).", "\n\n On July 18, 2013, Petro filed a competing motion for summary judgment, an affidavit,\na memorandum of law, and a statement of undisputed facts. ", "Petro asserted that Ray “directly\nviolated the contract by failing to pay rent in a timely manner on two separate occasions,\nfailing to pay the required late fees for each of those late rent payments[,] and altering\n[Petro’s] salon without permission.", "”3 Petro claimed she “properly exercised her right to\nterminate the agreement for these violations.” ", "The record on appeal is devoid of any\nresponse filed by Ray to Petro’s motion for summary judgment.", "\n\n On October 4, 2013, Petro filed a response to Ray’s motion for summary judgment.4\nPetro asserted that Ray’s motion for summary judgment failed to comply with Tenn. R. Civ.", "\nP. 56.03, in that it failed to be accompanied by a separate concise statement of material facts\nand also failed to be supported by specific citations to the record. ", "Petro also claimed that\nRay’s motion for summary judgment should fail as a matter of law because Petro was within\nher rights to terminate the lease agreement. ", "While Petro did not dispute that she deposited\nthe late rental payments, she argued that the lease also required that any late rental payment\nbe accompanied by a 10% late fee, due at the time the rent was eventually paid. ", "Petro\nasserted that the required late fee was never paid and that Ray “also altered Defendant’s salon\n\n\n 2\n The record on appeal contains no indication how the general sessions court arrived at this damages\naward.", "\n 3\n Petro claimed that, on January 21, 2012, Ray installed a deadbolt lock on the door to Ray’s leased\nroom.", "\n 4\n Petro’s response to Ray’s motion for summary judgment also contains her “Response to Plaintiff’s\nUndisputed Statement of Facts.” ", "Additionally, Petro asserted six additional material facts. ", "An Affidavit of\nAngel Petro was also filed in response to Ray’s motion for summary judgment. ", "This affidavit is identical\nto the July 17, 2013 affidavit Petro filed in support of her own motion for summary judgment, except that\nit is dated October 3, 2013, and contains an additional paragraph that states, “[a]t no time did I inform Ms.\nRay that her rent would be unilaterally increased.”", "\n\n -4-\n\fwithout permission - an act that put [Petro] at risk of breaching her lease with her landlord.”", "\n\n On October 11, 2013, the circuit court heard the cross motions for summary judgment.", "\nOn November 6, 2013, the court entered an order titled “Order Granting Defendant’s and\nPlaintiff’s Motions for Summary Judgment.” ", "The order states:\n\n This cause came to be heard on October 11, 2013, upon cross motions\n for summary judgment by both the Plaintiff and the Defendant under Tenn. R.\n Civ. ", "P. 56. ", "Based upon the statements of counsel and the entire record in this\n cause, the Court finds that both motions should be granted. ", "It is therefore:\n\n ORDERED, ADJUDGED AND DECREED,\n\n 1. ", " That any and all of plaintiff’s claims against defendant are\n hereby dismissed.", "\n 2. ", " That the parties are each responsible for their own costs.", "\n 3. ", " That the parties shall evenly split any unpaid costs between them.", "\n 4. ", " That the appeal bond paid by defendant be refunded with\n payment made to her attorney, Sean W. Lyons. . . .", "\n\n On October 23, 2013, prior to the entry of the court’s order described above but after\nthe October 11 hearing, Ray filed a “Request for a Finding of Material Facts and a Hearing\non Damages.” ", "In that request, Ray asserted that the circuit court “granted Plaintiff Donna\nRay’s Motion on substantive issues” and “also granted Defendant Angel Petro’s Motion on\nprocedural grounds.” ", "Ray requested that the court make “[a] [f]inding of [m]aterial [f]acts,”\nand she also asserted that she was entitled to a hearing on damages. ", "On November 21, 2013,\nthe circuit court entered an order denying Ray’s request for a finding of material facts. ", "The\norder stated: “1. ", "That this action has already been dismissed by order of this Court and is\nnow closed. ", "2. ", "That Plaintiff is not entitled to a finding of material facts. ", "3. ", "That Plaintiff\nis not entitled to a damages hearing in this matter.”", "\n\n Issues\n\n Ray timely appealed. ", "She raises the following issues for our review, which we have\nslightly restated:\n\n 1. ", " Whether the trial court erred when it granted Petro’s motion for\n summary judgment and dismissed Ray’s claim.", "\n\n 2. ", " Whether the trial court erred when it failed to provide the legal grounds\n\n -5-\n\f upon which it granted Petro’s motion for summary judgment and\n dismissed Ray’s claim.", "\n\n Discussion\n\n A trial court’s decision to grant a motion for summary judgment presents a question\nof law. ", "Our review is therefore de novo with no presumption of correctness afforded to the\ntrial court’s determination. ", "Bain v. Wells, 936 S.W.2d 618, 622 (Tenn. 1997). ", "This Court\nmust make a fresh determination that the requirements of Tennessee Rule of Civil Procedure\n56 have been satisfied. ", "Abshure v. Methodist Healthcare-Memphis Hosps., ", "325 S.W.3d 98,\n103 (Tenn. 2010).", "\n\n We address Ray’s second issue first, as it is dispositive. ", "In 2007, Tennessee Rule of\nCivil Procedure 56.04 was amended to require trial courts to “state the legal grounds upon\nwhich the court denies or grants the [summary judgment] motion” and to include such\nstatement in the order reflecting the court’s ruling.5 In part, the change to Rule 56.04 was\nintended to enable reviewing courts to easily ascertain the legal basis for the trial court’s\ndecision. ", "Smith v. UHS of Lakeside, Inc., 439 S.W.3d 303, 313 (Tenn. 2014). ", "This Court\nhas stated that “[w]hen the legal grounds for the trial court’s decision are omitted, a\nreviewing court cannot analyze the decision’s validity, and appellate review becomes\nunnecessarily speculative.” ", "Winn v. Welch Farm, LLC, No. ", "M2009-01595-COA-R3-CV,\n2010 WL 2265451, at *5 (Tenn. Ct. ", "App. ", "June 4, 2010).", "\n\n The requirements of the current version of Rule 56.04 are “specific and without\nexception.” ", "Id. (citing Tenn. R. Civ. ", "P. 56.04). ", "Since its adoption, this Court has, on\noccasion, vacated summary judgment orders that failed to comply with Rule 56.04 and\nremanded them to the trial court for further consideration. ", "See, e.g., Ragland v. Morrison,\nNo. ", "W2013-00540-COA-R3-CV, 2013 WL 4805624, at *4-5 (Tenn. Ct. ", "App. ", "Sept. 10,\n2013); State v. Centurion Industria e Comercia de Cigarros, LTDA, No. ", "M2010-02602-\nCOA-R3-CV, 2011 WL 2923725, at *7 (Tenn. Ct. ", "App. ", "July 20, 2011); Winn, 2010 WL\n2265451, at *6; Eluhu v. HCA Health Servs. ", "of Tenn. Inc., No. ", "M2008-01152-COA-R3-CV,\n2009 WL 3460370, at *21 (Tenn. Ct. ", "App. ", "Oct. 27, 2009). ", "In other cases, however, this Court\nhas chosen to “soldier on without guidance from the trial court,” Church v. Perales, 39\nS.W.3d 149, 158 (Tenn. Ct. ", "App. ", "2000), where the basis for the trial court’s decision can be\nreadily gleaned from the record. ", "See, e.g., Burse v. Hicks, No. ", "W2007-02848-COA-R3-CV,\n\n\n 5\n “Previously Rule 56.04 required a trial judge ‘upon request’ to state the legal grounds for granting\nsummary judgment. ", "The amendment extends that principle to a denial of summary judgment. ", "The\namendment also deletes the words ‘upon request.’” ", "Tenn. R. Civ. ", "P. 56.04 Adv. ", "Comm’n Cmt. ", "to 2007\namend.", "\n\n -6-\n\f2008 WL 4414718, at *2 (Tenn. Ct. ", "App. ", "Sept. 30, 2008) (proceeding with review “for the\nsake of judicial economy” after determining that “[t]he record presents a clear legal issue”);\nWhite v. Pulaski Elec. ", "Sys., ", "No. ", "M2007-01835-COA-R3-CV, 2008 WL 3850525, at *3\n(Tenn. Ct. ", "App. ", "Aug. 18, 2008) (proceeding with review after determining that the legal\ngrounds for summary judgment were “readily found” in the record); Burgess v. Kone, Inc.,\nNo. ", "M2007-02529-COA-R3-CV, 2008 WL 2796409, at *2 (Tenn. Ct. ", "App. ", "July 18, 2008)\n(proceeding with review after determining that the legal grounds for the trial court’s decision\nwere “readily ascertained” because the record included a CD-Rom of the hearing, including\nthe court’s ruling from the bench).", "\n\n The Tennessee Supreme Court recently addressed the requirements of Rule 56.04 and\nthe appellate courts’ enforcement of that rule in Smith v. UHS of Lakeside, Inc., 439 S.W.3d\n303, 313-14 (Tenn. 2014). ", "In Smith, the supreme court began its analysis of Rule 56.04 by\nemphasizing the crucial role the judicial system plays in society and remarking that\n“[p]roviding reasons for a decision reinforces the legitimacy of the legal process which, in\nturn, promotes respect for the judicial system.” ", "Id. at 313. ", "The Tennessee Supreme Court\nexplained that Rule 56.04’s mandate that the trial court state its grounds for a decision not\nonly assists appellate courts in their review but that the required explanation “of the basis for\njudicial decisions promote[s] respect for and acceptance of not only the particular decision\nbut also for the legal system.” ", "Id. Emphasizing the latter of those two objectives, the Court\nsuggested that appellate courts should take care not to be too lenient in their enforcement of\nRule 56.04’s requirements:\n\n Despite the amendments to Tenn. R. Civ. ", "P. 56.04 making the statement\n of grounds mandatory, the Court of Appeals has been reticent to vacate\n summary judgment orders that plainly do not comply with Tenn. R. Civ. ", "P.\n 56.04 and to remand them to the trial court for further consideration. ", "The court\n continues to conduct archeological digs and to review summary judgment\n orders when the basis for the trial court’s decision can be readily gleaned from\n the record and to remand the case only when their practiced eyes cannot\n discern the grounds for the trial court’s decision.", "\n\n We readily agree that judicial economy supports the Court of Appeals’\n approach to the enforcement of Tenn. R. Civ. ", "P. 56.04 in proper circumstances\n when the absence of stated grounds in the trial court’s order does not\n significantly hamper the review of the trial court’s decision. ", "However, in the\n future, the resolution of issues relating to a trial court’s compliance or lack of\n compliance with Tenn. R. Civ. ", "P. 56.04 should also take into consideration the\n fundamental importance of assuring that a trial court’s decision either to grant\n or deny a summary judgment is adequately explained and is the product of the\n\n -7-\n\f trial court’s independent judgment.", "\n\nId. at 314 (footnotes omitted).", "\n\n We now turn to the trial court’s order in this case. ", "The trial court’s November 6, 2013\norder specifically finds that both motions for summary judgment should be granted. ", "The\norder goes on to dismiss “[Ray’s] claims against [Petro].” ", "The order does not state the legal\ngrounds for the grant of summary judgment, and the trial court did not recite any evidence\nor argument it considered in making its decision. ", "This order does not comply with Rule\n56.04.", "\n\n\n While we acknowledge that this Court has, in the past, chosen to proceed with its\nreview when the legal grounds for the trial court’s decision were “readily gleaned” from the\nrecord, we do not believe such action is appropriate in this case. ", "The appellate record in this\ncase does not contain a transcript of the hearing on the motion for summary judgment or any\nother indication of the legal grounds for the trial court’s decision.6 In addition to causing us\nto wonder how the trial court could find “that both [summary judgment] motions should be\ngranted,” we are also unable to determine, based on the trial court’s order, exactly why Ray’s\nclaims against Petro were dismissed.", "\n\n We cannot determine from the record whether the trial court found Ray’s motion for\nsummary judgment insufficient under Tenn. R. Civ. ", "P. 56. ", "We are also unable to determine\nwhether the trial court found Petro’s factual assertions undisputed due to Ray’s failure to\nrespond pursuant to Tenn. R. Civ. ", "P. 56.03 or whether the trial court found that any disputed\nfacts were immaterial. ", "Further, Petro asserted three reasons why she was justified to cancel\nthe Lease Contract immediately: (1) Ray’s failure to timely pay rent on two occasions; (2)\nRay’s failure to pay a late fee when she paid her late rent, and; (3) Ray’s installation of a lock\non the door to her leased room. ", "The record does not indicate on which of these three\njustifications the court relied in dismissing plaintiff’s claim.", "\n\n Given the foregoing, “[w]e cannot proceed with a review, speculating on the legal\ntheories upon which the trial court may have ruled and the legal conclusions the trial court\nmay have made.” ", "Winn, 2010 WL 2265451, at *6. ", "Accordingly, we must vacate the order\nof the trial court granting the cross motions for summary judgment and remand this case for\nfurther proceedings consistent with this opinion. ", "The parties are free to re-assert their\n\n\n 6\n The record on appeal does contain a Statement of the Evidence provided by Appellant Ray.", "\nHowever, the Statement of Evidence Ray filed is only a procedural and brief factual history of this case,\nrather than a summary of the trial court’s oral ruling, if any.", "\n\n -8-\n\frespective motions for summary judgment on remand.", "\n\n Conclusion\n\n Given the foregoing, the judgment of the Davidson County Circuit Court is vacated,\nand this case is remanded for further proceedings consistent with this opinion. ", "Costs are\ntaxed one-half against the Appellee, Angela Petro and one-half against the Appellant, Donna\nRay, and her surety, for which execution may issue if necessary.", "\n\n\n\n\n _________________________________\n BRANDON O. GIBSON, JUDGE\n\n\n\n\n -9-\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.006006006006006006, 0.016666666666666666, 0.006896551724137931, 0.019801980198019802, 0.016129032258064516, 0.008130081300813009, 0.058823529411764705, 0.01282051282051282, 0, 0.058823529411764705, 0.02390438247011952, 0.014925373134328358, 0.02857142857142857, 0.008928571428571428, 0.006097560975609756, 0.01775147928994083, 0.010101010101010102, 0.01639344262295082, 0.003194888178913738, 0, 0, 0, 0, 0, 0, 0, 0.006535947712418301, 0, 0, 0, 0, 0, 0.014925373134328358, 0.017241379310344827, 0, 0.01694915254237288, 0.00909090909090909, 0.004694835680751174, 0.009900990099009901, 0.007407407407407408, 0, 0.007352941176470588, 0, 0, 0, 0.0037174721189591076, 0, 0, 0, 0, 0, 0, 0.007692307692307693, 0, 0.012195121951219513, 0.0041841004184100415, 0.012345679012345678, 0.002967359050445104, 0.004132231404958678, 0.014705882352941176, 0.008620689655172414, 0.011111111111111112, 0.02666666666666667, 0, 0.0070921985815602835, 0.007782101167315175, 0, 0.00398406374501992, 0, 0.010101010101010102, 0.022099447513812154, 0, 0.006289308176100629, 0, 0.008583690987124463, 0.015503875968992248, 0.006622516556291391, 0, 0.021505376344086023, 0.003389830508474576, 0, 0, 0, 0, 0, 0.007462686567164179, 0, 0, 0, 0, 0, 0, 0, 0.008064516129032258, 0.004975124378109453, 0.016042780748663103, 0.007042253521126761, 0.008928571428571428, 0, 0.011627906976744186, 0, 0, 0, 0.014705882352941176, 0.012048192771084338, 0, 0.007936507936507936, 0, 0.0040650406504065045, 0, 0, 0.02040816326530612, 0.015873015873015872, 0.020833333333333332, 0, 0.014705882352941176, 0.007518796992481203, 0.015151515151515152, 0.0047169811320754715, 0.06896551724137931, 0.03508771929824561, 0, 0, 0.009900990099009901, 0.038461538461538464, 0, 0.01092896174863388, 0.027777777777777776, 0.03389830508474576, 0, 0.0375, 0.034482758620689655, 0, 0.0136986301369863, 0.05263157894736842, 0.017241379310344827, 0, 0, 0.013245033112582781, 0, 0, 0.03225806451612903, 0.006211180124223602, 0, 0, 0.07142857142857142, 0.07142857142857142, 0.08333333333333333, 0, 0.010869565217391304, 0, 0.011976047904191617, 0, 0, 0.017543859649122806, 0, 0.006060606060606061, 0.017543859649122806, 0, 0, 0.014218009478672985, 0.010309278350515464, 0, 0.002898550724637681, 0.008368200836820083, 0.010810810810810811, 0, 0, 0.014388489208633094, 0, 0.006993006993006993, 0, 0, 0, 0, 0, 0, 0, 0.003968253968253968, 0.00228310502283105, 0.013986013986013986, 0, 0.012658227848101266, 0, 0, 0, 0, 0, 0, 0.006711409395973154, 0.0058823529411764705, 0, 0.004484304932735426, 0.018072289156626505, 0.004608294930875576 ]

[ "- 27. ", "What is g*q(b) + 27*u(b)?", "\n-3*b\nLet p(k) = 4*k**2 + 5*k. ", "Let t be ((-12)/(-15))/((-4)/10). ", "Let z be (104/(-16))/(t/(-4)). ", "Let c(i) = -i + 12*i + 4*i**2 + 5*i**2. ", "Determine z*p(v) + 6*c(v).", "\n2*v**2 + v\nLet v(j) = 15*j**2 + 20*j - 11. ", "Let k(g) = 8*g**2 + 10*g - 6. ", "Give 11*k(t) - 6*v(t).", "\n-2*t**2 - 10*t\nLet x(o) = o + 2. ", "Let k(m) = 2*m + 5. ", "Let a(r) = -r**2 - 8*r + 5. ", "Let d be a(-10). ", "Determine d*x(q) + 6*k(q).", "\n-3*q\nLet k(y) be the third derivative of 5*y**4/24 - 7*y**3/6 - 46*y**2 + 2*y. ", "Let v(b) = -3*b + 4. ", "Give 6*k(i) + 11*v(i).", "\n-3*i + 2\nLet l(k) = k + 2. ", "Let b(u) be the second derivative of -u**3/3 - 5*u**2/2 + 5*u. ", "Give 2*b(j) + 5*l(j).", "\nj\nLet y(j) = 5*j - 3. ", "Let d(s) = -6*s + 3. ", "What is -2*d(r) - 3*y(r)?", "\n-3*r + 3\nLet k(w) = -w**2 - 4*w - 9. ", "Let s(l) = -l**2 - 2*l - 4. ", "Give -4*k(b) + 9*s(b).", "\n-5*b**2 - 2*b\nLet m(u) = 2*u**2 + u. Let k(j) = 3*j**2 + j. Let h be 10/25 + (-44)/10. ", "Let i(w) = 2*w + 1. ", "Let r be i(1). ", "What is h*m(p) + r*k(p)?", "\np**2 - p\nLet u(c) = -c + 2. ", "Let y = 51 - 49. ", "Let z(t) = -3. ", "What is y*z(k) + 3*u(k)?", "\n-3*k\nLet o(m) = m**3 + 17*m**2 + 15*m - 15. ", "Let p be o(-16). ", "Let l(u) = -6*u**2 - 5*u - 3. ", "Let j(s) = -s**2 - s - 1. ", "Calculate p*l(f) - 4*j(f).", "\n-2*f**2 - f + 1\nLet w(h) = 24*h - 48. ", "Let g(s) = -s + 1. ", "Determine -48*g(n) - w(n).", "\n24*n\nLet g(d) = 9*d - 5. ", "Let b(p) = 2*p + 1. ", "Let s be b(3). ", "Let w(v) = 2 + v + v - s*v + v. Determine -2*g(m) - 5*w(m).", "\n2*m\nLet a(v) = 2*v - 11. ", "Let j(h) = 5*h - 33. ", "Calculate -17*a(z) + 6*j(z).", "\n-4*z - 11\nLet g(o) = o + 17. ", "Let p(u) = 9. ", "Calculate 2*g(h) - 5*p(h).", "\n2*h - 11\nLet o = -8 + 23. ", "Let y(t) = 1 - 26*t**2 + 2*t + 3*t**3 - 3 + 24*t**2. ", "Let n(m) = 21*m**3 - 15*m**2 + 15*m - 15. ", "Give o*y(f) - 2*n(f).", "\n3*f**3\nLet z(g) = -2*g**3 - 3*g**2 - 3*g - 3. ", "Let h(t) be the first derivative of -t - 1/2*t**2 - 1/4*t**4 - 1/3*t**3 + 2. ", "Let l = 4 + -3. ", "Give l*z(c) - 3*h(c).", "\nc**3\nLet c(a) = 5*a + 2. ", "Let i(b) = -51*b - 21. ", "Suppose 9*d = -286 + 97. ", "Calculate d*c(w) - 2*i(w).", "\n-3*w\nLet u(y) = -2*y**2 - 9*y + 3. ", "Let n(i) = i**2 - 1. ", "Give 4*n(g) + u(g).", "\n2*g**2 - 9*g - 1\nLet h(b) = b + 1. ", "Let g(d) = -4*d - 3. ", "Determine 2*g(m) + 6*h(m).", "\n-2*m\nLet l(p) = -4*p**2 - 8*p - 5. ", "Let u be l(-3). ", "Let z(j) = -8*j**2 + 0*j**3 - 6*j**3 - 11*j + 2*j**2. ", "Let c(d) = -2*d**3 - 2*d**2 - 4*d. ", "What is u*c(g) + 6*z(g)?", "\n-2*g**3 - 2*g**2 + 2*g\nLet h(a) = a**2 - a - 1. ", "Let r(n) = -3*n**2 - 2*n - 2. ", "Let l(k) = -3*k**2 - k - 1. ", "Let c(i) = -4*l(i) + 3*r(i). ", "Let y = -38 - -41. ", "Determine y*c(b) - 6*h(b).", "\n3*b**2\nLet r(u) = 2*u**2 - 2. ", "Let g be 6/(-4) - 25/(-10). ", "Let o(y) = -y**2. ", "Determine g*r(k) + 3*o(k).", "\n-k**2 - 2\nLet g(b) = -34*b + 4. ", "Let y(n) = 17*n - 2. ", "Determine 3*g(o) + 5*y(o).", "\n-17*o + 2\nLet l = 7 - -5. ", "Let w be -1*(1 + l)*-1. ", "Let p(i) = 15*i**2 - 13*i - 15. ", "Let j(h) = 7*h**2 - 6*h - 7. ", "Determine w*j(f) - 6*p(f).", "\nf**2 - 1\nLet m(x) = -6*x**2 + 4*x. ", "Let z(r) = 6*r**2 - 3*r. ", "Give -2*m(j) - 3*z(j).", "\n-6*j**2 + j\nLet b(j) = j. Let o(v) = 4*v + 1. ", "Suppose 4*y = m + m + 536, -133 = -y + m. Suppose 5*n = -y - 65. ", "Let a be (n/(-12))/((-2)/6). ", "Determine a*b(l) + 2*o(l).", "\n-2*l + 2\nLet c = 10 - 14. ", "Suppose -9 = -0*p - 3*p. ", "Let w(x) = 2*x**2 - x - 5. ", "Let o(d) = 5*d**2 - 6 + 0*d - 2*d - 3*d**2 + 0*d**2. ", "Give c*w(y) + p*o(y).", "\n-2*y**2 - 2*y + 2\nLet y be ((-3)/(-2))/(2/4). ", "Let j(r) = 2*r + 3. ", "Let i(d) = d**2 + 3*d + 4. ", "Give y*j(z) - 2*i(z).", "\n-2*z**2 + 1\nLet u(o) = o**3 - 6*o**2 - 4*o - 4. ", "Suppose -4*a - 26 = -10. ", "Let h(l) = -l**3 + 5*l**2 + 3*l + 3. ", "Let j = -8 - -5. ", "Determine a*h(n) + j*u(n).", "\nn**3 - 2*n**2\nLet m(v) = -9*v**2 - 2*v - 7. ", "Suppose 4*c - 6*c = -12. ", "Let g(f) = 5*f**2 + f + 4. ", "Calculate c*m(k) + 11*g(k).", "\nk**2 - k + 2\nLet i(r) = -1. ", "Let q(m) = 19*m - 114. ", "Calculate -114*i(u) + q(u).", "\n19*u\nLet i(a) = -42*a**3 - 12. ", "Let l(k) = 17*k**3 + 5. ", "Calculate -5*i(w) - 12*l(w).", "\n6*w**3\nLet n = 133 + -128. ", "Let u(a) = 10*a**3 + 5*a - 5. ", "Let y(r) = r**3 + r - 1. ", "Determine n*y(j) - u(j).", "\n-5*j**3\nLet t(f) = f**3 + 2*f**2 - 2*f + 1. ", "Let g be t(-3). ", "Let l(i) = -i. ", "Let s(v) = 4*v + 1. ", "Determine g*s(m) - 7*l(m).", "\n-m - 2\nLet p(h) = -3*h - 5. ", "Let f(v) = 4*v + 7. ", "Calculate 4*f(t) + 5*p(t).", "\nt + 3\nLet p(l) = l + 1. ", "Let i(n) = -5*n - 7. ", "Calculate 3*i(u) + 12*p(u).", "\n-3*u - 9\nLet l(h) = h**2 + 1. ", "Let y(w) = -4*w**2 - 2. ", "Let f(o) = 3*l(o) + y(o). ", "Let m(p) = -4. ", "Let a(v) = 1. ", "Let d(z) = -2*a(z) - m(z). ", "Determine d(b) - 2*f(b).", "\n2*b**2\nLet p(x) = x**2 + x - 1. ", "Let w(h) = 7*h**2 - 3*h + 3. ", "What is 6*p(d) + 2*w(d)?", "\n20*d**2\nLet h(u) = 2. ", "Let l(n) = -n - 1. ", "Determine 3*h(z) + 4*l(z).", "\n-4*z + 2\nLet z(x) = 7*x**2 - 9*x - 4. ", "Let y(b) be the first derivative of -20*b**3/3 + 13*b**2 + 11*b + 7. ", "Calculate 6*y(u) + 17*z(u).", "\n-u**2 + 3*u - 2\nLet d(m) = 3*m**3 - 4*m + 13. ", "Let p(o) = o**3 - o. Give -d(i) + 4*p(i).", "\ni**3 - 13\nLet j(h) = -h**2 + 3*h. ", "Let q(x) = -4*x. ", "Determine 2*j(g) + 3*q(g).", "\n-2*g**2 - 6*g\nLet y(c) = -3*c**3 + 2 - 5*c**2 - 2*c + 2 + 1. ", "Let j(d) = -d**3 - 2*d**2 - d + 2. ", "Determine -5*j(b) + 2*y(b).", "\n-b**3 + b\nLet g(m) = -2*m**3 - 6*m**2 - 4. ", "Let a(h) = h**2 + 1. ", "Give 4*a(o) + g(o).", "\n-2*o**3 - 2*o**2\nLet a(q) = -q + 24. ", "Let u(v) = -v + 49. ", "What is 5*a(l) - 3*u(l)?", "\n-2*l - 27\nSuppose 0 = -0*u - 2*u + 4. ", "Let t(g) = -2*g + 0*g + u*g - 3*g. ", "Let m(b) = 6*b. ", "Determine 6*m(s) + 11*t(s).", "\n3*s\nLet m(f) = -4*f**2 + 5*f + 6. ", "Let d(a) = a**2 + a + 1. ", "Give 4*d(y) - m(y).", "\n8*y**2 - y - 2\nSuppose 4 = n + 10. ", "Suppose l - 16 = -5. ", "Let k(u) = 29 + 8*u - 69 + 34. ", "Let f(o) = 15*o - 11. ", "Give l*k(m) + n*f(m).", "\n-2*m\nLet i be (-1)/1 + 3 + -6. ", "Let l(t) be the second derivative of -t**3/2 - 3*t**2 + t. Let q(r) = 2*r + 5. ", "Calculate i*q(c) - 3*l(c).", "\nc - 2\nLet l(r) be the third derivative of -13*r**4/12 + r**3/2 - 3*r**2 - 7. ", "Let v(m) = 9*m - 1. ", "Determine -6*l(h) - 17*v(h).", "\n3*h - 1\nLet l(b) = -1. ", "Let z = -28 + 29. ", "Let t(g) = g - 1. ", "Determine z*t(w) - l(w).", "\nw\nLet o(g) = -3*g**2 - 2*g. ", "Let s(h) be the first derivative of -h**3/3 - 8. ", "What is -o(b) + s(b)?", "\n2*b**2 + 2*b\nLet h = 30 - 18. ", "Suppose 0*j + h = -3*j. ", "Let s = -40 + 29. ", "Let n(w) = 3*w**3 + 8*w + 3. ", "Let d(f) = -f**3 - 3*f - 1. ", "Give j*n(q) + s*d(q).", "\n-q**3 + q - 1\nLet h(i) = 2*i**2 - i - 1. ", "Let o(a) = 7*a**2 - 4*a - 5. ", "Give -9*h(w) + 2*o(w).", "\n-4*w**2 + w - 1\nLet o(t) = 2*t**2 - 4*t - 5. ", "Let v(l) = l**2 - 2*l - 2. ", "Suppose 2*r - 3 - 1 = 0. ", "Let h(b) = 3*b + 2 - r - 4*b. ", "Let k be h(-2). ", "Calculate k*o(w) - 5*v(w).", "\n-w**2 + 2*w\nLet z(c) = c + 1. ", "Let f(b) = 8*b - 1. ", "Let u(q) = -f(q) + 3*z(q). ", "Let o(s) = -3 + 1 + 1 + s. Determine -2*o(r) - u(r).", "\n3*r - 2\nLet d(s) = -6*s**3 + 2*s - 2. ", "Let y(x) = 25*x**3 - x**2 - 9*x + 7. ", "Let o(j) = -9*d(j) - 2*y(j). ", "Let b(k) = -6*k**3 - 3*k**2 - 6. ", "Give 5*b(g) + 7*o(g).", "\n-2*g**3 - g**2 - 2\nLet g(k) = -k**3 - k**2 + 1. ", "Let v(c) = c**3 - 6*c**2 + 10*c - 3. ", "Let h be v(4). ", "Let q(d) = -7*d**3 - 5*d**2 + 2*d + 7. ", "Determine h*g(j) - q(j).", "\n2*j**3 - 2*j - 2\nLet v(q) = -q + 16. ", "Let d(u) be the first derivative of -1/2*u**3 + 1/2*u**2 + 0*u - 2. ", "Let l(r) be the second derivative of d(r). ", "What is -11*l(m) - 2*v(m)?", "\n2*m + 1\nLet c(b) = -5*b**3 + 2*b**2. ", "Let m(g) = -g**2 + 44*g**2 + 3*g**2 - 110*g**3 - g**2. ", "Determine 45*c(i) - 2*m(i).", "\n-5*i**3\nLet d(m) = m**3 - 3*m**2 + 2*m. ", "Let x be (-20)/(-9) + -1 - 10/45. ", "Let c(s) = s**2. ", "Determine x*d(i) + 3*c(i).", "\ni**3 + 2*i\nLet y(z) = z**2 - 2*z + 2. ", "Let d(v) = -2*v**2 + 3*v - 3. ", "Suppose -33 = -11*b - 0. ", "Give b*y(o) + 2*d(o).", "\n-o**2\nLet j(g) = 3 + 0 + 3 - 2*g**2 - 11. ", "Let u(m) = -3*m**2 - 7. ", "Determine 7*j(b) - 5*u(b).", "\nb**2\nLet l(f) = -7*f**3 - 7*f**2 + 7*f - 5. ", "Let y = -13 + 7. ", "Let v(p) = -7 - 8*p**2 - 14*p**3 + 1 + 8*p + 6*p**3. ", "Give y*l(m) + 5*v(m).", "\n2*m**3 + 2*m**2 - 2*m\nLet z(t) = -197*t**2 + 2*t + 99*t**2 + 99*t**2. ", "Let g(p) = p**2 - p. Give -2*g(d) - z(d).", "\n-3*d**2\nLet k(p) = -6*p**2 - 7*p. ", "Let w(l) = -17*l**2 - 20*l. ", "What is 8*k(f) - 3*w(f)?", "\n3*f**2 + 4*f\nLet f(g) = g**2 - 5. ", "Let j = 195 + -191. ", "Let d(c) = -4. ", "Determine j*d(b) - 3*f(b).", "\n-3*b**2 - 1\nLet f(b) = 2*b**3 - 3*b**2 + 3*b + 3. ", "Let h(j) = j**2 - j - 1. ", "Let p = -5 + 8. ", "Suppose 3*r + 5*v = 3 - 0, -5*r - v + 5 = 0. ", "Calculate p*h(w) + r*f(w).", "\n2*w**3\nLet q(x) = -x - 2. ", "Let s be 1 + -1 + 0 - -2. ", "Let b(z) = 2*z - 2 - s*z - z. Suppose 2*i + 2*u - 12 = 0, -4*i - 2*u + 13 = -3. ", "Calculate i*b(v) - 3*q(v).", "\nv + 2\nLet r(a) = a**2 + 7*a + 8. ", "Let l be r(-5). ", "Let u(c) = -3*c + 2. ", "Let p(d) = -13*d + 9. ", "Determine l*p(y) + 9*u(y).", "\n-y\nLet i(t) = -4*t**3 + 5*t**2 - 1. ", "Let r(f) = -3*f**3 + " ]

{ "pile_set_name": "DM Mathematics" }

[ 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0.03333333333333333, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0.06666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.012987012987012988, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0, 0, 0.038461538461538464, 0, 0, 0, 0.038461538461538464, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0.02127659574468085, 0, 0.034482758620689655, 0, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0.04, 0, 0, 0.06896551724137931, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0.041666666666666664, 0.030303030303030304, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0.05, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0, 0, 0, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0.03571428571428571, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0, 0, 0.037037037037037035, 0, 0, 0, 0.038461538461538464, 0, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0.014084507042253521, 0, 0, 0, 0, 0, 0, 0, 0.038461538461538464, 0, 0.04, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.02702702702702703, 0 ]

[ "A Bayesian approach to hazard identification. ", "The case of electromagnetic fields and cancer.", "\nThis paper discusses certain issues related to uncertainty in hazard identification. ", "Research on the hypothesis that exposure to 50-60-Hz magnetic and electric fields (EMF) increases the risk of cancer has been ongoing for two decades. ", "Epidemiological studies provide a somewhat consistent pattern indicating an increased risk for childhood leukemia and adult chronic lymphatic leukemia and possibly also for other leukemias and brain cancer. ", "However, there is still no good candidate for a mechanism. ", "Epidemiological studies have throughout the two decades been interpreted with great caution, and final evaluations as to carcinogenicity have been deferred. ", "The reason for this carefulness may be the lack of knowledge about a plausible mechanism. ", "The purpose of this paper is to discuss the process of weighing epidemiological data, experimental data, and other background information into a synthesis such that the evaluation can be based on all data combined. ", "A Bayesian approach to this weighing is discussed along with some alternatives. ", "The Bayesian approach provides a structure for the pooling of evidence and points out where subjective judgments come into play." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0.006622516556291391, 0, 0, 0, 0, 0, 0, 0 ]

[ "Kaena\n\nIn Hawaiian, ka ‘ena means \"the heat.\"", "\n\nHawaiian place names\n Ka‘ena Point is the westernmost point of the Hawaiian Island of O‘ahu. ", "There is a state park at Ka‘ena Point. ", "There is a USAF Satellite Tracking Station above Ka‘ena Point.", "\n Ka‘ena is a point and land section on Hawai‘i Island,\n Ka‘ena is the name of the northwestern tip of the Island of Lāna‘i.", "\n\nOther uses\n Kaena is the name of the main character in the movie Kaena: The Prophecy distributed by Sony Pictures" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.022222222222222223, 0, 0.025, 0, 0, 0.017391304347826087 ]

[ "Murrumbidgee Regional High School\n\nMurrumbidgee Regional High School is a dual-campus government-funded co-educational comprehensive secondary day school located in Griffith, a city in the Riverina region of New South Wales, Australia. ", "\n\nEstablished in 2019 through the merger of Griffith High School and Wade High School, the former schools enrolled approximately 1,250 students in 2018, from Year 7 to Year 12, of whom eleven percent identified as Indigenous Australians and 26 percent were from a language background other than English. ", "The school is operated by the NSW Department of Education; the principal is Peter King.", "\n\nSee also \n\n List of government schools in New South Wales\n List of schools in the Riverina\n Education in Australia\n\nReferences\n\nExternal links \n \n NSW Schools website\n\nCategory:Educational institutions established in 2019\nCategory:Public high schools in New South Wales\nCategory:Griffith, New South Wales\nCategory:2019 establishments in Australia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00423728813559322, 0.006578947368421052, 0.022988505747126436, 0.005747126436781609 ]

[ "Terminator: Genisys Trailer Spoils a Plot Twist\n\nThe latest trailer for the Terminator reboot is leaving fans of the franchise surprised and frustrated in more ways than one. ", "That’s because the promotional video appears to reveal a major part of the movie’s story, something that no one saw coming.", "\n\nWhile the information is surprising in itself, you also have to wonder whether revealing it in a trailer was a wise move. ", "It’s not as if the trailer was lacking for new footage." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011428571428571429, 0, 0, 0 ]

[ "Closeup of my Holes While Peeing Laying on my Side-ph5ad90d90658bf reencode side p\n\nnewprivatewindows FOLLOW 1 3180 VIEWS SHARE SAVE FLAG CONTENT" ]

{ "pile_set_name": "OpenWebText2" }

[ 0 ]

[ "Moral high ground\n\nThe moral high ground, in ethical or political parlance, refers to the status of being respected for remaining moral, and adhering to and upholding a universally recognized standard of justice or goodness.", "\n\"Parties seeking the moral high ground simply refuse to act in ways which are not viewed as legitimate and morally defensible.\"", "\n\nPolitics\nHolding the moral high ground can be used to legitimize political movements, notably nonviolent resistance, especially in the face of violent opposition, and has been used by civil disobedience movements around the world to garner sympathy and support from society.", "\n\nSimilarly, 21st century states may refrain from declaring war in order to retain the moral high ground – though the cynic will observe that realpolitik still leads to wars being fought, only without declarations.", "\n\nBusiness\nEconomist and social critic Robert H. Frank challenged the idea that prosocial behavior was necessarily deleterious in business in his book What Price the Moral High Ground?", "\n\nHe argued that socially responsible firms often reap unexpected benefits even in highly competitive environments, because their commitment to principle makes them more attractive as partners to do business with.", "\n\nEveryday use\n\nIn everyday use a person may take the perspective of the 'moral high ground' in order to produce a critique of something, or merely to win an argument. ", "This perspective is sometimes associated to snobbery but may also be a legitimate way of taking up a stance.", "\n\nSocial sciences or philosophies are sometimes accused of taking the 'moral high ground' because they are often inherently interested in the project of human freedom and justice. ", "The traditional project of education itself may be seen as defending a type of moral high ground from popular culture, perhaps by using critical pedagogy: its proponents may themselves be accused (rightly or wrongly) of seeking a false and unjustified sense of superiority thereby.", "\n\nHistory\nRobert Lowell took the moral high ground, not once, but twice, with separate American presidents, in protesting US militarism.", "\n\nPeter Mandelson considered that Tony Blair was \"good at taking the high ground and throwing himself off it\".", "\n\nSee also\n Critical pedagogy\n Moral hierarchy\n Virtue signalling\n\nReferences \n\nHigh ground\nCategory:Political science" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0, 0, 0, 0.005434782608695652, 0, 0, 0, 0, 0, 0.007352941176470588, 0.01818181818181818, 0 ]

[ "“The witness then stated one of the unidentified suspects shot the victim in the chest with a chrome pistol, then proceeded to shoot him again in the neck after he was on the ground and took his bag,” the incident report said.", "\n\nBystanders told police the men who robbed and fatally shot Peters left in a maroon, 4-door truck driven by a third person.", "\n\nLast month, police released surveillance photos of three people of interest in the deadly shooting. ", "Both Ellis and Moore were among the people shown in the photos, Spencer said.", "\n\nMORE: 3 people of interest sought in alleged hate-motivated shooting death of Decatur man\n\nJoshua Cortez Ellis (left), Shaleeya Moore Credit: DeKalb County Police Department Credit: DeKalb County Police Department\n\nEllis was arrested June 6 by deputies in Clayton County after being wanted for armed robbery and aggravated assault charges, the sheriff’s office said in a news release. ", "He’s accused of robbing and pistol-whipping a man on May 5, and he remains in the Clayton County jail.", "\n\nInvestigators checked the box on the report indicating the crime was “hate motivated.” ", "Georgia is one of four states that does not have a hate crimes law, which allow for steeper penalties against certain bias-related crimes.", "\n\nPeters, who was from Pell City, Ala., worked at Regional Medical Group in Decatur as a case manager.", "\n\nMORE: Man killed in alleged DeKalb hate crime remembered as creative, kind\n\nAnyone with information on the identity of the unknown person of interest, his whereabouts or the location of Moore is asked to contact the DeKalb County Police Department at 770-724-7850.", "\n\nThis is the unidentified third person of interest in the shooting death of a Decatur man, which investigators said was a hate-motivated crime. ", "Credit: DeKalb Police Department Credit: DeKalb Police Department\n\nTipsters can remain anonymous by calling Crime Stoppers at 404-577-8477, texting information to 274637 or visiting the Crime Stoppers website.", "\n\nIn other news:" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.008064516129032258, 0, 0.03896103896103896, 0.0103359173126615, 0, 0, 0, 0.00980392156862745, 0.011278195488721804, 0, 0.023923444976076555, 0 ]

[ "Orange, Wisconsin\n\nOrange is a town in Juneau County, Wisconsin, United States. ", "The population was 549 at the 2000 census. ", "The unincorporated communities of Lone Rock and Orange Mill are located in the town.", "\n\nGeography\nAccording to the United States Census Bureau, the town has a total area of 35.1 square miles (91.0 km²), of which, 35.1 square miles (91.0 km²) of it is land and 0.03% is water.", "\n\nDemographics\nAs of the census of 2000, there were 549 people, 221 households, and 154 families residing in the town. ", "The population density was 15.6 people per square mile (6.0/km²). ", "There were 261 housing units at an average density of 7.4 per square mile (2.9/km²). ", "The racial makeup of the town was 99.27% White, 0.36% from other races, and 0.36% from two or more races. ", "Hispanic or Latino of any race were 0.91% of the population.", "\n\nThere were 221 households out of which 24.4% had children under the age of 18 living with them, 58.8% were married couples living together, 3.6% had a female householder with no husband present, and 29.9% were non-families. ", "23.1% of all households were made up of individuals and 12.2% had someone living alone who was 65 years of age or older. ", "The average household size was 2.48 and the average family size was 2.94.", "\n\nIn the town, the population was spread out with 23.9% under the age of 18, 6.2% from 18 to 24, 24.2% from 25 to 44, 28.2% from 45 to 64, and 17.5% who were 65 years of age or older. ", "The median age was 42 years. ", "For every 100 females, there were 103.3 males. ", "For every 100 females age 18 and over, there were 113.3 males.", "\n\nThe median income for a household in the town was $35,909, and the median income for a family was $38,438. ", "Males had a median income of $30,313 versus $20,000 for females. ", "The per capita income for the town was $17,788. ", "About 9.7% of families and 15.2% of the population were below the poverty line, including 29.9% of those under age 18 and 6.9% of those age 65 or over.", "\n\nReferences\n\nCategory:Towns in Juneau County, Wisconsin\nCategory:Towns in Wisconsin" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0125, 0, 0, 0.005291005291005291, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "/*\nCopyright (c) 2003-2012, CKSource - Frederico Knabben. ", "All rights reserved.", "\nFor licensing, see LICENSE.html or http://ckeditor.com/license\n*/\nCKEDITOR.plugins.setLang( 'codemirror', 'fo', {\n\ttoolbar: 'Kelda',\n\tsearchCode: 'Search Source',\n\tautoFormat: 'Format Selection',\n\tcommentSelectedRange: 'Comment Selection',\n\tuncommentSelectedRange: 'Uncomment Selection',\n\tautoCompleteToggle: 'Enable/Disable HTML Tag Autocomplete'\n});\n" ]

{ "pile_set_name": "Github" }

[ 0.03389830508474576, 0, 0.0113314447592068 ]

[ "Q:\n\nWhy is this call to LocalFree() causing an error?", "\n\nI am invoking GetNamedSecurityInfo() as follows:\nPSID pSID = NULL;\nPSECURITY_DESCRIPTOR pSD = NULL;\n\n// Retrieve the owner SID for the file\nif(GetNamedSecurityInfo(TEXT(\"myfile.txt\"),\n SE_FILE_OBJECT,\n OWNER_SECURITY_INFORMATION,\n &pSID,\n NULL, NULL, NULL,\n &pSD) !", "= ERROR_SUCCESS) {\n /* error handling */\n}\n\nFreeSid(pSID);\nLocalFree(pSD);\n\nHowever, when I run the application, it crashes. ", "The debugger reports: Critical error detected c0000374 and points to the LocalFree() line at the end of the snippet above.", "\nWhy is this line causing a problem? ", "According to the documentation for the ppSecurityDescriptor parameter:\n\n\"A pointer to a variable that receives a pointer to the security descriptor of the object. ", "When you have finished using the pointer, free the returned buffer by calling the LocalFree function.\"", "\n\n...which is exactly what I have done.", "\n\nA:\n\nThe SID referenced by your pSID local var is referring to data already held within the security descriptor referenced by pSD. ", "It \"owns\" that SID, and you own the descriptor reference. ", "You only need to free the latter.", "\nShort version: Remove the FreeSid(pSID) call.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.020942408376963352, 0.0078125, 0, 0, 0, 0, 0, 0.015151515151515152, 0.017241379310344827, 0, 0, 0 ]

[ "Well, I suppose I’d best write something about the Fred Whitton Challenge that happened this weekend, so here goes. ", "This could well be quite a long one (look, if I had to suffer for hours riding it, I’ll make sure that there’s at least 10 minutes of suffering reading it) so probably best go and get a cuppa. ", "Sol and I had spoken about this ride last year, and Sol had talked me into trying to get an entry. ", "It’s pretty much universally regarded as the toughest of UK sportives, with 4000m of ascent packed into 175kms of riding, and gradients up to 33%. ", "And if this wasn’t tough enough, the sting in the tail of the profile was the wicked spike of Hardknott Pass. ", "I’ve got a book somewhere that states bluntly “if you can ride this, you can ride anything”. ", "And that’s with fresh legs. ", "With 100 miles, and ~3500m of climbing already done, this is masochism on a grand scale. ", "Still, I posted off the entries, and muttered a small curse when they were accepted and we got a place. ", "No going back now. ", "Might as well make the most of it.", "\n\nSo, we travelled up to Ambleside on Saturday morning, threw our gear in the B&B that was to be our HQ for the weekend (big recommendation here for the Claremont Hotel in Ambleside, where we were looked after all weekend), and popped into Coniston to register, and be equipped with a ‘dibber’. ", "This device attaches around the wrist, and is used to record the times at various places on the ride by ‘dibbing’ it into a small device held by marshals at various places on the course. ", "It was immediately apparent during the registration that the organisation of the event was executed with military precision, and Northern common-sense and humour. ", "I loved it, and it boded well for the smooth running of the event tomorrow. ", "Whilst in Coniston we took the opportunity to load up with pasta at Harry’s Restaurant (I can highly recommend the arrabiata) before heading back to Ambleside for a quick wander around town, and an enormous portion of sausage and chips just to make sure that we wouldn’t go hungry. ", "An early night was in order, as we really needed to get away as close as possible to the 6am start the next day – the weather forecast for the morning was looking good, but the afternoon was not so good, with high winds building up, culminating with torrential rain from 5pm onwards or so. ", "As we were expecting a 12 hour or so ride, we wanted as much of it as possible to be in the good weather.", "\n\nThe alarm went off at 5am, and we were on the road by 5:30, and got to Coniston 20 mins later. ", "The start was, well, rather understated really. ", "We rolled up to the gate, dibbed our dibbers with the marshals, and pedalled off up the road into the bright early morning sunshine. ", "This part of the country is devastatingly beautiful at the worst of times, but in these conditions, with the sun low on the horizon, and early morning mist rising off the ground, it was almost too much for words. ", "Well, certainly nothing I could ever say would do it justice, so I’ll just leave the flowery prose there and let you imagine the scene. ", "The first climb was a nice gentle climb up Hawkshead Hill, which was just right to get the legs working, and start to enjoy the day.", "\n\nThe first major test of the day was the climb up Kirkstone pass. ", "While this climb was long, it wasn’t particularly steep, so it was nice just to get into a rhythm, and enjoy the scenery and the steady gaining of altitude. ", "This is the highest point on the route, and so a major psychological boost at the summit, realising that there was now more descent than ascent for the rest of the day. ", "Also notable was the small crowd at the summit, including a cheery lady with some magnificent cowbells who waved and clattered them enthusiastically. ", "The descent was breathtaking, and probably the fastest part of the route. ", "Long, fast, wide, open, clear roads. ", "A group of us flew down in close formation, with me thinking “I *am* Fabian Cancellara” as we scythed through the corners, using both sides of the road. ", "I may well have laughed out loud at the time.", "\n\nFrom there, a short climb over Matterdale End brought us onto the only part of the route that was a bit dull… the A66 into Keswick. ", "To be fair, we were only on it for a few kms, but it was busy, noisy, and into the wind all the way. ", "In short, pretty miserable. ", "Not helped by the tw@ who inserted himself into the 20cm gap between my front wheel and Sol’s rear wheel (yes, I’m a merciless wheelsucking leech who never takes a pull at the front…) and then casually hoiked up a loogie and gobbed it over his shoulder. ", "Right into my face. ", "We then turned into Borrowdale and my mood lifted instantly. ", "Borrowdale is extraordinarily scenic, and we were sheltered from the worst of the wind as we wended out way wearily Westward. ", "Ahead, lay the first major test of the day. ", "Honister Pass.", "\n\nI’ve seen Honister Pass described before now as the most beautiful of the Lake District passes. ", "And while I won’t disagree with this (it really is stunningly beautiful) I would bet that the author of that statement hasn’t attempted to cycle down it. ", "Getting up it was hard enough (indeed, I needed to stop and take a rest at one point) but getting down the other side was terrifying. ", "Exhiliarating, but as scary as anything I’ve ever done. ", "70km/h, on gravel-strewn, potholed roads with a badly corrugated surface concentrates the mind wonderfully.", "\n\nThe first food stop came at the bottom, and we took a leisurely time eating nanas, flapjack, sandwiches, and refilling our water bottles. ", "The wind was by now really picking up, to the point where it was getting tricky to just keep going in a straight line at times.", "\n\nThe climb up to Newlands Hause came next. ", "And it’s a brute. ", "The wind was really strong now, and as well as the steady 20% gradient, we were battling with winds gusting up to 40mph. ", "There was only one thing for it… I gritted my teeth, set my mind to the task ahead, and decided to enjoy the pain. ", "And, that’s exactly what happened. ", "Even the final vicious 25% hairpin at the top was despatched with a grin on my face, and a cheery “hello again!” ", "to the nice lady with the magnificent cow-bells who had been at the top of Kirkstone. ", "And the descent was brilliant – the road was open, smooth, and above all, fast. ", "I think this was the only descent all day where I didn’t even attempt to cover the brakes. ", "I just shifted quickly up to the longest gear, got down on the drops, shouted “Geronimo!” ", "and threw caution to the wind.", "\n\nThe climb up Whinlatter was lovely. ", "Not too steep, but with enough of a gradient to make it a challenge, it snakes it’s way up through a good covering of trees. ", "This was a welcome change from the exposed, blasted sections over Honister and Newlands that immediately preceeded it, even if it did mean I got rather hot. ", "It was worth at though. ", "At the summit, hundreds of people had gathered to clap, cheer, and offer encouragement to all the riders on the way though. ", "I’m not a particularly emotional chap (well, I just learned at a young age not to show any) but I was quite overwhelmed by this. ", "I lost count of how many times I said “thank you” and waved at the families who were cheering, waving cow-bells, and even offering drinks and snacks to the riders. ", "A couple of kilometres further on was the first dibbing point of the route, where we had to stop, and dib our wrist tags into the box held by the marshals to record a split time. ", "By now, the wind was so strong on the more exposed Western flank that the descent from Whinlatter was actually a bit of a trial, and quite hard work.", "\n\nFrom here, things turned a bit crap for me for a few kms. ", "The climb up Fangs Brow was just a grind, and even the flat bits were now hurting. ", "I was falling further and further behind Sol, who realised that something was up, and slowed the pace right down. ", "I’ve been in this place before, during the Macc Monster ride last year, and knew what I had to do. ", "We stopped for five minutes, and I crammed down a couple of protein and carb bars and had a good drink to go with them. ", "It worked. ", "Ten minutes later, I had a new spring in my step, and we were on the relentless onslaught up Cold Fell. ", "Although not the highest, or steepest part of the route, it was flippin’ windy up there, and a leg-sappingly long struggle to the top, where a vicious 25% gradient kicked up at the top into a final hairpin. ", "Once more, several brave souls were again there to cheer us all on. ", "The descent off of the Fell was brilliant. ", "Blasting through the village of Calder Bridge at 50km/h wth the police holding up the traffic was a moment I’ll remember for a long time.", "\n\nWe then stopped again at the food stop, and for the next dib of our dibbers. ", "We took our time over this stop, as we knew that coming up next was the nemesis of Hardknott. ", "The decision to build a road up Hardknott is best described as perverse. ", "This, however, pales into insignificance compared to the decision to hold a bike ride up it. ", "Depraved is the only word that can be used to describe that particular decision. ", "But, I’m always up for a bit of depravity. ", "However, even my depravity has limits, and after a couple of hundred metres I looked up, and realised that this was one challenge I just wasn’t up to. ", "I took the decision to walk a bit, until the gradient eased up to just 20%, where I got back on and gave it another go. ", "This all went well, but ahead of me was, arguably, the toughest bit of road in the country. ", "33% gradient though a series of switchbacks. ", "Again, I walked. ", "Along with about 90% of the others. ", "I know my place, and attempting to cycle up this particular stretch of road is not it. ", "Maybe next year. ", "The descent from Hardknott is something I’m desperately trying to forget. ", "All I will say on the matter is that it’s no place for the timid. ", "Sadly that’s one word that fits me very well.", "\n\nWrynose was next… It’s slighly (but only slightly) softer at the edges than Hardknott, but crucially, from this direction was considerably shorter. ", "I was determined to either get over it, or fall over trying. ", "Sol, who was ahead of me at this point, obviously didn’t know the plan, and pulled over and unclipped at the start of the toughest section. ", "I engaged my lowest gear, stood up, got my weight over the front, and hit the first hairpin. ", "It hurt. ", "My heartrate leapt instantly into the 170s. ", "I dug in, and pushed harder up the 30% gradient that immediately followed. ", "My legs started to buckle. ", "Push, push… Up to the last hairpin. ", "I remember there being people shouting encouragement, but I didn’t have the breath to thank them. ", "My vision started to go blurry at the edges, but at this point, I knew I’d done it. ", "The gradient backed off, and I pedalled up to the summit, and took shelter from the wind behind the Mountain Rescue vehicle and waited for Sol. ", "I later saw that my max heart-rate for the day was up in the 190s. ", "The descent was again, frankly, terrifying. ", "At least this time I had the excuse of a slow car holding up a bunch of us. ", "Sol, with his racers head on, had no such fear, and with a glorious bit of outbraking, swooped round the outside of the car into a downhill 30% hairpin where the run-off consisted of a yawning abyss, and ****ed off into the distance. ", "This, I consider to be more impressive than climbing up there in the first place.", "\n\nOnce over Wrynose, it was all over. ", "Maybe 10kms or so, with only one short, sharp climb up from the Elterwater road up onto the Coniston road. ", "The nice policeman there held up the traffic, and waved us through with a cheery “well ridden fellas. ", "You’ve done it now”. ", "And indeed, we had. ", "About 20 minutes later, we turned off the main road, and I doubt I’ll ever forget this moment. ", "For about 200 metres, both sides of the road were lined with cheering, clapping spectators, marshals, policemen etc. ", "Sol & I shook hands as we crossed the line, dibbed our dibbers for the last time, and climbed off the bikes, with weary legs and proud hearts. ", "9hrs 51 minutes. ", "Comfortably inside the 12 hours we had set ourselves. ", "We put the bikes in the car, had a bite to eat, and collected our certificates before heading off. ", "People were still arriving in their droves, and perfectly according to plan, it started to rain. ", "We couldn’t have timed it better.", "\n\nA day that will stick with me for ever. ", "Big thanks to Sol for putting up with my timid descending and waiting at the bottom of every hill for me, and waiting again during my unscheduled stop when I just ran out of energy. ", "And finally, the bike… while I witter on about how tough it all was, the bike just sucked it up, and cossetted me around, flattering my lack of fitness and ability. ", "Thanks Drew.", "\n\nShare this:\n\nLike this:\n\nOK, it’s my fault. ", "I mentioned Spring, and it’s rained every bloody day since. ", "I take full responsibility for this, and will find out who is to blame (c) Gordon Brown.", "\n\nLooking at things positively, erm, well, it’s not looking good. ", "On the climbing front, I’ve achieved remarkably little, mainly due to the bloody awful weather. ", "A nice morning spent at a climbing centre in Stockport with Foz was good fun, and I look forward to heading back there when I can. ", "As far as cycling goes, I broke my road bike (to be fair, Sram are looking into the failure as a warranty issue) and flattened my thumb with a lump hammer trying to get the seatpost out of my mountain bike. ", "And then fell off the bloody thing." ]

{ "pile_set_name": "Pile-CC" }

[ 0.008620689655172414, 0, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0, 0, 0.01694915254237288, 0, 0.006134969325153374, 0, 0.0035460992907801418, 0, 0, 0.010309278350515464, 0, 0, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0, 0.006535947712418301, 0, 0.014925373134328358, 0, 0, 0.003937007874015748, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007874015748031496, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0, 0, 0, 0, 0.006711409395973154, 0, 0.012048192771084338, 0.008771929824561403, 0, 0, 0, 0.009615384615384616, 0, 0, 0.023255813953488372, 0.0072992700729927005, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006666666666666667, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.013888888888888888, 0.014925373134328358, 0, 0, 0, 0, 0.02631578947368421, 0.018691588785046728, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011363636363636364, 0, 0, 0, 0.004830917874396135, 0 ]

[ "Expression of matrix metalloproteinase-26 (MMP-26) mRNA in mouse uterus during the estrous cycle and early pregnancy.", "\nMatrix metalloproteinases (MMPs) and their tissue inhibitors play important roles in the remodeling of extracellular matrix (ECM). ", "MMP-26, also called endometase or matrilysin-2, is a novel member of the MMP family. ", "The present study was to investigate the temporal and spatial expression of MMP-26 mRNA in mouse uterus during the estrous cycle and early pregnancy by using in situ hybridization and semi-quantitative RT-PCR. ", "In this study, MMP-26 mRNA was found to be localized to the luminal and glandular epithelium at proestrus and estrus, and the expression level was decreased significantly from metestrus to dioestrus. ", "During pre-implantation period, MMP-26 mRNA was predominantly expressed in luminal and glandular epithelium at much higher level; whereas it switched to stroma during peri-implantation period, and also appeared in the blastocysts and the implantation sites. ", "The results suggested that MMP-26 might play a role in the cycling changes of mouse uterus during the estrous cycle and embryo implantation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.007575757575757576, 0.011764705882352941, 0.004761904761904762, 0, 0, 0 ]

[ "#ifndef EXTNOTI_H\r\n#define EXTNOTI_H\r\n\r\n#define PLUGIN_NAME L\"ProcessHacker.", "ExtendedNotifications\"\r\n#define SETTING_NAME_ENABLE_GROWL (PLUGIN_NAME L\".", "EnableGrowl\")\r\n#define SETTING_NAME_LOG_FILENAME (PLUGIN_NAME L\".", "LogFileName\")\r\n#define SETTING_NAME_PROCESS_LIST (PLUGIN_NAME L\".", "ProcessList\")\r\n#define SETTING_NAME_SERVICE_LIST (PLUGIN_NAME L\".", "ServiceList\")\r\n\r\n// main\r\n\r\ntypedef enum _FILTER_TYPE\r\n{\r\n FilterInclude,\r\n FilterExclude\r\n} FILTER_TYPE;\r\n\r\ntypedef struct _FILTER_ENTRY\r\n{\r\n FILTER_TYPE Type;\r\n PPH_STRING Filter;\r\n} FILTER_ENTRY, *PFILTER_ENTRY;\r\n\r\n// filelog\r\n\r\nVOID FileLogInitialization(\r\n VOID\r\n );\r\n\r\n#endif\r\n" ]

{ "pile_set_name": "Github" }

[ 0.02631578947368421, 0.02702702702702703, 0.03076923076923077, 0, 0.015384615384615385, 0.016611295681063124 ]

[ "###### Strengths and limitations of this study\n\n- This study provides the first comprehensive review of disease-specific instruments measuring quality of life of family carers of people with neurodegenerative diseases.", "\n\n- The findings of the review offer guidance to researchers and clinicians in the selection of appropriate and psychometrically strong disease-specific instruments.", "\n\n- Only instruments specific to neurodegenerative diseases were examined.", "\n\n- We did not review the performance of generic measures of quality of life.", "\n\n- The instruments identified in this review were developed specifically for family carers rather than professional (ie, paid) carers of people with neurodegenerative diseases.", "\n\nIntroduction {#s1}\n============\n\nNeurodegenerative diseases have a profound impact as they lead to a prolonged and irreversible decline in global intellectual, social and physical functioning. ", "People living with neurodegenerative diseases tend to progressively lose their independence and require increased levels of care and support. ", "Dementia is the most common type of neurodegenerative disease, affecting 800 000 people in the UK alone,[@R1] and costing £26.3 billion to society each year.[@R2] Family members, friends and neighbours who act as carers are a vital determinant of positive outcomes for people with neurodegenerative diseases such as dementia. ", "They provide a wide range of practical and emotional support, social care, and assistance with activities of daily living.[@R3] These caregiving tasks include, for example, help with personal care, managing finances and legal affairs, social activities, mobility, and administering and coordinating medication.[@R3]\n\nCaring for a person with a neurodegenerative disease may result in multiple negative outcomes, including increased anxiety and depression, stress, exhaustion, social isolation, and concerns about the future.[@R1] Nevertheless, caring can also have positive effects such as greater closeness to the person with the condition, reciprocity and spiritual growth.[@R4] In recent years, there has been an increasing research focus on assessing quality of life (QOL) as an informative and important patient-reported outcome measure in the person with the disease and their carers. ", "Although QOL is subjective in regard to how it is perceived by the individual, there is growing consensus that it represents a multidimensional construct encompassing various domains such as physical health, socioeconomic status; psychological, emotional and social well-being, and that it is a useful way of capturing the broad impacts of complex disorders such as neurodegenerative disease.[@R7] In this paper, following the recommendations of our carer consultation, the term 'family carer' is used to refer to all 'informal' carers (ie, not paid carers), including family members, neighbours and friends of a person with a neurodegenerative disease. ", "This also includes people who are not, in fact, family members, since the term 'informal' was seen as minimising and trivialising the nature of the care provided, and the term 'carer' by itself was seen as too imprecise.", "\n\nGiven the important role of family carers, it is essential for the person with the illness as well as for the carer, that carers of people with neurodegenerative diseases maintain a good QOL. ", "Carer QOL is likely to be associated with patient QOL, and when carer QOL deteriorates, there is likely to be a higher risk that the person with dementia will need admission into a care home, so driving lower life quality and higher societal cost. ", "It is also important to measure the broad QOL carer impacts of interventions for the person with dementia and for carers. ", "To ensure this can be monitored effectively, it is necessary to measure carer QOL accurately using psychometrically robust measures. ", "To date, QOL of affected individuals and their carers has been predominantly assessed using generic health status instruments such as the SF-36[@R8] and the EQ-5D.[@R9] Disease-specific instruments have been used much less frequently. ", "This is problematic as generic instruments miss issues that are pertinent to specific conditions and, consequently, are less responsive to detecting changes in carer QOL over time.[@R10] [@R11] For example, an increased level of support received as a carer has been associated with better carer QOL in dementia,[@R4] but neither the EQ-5D nor the SF-36 capture such a construct.", "\n\nAn earlier review has examined the effects (eg, physical, social, emotional, financial) of caring for an elderly family member with dementia on carer QOL.[@R11] Disease-specific and generic instruments were identified that assess QOL of either patients with dementia or their carers. ", "However, the psychometric properties of these measures were not reported or discussed, and the review focused exclusively on dementia and Alzheimer\\'s disease. ", "Building on this, we therefore completed a systematic review to identify and examine the disease-specific instruments that measure QOL of family carers of people with a neurodegenerative disease. ", "Here, we examine the psychometric properties of these instruments.", "\n\nMethods {#s2}\n=======\n\nThe systematic review was conducted and reported in accordance with the recommendations from the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) statement.[@R12]\n\nInclusion criteria {#s2a}\n------------------\n\nInstruments were included in the review if they satisfied the following criteria: (1) the study described the development (inauguration paper) and/or the evaluation of the psychometric properties and relationships with other relevant constructs (validation paper) of a measure of carer QOL; (2) the study population were adult (aged 18 years or above) family (defined as family members, neighbours or friends) carers of people with a neurodegenerative disease (dementia, Alzheimer\\'s disease, Parkinson\\'s disease (PD), Huntington\\'s disease (HD), multiple sclerosis (MS) and motor neuron disease); (3) the instrument was designed to be disease-specific and not a generic measure of QOL; (4) studies only documented instruments that were self-report in their design. ", "Any studies that reported an eligible measure (eg, as an outcome in a clinical trial) without any explicit validation were excluded; and (5) studies were written in English.", "\n\nSearch strategy {#s2b}\n---------------\n\nArticles were identified from initial searches of five electronic databases: PubMed, PsycINFO, Scopus, Web of Science and the International Bibliography of the Social Sciences (IBSS). ", "The searches were conducted from inception until 8 February 2016. ", "All articles identified up until this time were screened regardless of their publication date. ", "We used the following five combined sets of search terms: (1) 'quality of life'; AND (2) caregiver\\* OR carer\\*; AND (3) informal OR unpaid OR spous\\* OR family; AND (4) dementia OR alzheimer\\* OR parkinson\\* OR huntington\\* OR multiple sclerosis OR motor neurone disease; AND (5) valid\\* OR reliab\\* OR development OR psychometric. ", "The search terms were intentionally broad and sensitive enough to ensure that all potentially relevant articles were identified (please see online [supplementary material file](#SM1){ref-type=\"supplementary-material\"} for full details of search strategy). ", "Six additional articles were obtained using lateral searching techniques.[@R13] These searches involved the manual checking of reference lists of included studies (snowballing), citation searches using the 'Cited by' option on Web of Science, Google Scholar, and Scopus, and the 'Related articles' option on PubMed and Web of Science (lateral searching). ", "The grey literature (ie, unpublished studies) was also searched using the following databases: OpenGrey and Patient-Reported Outcome and Quality of Life Instruments Database (PROQOLID). ", "We attempted to make direct contact (via email) with the authors of a manuscript when no published psychometric data were available for the instrument being reported. ", "Two independent reviewers (TEP and NF) screened article titles and abstracts against the predefined inclusion criteria. ", "Full-text articles were sought for all potentially relevant studies. ", "Any disagreements concerning inclusion were resolved through discussion and advice from a third reviewer (SD).", "\n\n10.1136/bmjopen-2016-013611.supp1\n\nData extraction {#s2c}\n---------------\n\nTwo reviewers (TEP and NF) extracted, independently, the following data for studies that met the inclusion criteria: name of the instrument, country, sample characteristics (gender, age), study design/setting, measurement domains, number of items, response format, evidence of reliability and validity.", "\n\nQuality assessment {#s2d}\n------------------\n\nThe methodological quality of the studies was assessed using the COnsensus based Standards for the selection of health Measurement Instruments (COSMIN) checklist.[@R14] This is a standardised tool which assesses the measurement properties of health-related instruments across nine domains (internal consistency, reliability, measurement error, content validity (including face validity), construct validity (subdivided into structural validity, hypotheses testing and cross-cultural validity), criterion validity and responsiveness) with each domain rated using 5--18 items. ", "Each item is rated as 'excellent', 'good', 'fair' or 'poor' quality. ", "A methodological quality score for each measurement property is obtained by taking the lowest rating of any item in that box (worst score counts). ", "Two independent reviewers (TEP and NF) assessed the methodological quality of the included studies using the checklist. ", "Any disagreements in scoring were resolved through discussion and advice from a third reviewer (SD).", "\n\nResults {#s3}\n=======\n\nSearch results {#s3a}\n--------------\n\nThe initial database searches identified 676 articles, of which 232 were deleted because of duplicates. ", "After title and abstract screening, we assessed seven articles as potentially relevant and obtained full texts. ", "From reviewing the full texts of these remaining articles, we found two studies that met inclusion criteria ([figure 1](#BMJOPEN2016013611F1){ref-type=\"fig\"}). ", "Six additional articles were identified using lateral search techniques.", "\n\n{#BMJOPEN2016013611F1}\n\nIn total, we included eight studies in the systematic review and these reported seven carer QOL instruments across the neurodegenerative diseases. ", "All of them were self-report measures and consisted of the HD quality-of-life battery for carers (HDQoL-C);[@R17] HD quality-of-life battery for carers-short form (HDQoL-C-SF);[@R18] CAREQOL-MS for MS;[@R19] Alzheimer\\'s Carers Quality of Life Instrument (ACQLI);[@R20] Parkinson Disease Questionnaire for Carers (PDQ-Carer);[@R21] Parkinsonism Carers QoL (PQoL Carers);[@R22] and the Caregiver Quality Of Life for dementia (CGQOL).[@R6] We did not identify any instruments designed to measure the QOL of carers of people with motor neuron disease.", "\n\nStudy characteristics {#s3b}\n---------------------\n\nThe sample characteristics for the eight studies assessing the carer QOL instruments are presented in [table 1](#BMJOPEN2016013611TB1){ref-type=\"table\"}.", "\n\n###### \n\nCharacteristics of the included studies\n\n -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Carer QOL Instrument Author(s) Country Sample\\ Study design/setting Measurement domains Number of items/response format\n Total N (% female)\\ \n Mean age years\\ \n (SD) \n ---------------------- ------------------------------ ---------- --------------------- --------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ---------------------------------------------------------------\n HDQoL-C Aubeeluck and Buchanan[@R17] UK 87 (62.1)\\ Longitudinal/cohort: spousal carers recruited through the Huntington\\'s Disease Association UK Demographic and objective information; practical aspects of caregiving; satisfaction with life; feelings about living with Huntington\\'s disease 34 items\\\n 58.2 (14.2) 11-point Likert scale\n\n HDQoL-C-SF Aubeeluck *et al*[@R18] France\\ 301 (60.5)\\ Cross-sectional survey: family or friend carers of people with Huntington\\'s disease Satisfaction with life; feelings about living with Huntington\\'s disease 20 items\\\n Italy 57.1 (13.1) 11-point Likert scale\n\n CAREQOL-MS Benito-Leon *et al*[@R19] Spain 276 (56.5)\\ Longitudinal/cohort: family carers of people with MS recruited from 19 Spanish outpatient clinics Physical burden and global health; social impact; emotional impact; need of support; emotional reactions to patient\\'s psychic status 24 items\\\n 50.2 (12.6) 5-point Likert scale\n\n ACQLI Doward[@R20] UK\\ 192 (72.3)\\ Longitudinal/cohort: family carers of people with dementia Single domain of carer QOL 30 items\\\n France\\ 60.0 (12.2) Dichotomous (true/not true)\n Germany\\ \n Italy\\ \n Spain \n\n PDQ-Carer Jenkinson *et al*[@R21] UK 236 (63.5)\\ Cross-sectional survey: family carers of people with Parkinson\\'s disease who were members of Parkinson\\'s UK Social and personal activities; anxiety and depression; self-care; stress 29 items\\\n 68.2 (9.5) 5-point Likert scale\n\n PDQ-Carer-SI Morley *et al*[@R23] UK 236 (63.5)\\ Cross-sectional survey: family carers of people with Parkinson\\'s disease who were members of Parkinson\\'s UK Single summary index score computed using the four subscales of the PDQ-Carer 29 items\\\n 68.2 (9.5) 5-point Likert scale\n\n PQoL Carers Pillas *et al*[@R22] UK 430 (62.4)\\ Cross-sectional survey: family carers of people with MSA and PSP Single domain of carer QOL 26 items\\\n 66.2 (8.5) 5-point Likert scale\n\n CGQOL Vickrey *et al*[@R6] USA 200 (79.0)\\ Longitudinal/cohort: family carers of people with dementia Assistance with instrumental activities of daily living; assistance with activities of daily living; role limitations due to caregiving; personal time; family interaction; demands of caregiving; worry; spirituality and faith; benefits of caregiving; caregiver feelings 80 items\\\n 61.5 (13.5) 3-point and 5-point Likert scales specific to groups of items\n -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\nACQLI, Alzheimer\\'s Carers Quality of Life Instrument; CGQOL, Caregiver Quality Of Life; HDQoL-C, Huntington\\'s disease quality-of-life battery for carers; HDQoL-C-SF, Huntington\\'s disease quality-of-life battery for carers short form; MS, multiple sclerosis; MSA,multiple system atrophy; PDQ-Carer, Parkinson Disease Questionnaire for Carers; PDQ-Carer-SI, Parkinson Disease Questionnaire for Carers Summary Index; PQoL Carers, Parkinsonism Carers QoL; PSP,progressive supranuclear palsy; QOL, quality of life.", "\n\nThe total sample sizes of these studies ranged from 87[@R17] to 430.[@R22] The studies recruited participants from the UK,[@R17] [@R21] Spain[@R19] and the USA.[@R6] The remaining two studies recruited participants across multiple countries which included France, Italy and Germany.[@R18] [@R20] The mean age of participants across the eight studies was 61.2 years. ", "The number of measurement domains of the instruments ranged from 1 (ACQLI, PQoL Carers) to 10 (CGQOL). ", "The number of items of these instruments ranged from 20 (HDQoL-C-SF) to 80 (CGQOL). ", "All measures used Likert-type rating scales (ranging from 3-point to 11-point), except for the ACQLI which used a dichotomous (true/not true) response format.", "\n\nMethodological quality of studies {#s3c}\n---------------------------------\n\n[Table 2](#BMJOPEN2016013611TB2){ref-type=\"table\"} provides a summary of the scores from the COSMIN checklist. ", "Six of the eight studies (75%) included in the review had at least one methodological domain rated as 'poor' quality.[@R6] [@R17] Across all studies, the measurement property that received the highest number of 'poor' ratings was content validity (4/8 studies). ", "Five of the eight studies (63%) had at least one methodological domain rated as of 'fair' quality.[@R6] [@R18] [@R21] The measurement property that received the highest number of 'fair' ratings was internal consistency (5/8 studies). ", "Of the 8 studies, 2 (26%) had at least one area of methodological quality rated as 'good' or 'excellent'.[@R19] [@R22] The measurement properties that received 'good' ratings were reliability and measurement error.[@R19] The measurement properties that received 'excellent' ratings were internal consistency, structural validity[@R19] and content validity.[@R22]\n\n###### \n\nResults of COSMIN checklist\n\n Carer QOL instrument Study reference Internal consistency Reliability Measurement error Content validity Structural validity Hypotheses testing Cross-cultural validity Criterion validity Responsiveness\n ---------------------- ------------------------------ ---------------------- ------------- ------------------- ------------------ --------------------- -------------------- ------------------------- -------------------- ----------------\n HDQoL-C Aubeeluck and Buchanan[@R17] 1 1 0 1 1 0 0 0 0\n HDQoL-C-SF Aubeeluck *et al*[@R18] 2 0 0 0 2 2 1 0 0\n CAREQOL-MS Benito-Leon *et al*[@R19] 4 3 3 1 4 0 0 0 0\n ACQLI Doward[@R20] 1 1 0 1 0 0 1 0 0\n PDQ-Carer Jenkinson *et al*[@R21] 2 0 0 1 2 0 0 0 0\n PDQ-Carer-SI Morley *et al*[@R23] 2 0 0 0 2 0 0 0 0\n PQoL Carers Pillas *et al*[@R22] 2 0 0 4 2 0 0 0 0\n CGQOL Vickrey *et al*[@R6] 2 1 0 0 1 1 1 0 0\n\nKey*:* 4: excellent, 3: good, 2: fair, 1: poor, 0: no information available.", "\n\nACQLI, Alzheimer\\'s Carers Quality of Life Instrument; CGQOL, Caregiver Quality Of Life; COSMIN,COnsensus-based Standards for the selection of health Measurement Instruments;HDQoL-C, Huntington\\'s disease quality-of-life battery for carers; HDQoL-C-SF, Huntington\\'s disease quality-of-life battery for carers short form; MS, multiple sclerosis; PDQ-Carer-SI, Parkinson Disease Questionnaire for Carers Summary Index; PQoL Carers, Parkinsonism Carers QoL; QOL, quality of life.", "\n\nPsychometric properties of the carer QOL instruments {#s3d}\n----------------------------------------------------\n\nThe instruments that had allowed the most comprehensive evaluation of psychometric properties across the 9 domains of the COSMIN checklist were the CAREQOL-MS (5/9 domains assessed) and the CGQOL (5/9 domains assessed). ", "The HDQoL-C, HDQoL-C-SF and ACQLI each had four of the nine domains evaluated. ", "The measures that had the least evidence available for their psychometric properties were the PQoL Carers (3/9 domains assessed), the PDQ-Carer (3/9 domains assessed) and the summary index of the PDQ-Carer (2/9 domains assessed). ", "Internal consistency was the most widely assessed measurement property, and was examined in all seven instruments. ", "Cronbach\\'s α coefficients for the total scale and instrument subscales ranged from 0.75 to 0.94 (see [table 3](#BMJOPEN2016013611TB3){ref-type=\"table\"} for an overview of the psychometric properties of each carer QOL instrument).", "\n\n###### \n\nEvidence of the reliability and validity of the carer QOL instruments\n\n Reliability Validity \n --------------------------------------- ------------------------------ -------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n HDQoL-C Aubeeluck and Buchanan[@R17] Not provided for total scale. ", "Subscale α: 0.80, 0.84, 0.89 Test--retest (N=10) over 2 weeks. ", "Pearson correlation: 0.78, 0.86, 0.90 for subscales Not assessed Two experts in the field of QOL and two experts in the field of HD commented on item content Convergent validity: positive correlations of HDQoL-C subscales with WHOQOL-BREF, Satisfaction with Life Scale, and Perceived Health Visual Analogue Scale\n HDQoL-C-SF Aubeeluck *et al*[@R18] Not provided for total scale. ", "Subscale α: 0.88, 0.80 Not assessed Not assessed Not assessed Known groups analyses showed that HDQoL-C-SF scores were higher (better carer QOL) for carers of patients in the low disease severity group compared with the moderate and high severity groups\n CAREQOL-MS Benito-Leon *et al*[@R19] Not provided for total scale. ", "Subscale α: 0.90, 0.85, 0.81, 0.78, 0.75 Test--retest (N=276) over 2 weeks. ", "ICC for total scale score=0.96 and ranged from 0.75 to 0.95 for subscales. ", "Cohen\\'s κ ranged from 0.46 to 0.93. ", "One item had κ\\<0.60 and 15 items had κ≥0.80. ", " SE of measurement ranged from 0.91 to 2.43 across the five subscales over 2 weeks time interval. ", " Item content analysed by MS experts. ", "Focus groups of MS carers and patients discussed item pool. ", "Items rated for clarity and meaning by MS experts and a separate carer sample Convergent validity: positive correlations of CAREQOL-MS subscales with Zarit Burden Interview. ", "Moderate-to-high negative correlations of CAREQOL-MS subscales with physical and mental components of SF-36\n ACQLI Doward[@R20] α ranged between 0.87 and 0.95 across the UK, France, Germany, Italy and Spain for times 1 and 2 administrations of the ACQLI. ", " Test--retest over 2 weeks. ", "Spearman correlations were 0.93, 0.92, 0.95, 0.94, 0.90 for UK, France, Germany, Italy and Spain, respectively. ", "Based on very small N per country Not assessed Field test of items with samples of carers. ", "States that carers found the ACQLI to be understandable, acceptable and relevant across all countries Convergent validity: positive spearman correlations of ACQLI with General Well-being Index in UK and Italy. ", "Known groups analysis demonstrated that the ACQLI can distinguish between carers based on their current health status.", "\n PDQ-Carer Jenkinson *et al*[@R21] Not provided for total scale. ", "Subscale α: 0.92, 0.87, 0.86, 0.83 Not assessed Not assessed Very limited assessment of content validity. ", "Items were evaluated by focus groups of researchers and a pilot sample of carers. ", " Convergent validity: moderate-to-high negative correlations of PDQ-Carer subscales with physical and mental components of SF-36\n PDQ-Carer-SI Morley *et al*[@R23] α=0.94 Not assessed Not assessed Not assessed Convergent validity: moderate-to-high negative correlations of PDQ-Carer-SI score with physical and mental components of SF-36\n Parkinsonism Carers QoL (PQoL Carers) Pillas *et al*[@R22] α=0.96 Not assessed Not assessed Very limited assessment of content validity. ", "The questionnaire was pilot tested in a small group of carers Convergent validity: Subscales of PQoL Carers correlated with Caregiver Burden Inventory, Hospital Anxiety and Depression Scale and the EQ-5D. ANOVA revealed that PQoL Carers scores differentiate between carers based on their current health status.", "\n Caregiver Quality Of Life (CGQOL) Vickrey *et al*[@R6] Not provided for total scale. ", "Subscale α: 0.88, 0.93, 0.78, 0.83, 0.86, 0.86, 0.82, 0.94, 0.92, 0.89 Test-retest (N=71) between 11 and 63 days following first administration (75% within 21 days). ", "ICC ranged from 0.53 to 0.89, exceeding 0.70 for 6 of the 10 subscales Not assessed Not assessed Convergent validity: Regression and correlation analyses of CGQOL subscales with a range of patient and carer characteristics (e.g. number of hours spent caregiving, duration of being a carer)\n\nACQLI, Alzheimer\\'s Carers Quality of Life Instrument; CGQOL, Caregiver Quality Of Life; HD, Huntington\\'s disease; HDQoL-C, Huntington\\'s disease quality-of-life battery for carers; HDQoL-C-SF, Huntington\\'s disease quality-of-life battery for carers short form; ICC, intraclass correlation coefficient; MS, multiple sclerosis; PDQ-Carer-SI, Parkinson Disease Questionnaire for Carers Summary Index; PQoL Carers, Parkinsonism Carers QoL; QOL, quality of life.", "\n\nReliability of the measures was reported in 4/8 studies.[@R6] [@R17] [@R19] [@R20] These studies computed test--retest reliability over 2--3 weeks time interval through calculation of Pearson or Spearman correlations. ", "Intraclass correlation coefficients (ICCs) were also used to assess the test--retest reliability of individual subscales in two instruments: the CAREQOL-MS and CGQOL. ", "ICCs ranged between 0.53 and 0.95 for all subscales across these two measures. ", "The CAREQOL-MS was the only instrument to calculate measurement error.", "\n\nContent validity was evaluated in 5/8 studies.[@R17] [@R19] [@R20] Structural validity was assessed in 7/8 studies.[@R6] [@R17] [@R21] Principal components analysis (PCA) was the most frequently employed method of statistical analysis for examining structural validity. ", "No studies included the use of confirmatory factor analysis (CFA) with either continuous or categorical variables (also known as item response theory (IRT)) to assess factorial structure.", "\n\nCorrelational and known group analyses were most commonly used to assess convergent and discriminant validity. ", "However, hypotheses testing was carried out for only two instruments; the HDQoL-C-SF[@R18] and the CGQOL.[@R6] Cross-cultural validity was evaluated for three measures: the HDQoL-C-SF,[@R18] ACQLI[@R20] and CGQOL.[@R6] None of the instruments assessed criterion validity or responsiveness.", "\n\nConstructs assessed by the carer quality of life instruments {#s3e}\n------------------------------------------------------------\n\n### Huntington\\'s disease {#s3e1}\n\nAs displayed in [table 3](#BMJOPEN2016013611TB3){ref-type=\"table\"}, the HDQoL-C consists of four measurement domains (demographic and objective information; practical aspects of caregiving; satisfaction with life; feelings about living with HD) which assess the QOL of spousal carers of people with HD. ", "It is a 34-item instrument which employs an 11-point Likert-type response scale. ", "PCA using varimax rotation was performed separately on each set of items for three of the four domains (not the component of demographic and objective information). ", "This identified three subcomponents for the first component of 'practical aspects of care giving' (levels of support and access to professionals; long-term and genetic issues; daily hassles). ", "PCA on the third domain of 'satisfaction with life' extracted two subcomponents (overall QOL issues; personal issues). ", "Finally, PCA on the fourth domain of 'feelings about living with HD' resulted in the identification of two subcomponents (negative feelings about life; positive feelings about life).", "\n\nThe short form of the HDQoL-C measures two of the four domains of the original instrument (satisfaction with life; feelings about living with HD). ", "It is a 20-item measure using an 11-point Likert-type response scale. ", "Exploratory factor analysis (EFA) using varimax rotation was performed on the 17 items of the 'feelings about living with HD' subscale. ", "This resulted in the extraction of the two subcomponents of 'negative feelings about life' and 'positive feelings about life' which accounted for 84% of the total variance. ", "Factor analysis was not performed on the 'satisfaction with life' subscale as only three items were retained from the full-length measure. ", "In addition to the English language version of the HDQoL-C, the measure was translated into French and Italian.", "\n\n### Multiple sclerosis {#s3e2}\n\nThe CAREQOL-MS measures QOL in carers of people with MS. ", "It consists of 24 items and uses a five-point Likert-type response format. ", "PCA using orthogonal rotation (unspecified method of rotation) extracted four factors identified as 'physical burden and global health', 'emotional impact', 'need of support' and 'emotional reactions to patient\\'s psychic status' explaining 60% of the total variance. ", "The first factor was later subdivided to include a separate subscale of 'social impact'.", "\n\n### Parkinson\\'s disease {#s3e3}\n\nThe PDQ-Carer measures QOL in carers of people with PD. ", "This instrument contains 29 items and uses a five-point Likert-type response format. ", "EFA using varimax rotation identified four factors: social and personal activities, anxiety and depression, self-care, and stress. ", "These factors explained 60% of the total variance.", "\n\nThe PQoL Carers is an alternative measure of QOL in family carers of people with PD. ", "This instrument contains 26 items and uses a five-point Likert-type response format. ", "Parallel analysis was performed to assess the dimensionality of the scale which identified a single factor structure (representing overall QOL), explaining 54% of the total variance.", "\n\n### Dementia and Alzheimer\\'s disease {#s3e4}\n\nThe ACQLI measures QOL in carers of people with Alzheimer\\'s disease and dementia. ", "This instrument consists of 30 items which use a dichotomous (true/not true) response format. ", "Structural validity of the ACQLI has not been evaluated. ", "The items of the measure assess QOL as a unidimensional construct, but no factor analysis was reported in the development of this scale. ", "Five language versions of the ACQLI are available: English, French, German, Italian and Spanish.", "\n\nFinally, the CGQOL is the most recently developed measure of QOL in carers of people with dementia and Alzheimer\\'s disease. ", "The instrument contains 80 items across 10 domains (assistance with instrumental activities of daily living; assistance with activities of daily living; role limitations due to caregiving; personal time; family interaction; demands of caregiving; worry; spirituality and faith; benefits of caregiving; caregiver feelings) using either a three-point or a five-point Likert-type response format, with categories specific to groups of items. ", "These 10 subscales were categorised under three superordinate factors labelled 'tangible assistance' (comprised of assistance (to the person with dementia) with instrumental activities of daily living; assistance (to the person with dementia) with activities of daily living; personal time; role limitations due to caregiving), 'psychosocial' (comprised of role limitations due to caregiving (cross-loaded with tangible assistance); family involvement; demands of caregiving; worry; caregiver feelings) and 'benefits/faith' (comprised of spirituality and faith, and benefits of caregiving) using EFA with promax rotation. ", "The CGQOL was originally developed in English and was later translated into Spanish. ", "It is to be noted that items were translated into Spanish, reviewed by a second translator and interviews were then conducted with eight Spanish-speaking carers in which to assess and refine item wording.", "\n\nDiscussion {#s4}\n==========\n\nWe identified eight studies which report the development of seven carer QOL measures in neurodegenerative diseases (ie, dementia and Alzheimer\\'s disease; HD; PD; MS). ", "No instruments were identified that measure carer QOL in motor neuron disease. ", "The findings of the studies, taken together, are potentially of value in guiding researchers and health professionals in the selection of an appropriate and psychometrically robust disease-specific instrument. ", "The studies demonstrate some key methodological problems in the current instruments available to measure carer QOL in these neurodegenerative diseases and highlight avenues for future research.", "\n\nOverall, limited information was available concerning the psychometric properties of the instruments that were identified. ", "Collectively, the studies have shown that many important elements of psychometric evaluation were either absent or not sufficiently tested during the development phases of these disease-specific measures. ", "This review found that the CAREQOL-MS[@R19] and the CGQOL[@R6] received the most comprehensive psychometric evaluation, whereas the PQoL Carers[@R22] and the PDQ-Carer[@R21] (including the validation of the summary index[@R23]) had the least information available on their psychometric properties.", "\n\nInternal consistency was the most widely reported psychometric property and was available for all seven instruments. ", "This was quite strong across the studies with Cronbach\\'s α coefficients ranging from 0.75 to 0.94. ", "Less information was provided for the temporal stability of the measures. ", "Only four of the instruments reported test--retest reliability (HDQoL-C, CAREQOL-MS, ACQLI, CGQOL), and this ranged from being adequate to excellent over 2--3 weeks period. ", "The CAREQOL-MS was the only instrument to report measurement error, which is the more useful figure than reliability since it controls for the population variance and is therefore more readily generalisable to other populations.[@R24]\n\nThe assessment of factorial structure was generally limited across all studies. ", "EFA and PCA were the methods predominantly used by the test developers to assess dimensionality. ", "However, no factor analysis was reported for the development of the ACQLI, despite the underlying assumption that it is a unidimensional measure of carer QOL. ", "Moreover, none of the studies had performed CFA as a hypothesis-driven test of structural validity. ", "All identified studies disregarded the categorical nature of responses and treated them as continuous for the purposes of factor analysis. ", "While this approximation may be acceptable for items using five or more categories,[@R25] it is generally untenable for dichotomous items[@R24] such as used in the ACQLI. ", "Future research using these instruments should investigate whether the factor structures that were identified in EFA will replicate in CFA when the fit of alternative measurement models are tested. ", "It would also be advantageous for researchers to explore factorial structures using methods for categorical variables (IRT), such as Rasch analysis.[@R26] A strong advantage of Rasch analysis is that different measures of the same attribute can be calibrated using the same scale and items can be used for computerised adaptive testing.[@R27] IRT methods can thus control for item properties that are difficult in classical measurement, such as the item difficulty or ability to discriminate between varying levels of the attribute.", "\n\nInterestingly, the factor analyses reported in the studies reviewed suggest that similar constructs are being measured by all carer QOL instruments across the various diseases. ", "These measurement domains include, for example, an appraisal of caring demands, evaluation of support received, positive and negative feelings towards caring, the social impact of caring and negative health effects due to caring, such as anxiety, depression, stress and fatigue. ", "In contrast to the other measures, the CGQOL includes a wider array of QOL domains believed to be affected by the caring role such as role limitations and family interaction.", "\n\nCorrelations with external measures were examined in all seven instruments. ", "As evidence of convergent validity, the disease-specific measures were often found to correlate with generic measures of QOL such as the SF-36 and the EQ-5D.[@R19] [@R21] Known group analysis was frequently used to evaluate construct validity. ", "For example, the HDQoL-C-SF differentiated between carers on the basis of the patients\\' disease severity. ", "As reported previously, it was shown that carers\\' scores on the HDQoL-C-SF were higher (ie, representing better QOL) when caring for family members whose HD was less severe.[@R18]\n\nA limitation of the studies reviewed is that hypotheses were not formulated in the assessment of construct validity. ", "The HDQoL-C-SF and CGQOL were the only two instruments in which hypotheses had been postulated a priori about the expected relationships among measures. ", "As such, it was unclear *how* researchers had anticipated their measures to be associated with, or distinct from, existing scales that measure similar constructs. ", "Another limitation of the studies included in the review is that criterion-related validity had not been examined or even considered as an important issue. ", "More importantly, none of the instruments that we examined had assessed responsiveness to change. ", "Thus, it is not known whether these instruments are sensitive to detecting changes in carers\\' QOL over time. ", "Researchers and clinicians need to measure whether interventions and services are effective in improving carer QOL. ", "The lack of known responsiveness to change in these existing measures could, therefore, be problematic for those seeking to administer these measures within intervention programmes and social care settings. ", "The growing use of QOL as a primary outcome measure in interventional studies highlights the importance of conducting responsiveness analysis on these measures and including such analyses in the development of future QOL instruments.", "\n\nLimitations {#s4a}\n-----------\n\nThere are several limitations of the present review that warrant consideration. ", "First, only articles written in English were sourced, and this may have led to the exclusion of carer QOL measures that were developed and/or validated in other languages. ", "Second, this review only focused on neurodegenerative diseases and did not examine the psychometric properties of carer QOL measures developed for other medical conditions. ", "For example, the Caregiver Quality of Life Index-Cancer (CQOLC);[@R28] scale is a self-report measure of QOL in family carers of patients with cancer. ", "In future research, it would be interesting to compare the psychometric properties of neurodegenerative disease-specific measures with carer QOL instruments across a broader range of disorders. ", "Third, we only examined the measurement of QOL of family carers (defined for our purposes as family members, neighbours or friends) and did not consider professional (paid) carers. ", "It should be noted, however, that no articles in this review were excluded during the screening process on the basis of the carer samples that were reported. ", "It appears that there are no instruments developed to measure the specific QOL impacts on paid carers. ", "Our systematic review appears to have been successful in detecting carer QOL measures that currently exist across the various neurodegenerative diseases.", "\n\nConclusions {#s5}\n===========\n\nIn this systematic review, we provide a comprehensive overview of disease-specific instruments to measure QOL of family carers of people with a neurodegenerative disease. ", "The included studies had key methodological limitations associated with the measurement of QOL using these disease-specific instruments. ", "These findings indicate that there is a need to further develop and refine these measures and potentially to develop new measures, in order to improve the psychometric quality of the measures available. ", "Given the considerable overlap in the constructs measured by the QOL instruments that we reviewed, it might be useful for researchers to explore whether a single measure of carer QOL for all neurodegenerative diseases would be feasible and valid. ", "However, due to the heterogeneity in symptoms and disease course, a rigorous development process is needed before assuming a single measure would be sufficient. ", "Moreover, it would be advantageous to create shorter and more concise measures of carer QOL. ", "This would offer greater brevity and flexibility to researchers and clinicians who need to administer these instruments in tandem with a number of other scales. ", "Long instruments such as the 80-item CGQOL[@R6] arguably impose a greater burden on respondents. ", "Thus, shorter measures that contain fewer items would benefit respondents by reducing completion time and reporting burden.", "\n\nOverall, the findings of this review should be helpful in guiding researchers and health professionals in the selection of an appropriate, and psychometrically robust, disease-specific instrument. ", "The accurate assessment of carer QOL is a growing research priority, and the findings of this review are a useful foundation for researchers seeking to develop and validate new measures of carer QOL in neurodegenerative disorders. ", "The development of psychometrically strong, disease-specific measures of QOL is important for the generation of better treatments, services, care and support for people with neurodegenerative disorders and their carers. ", "As demonstrated in this review, there are few instruments that measure carer QOL in neurodegeneration, and the psychometric properties of the few available measures are limited. ", "Further psychometric testing is needed on existing measures; future validation studies should include the use of IRT in conjunction with traditional methods of assessment. ", "There is room for new instruments with stronger psychometric development, evaluation and properties in this important area.", "\n\n**Contributors:** All authors were involved in the design of the study. ", "TEP designed the literature search and screened the titles and abstracts of the identified studies in collaboration with NF. ", "TEP and NF performed the data extraction and quality assessment. ", "Preparation of the manuscript was completed by TEP. ", "AB and SB edited and reviewed the manuscript. ", "All authors approved the manuscript. ", "The views expressed are the authors\\' own.", "\n\n**Funding:** This work was supported by an Alzheimer\\'s Society Project Grant (234ASPG14017).", "\n\n**Competing interests:** None declared.", "\n\n**Provenance and peer review:** Not commissioned; externally peer reviewed.", "\n\n**Data sharing statement:** No additional data are available.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0, 0, 0, 0, 0, 0, 0.009202453987730062, 0.005611672278338945, 0.0030581039755351682, 0, 0.005154639175257732, 0.012096774193548387, 0.00819672131147541, 0.007518796992481203, 0.01276595744680851, 0.013227513227513227, 0.006993006993006993, 0, 0.00510204081632653, 0, 0.0058309037900874635, 0, 0.008849557522123894, 0, 0, 0, 0, 0.005633802816901409, 0.010752688172043012, 0, 0.016666666666666666, 0, 0, 0.0079155672823219, 0.004815409309791332, 0, 0, 0.016666666666666666, 0, 0, 0, 0, 0, 0, 0, 0.013793103448275862, 0.020072992700729927, 0.00966183574879227, 0.001944361352078971, 0.021739130434782608, 0.019417475728155338, 0, 0.006329113924050633, 0.005291005291005291, 0.007633587786259542, 0.01282051282051282, 0.006188569348380051, 0.022964509394572025, 0.008928571428571428, 0.012658227848101266, 0.008695652173913044, 0, 0.004347826086956522, 0.0011217049915872126, 0, 0.0057553956834532375, 0.004624277456647399, 0, 0, 0.02702702702702703, 0, 0, 0.02564102564102564, 0.016666666666666666, 0.011363636363636364, 0.00974025974025974, 0, 0, 0, 0.008298755186721992, 0.00847457627118644, 0.009615384615384616, 0, 0, 0.003949967083607637, 0.010526315789473684, 0.009615384615384616, 0, 0.008737864077669903, 0.01818181818181818, 0.011976047904191617, 0, 0.014285714285714285, 0.025735294117647058, 0.0053475935828877, 0, 0.01730103806228374, 0.002127659574468085, 0, 0.006060606060606061, 0, 0.01680672268907563, 0, 0, 0, 0.007352941176470588, 0, 0, 0, 0.03296703296703297, 0, 0.0037313432835820895, 0, 0.021739130434782608, 0, 0.007633587786259542, 0, 0.011494252873563218, 0, 0.005494505494505495, 0.022727272727272728, 0, 0.017543859649122806, 0.0072992700729927005, 0.010416666666666666, 0.015748031496062992, 0, 0.001607717041800643, 0.011764705882352941, 0, 0.01507537688442211, 0.012658227848101266, 0, 0.0051813471502590676, 0, 0, 0.02356902356902357, 0, 0, 0, 0.017341040462427744, 0.006329113924050633, 0.020618556701030927, 0.012578616352201259, 0, 0, 0.017543859649122806, 0.005050505050505051, 0.009398496240601503, 0.00558659217877095, 0, 0.011494252873563218, 0, 0.012295081967213115, 0, 0.010033444816053512, 0.006535947712418301, 0, 0, 0, 0.01818181818181818, 0.008620689655172414, 0, 0.008583690987124463, 0, 0.005813953488372093, 0.005780346820809248, 0.019867549668874173, 0.005154639175257732, 0.0055248618784530384, 0, 0.009708737864077669, 0.006535947712418301, 0.004901960784313725, 0.0072992700729927005, 0, 0.008097165991902834, 0, 0.010752688172043012, 0, 0.010309278350515464, 0, 0, 0.008658008658008658, 0.004545454545454545, 0.0056179775280898875, 0.005813953488372093, 0, 0, 0.016, 0.03076923076923077, 0.019230769230769232, 0.021739130434782608, 0, 0.023809523809523808, 0.021052631578947368, 0, 0, 0, 0 ]

[ "The experience of life-threatening illness: patients' and their loved ones' perspectives.", "\nLittle is known about the actual concerns of patients and families regarding their health care during life-threatening illness and at end of life. ", "Previous research with these groups has focused on their reaction to concerns of the medical community, eg, advance directives, decision making, and pain and symptom management. ", "To elicit and listen attentively to the actual experiences and major concerns of persons with life-threatening illness, personal/family caregivers, and bereaved individuals regarding their health care and interactions with healthcare system. ", "Thirty-three focus groups were convened to involve 3 categories of individuals: persons with life-threatening illness (n = 77), personal/family caregivers (n = 70), and bereaved persons (n = 81). ", "Three focus groups, 1 of each kind, were held in 11 cities across the United States. ", "Verbatim transcripts were coded and analyzed to identify themes. (", "1) Persons with life-threatening illnesses indicated that health professionals focus on medical and physical interventions, give too little information, appear uncomfortable talking about death, and do not include family members in conversations. (", "2) Caregivers reported exhaustion. ", "They said that doctors do not appreciate the impact of the illness on their lives and rarely consult them, although all treatment decisions affect them. (", "3) Bereaved persons emphasized the loved ones' comfort in the last days of life. ", "They wished that physicians would tell families when the end is near and avoid interrupting the process of dying with medical and often futile tasks. \"", "I'm sorry\" is sufficient initially to express the physician's condolences, but families appreciate contact weeks later. ", "Many sources of dissatisfaction with care among persons with life-threatening illness and their families are interpersonal in nature. ", "The physician's respectful presence and demonstration of caring are highly desired, significant interventions for those who cannot be cured of illness and for their loved ones. ", "Making healthcare professionals aware of these concerns may itself bring about some changes in daily practice. ", "Further research is needed to test the most useful skills and behaviors of healthcare professionals in caring for persons with life-threatening illness and their loved ones." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nHow to reduce database size with BLOB fields\n\nI have a database that's used to store fingerprints. ", "Under my conception this should be a small database but the problem is that the original developer was probably tripping on peyote and decided it would be a great idea to store the fingerprints in BLOB fields. ", "\nThanks to this magic trick the database is now 3 GB in size and the frontend its crashing all the time, no wonder since a simple SELECT TOP(1000) takes about a minute from MSSMS.", "\nSo I'm left with a doubt about how to proceed. ", "Is there a way I could reduce the size of the table containing the pictures? ", "Or maybe another alternative to this madness.", "\nRegards. ", "\n\nA:\n\n3GB is not really a lot of data. ", " My laptop has 16GB memory, our datawarehouse is 3TB and that would be a fairly small warehouse. ", " The maximum database size according to here is 524,272 TB!? ", " So I think performance here is more about the kit you are on, plus index and query design.", "\nYou could refactor as Russell has suggested. ", " However you could also maintain the original one-table design with appropriate indexing, either a non-clustered covering index, or even full-text indexing to support the 'search for record' type queries - this should not include the blob. ", " Then only get the fingerprint images on an individual basis, when required by the application. ", " To put this another way, do not include the blob column in SELECTs where it is not explicitly required. ", " This will have the same effect as splitting the data into two tables without the redesign. ", " Don't attempt to get all the fingerprints at once!", "\nPlease tell us more about the spec of kit you are on, the version of SQL Server you are running, the table DDL (including indexes) plus what type of queries the application normally runs.", "\n\nA:\n\nThere are a few approaches to handling this problem. ", " Here are three options:\n\nCreate a FingerprintBLOB table (perhaps in a different database) for the BLOBs of fingerprints then drop that column from theOriginalTable. ", "That way when you SELECT TOP(1000) * FROM OriginalTable you will not need to read the BLOBs from the FingerprintBLOB table. ", " This should greatly reduce the I/O requirements.", "\nIf you want to manage the storage all from SQL Server, this would be the choice to make. ", "It keeps the fingerprints in the database, but separates the I/O issues for general queries.", "\nStore each FingerprintBLOB as a separate file in a directory structure on disk. ", " Keep the BLOB's \\\\Server\\Share\\Path\\Filename in the OriginalTable.", "\nIf you would like to keep the database space smaller and prefer to store on the file system then choose this approach. ", " You can implement this on your own, which means you will need to manage the two separate backups: Database and File Structure. ", " \nOr, a hybrid option is that you can use the SQL Server FILESTREAM which can be used to write files to non-database disk, but still provide a single SQL Server BACKUP and RESTORE process that backs up both kinds of data. ", " \n\nAny approach would be best done by creating new tables or a table and file structures. ", "Then migrate the data to the appropriate locations. ", "Once you have the data migrated you can adjust object names, if desired.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.009708737864077669, 0.004761904761904762, 0.00558659217877095, 0, 0, 0, 0, 0, 0, 0, 0, 0.021739130434782608, 0, 0, 0, 0, 0, 0, 0, 0, 0.008064516129032258, 0, 0.011111111111111112, 0, 0, 0.029850746268656716, 0, 0.0078125, 0.0045045045045045045, 0, 0, 0, 0 ]

[ "Jimmy Kimmel to Host the 2012 Emmy Awards\n\nThis could be a very smart move by the Emmys. ", "Today ABC announced that Jimmy Kimmel, late-night talk show host, will be hosting the 64th Primetime Emmy Awards, airing on in September.", "\n\nThis will be Kimmel’s first time hosting the Emmys and Don Mischer will serve as producer for the telecast for the 12th time. “", "We are thrilled to have been asked to produce the 64th Primetime Emmy Awards,” says\nMischer. “", "We love television and look forward to working with the Television Academy and ABC\nin creating a show that is fast-paced, humorous, unpredictable and at times irreverent, but clearly\ncelebratory of our incredible industry.”", "\n\nKimmel’s post-Oscar show has become a staple on ABC, attracting big-name talent for parody videos. ", "While David Letterman didn’t exactly dazzle us as an Oscar host, Kimmel could do very well as an Emmy host, possessing both a decent sense of humor and natural “aw-shucks” charisma." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011235955056179775, 0.014598540145985401, 0.015503875968992248, 0, 0.008968609865470852, 0.009900990099009901, 0.016574585635359115 ]

[ "ATLANTA -- Atlanta Falcons defensive end Takkarist McKinley is with a family member in Oakland, California, after undergoing a mental evaluation prompted by a friend's call to Los Angeles police.", "\n\nFalcons spokesman Brian Cearns told The Associated Press McKinley \"is in a good spot\" and has been in \"constant communication\" with the team, including coach Dan Quinn. ", "Cearns said McKinley is staying with an uncle.", "\n\nTMZ Sports reported Tuesday night that a friend became concerned for McKinley's well-being and summoned police. ", "No criminal charges were filed. ", "TMZ Sports says McKinley was cooperative when detained by officers.", "\n\nIt is not known what prompted McKinley's friend to call police. ", "Cearns says the situation has been resolved.", "\n\nMcKinley, who played collegiately at UCLA, was a first-round pick by the Falcons in 2017. ", "He led the Falcons with seven sacks in 2018." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.010256410256410256, 0.017543859649122806, 0.021739130434782608, 0.008771929824561403, 0, 0.029850746268656716, 0.015151515151515152, 0, 0.021739130434782608, 0 ]

[ "Faith\n\nHuman beings need to believe. ", "It’s a fact. ", "Faith is essential in our lives. ", "Otherwise, we are nothing but tissue and bones. ", "But what are the things which we have faith in? ", "An easy one: God. ", "Ok, accepted. ", "He will never show up. ", "We don’t even know exactly where he is, what he does and what he doesn’t. ", "It’s a mystery. ", "Verdict: passed. ", "It’s fine to have faith in God.", "\n\nThen, you can have more or less faith in yourself, in your husband/wife, in friends, family, etc. ", "And that’s the end of the list. ", "Because faith is what endures against the worst: death, destruction, hopelessness, discourage, disappointment. ", "When there is nothing left to believe in, faith makes its most valuable appearance: in spite of the emptiness and darkness around you, you keep on going, moving forward.", "\n\nIt’s impossible to speak about faith in Society, since there is no subject, but crowds. ", "You find faith in the deepest levels of your soul, something a society can’t have. ", "So when any event is taking place in the context of society, we must be careful to talk about faith and beliefs. ", "In fact, it’s even dangerous to speak about emotions, feelings, spirit, soul referring to society. ", "It means to assign spiritual aspects to an entity, a concept, an outcome. ", "Society is the environment of reason, of speculation, of objectivism, or supra-subjetivism. ", "When human subjective attributes are applied to society, it’s obligatory metaphoric language.", "\n\nWhen is this metaphoric language applied to society then?", "\n\nWhen some, many, all of its individuals express a feeling, an emotion, all together, which doesn’t mean at all that the group is experimenting an emotion as a being.", "\n\nAs Society, we must balance its’ results, its’ means, its’ ends. ", "And in this assessments we must leave emotions, faith, spirit, set aside.", "\n\nThe context of the individual is utterly different to that of society. ", "It is said that societies have a purpose, but that is not correct from an epistemological point of view. ", "When a society “makes” a decision, what really happens is that its individuals make a decision, and by previous agreement, by some kind of “method” the collective expression of all individuals involved becomes decision.", "\n\nBut since individuals DO have an emotional, irrational side, when they decide, we must take this aspect into account simultaneously, when analyzing any social event. ", "For the individuals obviously have a total influence in the final outcome.", "\n\nThis must be well known by sociologists, and definitely even more by those sociologists who work for those who need forecasts and visions of what a society would do, how would it react, under certain circumstances.", "\n\nWhat this means is that if someone puts his/her aims at the beginning and wants to achieve it, he/she will try to drive individuals in order to assure that they will respond as expected. ", "When we are rational we are unpredictable. ", "When emotional, on the contrary, highly predictable. ", "Therefore, we have to make huge efforts as individuals, to maintain the spiritual, emotional and affectionate side of our beings out of social events, where a decision is being required from us, i.e.: Democracy and voting.", "\n\nExpress feelings in any sport match is fine, it’s good for you, and irrelevant for society.", "\n\n2 Responses to “Faith”\n\n>> It’s impossible to speak about faith in Society, since there is no subject, but crowds.", "\n\nActually, I think it does make sense to talk about Society as an organism — one in which we can have faith, or not.", "\n\nYou said a society is nothing but crowds of people. ", "I reply that the brain is nothing but crowds of neurons.", "\n\nJust as neurons are organized into brains that have personalities, so people organize themselves into societies that have character. ", "We can have faith in a person, or not, and we can have faith in a society, or not.", "\n\nWell, I find it really interesting and challenging to apply individual models or biological models to a “large scale organism”, like societies.", "\n\nI usually get puzzled when I read very educated people express their admiration on how Nature “designs” perfection in species, in environments, etc., ", "when Nature actually does not have any intention or purpose at all (obviously, from my point of view).", "\n\nIn a similar type of approach, I still find difficult to understand that a Society has a “will”, a purpose, an intention, although there will always be an outcome, a result.", "\n\nBut my point is not if we can have faith in society (which we obviously can or cannot) it’s more the other way round: if Societies can “have” faith, hope, experience happiness, as a whole." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.058823529411764705, 0, 0, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008620689655172414, 0, 0, 0, 0, 0, 0, 0, 0.00980392156862745, 0.005714285714285714, 0 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a hydraulic control device for an automatic transmission for a vehicle such as an automobile, and more particularly, to a hydraulic control device for such an automatic transmission having two parallelly arranged input clutches which are selectively engaged or disengaged in providing a plurality of speed stages.", "\n2. ", "Descriptions of the Prior Art\nThe hydraulically operated automatic transmission for a vehicle such as an automobile generally includes a hydraulically operated input clutch which is sometimes called a forward clutch and which, when engaged, connects the speed stage shifting gear mechanism of the transmission to a rotational power input member therefor which is generally a rotational output member of the fluid torque converter forming an power inlet portion of the automatic transmission. ", "Such a forward clutch is engaged to provide all forward speed stages available by the transmission by a hydraulic pressure supplied thereto under the control of the manual shift valve when it is shifted to any one of forward drive ranges such as the so-called D range, S range, and L range. ", "The manually operated shift valve generally never fails to provide a hydraulic pressure to the forward clutch when it is shifted to either one of the forward drive ranges. ", "Therefore, it is generally improbable that the vehicle equipped with such a hydraulically operated automatic transmission is disabled to drive forward due to non engagement of the forward clutch.", "\nIn Japanese Patent Application No. ", "62-195471 filed on Aug. 5, 1987 and laid open to public on Feb. 13, 1989, two of the inventors of the present invention have proposed an automatic transmission for a vehicle such as an automobile in which a speed stage shifting mechanism includes two parallel arranged input clutches and is adapted so that a first one of the two input clutches is engaged when it provides a first speed stage, a second speed stage and a third speed stage, whereas a second one of the two input clutches is engaged when it provides the third speed stage and a fourth speed stage. ", "Therefore, with regard to the two input clutches there exist three conditions for forward driving of the vehicle that the first clutch only is engaged, the first and the second clutch are both engaged, and the second clutch only is engaged. ", "In other words, the switching over of the two clutches is not an alternative selection. ", "In order to operate such a transmission mechanism automatically, provided that the clutches are of a hydraulically operable type, normally at least two automatically operable hydraulic pressure switching over valves would be required.", "\nOn the other hand, when a certain friction engaging means such as a brake incorporated in the automatic transmission is adapted to be engaged in a certain speed stage such as the fourth speed stage under a certain vehicle operating condition such as normal engine driving and further to be engaged in another speed stage different more than one speed stage from said certain speed stage such as the second speed stage under another vehicle operating condition such as engine braking, the switching over of supply and exhaust of hydraulic pressure to and from said certain friction engaging means would not be available by a certain shift valve which switches over speed stages between said certain speed stage such as the fourth speed stage and a speed stage directly adjacent said certain speed stage such as the third speed stage or another certain valve which switches over speed stages between said another speed stage such as the second speed stage and a speed stage directly adjacent said another speed stage such as the third speed stage." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0, 0, 0 ]

[ "Q:\n\nAndroid: negative coordinates in ViewGroup and touch rectangles\n\nI come from an ActionScript/Flash/AIR background and I'm new to the Android View hierarchy. ", "Given that, I found something very odd about ViewGroup and it's coordinate system.", "\nLet's say we have the following parent/child relationship inside the main Activity View which extends RelativeView (or basically some group layout that allows absolute coordinates and scale):\ncircle1 = new ImageView(context);\ncircle1.setImageBitmap(...);\ncircle2 = new ImageView(context);\ncircle2.setImageBitmap(...);\ncont = new RelativeView(context);\n\ncont.addView(circle1);\ncont.addView(circle2);\nthis.addView(cont);\n\nThe idea is to create a container which is centered on the main view and to center two circles inside of the container. ", "This allows the container to be animated, grouping the two circles.", "\ncont.setX(getWidth() / 2);\ncont.setY(getHeight() / 2);\ncircle1.setX(-circle1.getWidth() / 2);\ncircle1.setY(-circle1.getHeight() / 2);\ncircle2.setX(-circle2.getWidth() / 2);\ncircle2.setY(-circle2.getHeight() / 2);\n\nDoing negative coordinates inside a ViewGroup, I immediately noticed that 'cont' clips them at the [0, 0] coordinate and cont.setClipChildren(false); has to be called. ", "I'm guessing this is a bad idea, because it looks like a optimization for the invalidate() area. ", "After disabling the clipping, the result renders as expected, but there is another problem:\nillustration\nAdding a touch event listener to circle2 returns a bogus touch rectangle (marked in purple) instead of the expected one (marked in cyan) which should be staring at the negative [X, Y] offset of circle2. ", "The resulting rectangle starts at [0, 0] of 'cont' and ends at [circle2X + circle2W, circle2Y + circle2H] as if it's clipped at [0, 0] of 'cont'.", "\nI know that you can solve the issue by not using negative coordinates, but that's not really a good solution if you are porting from ActionScript where negative coordinates make perfect sense (as in any real world coordinate system) and touch rectangles are calculated correctly in the DisplayObjectContainer class.", "\nSo what other solutions are there?", "\n\nShould a custom ViewGroup class be created and what has to be done there?", "\nIs there a magical setting which can allow touch rectangles of children Views not to be clipped at [0, 0] of the parent ViewGroup?", "\nSomething else?", "\n\nThanks.", "\n\nA:\n\nYou can use View#scrollTo to move the origin so that your content is shown entirely within the View's bounding rect.", "\nMany things in the Android UI toolkit rely on the measured and laid out bounds of Views being accurate. ", "In general you don't want to go against the grain here.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.012422360248447204, 0.012195121951219513, 0.0018484288354898336, 0, 0.0026109660574412533, 0, 0, 0, 0.006329113924050633, 0, 0.013333333333333334, 0.015267175572519083, 0, 0, 0.00819672131147541, 0.01904761904761905, 0, 0 ]

[ "Soccer United Marketing president Kathy Carter has confirmed to ESPN FC that she is exploring a run for the presidency of the U.S. Soccer Federation.", "\n\nSI.com's Grant Wahl first tweeted the possibility that Carter will run. ", "One source told ESPN FC that Carter is in \"the final stages\" of formalizing her bid, and put her chances of running at \"95 percent.\" ", "The source added that Carter, whose position has her helping to run the marketing arm of MLS, has gone so far as to hire an outside agency separate from SUM and MLS to handle the logistics of her campaign, and could make an announcement in the next 48 hours.", "\n\nMultiple sources indicated that if Carter does run, it's a strong indicator that current USSF president Sunil Gulati will decide not to seek re-election. ", "One source indicated that Carter is running at the urging of Gulati and MLS commissioner Don Garber.", "\n\nCarter was more circumspect, and issued a statement indicating she hasn't made a final decision.", "\n\n\"I am exploring a run for President of the United States Soccer Federation because soccer can and should become the leading sport in America, and I believe I could help make that vision a reality,\" Carter said in a statement via email.", "\n\n\"The game of soccer has been a consistent thread through every aspect of my life. ", "I have spent over 40 years as a player, executive and fan of the beautiful game. ", "Going forward, our growth and advancement as a sport requires excellence at every level -- from our youth and adult programs to our professional leagues and our national teams.\"", "\n\nShould Carter formally announce her intentions to run, she would be the only woman in a crowded field that includes former U.S. international Paul Caligiuri, current USSF vice president Carlos Cordeiro, Boston-based attorney Steve Gans, Springfield, Mass.-based businessman and soccer entrepreneur Paul Lapointe, former player and current broadcaster Kyle Martino, New York-based attorney Mike Winograd, and former U.S. international and current broadcaster Eric Wynalda.", "\n\nIf Kathy Carter runs for USSF president, sources say Sunil Gulati would almost certainly not seek re-election. ", "Getty Images\n\n\"Should I decide to run, I will first look to engage the federation's many stakeholders as part of the process,\" she said. \"", "I believe we need new ideas and I look forward to listening to fresh perspectives on how to advance our game. ", "The federation and our sport is primed for greatness and I will enter the race if I believe I can help to deliver results for the Federation's members, players, and fans.\"", "\n\nCarter has a long career on the business side of the game, having served as a vice president for Anschutz Entertainment Group, who own the Los Angeles Galaxy. ", "Carter has also worked in an executive capacity for Envision, as well as ISL United States, a subsidiary of the company that at one point did business with FIFA, the International Olympic Committee, and the International Association of Athletics Federations.", "\n\nISL went bankrupt in 2001 amid hundreds of millions of dollars of debt, and was later found to have paid bribes to leading soccer figures, including former FIFA president Joao Havelange and then-FIFA Executive Committee member Ricardo Teixeira. ", "Carter wasn't implicated in any of the corrupt activity.", "\n\nCarter also served as MLS' vice president of corporate marketing, from the league's inception until late 1999. ", "She also worked on the organizing committee for the 1994 World Cup. ", "Carter also has experience on the playing side of the game, having played collegiately as a goalkeeper at William & Mary.", "\n\nWhile Carter's resume is extensive, she will run into resistance from some segments of the USSF's voting membership that view her tenure at SUM as problematic. ", "The failure of the U.S. men's national team to qualify for the 2018 World Cup has led many to call for a break from the leadership of Gulati, and Carter will be seen by some quarters as representing the status quo.", "\n\nThe issue of the conflict of interest between MLS, SUM, and the USSF -- which has a deep business relationship with SUM -- will also draw fire from opponents. ", "One source characterized her candidacy as a \"Hail Mary\" on the part of Gulati and Garber to have a preferred candidate in the field. ", "There are less than 10 days remaining until the filing deadline for candidates on Dec. 12.", "\n\nThat said, her experience on the business side of the game is impressive, and she would add some diversity to an organization that is still male-dominated.", "\n\nThe developments in the USSF presidential election campaign come ahead of a meeting of the USSF Board of Directors on Dec. 10 in Toronto following the MLS Cup. ", "Multiple sources have told ESPN FC that among the items on the agenda is a set of policy changes that would alter the future role of the USSF president.", "\n\nGulati has been criticized in the past for having too much power over decisions such as the selection of national team coaches. ", "The changes, if approved, would see the president become more of a Chairman of the Board type of position that would be more collaborative in nature, especially as it relates to the hiring of national team coaches." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.026845637583892617, 0.02702702702702703, 0.015037593984962405, 0.015503875968992248, 0.01282051282051282, 0.03, 0.01020408163265306, 0.004219409282700422, 0, 0, 0, 0.016913319238900635, 0.017699115044247787, 0.007246376811594203, 0, 0, 0.018633540372670808, 0.01937984496124031, 0.012145748987854251, 0.017857142857142856, 0.017699115044247787, 0, 0.01652892561983471, 0.012345679012345678, 0.004672897196261682, 0.018633540372670808, 0, 0, 0, 0.006172839506172839, 0.006578947368421052, 0, 0.004672897196261682 ]

[ "All relevant data are within the manuscript and its Supporting Information files.", "\n\nIntroduction {#sec001}\n============\n\nEnterovirus 71 (EV71) is an RNA virus that causes hand-foot-mouth disease (HFMD), commonly causing mild symptom in infants, but in some cases also leading to severe diseases such as aseptic meningitis (AM), brain stem encephalitis (BSE), acute flaccid paralysis (AFP), and even fatal encephalitis in neonates \\[[@ppat.1008142.ref001]--[@ppat.1008142.ref004]\\]. ", "As a neurotropic virus, the emerging EV71-related outbreaks have been the subject of great public health concern and are responsible for increased neurovirulence and mortality in the Asian-Pacific region \\[[@ppat.1008142.ref005], [@ppat.1008142.ref006]\\]. ", "In HFMD epidemics in China from 2008 to 2012, more than 90% of deaths were associated with EV71 \\[[@ppat.1008142.ref007],[@ppat.1008142.ref008]\\]. ", "EV71 is thought to cause serious neurological disease with distinct clinicoradiological syndromes in affected patients, resulting in higher paresis-related morbidity in the gray matter of the brainstem or spinal cord \\[[@ppat.1008142.ref009]\\]. ", "However, the exact pathogenesis of EV71 infections, especially in cases where they cause severe neurological symptoms, remains poorly understood.", "\n\nToll-like receptor 7 (TLR7) is widely expressed in immune cells, intestinal cells, lung cells, and neural cells. ", "As a pattern-recognition receptor (PRR), TLR7 can recognize viral RNA, oligomeric RNA, short interfering RNA (siRNA), and microRNA (miRNA) from pathogenic sources to activate intracellular signaling pathways and release appropriate cytokines \\[[@ppat.1008142.ref010]--[@ppat.1008142.ref012]\\]. ", "Emerging evidence suggests that beyond its function as an immune receptor in immune cells, TLR7 also serves as a death receptor in various forms of non-infectious central nervous system (CNS) injury, such as ischemic stroke, Alzheimer's disease, and morphine-mediated neurodegeneration \\[[@ppat.1008142.ref011], [@ppat.1008142.ref013], [@ppat.1008142.ref014]\\].", "\n\nIn infectious contexts, TLR7 plays multiple roles relevant to neurological disorders and inflammatory responses in the CNS. ", "When simian immunodeficiency virus (SIV) infects the brains of rhesus macaques, the secretion of microRNA21 activates the TLR7 pathway, leading to neurological disease \\[[@ppat.1008142.ref012]\\]. ", "Japanese encephalitis virus (JEV) infection elicits an elevation of inflammatory cytokine expression through TLR7 signaling to cause neuroinflammation \\[[@ppat.1008142.ref015]\\]. ", "Meningitis caused by Toscana virus (TOSV) is associated with a strong TLR7-mediated antiviral response in the CNS \\[[@ppat.1008142.ref016]\\]. ", "Upon EV71 infection, TLR7 usually acts as an inflammatory response modulator in intestinal epithelial cells and immune cells \\[[@ppat.1008142.ref017]--[@ppat.1008142.ref020]\\]. ", "It remains unclear as to what role is played by TLR7 in the brain following EV71 infection, and the molecular mechanisms by which TLR7-mediates viral neural pathogenesis remain unclear.", "\n\nIn this study, we conducted experimental intracranial infections with EV71 in neonatal mice, and found a non-significant viral load in the cerebral cortex of both wild-type (WT) and TLR7 knockout (TLR7^-/-^) mice. ", "Compared with EV71-infected WT mice, there was an obvious alleviation of neurological injury-related symptoms, histopathologic damage, and cell apoptosis, as well as lower brain IL-6 levels in EV71-infected TLR7^-/-^ mice. ", "Further investigations revealed that intracranial IL-6 neutralization significantly relieved neurological injury-related symptoms and neural cell apoptosis in the brains of EV71-infected WT mice. ", "Moreover, we demonstrated that EV71 preferentially infected and induced IL-6 production in murine brain astrocytes, and we further verified that TLR7 silencing and IL-6 blockade attenuated EV71-infected cell apoptosis *in vitro*. ", "Finally, we retrospectively found TLR7 upregulation, IL-6 induction and astrocytic cell apoptosis in EV71-infected human brain. ", "Thus, we identified a novel mechanism underlying TLR7-mediated neural pathogenesis involved in IL-6 induction in astrocytes of the brain upon EV71 infection.", "\n\nResults {#sec002}\n=======\n\nThe evaluation of EV71-induced neuropathogenesis after intracranial injection in mice {#sec003}\n-------------------------------------------------------------------------------------\n\nNumerous animal models have been developed to study the pathogenesis upon EV71 infection, and the intracranial infection in suckling mice is established as an appropriate animal model to better understand EV71-associated neuropathogenesis \\[[@ppat.1008142.ref004]\\]. ", "To assess whether EV71 infection in mice brain caused neuropathogenesis, 3-day-old suckling WT mice were intracranially injected with PBS, UV-inactivated EV71 (EV71-UV), Heated-inactivated EV71 (EV71-Heated), and EV71. ", "We found that EV71 robustly replicated on day 1 post-infection, and then declined from day 3 to 5 post-infection in the cerebral cortex tissues of EV71-infected mice, but not in mock-infected, UV-, or Heated-inactivated EV71-infected mice ([Fig 1A](#ppat.1008142.g001){ref-type=\"fig\"} and [S1A Fig](#ppat.1008142.s001){ref-type=\"supplementary-material\"}). ", "We also observed a relatively low-level of EV71 replication in the cerebellum of EV71-infected mice ([Fig 1B](#ppat.1008142.g001){ref-type=\"fig\"} and [S1B Fig](#ppat.1008142.s001){ref-type=\"supplementary-material\"}).", "\n\n{#ppat.1008142.g001}\n\nThe neuropathogenesis induced by neurotropic viruses including Zika virus (ZIKV) and Japanese encephalitis virus (JEV) is generally associated with neural cell apoptosis \\[[@ppat.1008142.ref021],[@ppat.1008142.ref022]\\]. ", "We further assessed the neural cell apoptosis induced by EV71 infection. ", "On day 1 post-infection, the Caspase-3 cleavage (cl-Caspase-3) (activated apoptosis), and EV71 dsRNA were obviously detected in the cerebral cortex tissues of EV71-infected mice, but not in mock-infected, EV71-heated-infected, or EV71-UV-infected mice ([Fig 1C and 1D](#ppat.1008142.g001){ref-type=\"fig\"}). ", "In addition, dsRNA had an obvious reduction from 3 days ([S1C and S1D Fig](#ppat.1008142.s001){ref-type=\"supplementary-material\"}) to 5 days ([S1E and S1F Fig](#ppat.1008142.s001){ref-type=\"supplementary-material\"}) post-infection, but cl-Caspase 3 became slightly higher from 3 days ([S1C and S1D Fig](#ppat.1008142.s001){ref-type=\"supplementary-material\"}) to 5 days ([S1E and S1F Fig](#ppat.1008142.s001){ref-type=\"supplementary-material\"}) post-infection. ", "However, compared with the cerebral cortex of EV71-infected mice, we found a lower level of cl-Caspase-3 and dsRNA in the cerebellum of EV71-infected mice on day 1 post-infection ([Fig 1E and 1F](#ppat.1008142.g001){ref-type=\"fig\"}) and similar observations were obtained on day 3 ([S2A and S2B Fig](#ppat.1008142.s002){ref-type=\"supplementary-material\"}) and day 5 ([S2C and S2D Fig](#ppat.1008142.s002){ref-type=\"supplementary-material\"}) post-infection. ", "Thus, these results reveal that EV71 robustly replicates and induces cell apoptosis in the cerebral cortex of EV71-infected mice, but exhibits relatively low levels of viral replication and cell apoptosis in the cerebellum of EV71-infected mice in the intracranial injection model.", "\n\n*TLR7* is deleted in the brain tissues of *TLR7*^-/-^ mice {#sec004}\n----------------------------------------------------------\n\nOur previous work has identified that TLR7 orchestrates the inflammatory and innate immune responses upon EV71 infection in macrophages \\[[@ppat.1008142.ref019]\\]. ", "This study further sought to determine whether TLR7 plays a role in EV71-infected neuropathogenesis *in vivo* utilizing a TLR7 knock-out (TLR7^-/-^) mouse model. ", "Initially, the genetic characteristics of the *TLR7* gene in brain tissues were determined. ", "By assessing the *TLR7* gene ([Fig 2A](#ppat.1008142.g002){ref-type=\"fig\"}), we systematically determined that *TLR7* DNA sequences ([Fig 2B](#ppat.1008142.g002){ref-type=\"fig\"}), *TLR7* mRNA expression ([Fig 2C](#ppat.1008142.g002){ref-type=\"fig\"}), and TLR7 protein production ([Fig 2D](#ppat.1008142.g002){ref-type=\"fig\"}) were present in the brain tissues of WT mice, whereas they were not detected in the brains of TLR7^-/-^ mice. ", "Similarly, immunohistochemistry (IHC) staining indicated that TLR7 protein was present in the cerebral cortex of WT mice, whereas it was not produced in the cerebral cortex of TLR7^-/-^ mice ([Fig 2E](#ppat.1008142.g002){ref-type=\"fig\"}). ", "Thus, these results confirm that the *TLR7* gene was successfully deleted in the brain tissues of homozygous TLR7^-/-^ mice. ", "Of note, there were no visible differences in behavior and growth between WT neonatal mice and TLR7^-/-^ neonatal mice ([Fig 2F](#ppat.1008142.g002){ref-type=\"fig\"}).", "\n\n{#ppat.1008142.g002}\n\nTLR7 promotes EV71-induced neural pathogenesis in the murine cerebral cortex {#sec005}\n----------------------------------------------------------------------------\n\nThe effects of TLR7 on EV71 infection-induced neuropathogenesis were then evaluated in WT and TLR7^-/-^ mice. ", "Three-day-old neonatal mice were intracranially injected with or without EV71, in accordance with a previously established intracranial infection model for assessing EV71 neurovirulence \\[[@ppat.1008142.ref004]\\]. ", "As compared with EV71-infected TLR7^-/-^ mice, infected WT mice exhibited significantly greater loss of body weight ([Fig 3A](#ppat.1008142.g003){ref-type=\"fig\"}), higher clinical scores (consistent with hind-limb paralysis) ([Fig 3B](#ppat.1008142.g003){ref-type=\"fig\"}), and lower survival rates ([Fig 3C](#ppat.1008142.g003){ref-type=\"fig\"}), suggesting that TLR7 is involved in promoting EV71-induced neurovirulence in mice.", "\n\n{#ppat.1008142.g003}\n\nNext, the role of TLR7 in regulating EV71 replication in the murine brains was verified. ", "Notably, there was no significant difference in EV71 load in the brain tissues of WT and TLR7^-/-^ mice ([Fig 3D and 3E](#ppat.1008142.g003){ref-type=\"fig\"}). ", "We found that the PFU value of EV71 was robustly high from day 2 to 3 post-infection, and then declined from day 5 to 7 post-infection in the brain tissues of both infected WT and TLR7^-/-^ mice ([Fig 3D](#ppat.1008142.g003){ref-type=\"fig\"}). ", "Similar results were observed that the no significant difference in EV71 RNA levels in the brain tissues of WT and TLR7^-/-^ mice ([Fig 3E](#ppat.1008142.g003){ref-type=\"fig\"}). ", "Parallel IHC staining for the EV71 VP1 protein revealed that VP1 was produced in the cerebral cortex, and that there was no significant difference in VP1 levels between WT and TLR7^-/-^ mice ([S3A Fig](#ppat.1008142.s003){ref-type=\"supplementary-material\"}), whereas the viral protein was a relatively low-level expressed in the cerebellum ([S3B Fig](#ppat.1008142.s003){ref-type=\"supplementary-material\"}). ", "Additional IHC staining with an antibody against EV71 dsRNA demonstrated that EV71 dsRNA was present with no significant difference in the cerebral cortex of both WT and TLR7^-/-^ mice ([Fig 3F](#ppat.1008142.g003){ref-type=\"fig\"}). ", "These results suggest that TLR7 does not play an antiviral role in the brain upon EV71 infection.", "\n\nTo further explore the role of TLR7 in neuropathogenesis induced upon EV71 infection, we analyzed the expression status of neurofilament protein. ", "These 10-nm intermediate filaments of neurons provide structure and mechanoresistance in the brain, and disruption of neurofilament organization and expression is a characteristic of certain neurological disorders \\[[@ppat.1008142.ref011], [@ppat.1008142.ref023]\\]. ", "Here, we examined the effect of TLR7 on neurofilament organization and expression upon EV71 infection via immunohistochemical analysis of the cerebral cortex on Day 3 and 5 after EV71 infection in WT and TLR7^-/-^ mice with neurofilament staining. ", "Fluorescence microscopy showed that in PBS-treated mice, neurofilament integrity was intact in the cortexes of both WT and TLR7^-/-^ mice, whereas upon EV71 infection, the integrity of neurofilaments was disrupted and the levels of neurofilaments were reduced with the progressive viral infection in the cortex of EV71-infected WT mice relative to TLR7^-/-^ mice ([Fig 3G](#ppat.1008142.g003){ref-type=\"fig\"}), indicating that TLR7 plays a critical role in facilitating EV71-induced neurodegeneration and neuropathogenesis. ", "Taken together, our results illustrate that TLR7 facilitates EV71-induced neuropathogenesis in the cerebral cortex in mice.", "\n\nTLR7 is required for EV71-induced neural cell apoptosis in the brain {#sec006}\n--------------------------------------------------------------------\n\nConsidering the neuropathogenesis induced by EV71 is generally associated with neural cell apoptosis, we further assessed the role of TLR7 in regulating neural cell apoptosis induced by EV71 infection. ", "WT mice and TLR7^-/-^ mice were treated with PBS or infected with EV71 for 3 and 5 days, and then rates of cellular apoptosis and neuropathogenesis were assessed in cortex samples. ", "Histopathological assessments revealed that typical inflammatory cell infiltration and neurodegeneration were evident in the cerebral cortex of infected WT mice, but were largely absent in the cerebral cortex of infected TLR7^-/-^ mice ([Fig 4A](#ppat.1008142.g004){ref-type=\"fig\"}), indicating that TLR7 plays a role in neural injury and neurodegeneration upon EV71 infection.", "\n\n{#ppat.1008142.g004}\n\nIt has been reported that the neuroinflammatory response is an important indicator of neural injury \\[[@ppat.1008142.ref024]\\]. ", "We next sought to assess the role of TLR7 in regulating expression of pro-inflammatory cytokines, including interleukin-1β (IL-1β), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), and C-X-C motif chemokine 1 (Cxcl-1) upon EV71 infection. ", "Our results revealed that *IL-1β* mRNA level was higher in the infected cerebral cortex of WT mice on 3 days post-infection as compared with infected TLR7^-/-^ mice ([Fig 4B](#ppat.1008142.g004){ref-type=\"fig\"}). ", "Notably, *IL-6* mRNA was induced in the cerebral cortex of infected WT mice on 3 and 5 day post-infection, whereas it only slightly induced in the cortex of infected TLR7^-/-^ mice ([Fig 4A](#ppat.1008142.g004){ref-type=\"fig\"}). ", "In addition, there were no differences in the levels of *TNF-α* or *CXCL-1* mRNA between EV71-infected WT and TLR7^-/-^ cerebral cortex samples ([Fig 4B](#ppat.1008142.g004){ref-type=\"fig\"}). ", "Moreover, IHC staining using an antibody against endogenous IL-6 revealed that IL-6 protein production was induced in the cerebral cortex of infected WT mice, whereas it was only slightly induced in the cerebral cortex of infected TLR7^-/-^ mice ([Fig 4C](#ppat.1008142.g004){ref-type=\"fig\"}). ", "Taken together, these results suggest that IL-6 is induced by EV71 and plays a primary role in the neuropathogenesis in mice induced upon EV71 infection.", "\n\nAdditionally, the role of TLR7 in regulating Caspase-3 cleavage was assessed. ", "IHC staining revealed that cleaved-Caspase-3 (cl-Caspase-3) was barely detected in the cerebral cortex of both mock-infected WT and TLR7^-/-^ mice ([Fig 4D](#ppat.1008142.g004){ref-type=\"fig\"}, left); whereas upon EV71 infection, cl-Caspase-3 protein was induced and the level of cl-Caspase-3 was much higher in cerebral cortex of infected WT mice as compared with that in infected TLR7^-/-^ mice ([Fig 4D](#ppat.1008142.g004){ref-type=\"fig\"}, right). ", "Similarly, Western blotting further confirmed that cl-Caspase-3 was largely absent in cerebral cortex of both mock-infected WT and TLR7^-/-^ mice, whereas upon EV71 infection, cl-Caspase-3 protein was induced and the levels of cl-Caspase-3 were enhanced in infected WT mice relative to infected TLR7^-/-^ mice ([Fig 4E](#ppat.1008142.g004){ref-type=\"fig\"}). ", "These data suggest that TLR7 is required for cell apoptosis in the cerebral cortex of mice upon EV71 infection. ", "Furthermore, TUNNEL staining indicated that cell apoptosis was largely absent in brain sections of mock-infected WT mice and TLR7^-/-^ mice ([Fig 4F](#ppat.1008142.g004){ref-type=\"fig\"}, left); however, upon EV71 infection, cell apoptosis was apparent in brain sections of both WT and TLR7^-/-^ mice, with the level of apoptosis being higher in infected WT mouse brain sections relative to infected TLR7^-/-^ mice brain sections ([Fig 4F](#ppat.1008142.g004){ref-type=\"fig\"}, right), further suggesting that TLR7 is involved in mediating apoptotic cell death in the brain upon EV71 infection.", "\n\nGiven that in apoptosis-related pathways, specific sets of genes function as apoptotic initiators, apoptosis effectors, and anti-apoptotic factors in senescent or damaged cells \\[[@ppat.1008142.ref025]\\], we next thought to establish the role of TLR7 in regulating the expression of 18 apoptosis-related genes in the brain tissues of WT and TLR7^-/-^ mice with or without EV71 infection ([Table 1](#ppat.1008142.t001){ref-type=\"table\"}). ", "Our results revealed that the apoptotic initiators p53 upregulated modulator of apoptosis (Puma), BCL-2 interacting mediator of cell death (Bim, also known as Bcl2L11), BH3 interacting domain death agonist (Bid), and BCL2-associated agonist of cell death (Bad) were up-regulated in EV71-infected WT mouse brain tissues, whereas the anti-apoptotic factors B-cell lymphoma-2 (Bcl-2), B-cell lymphoma-extra large (Bcl-XL), and BCL-2 like 2 (Bcl-W) were down-regulated in these same samples ([Fig 4G](#ppat.1008142.g004){ref-type=\"fig\"}). ", "We also found that the altered regulation of these genes was markedly attenuated in infected TLR7^-/-^ mice brain tissues relative to those from WT mice ([Fig 4F](#ppat.1008142.g004){ref-type=\"fig\"}). ", "These results suggest that TLR7 facilitates the activation of apoptotic initiators and the repression of anti-apoptotic factors. ", "Taken together, our results reveal that TLR7 is required for neural cell apoptosis in the murine brain upon EV71 infection.", "\n\n10.1371/journal.ppat.1008142.t001\n\n###### List of apoptosis-associated genes information in this study.", "\n\n![](", "ppat.1008142.t001){#ppat.1008142.t001g}\n\n Gene Name Description Category\n ----------- ------------------------------------------------------------------ --------------------------\n PUMA p53 upregulated modulator of apoptosis, BCL2 binding component 3 Pro-apoptotic initiators\n BIM BCL-2 interacting mediator of cell death, BCL2 like 11 \n BID BH3 interacting domain death agonist \n BAD BCL2 associated agonist of cell death BCL2/MCL1 inhibitors\n NOXA Phorbol-12-myristate-13-acetate-induced protein 1 \n BAX BCL2 associated X, apoptosis regulator Apoptosis effectors\n BAK BCL2 antagonist/killer 1 \n CytC Cytochrome c, somatic \n SMAC Diablo IAP-binding mitochondrial protein \n XIAP X-linked inhibitor of apoptosis \n APAF1 Death-associated APAF1-related killer \n BCL-2 B-cell lymphoma-2, apoptosis regulator Anti-apoptotic factors\n BCL-XL B-cell lymphoma-extra large, BCL-2 like 1 \n BCL-W B-cell lymphoma-W, BCL-2 like 2 \n MCL1 MCL1 apoptosis regulator, BCL2 family member \n Caspase-3 Cysteine-aspartic acid protease-3 Caspase cascade\n Caspase-7 Cysteine-aspartic acid protease-7 \n Caspase-9 Cysteine-aspartic acid protease-9 \n\nIL-6 plays a crucial role in TLR7-mediated neural pathogenesis upon EV71 infection {#sec007}\n----------------------------------------------------------------------------------\n\nIn immune cells, EV71 activates TLR7 signaling to induce the production of multiple inflammatory cytokines, including IL-6 \\[[@ppat.1008142.ref019]\\]. ", "Elevated levels of hippocampal IL-6 are thought to be related to neurodegeneration in the early stages of Alzheimer's disease \\[[@ppat.1008142.ref026]\\]. ", "As TLR7 mediated IL-6 expression and cell apoptosis in the cerebral cortex of EV71-infected mice, we further assessed the role of IL-6 in TLR7-mediated neuropathogenesis upon EV71 infection. ", "Neonatal WT mice were intracranially injected with EV71 and then treated with isotype IgG (IgG) or anti-IL-6 antibody (IL-6-Ab) ([Fig 5A](#ppat.1008142.g005){ref-type=\"fig\"}). ", "Remarkably, upon EV71 infection, the body size of IgG-treated mice was significantly reduced, whereas the body size of IL-6-Ab-treated mice was only slightly reduced relative to uninfected controls ([Fig 5B](#ppat.1008142.g005){ref-type=\"fig\"}). ", "We further found that upon EV71 infection, IgG-treated mice displayed significantly lower body weight ([Fig 5C](#ppat.1008142.g005){ref-type=\"fig\"}), exhibited much higher clinical scores ([Fig 5D](#ppat.1008142.g005){ref-type=\"fig\"}), and had lower survival rates ([Fig 5E](#ppat.1008142.g005){ref-type=\"fig\"}), than did IL-6-Ab-treated mice ([Fig 5C--5E](#ppat.1008142.g005){ref-type=\"fig\"}).", "\n\n{#ppat.1008142.g005}\n\nDue to some specific secreted proteins and peptides entering to the cerebrospinal fluid (CSF) and blood circulation \\[[@ppat.1008142.ref027]\\], the IL-6 protein level and EV71 viral load in CNS and peripheral tissues after IL-6 antibody neutralizing administration was assessed. ", "As expected, IL-6 protein levels were significantly reduced by IL-6-Ab neutralization in the cerebral cortex ([S4A Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}), cerebellum tissues ([S4B Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}), as well as CSF ([S4C Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}) of both mock-infected or EV71-infected mice. ", "However, IL-6 protein level didn't change in peripheral blood ([S4D Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}) of both mock-infected or EV71-infected mice after IL-6-Ab neutralization. ", "Moreover, there was no significant difference in virus titers in the cerebral cortex ([S4E Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}), cerebellum tissues ([S4F Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}), as well as CSF ([S4G Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}) of IgG-treated and IL-6-Ab-treated EV71-infected mice. ", "Notably, EV71 virus was not detected in the peripheral blood of EV71-infected mice ([S4H Fig](#ppat.1008142.s004){ref-type=\"supplementary-material\"}). ", "The similar results were also observed in the tissues of cerebral cortex ([S5A and S5B Fig](#ppat.1008142.s005){ref-type=\"supplementary-material\"}) and cerebellum tissues ([S5C and S5D Fig](#ppat.1008142.s005){ref-type=\"supplementary-material\"}) of different groups of mice. ", "In addition, there was a low level of IL-6 protein and EV71 load in spinal cord ([S6A and S6B Fig](#ppat.1008142.s006){ref-type=\"supplementary-material\"}), while their expressions were barely detected in skeletal muscle ([S6C and S6D Fig](#ppat.1008142.s006){ref-type=\"supplementary-material\"}) of EV71-infected mice. ", "These results revealed that EV71-induced IL-6 induction could be reduced, whereas EV71 viral load was not affected after IL-6-Ab neutralization in mice brain, suggesting that IL-6 blockade mediated protection is independent of the virus load.", "\n\nMoreover, immunohistochemical staining for neurofilaments revealed that in mock-infected mice, the integrity of neurofilaments was intact in the cerebral cortex of both IgG-treated and IL-6-Ab-treated mice, whereas upon EV71 infection, the integrity of neurofilaments was disrupted and neurofilament levels were reduced with the progressive viral replication in the cerebral cortex of IgG-treated mice relative to those treated with IL-6-Ab ([Fig 5F](#ppat.1008142.g005){ref-type=\"fig\"}). ", "These results suggest that IL-6 plays a role in promoting EV71-induced neurodegeneration and neuropathogenesis in mice.", "\n\nNext, the effects of IL-6 on EV71-induced cell apoptosis were assessed. ", "TUNNEL staining revealed that in mock-infected mice, cell apoptosis was barely detectable in the cerebral cortex of IgG-treated and IL-6-Ab treated mice ([Fig 5G](#ppat.1008142.g005){ref-type=\"fig\"}, left). ", "However, upon EV71 infection, cell apoptosis occurred in the cerebral cortex of both IgG-treated and IL-6-Ab treated mice, while the level of cell apoptosis was higher in the cerebral cortex of IgG-treated mice as compared with IL-6-Ab treated mice ([Fig 5G](#ppat.1008142.g005){ref-type=\"fig\"}, right), suggesting that IL-6 promotes EV71-induced cell apoptosis in the cerebral cortex. ", "Parallel IHC staining revealed that cl-Caspase-3 levels were largely undetectable in brain sections of both IgG-treated and IL-6-Ab treated mice ([Fig 5H](#ppat.1008142.g005){ref-type=\"fig\"}, left), whereas upon EV71 infection, cl-Caspase-3 was induced and the level of cl-Caspase-3 was higher in the brain sections of IgG-treated mice as compared with those in IL-6-Ab treated mice ([Fig 5H](#ppat.1008142.g005){ref-type=\"fig\"}, right). ", "Consistent with these findings, Western blotting revealed a lack of cl-Caspase-3 in brain samples from mock-infected IgG- and IL-6-Ab treated mice, whereas upon EV71 infection, cl-Caspase-3 was induced in the brain sections of both IgG-treated and IL-6-Ab treated mice, and the levels of cl-Caspase-3 were higher in the brain sections of IgG-treated mice as compared with those in IL-6-Ab treated mice ([Fig 5I](#ppat.1008142.g005){ref-type=\"fig\"}). ", "Thus, these data revealed that IL-6 plays a dominant role in TLR7-mediated neuropathogenesis upon EV71 infection *in vivo*.", "\n\nEV71 preferentially infects astrocytes in the mouse brain and induces IL-6 production *via* TLR7 {#sec008}\n------------------------------------------------------------------------------------------------\n\nAs TLR7 is expressed in the cortex and hippocampus, it regulates neural development and brain function even in the absence of infectious or pathogenic molecules \\[[@ppat.1008142.ref011], [@ppat.1008142.ref028]\\]. ", "We first evaluated the distribution of neural cells in the cerebral cortex or hippocampal areas of WT and TLR7^-/-^ mice based on neural markers. ", "Immunohistochemical analysis revealed that there were no significant differences in numbers and distributions of astrocytes (GFAP-positive), neurons (NeuN-positive), or microglia (IBA-1 positive) between cerebral cortexes or hippocampal areas of WT and TLR7^-/-^ mice ([Fig 6A](#ppat.1008142.g006){ref-type=\"fig\"}). ", "Notably, confocal microscopy analyses revealed that TLR7 localized with GFAP, NeuN, and IBA-1 in the cerebral cortex of WT mice, and TLR7 was not detected in cerebral cortex of TLR7^-/-^ mice as expected ([Fig 6B](#ppat.1008142.g006){ref-type=\"fig\"}), suggesting that TLR7 is expressed in astrocytes, neurons, and microglia in the murine cerebral cortex.", "\n\n{#ppat.1008142.g006}\n\nAs EV71 antigen has been detected in neurons and astrocytes in CNS tissues of infected rhesus macaques and human patients \\[[@ppat.1008142.ref029]\\], we further assessed where EV71 replicates in cerebral cortex of mice. ", "Confocal microscopy analyses indicated that the viral dsRNA mainly localized with GFAP, rather than with NeuN or IBA-1 ([Fig 6C](#ppat.1008142.g006){ref-type=\"fig\"}), suggesting that EV71 preferentially replicates in astrocytes of the murine cerebral cortex. ", "In addition, the localization and expression of endogenous IL-6 protein in the cerebral cortex upon EV71 infection were examined. ", "In the absence of infection, endogenous IL-6 protein was barely detected in the cerebral cortex of WT or TLR7^-/-^ mice, whereas upon EV71 infection IL-6 levels were significantly elevated in the cerebral cortex of WT mice relative to TLR7^-/-^ mice ([Fig 6D and 6E](#ppat.1008142.g006){ref-type=\"fig\"}, and [S7 Fig](#ppat.1008142.s007){ref-type=\"supplementary-material\"}). ", "Furthermore, EV71-induced IL-6 mainly localized in GFAP positive cells ([Fig 6D and 6E](#ppat.1008142.g006){ref-type=\"fig\"}), moderately in IBA-1 positive cells ([S7A and S7B Fig](#ppat.1008142.s007){ref-type=\"supplementary-material\"}), while marginally in NeuN positive cells ([S7C and S7C Fig](#ppat.1008142.s007){ref-type=\"supplementary-material\"}).", "\n\nEV71 preferentially infects and induces IL-6 production in astrocytes. ", "Thus, we would like to figure out how TLR7 mediated astrocytic cell apoptosis with IL-6 production. ", "The neonatal mice were intracranially injected with TLR7 agonist R837. ", "Immunofluorescence staining results revealed that IL-6 production ([Fig 6F](#ppat.1008142.g006){ref-type=\"fig\"}) and Caspase-3 cleavage (cl-Caspase-3) ([Fig 6F](#ppat.1008142.g006){ref-type=\"fig\"}) were induced in GFAP positive cells in cerebral cortex of mice after R837 administration for 1 day. ", "While these inductions were observed continuously in cerebral cortex of mice from 3 to 5 days upon R837 administration ([S8A and S8B Fig](#ppat.1008142.s008){ref-type=\"supplementary-material\"}). ", "IL-6 protein was consistently induced in CSF of mice after R837 administration from 1, 3, to 5 days ([S8C Fig](#ppat.1008142.s008){ref-type=\"supplementary-material\"}). ", "Altogether, these results confirmed that EV71 preferentially infects and induces IL-6 production through TLR7 in brain astrocytes in mice.", "\n\nTLR7 promotes IL-6 production and astrocytic cell apoptosis upon EV71 infection {#sec009}\n-------------------------------------------------------------------------------\n\nGiven that EV71 preferentially infects mice astrocytes and induces neuropathogenesis *via* TLR7, we thus further assessed the role of TLR7 in promoting cell apoptosis upon EV71 infection in human astroglioma U251 cells. ", "Our results confirmed that GFAP (an astrocyte marker) was highly expressed in the cytoplasm of U251 cells ([Fig 7A](#ppat.1008142.g007){ref-type=\"fig\"}). ", "Firstly, the dynamic EV71 replication in U251 cells was estimated. ", "We found the levels of viral RNA ([S9A Fig](#ppat.1008142.s009){ref-type=\"supplementary-material\"}) and proteins ([S9B Fig](#ppat.1008142.s009){ref-type=\"supplementary-material\"}) were continuously increased ranged from 0 to 48 h, while slightly reduced at 60 h post-infection in U251 cells. ", "The role of TLR7 in regulating cell apoptosis in U251 cells upon EV71 infection was then evaluated using shRNAs specifically targeting TLR7 (shTLR7) or shGFP (as a negative control). ", "qPCR assays revealed that *TLR7* mRNA expressed in mock-infected cells or induced in EV71-infected cells was significantly attenuated by shTLR7 ([Fig 7B](#ppat.1008142.g007){ref-type=\"fig\"}, left), indicating that shTLR7 is highly efficient at achieving knockdown in cells. ", "The results also indicated that EV71 *VP1* RNA was not affected by shTLR7 ([Fig 7B](#ppat.1008142.g007){ref-type=\"fig\"}, right), suggesting that TLR7 doesn't influence EV71 replication in U251 cells. ", "Notably, *IL-1β* mRNA was barely detected in U251 cells upon EV71 infection, whereas *IL-6* and *TNF-α* mRNA was highly expressed and significantly induced by EV71 in these cells ([Fig 7C](#ppat.1008142.g007){ref-type=\"fig\"}), while the inductions of *IL-6* and *IL-8* mRNA were significantly down-regulated by shTLR7, whereas *TNF-α* mRNA was not affected by shTLR7 ([Fig 7C](#ppat.1008142.g007){ref-type=\"fig\"}). ", "In addition, ELISA assays further demonstrated that IL-1β protein level was not detectable in U251 cells ([Fig 7D](#ppat.1008142.g007){ref-type=\"fig\"}, left), whereas there was abundant IL-6 production and prominently induced by EV71 in these cells, and this induction was decreased by shTLR7 ([Fig 7D](#ppat.1008142.g007){ref-type=\"fig\"}, right). ", "In parallel, IL-8 protein level was mildly elevated by EV71, but this production was not affected by shTLR7 ([S9C Fig](#ppat.1008142.s009){ref-type=\"supplementary-material\"}). ", "These results suggest that IL-8 slightly secreted from astrocytes upon viral infection independent on TLR7, although IL-8 protein can consistently release from astrocytes \\[[@ppat.1008142.ref030]\\]. ", "Collectively, these results suggest that TLR7 facilitates IL-6 expression and production upon EV71 infection in U251 cells.", "\n\n{#ppat.1008142.g007}\n\nNext, the role of TLR7 in mediating EV71-induced neurotoxicity was assessed. ", "Upon EV71 infection, cell viability was reduced in the presence of shGFP, whereas this reduction was reversed in the presence of shTLR7 ([Fig 7E](#ppat.1008142.g007){ref-type=\"fig\"}, left), suggesting TLR7 is involved in mediating EV71-induced cell death in U251 cells. ", "In addition, upon EV71 infection, the lactate dehydrogenase (LDH) release was induced in the presence of shGFP, whereas such induction was significantly attenuated in the presence of shTLR7 ([Fig 7E](#ppat.1008142.g007){ref-type=\"fig\"}, right), further indicating that TLR7 is involved in promoting the EV71-induced death in U251 cells. ", "Since TLR7 and TLR8 are known to be functionally related \\[[@ppat.1008142.ref031]\\], the biological relationship in functionality of TLR7 with TLR8 was also investigated. ", "TLR8 was expressed in astrocytes of both WT and TLR7^-/-^ mice cerebral cortex ([S10A Fig](#ppat.1008142.s010){ref-type=\"supplementary-material\"}), indicating that TLR7 deficiency doesn't affect TLR8 expression in astrocytes of mice cerebral cortex. ", "Then, siRNA silencing of TLR8 was applied in human U251 cells, followed by stimulated with R837 (TLR7 but not TLR8 agonist) as a positive control and EV71, revealing no effect on TLR7 expression after TLR8 silencing ([S10B Fig](#ppat.1008142.s010){ref-type=\"supplementary-material\"}). ", "Upon R837 or EV71 treatment, cell viability was reduced while LDH release was induced ([S10C Fig](#ppat.1008142.s010){ref-type=\"supplementary-material\"}). ", "However, these changes were not affected by knockdown of TLR8. ", "These results further indicated EV71-induced neurotoxicity in human U251 cells might rely on TLR7 but not TLR8. ", "In contrast, upon VTX-2337 (TLR8 but not TLR7 agonist) stimulation, cell apoptosis was strongly induced ([S10D Fig](#ppat.1008142.s010){ref-type=\"supplementary-material\"}). ", "In parallel, cell viability was reduced while LDH release was induced ([S10E Fig](#ppat.1008142.s010){ref-type=\"supplementary-material\"}). ", "Therefore, the data reveal that EV71 activates TLR7 signaling and IL-6 production independent of TLR8 in astrocytes.", "\n\nFurthermore, the TLR7-mediated astrocytic cell apoptosis upon EV71 infection was explored. ", "The qPCR analyses revealed that upon EV71 infection, the mRNA levels of apoptotic initiators including *Puma*, *Bad*, *Noxa*, and *Bax*, were induced in shGFP-transfected cells, whereas this upregulation was attenuated in shTLR7-transfected cells ([Fig 7F](#ppat.1008142.g007){ref-type=\"fig\"}). ", "Moreover, immunoblotting for cleaved-poly(ADP-ribose) polymerase (PARP) and cleaved-Caspase-3 revealed that upon EV71 infection, PARP cleavage and Caspase-3 cleavage were induced in shGFP-transfected cells, whereas these cleavage events were reduced in shTLR7-transfected cells ([Fig 7G](#ppat.1008142.g007){ref-type=\"fig\"}). ", "Therefore, these results suggest that TLR7 facilitates astrocytic cell apoptosis upon EV71 infection. ", "Taken together, our results thus reveal that TLR7 promotes IL-6 production to facilitate astrocytic cell apoptosis upon EV71 infection.", "\n\nIL-6 blockade attenuates astrocytic cell apoptosis upon EV71 infection in U251 cells {#sec010}\n------------------------------------------------------------------------------------\n\nWe further assessed that TLR7 mediated astrocytic cell apoptosis with IL-6 production. ", "In U251 cells, upon R837 treatment, cell viability was reduced ([S11A Fig](#ppat.1008142.s011){ref-type=\"supplementary-material\"}) while LDH release was induced ([S11B Fig](#ppat.1008142.s011){ref-type=\"supplementary-material\"}). ", "Moreover, similar with EV71 infection, R837 stimulation induced IL-6 production ([S11C Fig](#ppat.1008142.s011){ref-type=\"supplementary-material\"}), and the cleavage of PARP and Caspase-3 ([S11D Fig](#ppat.1008142.s011){ref-type=\"supplementary-material\"}) in U251 cells. ", "The data demonstrated that TLR7 agonist caused IL-6 expression and apoptosis in U251 cells (*in vitro*). ", "In addition, we found that an appropriate concentration of IL-6 (ranged from 20 to 500 pg/ml) activated Caspase-3 cleavage in U251 cells ([S11E and S11F Fig](#ppat.1008142.s011){ref-type=\"supplementary-material\"}), suggesting that TLR7-mediated IL-6 production triggers astrocytic cell apoptosis.", "\n\nAs TLR7 promotes IL-6 production and cell apoptosis induction by EV71 infection in U251 cells, we further explored the role of IL-6 in TLR7-mediated cell apoptosis induced by EV71. ", "U251 cells were infected with EV71 and then treated with isotype IgG (IgG) or anti-IL-6 antibody (IL-6-Ab) ([Fig 8A](#ppat.1008142.g008){ref-type=\"fig\"}). ", "ELISA results revealed that IL-6 protein levels were sharply reduced by IL-6-Ab treatment in cell supernatants of both mock-infected or EV71-infected cells ([Fig 8B](#ppat.1008142.g008){ref-type=\"fig\"}), demonstrating that the IL-6-Ab blockade is efficient. ", "Upon EV71 infection, cell viability was attenuated in the presence of IgG, whereas this reduction was reversed by IL-6-Ab ([Fig 8C](#ppat.1008142.g008){ref-type=\"fig\"}). ", "In addition, LDH release was increased in the presence of IgG, whereas this increase was reduced by IL-6-Ab ([Fig 8D](#ppat.1008142.g008){ref-type=\"fig\"}). ", "Moreover, upon EV71 infection, the mRNA levels of the apoptotic initiators *Puma*, *Bad*, *NoxA*, and *Bax* were enhanced in IgG-treated cells, whereas these enhancements were reduced in IL-6-Ab-treated cells ([Fig 8E](#ppat.1008142.g008){ref-type=\"fig\"}). ", "Notably, upon EV71 infection, PARP cleavage and Caspase-3 cleavage were increased in IgG-treated cells, whereas these cleavage events occurred less frequently in IL-6-Ab-treated cells ([Fig 8F](#ppat.1008142.g008){ref-type=\"fig\"}). ", "Collectively, these results demonstrate that IL-6 is involved in promoting TLR7-mediated cell death in U251 cells upon EV71 infection.", "\n\n{#ppat.1008142.g008}\n\nTLR7 upregulation, IL-6 induction and astrocytic cell apoptosis in EV71-infected human brain {#sec011}\n--------------------------------------------------------------------------------------------\n\nEV71 is neurotropic that has been demonstrated in human and primate pathological specimens, and the viral distribution is distinct and stereotyped \\[[@ppat.1008142.ref009]\\]. ", "To extrapolate the role of TLR7 in EV71-induced neuropathogenesis to human infections, we performed the histological analysis in six human brain specimens. ", "The pathological changes were characterized as inflammatory cell infiltration and neurodegeneration in both cerebral cortex ([Fig 9A](#ppat.1008142.g009){ref-type=\"fig\"}) and cerebellum ([S12A Fig](#ppat.1008142.s012){ref-type=\"supplementary-material\"}) of EV71-infected death cases. ", "We also observed that the EV71 antigen VP1 was expressed in the cerebral cortex ([Fig 9B](#ppat.1008142.g009){ref-type=\"fig\"}) and cerebellum ([S12B Fig](#ppat.1008142.s012){ref-type=\"supplementary-material\"}) of EV71-infected human brain tissues. ", "The similar observations were found that EV71 dsRNA was distributed in EV71-infected human brain regions, including the cerebral cortex ([Fig 9C](#ppat.1008142.g009){ref-type=\"fig\"}) and cerebellum ([S12C Fig](#ppat.1008142.s012){ref-type=\"supplementary-material\"}). ", "In the parallel histological analysis, TLR7 expression appeared at a higher level in the cerebral cortex of EV71-infected human brain tissues than uninfected ones ([Fig 9D](#ppat.1008142.g009){ref-type=\"fig\"}). ", "The similar phenomenon was observed in the cerebellum of EV71-infected human brain specimens ([S12D Fig](#ppat.1008142.s012){ref-type=\"supplementary-material\"}). ", "Further histological analysis revealed the IL-6 expression ([Fig 9E](#ppat.1008142.g009){ref-type=\"fig\"}), as well as cl-Caspase-3 level ([Fig 9F](#ppat.1008142.g009){ref-type=\"fig\"}) in GFAP positive cells were obviously upregulated in EV71-infected human cerebral cortex. ", "In addition, these up-regulations of the IL-6 expression ([S12E Fig](#ppat.1008142.s012){ref-type=\"supplementary-material\"}), and cl-Caspase-3 level ([S12F Fig](#ppat.1008142.s012){ref-type=\"supplementary-material\"}) in GFAP positive cells were displayed in EV71-infected human cerebellum. ", "However, we noticed that the up-regulations of the IL-6 and cl-Caspase-3 expression in the cerebellum were less than that in the cerebral cortex of EV71-infected human brain tissues, which is consistent with those found in EV71-infected mice brain. ", "Altogether, these data demonstrated that TLR7 upregulation, IL-6 induction and astrocytic cell apoptosis occurred in human brain upon EV71 infection.", "\n\n{#ppat.1008142.g009}\n\nTaken together, we propose that the neurotropic EV71 preferentially infects and replicates in astrocytes of the murine and human cerebral cortex. ", "EV71 RNA is recognized by TLR7 to trigger the signaling events and to promote IL-6 production and release, which results in the induction of cell apoptosis and in the development of neuroinflammation and brain injury ([Fig 10](#ppat.1008142.g010){ref-type=\"fig\"}).", "\n\n{#ppat.1008142.g010}\n\nDiscussion {#sec012}\n==========\n\nToll-like receptors (TLRs) act as innate immune receptors to recognize conserved pathogen-associated molecules in certain immune cell types. ", "Various TLRs are also expressed in neurons, astrocytes, and in microglial cells, and they are conducive to the immunological responses of the CNS \\[[@ppat.1008142.ref032]--[@ppat.1008142.ref034]\\]. ", "Emerging evidence suggests that TLRs play fundamental roles in brain development and homeostasis \\[[@ppat.1008142.ref028], [@ppat.1008142.ref035], [@ppat.1008142.ref036]\\]. ", "TLR7 is widely expressed in immune cells, intestinal cells, lung cells, and neural cells, wherein it is also able to detect and respond to specific viral RNAs, single-stranded oligoribonucleotides, siRNAs, and microRNAs, leading to intracellular signaling pathway activation and cytokine production \\[[@ppat.1008142.ref010], [@ppat.1008142.ref011], [@ppat.1008142.ref019], [@ppat.1008142.ref037]\\]. ", "In various forms of non-infectious CNS injury, TLR7 also serves as a prominent mediator of neurodegeneration \\[[@ppat.1008142.ref011], [@ppat.1008142.ref014], [@ppat.1008142.ref038]\\]. ", "TLR7 can thus play broad regulatory roles across a range of pathways pertaining to neurodegeneration, innate immunity, and cell biology.", "\n\nWe have previously shown that TLR7 orchestrates immune and inflammatory responses in macrophages during EV71 infection \\[[@ppat.1008142.ref019]\\]. ", "Given the neurotropic pathology associated with EV71, we speculated that TLR7 may regulate the immunological protection of CNS upon EV71 infection. ", "Using intracranial infection model which is suitable for evaluating EV71 neurovirulence \\[[@ppat.1008142.ref004]\\], the neurotropic EV71 strain was intracranially injected in 3-day-old neonatal WT and TLR7^-/-^ mice. ", "Compared with WT mice, TLR7^-/-^ mice were protected from EV71-induced weight loss, hind-limb paralysis, and lethality. ", "Further histological analyses revealed a reduction in EV71-induced neurodegeneration in TLR7^-/-^ mice, suggesting TLR7 was essential for EV71 neurovirulence in mice. ", "Unexpectedly, further findings revealed EV71 replication and tissue distribution were unaffected in the cerebral cortex of WT and TLR7^-/-^ mice. ", "This suggested that TLR7 failed to act as an antiviral immune receptor in these tissues, instead of serving as a death receptor in the context of murine brain neuropathogenesis upon EV71 infection. ", "Thus, we uncovered an additional biological function of TLR7 in the context of EV71-induced neurological lesion-related symptoms in the brains of mice. ", "TLR3, TLR7, and TLR9 are known to be important host factors involved in restricting EV71 infection in diverse infection models *in vivo* and *in vitro* \\[[@ppat.1008142.ref019], [@ppat.1008142.ref039], [@ppat.1008142.ref040]\\]. ", "Given TLR7 systemically modulates immune response, it should be emphasized that the different roles of TLR7 on EV71 infection might result from specifically viral distribution in mice organs in distinct EV71 infection models, such as oral and intraperitoneal routes \\[[@ppat.1008142.ref039], [@ppat.1008142.ref041]\\]. ", "In this study, we found viral distribution in a high level in cerebral cortex of the intracranially EV71-infected mice, which is similar with the EV71-infected human brain. ", "Thus, it is ideal to investigate the function of TLR7 in EV71-induced neuropathogenesis in the intracranial infection model.", "\n\nIn the CNS, the TLR7-mediated apoptosis pathway leads to cell death under either physiological (eg. ", "neurodegeneration) or pathological (eg. ", "neurotropic virus infection) conditions \\[[@ppat.1008142.ref011],[@ppat.1008142.ref012],[@ppat.1008142.ref042]\\]. ", "To investigate the role of TLR7 in EV71-related neurological damage, we therefore detected multiple markers of apoptosis including activated Caspase-3, DNA damage, and apoptosis-associated gene expression in the cerebral cortex of WT and TLR7^-/-^ mice. ", "Our observations revealed that the induction of apoptosis upon EV71-infection was significantly reduced in TLR7^-/-^ mice. ", "The coordinated neuroinflammatory response may be an important factor in neural injury \\[[@ppat.1008142.ref024]\\]. ", "In TLR7-mediated neural apoptosis upon EV71-infection, the level of IL-6 was predominantly induced in the cerebral cortex on days 3 and 5 after EV71 infection, and was also specifically modulated by TLR7. ", "Subsequently, we assessed the role of IL-6 in TLR7-mediated neuropathogenesis upon EV71 infection. ", "In an intracranial injection model, IL-6 blockade effectively protected EV71-infected mice from neurological lesion-related symptoms. ", "Correspondingly, IL-6 blockade significantly reduced the induction of apoptosis in the cerebral cortex of EV71-infected mice, while IL-6 blockade mediated such protection is independent of the virus load. ", "Similar with findings regarding that IL-6 blockade protects mice from EV71-induced immunopathogenesis in the intraperitoneal infection model \\[[@ppat.1008142.ref043]\\]. ", "Besides the TLR/TNFα/apoptosis/necroptosis pathway as a driver of neurodegeneration in Alzheimer's disease \\[[@ppat.1008142.ref011], [@ppat.1008142.ref044]\\], we identified a distinct TLR7/IL-6/apoptosis axis in viral neural pathogenesis mediated by TLR7 upon EV71 infection *in vivo*.", "\n\nNeuroinflammation has been described in various neural cells of the brain, including astrocytes, neurons, and microglia, which contribute to disease development and progression \\[[@ppat.1008142.ref045]\\]. ", "As TLR7 protein is expressed in the cortex and hippocampus and regulates neural development and brain function even under non-infectious conditions \\[[@ppat.1008142.ref011], [@ppat.1008142.ref028]\\], we evaluated the viral distribution of neural cells in cerebral cortex of mice. ", "Confocal microscopy revealed that viral dsRNA mainly colocalized with GFAP, rather than with NeuN or IBA-1, suggesting that EV71 preferentially infects and replicates in astrocytes of the murine cerebral cortex. ", "Moreover, endogenously induced IL-6 protein mainly localized to astrocytes in the cerebral cortex of mice upon EV71 infection. ", "In fact, EV71 antigen has primarily been detected in the neurons and astrocytes in CNS specimen from infected rhesus macaques and human patients \\[[@ppat.1008142.ref029]\\]. ", "Our data provide novel insights into the fact that EV71 preferentially infects and induces IL-6 in the astrocytes of mice, providing a novel explanation for the observed viral neuropathogenesis.", "\n\nAstrocytes (also known as astroglia) are a class of neural cells of ectodermal and neuroepithelial origin that maintain homeostasis and provide for the defense of the CNS \\[[@ppat.1008142.ref046]\\]. ", "They are emerging as pivotal regulators of inflammatory responses in the context of CNS injury \\[[@ppat.1008142.ref047],[@ppat.1008142.ref048]\\]. ", "Given that EV71 preferentially infected astrocytes, we further evaluated the role of TLR7 in the human astroglioma U251 cells upon EV71 infection. ", "Using TLR7 silencing and IL-6 neutralization approaches, we confirmed that TLR7 knockdown and IL-6 blockade attenuated astrocytic cell apoptosis upon EV71 infection. ", "Astrocytes are tightly integrated into neural networks and act within the context of neural tissue *in vivo*, and therefore the neurotoxic reactive astrocytes are also induced by activated microglia or damaged neurons in neurodegenerative diseases \\[[@ppat.1008142.ref049], [@ppat.1008142.ref050]\\]. ", "In this study, we propose that EV71 RNA triggers TLR7 signaling, subsequently promoting IL-6 expression primarily in astrocytes. ", "The release of IL-6 protein by these EV71-infected cells mediate autocrine and paracrine signaling in proximal astrocytes, leading to astrocytic cell apoptosis. ", "These dysfunctional astrocytes disrupt brain homeostasis, leading to the systematic development of neural inflammation and injury in brain, and even causing death in the case of some EV71 infections. ", "However, the interplay of EV71-infected astrocytes with other neural cell types such as microglia or neurons involved in viral neural pathogenesis remains to be further studied. ", "Altogether, these data reveal that astrocytes are responsible for EV71-induced neurodegeneration, a potential role of microglia in such pathology needs to clarify beyond this limited study. ", "As such, new approaches, including human brain organoids, and 3D microfluidic platforms, have major advantages in providing a micro-physiological system more closely reflecting the *in vivo* brain environment \\[[@ppat.1008142.ref051]\\], which are ideal to understand astrocytes-microglia or neurons crosstalk in EV71-associated CNS disorders.", "\n\nViral infections of the CNS can manifest in various forms of inflammation to influence the CNS homeostasis, including tick-borne encephalitis virus (TBEV), Zika virus (ZIKV), West Nile virus (WNV), and Japanese encephalitis virus (JEV) \\[[@ppat.1008142.ref042], [@ppat.1008142.ref052], [@ppat.1008142.ref053]\\], which has led to substantial focus on the responses of astrocytes in the context of CNS injury. ", "Here we further expand current understanding of not only the mechanism underlying TLR7-mediated neural pathogenesis involved in IL-6 induction, but also the effects of IL-6 on the fate of astrocytes in the brain upon EV71 infection. ", "Our findings may thus provide clues to aid the design of new strategies aimed at better containing and mitigating neurotropic virus- and astrocyte- dependent neural pathogenesis.", "\n\nMaterials and methods {#sec013}\n=====================\n\nAnimal studies {#sec014}\n--------------\n\nC57BL/6 WT mice were purchased from Shanghai Laboratory Animal Center. ", "The TLR7^-/-^ mice were originally obtained from The Jackson Laboratory (Bar Harbor, Maine, USA). ", "The mice were housed under specific pathogen-free (SPF) conditions in individually ventilated cages. ", "Three-day-old suckling mice were intracranially injected with 10 μl PBS containing 1×10^9^ plaque-forming units (PFU)/ml of EV71 with a 50-μl gastight microsyringe (Hamilton, Reno, NV, USA). ", "Following EV71 infection, mouse weights and clinical scores were recorded every day until one-week post-treatment. ", "The clinical scores were defined as follows: 0, healthy; 1, ruffled hair and hunched back; 2, limb weakness; 3, paralysis in one limb; 4, paralysis in both limbs; and 5, death.", "\n\nFor intracranial IL-6 neutralization, neonatal WT mice were intracranially injected with 10 μl PBS or EV71 per mouse. ", "Eight hours later, the mice were divided into groups and separately intracranially injected with IgG isotype or anti-IL-6 at a dose of 8 μg/per mouse, and this injection was repeated the following day. ", "For R837 administration *in vivo*, the suckling mice were intracranially injected with 10 μl PBS containing R837 (TLR7 agonist, Catalog number: HY-B0180; MedchemExpress; NJ, USA) at a dose of 50 μg/per mouse.", "\n\nTo collect cerebrospinal [fluid](https://cn.bing.com/dict/clientsearch?mkt=zh-CN&setLang=zh&form=BDVEHC&ClientVer=BDDTV3.5.1.4320&q=%E8%84%91%E8%84%8A%E6%B6%B2) (CSF), there-day-old WT mice were sacrificed and removed the entire spine of the mouse, 10 μl of CSF was aspirated with microsyringe, and then diluted in 1ml PBS. ", "Finally, 200 μl diluted CSF was subjected to ELISA assay to detect IL-6 protein expression using mouse IL-6 ELISA kit (4A Biotech Co. Ltd; Beijing, China), or RNA extraction to measure EV71 RNA copies.", "\n\nEthics statement {#sec015}\n----------------\n\nAll animal studies were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. ", "85--23, revised in 1996). ", "All procedures involving mice and experimental protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of the College of Life Sciences, Wuhan University (Permit numbers: 2017--016).", "\n\nHuman brain tissues {#sec016}\n-------------------\n\nBrain tissue samples from six deceased patients (three were confirmed to be EV71-infected and the other three were uninfected as the negative controls) were obtained from the School of Forensic Medicine, Kunming Medical University. ", "The tissues were fixed in formalin, and embedded in paraffin. ", "The infected group included two males and one female, and the average age was 27.3 months. ", "The average age of control group was 16 months ([Table 2](#ppat.1008142.t002){ref-type=\"table\"}).", "\n\n10.1371/journal.ppat.1008142.t002\n\n###### Demographic and baseline characteristics of EV71-negative individuals and EV71-positive patients[^a^](#t002fn001){ref-type=\"table-fn\"}.", "\n\n![](", "ppat.1008142.t002){#ppat.1008142.t002g}\n\n Number Age (month) Gender EV71 infection[^*b*^](#t002fn002){ref-type=\"table-fn\"}\n -------- ------------- -------- --------------------------------------------------------\n 1 8 Male \\-\n 2 35 Female \\-\n 3 5 Male \\-\n 4 28 Male \\+\n 5 36 Male \\+\n 6 18 Female \\+\n\n^*a*^ All EV71-positive individuals were confirmed to be negative for other enteroviruses and were not suffering from any concomitant illness, did not show any serological markers suggestive of autoimmune disease. ", "Matched by sex and age, EV71-negative individuals with no history of HFMD were randomly selected as controls.", "\n\n^*b*^ The status of EV71 infection is marked as \"-\" and \"+\" for EV71-negative individuals and EV71-positive patients, respectively.", "\n\nCell lines and transfection {#sec017}\n---------------------------\n\nHuman astroglioma U251 cells were purchased from American Type Culture Collection (ATCC) (Manassas, VA, USA). ", "Human embryonal rhabdomyosarcoma (RD) cells were obtained from the China Center for Type Culture Collection (CCTCC) (Wuhan, China). ", "All cell lines were cultured in Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen, Carlsbad, CA), supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY), 100 U/ml penicillin, and 100 mg/ml streptomycin sulfate at 37°C in a 5% CO~2~ incubator.", "\n\nFor cell transfection, U251 cells (2×10^6^) were cultured in 6-plate well in 2 ml medium, and then 2 μg plasmids transcribing shRNA were transiently transfected into cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer\\'s instructions.", "\n\nVirus and infection {#sec018}\n-------------------\n\nThe neurotropic Enterovirus 71 (EV71) strain (Xiangyang-Hubei-09) was originated from the brain tissue of a one-year-old dead EV71-infected infant in Xiangyang city, Hubei province in China, and isolated previously in our laboratory (GenBank accession no. ", "JN230523.1). ", "The virus stock was propagated in RD cells, and virus titration and inoculation with EV71 were performed as described previously \\[[@ppat.1008142.ref054],[@ppat.1008142.ref055]\\]. ", "The inactivated EV71 virus was obtained in two forms: (1) the irradiation by ultraviolet (UV) lamp for 2 h; (2) heating in water at 65°C for 30 min.", "\n\nAliquots were stored at -80°C prior to usage. *", "In vitro*, U251 cells were infected with the virus at the indicated multiplicities of infection (MOIs) and unbound virus was washed away 2 h later, after which samples were incubated at 37°C for an additional 24 or 48 h.\n\nReagents {#sec019}\n--------\n\nMouse anti-TLR7 (clone ID, 4G6) was purchased from Novus Biologicals (Littleton, CO, USA). ", "Mouse anti-Neurofilament-L (DA2), as well as rabbit antibodies against Hexaribonucleotide binding protein-3 (NeuN) (clone ID, D4G40), Glial fibrillary acidic protein (GFAP) (clone ID, E4L7M), Caspase-3 (clone ID, D3R6Y), Cleaved Caspase-3 (Asp175) (clone ID, 5A1E), and Poly(ADP-ribose) polymerase (PARP) (clone ID, 46D11) were purchased from Cell Signaling Technology (Beverly, MA, USA). ", "Rabbit anti-Ionized calcium binding adaptor molecule 1 (IBA-1) was purchased from Abcam (Cambridge, United Kingdom). ", "Mouse anti-EV71 VP1 was purchased from Abnova Company (Taiwan, China). ", "Mouse anti-dsRNA monoclonal antibody J2 was obtained from Scicons (Hungary). ", "Rabbit anti-TLR8 (abs102571) was obtained from Absin Bioscience Inc. (Shanghai, China). ", "Rabbit anti-Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was purchased from ProteinTech Group (Chicago, IL, USA). ", "Mouse anti-β-actin was purchased from Santa Cruz Biotechnology (Santa Cruz tech., ", "CA, USA). ", "Rat antibodies against mouse IL-6 (clone ID, MP5-20F3) or isotype IgG1 (clone ID, TNP6A7) were purchased from BioXcell (West Lebanon, NH, USA). ", "A mouse monoclonal antibody against human/primate IL-6 (clone ID, \\#6708) and isotype IgG1 (clone ID, \\#11711) was purchased from R&D systems (Minneapolis, MN, USA). ", "Recombinant human IL-6 protein (Catalog number: 200--06) was purchased from Pepro Tech Inc. (Rocky Hill, NJ, USA). ", "Cell apoptosis inducer, etoposide (Catalog number: HY-13629), and TLR8 agonist, VTX-2337 (Catalog number: HY-13773) were purchased from MedchemExpress (NJ, USA).", "\n\nThe shTLR7 and shGFP plasmids expressing a short-hairpin RNA (shRNA) targeting TLR7 or Green fluorescent protein (GFP) as a negative control were generated by inserting the appropriate DNA fragments into the pSilencer 2.1-U6 neo vector (Ambion, Inc., Austin, TX, USA), respectively, as described previously \\[[@ppat.1008142.ref019]\\]. ", "The specific DNA fragments were synthesized by Tsingke Biological Technology (Beijing, China). ", "The siRNA specific to the negative control (NC) and human TLR8 were synthesized by RiboBio (Guangzhou, China) and used at the concentration of 50 nM. siRNA-NC targeted the sequence 5'-TTCTCCGAACGTGTCACGT-3', siRNA-TLR8 targeted the sequence 5'-GATGGTGGTGCTTCAATTA-3'.", "\n\nImmunohistochemistry and immunofluorescence staining {#sec020}\n----------------------------------------------------\n\nTissue samples were mounted on slides from paraffin blocks (5-μm sections), deparaffinized three times in xylene for 5 min, and hydrated in a methanol gradient (100%, 95%, 70%, and 50%). ", "3% H~2~O~2~ and 10 mM citrate buffer (pH6) was used for antigen retrieval. ", "Nonspecific peroxidase activity was blocked for 30 min with 5% bovine serum albumin (BSA). ", "The slides were then incubated with the primary antibody overnight at 4°C and then washed with PBS for 10 min. ", "The biotinylated secondary antibody was initially applied for 30 min, after which an avidin biotin complex kit (Dako/Agilent Technologies, Santa Clara, CA, USA) was used for an additional 30 min. ", "3,3'-diaminobenzidine tetrahydrochloride hydrate (DAB) with 5% H~2~O~2~ was used for detection. ", "Slides were then counterstained with hematoxylin and eosin (H&E) to stain nuclei. ", "Immunohistochemistry was conducted at each site using specific antibodies, and samples were visualized by microscopy (Olympus, Tokyo, Japan).", "\n\nFor immunohistochemistry analysis, the IHC reaction was assessed using light microscopy following scoring criteria: 0, no or faint staining intensity; 1+, faint cytoplasmic staining; 2+, moderate and incomplete membranous staining; and 3+, strong membranous staining. ", "The intensity of immunohistochemistry or immunofluorescence staining was generated using Image J software from three representative images.", "\n\nRNA extraction and quantitative PCR {#sec021}\n-----------------------------------\n\nRNA was extracted from homogenized mouse brain tissues or cultured cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). ", "Quantitative real-time PCR (qPCR) analyses were performed using the Roche LightCycler 480 (Roche Diagnostics, Indianapolis, IN, USA) and SYBR RT-PCR kits (Roche) according to the manufacturer\\'s instructions. ", "The data represent absolute mRNA copy numbers normalized to GAPDH used as a reference gene. ", "Relative fold expression values were determined by using the ^ΔΔ^Ct method. ", "Primer sequences are listed in [S1 Table](#ppat.1008142.s013){ref-type=\"supplementary-material\"}.", "\n\nWestern blotting {#sec022}\n----------------\n\nRadio-immunoprecipitation assay (RIPA) buffer containing protease inhibitors was used in order to lyse and extract protein from murine brain homogenates and cultured cells. ", "Supernatant protein concentrations were then determined using a BCA assay kit, and protein lysates (100 μg) were resolved by SDS-PAGE and transferred onto nitrocellulose (NC) membranes (Amersham, Piscataway, NY, USA). ", "Nonspecific binding was blocked with 5% nonfat dried milk (BD Biosciences, San Jose, CA, USA) for 1 h at room temperature. ", "After three washes in PBS, the NC membranes were incubated with appropriate primary and secondary antibodies. ", "Blots were then analyzed using a Luminescent Image Analyzer (Fujifilm LAS-4000; GE Life Sciences, Piscataway, NJ, USA). ", "The relative target protein expression to internal control is quantified using Image J software.", "\n\nEnzyme-linked immunosorbent assays (ELISAs) {#sec023}\n-------------------------------------------\n\nU251 cells (1×10^6^ per well) were seeded in 6-well culture plates with 10% FBS, and were transfected with shGFP or shTLR7 plasmids. ", "At 24 h post-transfection, cells were infected with EV71 at a MOI = 0.5 for 2 h, and were then washed with PBS to remove the unbound virus. ", "Then, cells were cultured in 2 ml of FBS-free DMEM for an additional 12 h. Finally, the cell supernatants were harvested after centrifugation at 10,000 *g* for 5 min for ELISAs. ", "Supernatant cytokine levels were assessed using human IL-1β immunoassay (BD Biosciences, CA, USA), human IL-6 immunoassay kits (R&D systems, Minneapolis, MN, USA), and human IL-8 ELISA kit (4A Biotech Co. Ltd, Beijing, China) following the manufacturer's provided instructions.", "\n\nCell viability and LDH release assays {#sec024}\n-------------------------------------\n\nCells (1×10^5^ per well) were seeded in 24-well plates after treatment. ", "A cell viability assay was then performed using the Cell Counting Kit 8 (CCK8, Dojindo, Japan) according to the manufacturer\\'s instructions. ", "Cell injury was determined by measuring the lactate dehydrogenase (LDH) activity in FBS-free culture medium at 30 min after restoration using an LDH detection kit (Dojindo, Japan) according to the manufacturer's instructions. ", "Briefly, medium was harvested from a 24-well plate and centrifuged at 5000 rpm for 10 min. ", "This cell-free supernatant was then incubated with the provided reaction mixture, and LDH activity was determined based on absorbance at 450 nm.", "\n\nStatistical analysis {#sec025}\n--------------------\n\nAll experiments were reproducible, and each set of experiments was repeated at least three times with similar results. ", "Statistical significance for comparison of two means was assessed via unpaired Student's *t-*test. ", "Analyses were performed using GraphPad Prism 7 (San Diego, CA, USA). ", "Survival curves were plotted using the Kaplan-Meier method, and significant differences in survival were calculated via the log-rank test. ", "Data are means ± the standard deviation (SD), and statistical significance was evaluated using the following *P* values: *P* \\<0.05 (\\*), *P* \\<0.01 (\\*\\*) or *P* \\<0.001 (\\*\\*\\*).", "\n\nSupporting information {#sec026}\n======================\n\n###### Immunofluorescence analysis in cerebral cortex of intracranially EV71-infected mice.", "\n\nThere-day-old WT mice were intracranially injected with 10 μl PBS, EV71-UV, EV71- Heated or EV71 per mouse (each group, n = 10--12) and sacrificed on day 1, 3 or 5 post-infection, respectively. (**", "A** and **B**) The EV71 virus RNA copies in cerebral cortex (A) or cerebellum (B) were determined by absolute quantitative PCR. ", "Data are shown as mean ± SD. \\*\\*\\*, *", "P* \\< 0.001. (**", "C** and **D**) The cerebral cortex sections of mice on day 3 post-infection from different groups were fixed and subjected to immunostaining with cl-Caspase-3 (Red), dsRNA (Green), and DAPI (Blue) (C). ", "The presentative images were acquired using fluorescence microscopy. ", "Bar = 20 μm. ", "The relative expression of cl-Caspase-3 and dsRNA was quantified using Image J software (D). ", "Data are shown as mean ± SD. (**", "E** and **F**) The cerebral cortex sections of mice on day 5 post-infection from different groups were immunostained with cl-Caspase-3 (Red), dsRNA (Green), and DAPI (Blue) (E). ", "The presentative images were acquired using fluorescence microscopy. ", "Bar = 20 μm. ", "The relative expression of cl-Caspase-3 and dsRNA was quantified using Image J software (F). ", "Data are shown as mean ± SD.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Immunofluorescence analysis in cerebellum of intracranially EV71-infected mice.", "\n\nThere-day-old WT mice were intracranially injected with 10 μl PBS, EV71-UV, EV71- Heated or EV71 per mouse (each group, n = 10--12) and sacrificed on day 1, 3 or 5 post-infection, respectively. (**", "A** and **B**) The cerebellum sections of mice on day 3 post-infection from different groups were fixed and subjected to immunostaining with cl-Caspase-3 (Red), dsRNA (Green), and DAPI (Blue) (A). ", "The presentative images were acquired using fluorescence microscopy. ", "Bar = 20 μm. ", "The relative expression of cl-Caspase-3 and dsRNA was quantified using Image J software (B). ", "Data are shown as mean ± SD. (**", "C** and **D**) The cerebellum sections of mice on day 5 post-infection from different groups were immunostained with cl-Caspase-3 (Red), dsRNA (Green), and DAPI (Blue) (C). ", "The presentative images were acquired using fluorescence microscopy. ", "Bar = 20 μm. ", "The relative expression of cl-Caspase-3 and dsRNA was quantified using Image J software (D). ", "Data are shown as mean ± SD.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Distribution of EV71 in cerebral cortex and cerebellum of WT and TLR7^-/-^ mice.", "\n\n(**A** and **B**) WT mice and TLR7^-/-^ mice mock-infected or EV71-infected were sacrificed on 2, 3, 5, and 7 days post-infection (each group, n = 3--5). ", "The mice cerebral cortex sections (A) and cerebellum sections (B) were fixed and subjected to IHC staining with EV71 VP1 antibody (Brown), respectively. ", "The presentative images were acquired using light microscopy. ", "Bar = 100 μm. ", "EV71 VP1 relative expression was shown as VP1 positive index and quantified with Image J software. ", "Data are shown as mean ± SD. ", "ns, non-significant.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### IL-6 protein production and EV71 load in different tissues of IL-6 Ab-treated mice.", "\n\nNeonatal WT mice were intracranially injected with 10 μl PBS or EV71 per mouse, and separately intracranially treated with IgG isotype or anti-IL-6 antibody. ", "The different sections of mice on day 1 in different groups were subjected to IL-6 protein and EV71 load detection. (**", "A** and **B**) The proteins were extracted from individual mice cerebral cortex (A) or cerebellum (B) tissues and then the IL-6 protein level in tissues (per gram) was determined by ELISA assay. (**", "C** and **D**) IL-6 secretion in cerebrospinal [fluid](https://cn.bing.com/dict/clientsearch?mkt=zh-CN&setLang=zh&form=BDVEHC&ClientVer=BDDTV3.5.1.4320&q=%E8%84%91%E8%84%8A%E6%B6%B2) (CSF) (C) and peripheral blood (D) were determined by ELISA assay. (**", "E**-**H**) EV71 RNA was extracted from mice cerebral cortex (E), cerebellum (F), CSF (G) and peripheral blood (H). ", "EV71 viral RNA copies were determined by absolute quantitative PCR. ", "Data are shown as mean ± SD. ", "ns, non-significant; \\*, *P* \\< 0.05; \\*\\*, *P* \\< 0.01; \\*\\*\\*, *P* \\< 0.001.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Immunofluorescence analysis of IL-6 and EV71 VP1 expression in cerebral cortex and cerebellum of IL-6 Ab-treated mice.", "\n\nNeonatal WT mice were intracranially injected with PBS or EV71 per mouse, and separately intracranially treated with IgG isotype or anti-IL-6 antibody. ", "The cerebral cortex and cerebellum sections of mice on day 1 in different groups were immunostained with IL-6 (Red), EV71 VP1 (Green), and DAPI (Blue). (**", "A**) The presentative images of cerebral cortex sections were acquired using fluorescence microscopy. ", "Bar = 20 μm. (**", "B**) The relative expression of IL-6 and EV71 VP1 in cerebral cortex was quantified using Image J software. (**", "C**) The presentative images of cerebellum sections were acquired using fluorescence microscopy. ", "Bar = 20 μm. (**", "D**) The relative expression of IL-6 and EV71 VP1 in cerebellum was quantified using Image J software. ", "Data are shown as mean ± SD. ", "ns, non-significant; \\*, *P* \\< 0.05.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Immunofluorescence analysis of IL-6 and EV71 VP1 expression in spinal cord and skeletal muscle of IL-6 Ab-treated mice.", "\n\nNeonatal WT mice were intracranially injected with PBS or EV71 per mouse, and separately intracranially treated with IgG isotype or anti-IL-6 antibody. ", "The spinal cord and skeletal muscle sections of mice on day 1 in different groups were immunostained with IL-6 (Red), EV71 VP1 (Green), and DAPI (Blue). (**", "A**) The presentative images of spinal cord sections were acquired using fluorescence microscopy. ", "Bar = 20 μm. (**", "B**) The relative expression of IL-6 and EV71 VP1 in spinal cord was quantified using Image J software. (**", "C**) The presentative images of skeletal muscle sections were acquired using fluorescence microscopy. ", "Bar = 20 μm. (**", "D**) The relative expression of IL-6 and EV71 VP1 in skeletal muscle was quantified using Image J software. ", "Data are shown as mean ± SD. ", "ns, non-significant; \\*, *P* \\< 0.05.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### IL-6 expression and location in cerebral cortex of EV71-infected WT and TLR7^-/-^ mice.", "\n\nNeonatal WT and TLR7^-/-^ mice were intracranially injected with PBS or EV71. ", "After 3 days EV71 incubation, brain sections from mice were subjected to immunostaining. (**", "A** and **B**) The cerebral cortex sections were immunostained with DAPI (Blue), IBA-1 (Green) and IL-6 (Red). ", "Bar = 20 μm. ", "Cells were observed using fluorescence confocal microscopy (A) and the IL-6 expression in IBA-1-positive (IBA-1^+^) cells was calculated (B). (**", "C** and **D**) The cerebral cortex sections were immunostained with DAPI (Blue), NeuN (Green) and IL-6 (Red). ", "Bar = 20 μm. ", "Cells were observed using fluorescence confocal microscopy (C) and the IL-6 expression in NeuN-positive (NeuN^+^) cells was calculated (D). ", "Graphs show mean ± SD. ", "ns, non-significant; \\*, *P* \\< 0.05.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### The neuropathogenic effect in mice after R837 intracranial injection.", "\n\nThere-day-old WT mice were intracranially injected with 10 μl PBS or 10 μl PBS containing 50 μg R837 per mouse, and then sacrificed on Day 1, 3 or 5 post-R837 administration. (**", "A**) Immunostaining of the brain's cortex from day 3 or 5 post-R837 administration was probed with IL-6 (Red), GFAP (Green) and stained with DAPI (Blue). ", "The presentative images were acquired using fluorescence microscopy. ", "Bar = 20 μm. (**", "B**) The mice cerebral cortex sections were subjected to cl-Caspase-3 (Red), GFAP (Green) and DAPI (Blue) staining. ", "The presentative images were captured using fluorescence microscopy. ", "Bar = 20 μm. (**", "C**) The IL-6 protein level in CSF from mice was detected by ELISA. ", "Graphs show mean ± SD. \\*, *", "P* \\< 0.05; \\*\\*, *P* \\< 0.01.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### The dynamic replication of EV71 in U251 cells.", "\n\n(**A** and **B**) U251 cells (2×10^6^) were seeded on a 6-well plate, then mock-infected or infected with EV71 (MOI = 0.5) for different periods. ", "The total RNA was extracted from cells and EV71 RNA level was determined by qPCR. ", "The *GAPDH* mRNA is used as an internal control (A). ", "The total protein was extracted from cells. ", "EV71 VP1 and 3C expression were detected by Western blotting analysis (B). (**", "C**) U251 cells (2×10^6^) were transfected with 2 μg plasmid transcribing siRNA specific to TLR7 (shTLR7) or its control (shGFP) and then mock-infected or infected with EV71 (MOI = 0.5) for 12 or 24 h. IL-8 secretion in supernatants of the cell cultures was analyzed by ELISA. ", "Graphs show mean ± SD. ", "ns, non-significant.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### EV71-activated TLR7 signaling is independent of TLR8 expression.", "\n\n(**A**) WT or TLR7^-/-^ mice cerebral cortex sections were stained with TLR8 (Red), GFAP (Green), and DAPI (Blue). ", "The presentative images were captured using fluorescence microscopy. ", "Bar = 20 μm. (**", "B** and **C**) U251 cells (2×10^6^) were transfected with siRNA (50 nM) target to TLR8 (siRNA-TLR8) or its control (siRNA-NC) for 24 h, and then treated with EV71 (MOI = 0.5) or R837 (10 μM) for another 24 h, respectively. ", "The cell lysates were harvested for Western blotting to examine the expression level of TLR8, TLR7, and GAPDH (B). ", "Cell viability and LDH release of treated cells were examined using CCK8 and LDH assay, respectively (C). (**", "D** and **E**) U251 cells were treated with different concentrations of VXT-2337 (TLR8 agonist) (0, 1, 5 or 10 μM) for 24 h. The protein was extracted and then detected by Western blotting with targeted antibodies (D). ", "Cell viability and LDH release of treated cells were examined using CCK8 and LDH assay (E).", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### The neurotoxicity effect in U251 cells after R837 treatment.", "\n\n(**A** and **B**) U251 cells were treated with different concentrations of R837 (0.5, 1, 5 or 10 μM) for 24 h. Cell viability (A) and LDH release (B) of treated cells were examined using CCK8 and LDH assay. (**", "C** and **D**) U251 cells were treated with R837 (10 μM) or EV71 (MOI = 0.5) for 24 h. The supernatants of treated cells were collected and IL-6 protein level was measured by ELISA (C). ", "The protein was extracted and then detected by Western blotting with targeted antibodies (D). (**", "E** and **F**) U251 cells were seeded on 20-mm cover slips and treated with different concentrations of human IL-6 protein (20, 100, 500 pg/ml) or Etoposide (150 μM) for 24 h, and then probed with cl-Caspase-3 (Green) and DAPI (Blue) (E). ", "Cells were observed using fluorescence confocal microscopy. ", "Bar = 20 μm. ", "The relative cl-Caspase-3 expression was calculated (F). ", "Graphs show mean ± SD. \\*, *", "P* \\< 0.05; \\*\\*, *P* \\< 0.01.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Histopathological characteristics in brain tissues from EV71-infected humans.", "\n\n(**A**) The hematoxylin-eosin (H&E) staining of cerebellum sections from human brain tissues (uninfected and EV71-infected; each group, n = 3). ", "The presentative images were acquired using light microscopy. ", "Bar = 100 μm. (**", "B**--**D**) Cerebellum sections from EV71-infected or uninfected humans were subjected to IHC staining with anti-EV71 VP1 antibody (B), anti-dsRNA antibody (C) or anti-TLR7 antibody (D). ", "The presentative images were acquired using light microscopy. ", "Bar = 100 μm. ", "The relative expression of indicated was shown as a positive index and quantified with Image J software. (**", "E** and **F**) Human cerebellum tissue sections were fixed and stained with GFAP (Green) and IL-6 (Red) (E) or cl-Caspase-3 (Red) (F). ", "The presentative images were acquired using fluorescence microscopy. ", "Bar = 100 μm. ", "The relative expression of IL-6 or cl-Caspase-3 in GFAP positive (GFAP^+^) cells was calculated with Image J software. ", "Data are shown as mean ± SD. \\*, *", "P* \\< 0.05; \\*\\*, *P* \\< 0.01; \\*\\*\\*, *P* \\< 0.001.", "\n\n(TIF)\n\n###### \n\nClick here for additional data file.", "\n\n###### List of primers used for qPCR in this study.", "\n\n(DOCX)\n\n###### \n\nClick here for additional data file.", "\n\n[^1]: The authors have declared that no competing interests exist.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.012345679012345678, 0.015, 0.0078125, 0.013605442176870748, 0.00816326530612245, 0, 0, 0.02040816326530612, 0.0110803324099723, 0.007936507936507936, 0.00510204081632653, 0.00558659217877095, 0.02112676056338028, 0.011299435028248588, 0, 0.004629629629629629, 0, 0, 0, 0, 0, 0.0020876826722338203, 0.0228310502283105, 0, 0, 0, 0.011152416356877323, 0, 0, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010309278350515464, 0, 0, 0, 0.00437636761487965, 0.0035587188612099642, 0.003389830508474576, 0.006172839506172839, 0, 0.009174311926605505, 0.008368200836820083, 0, 0.012048192771084338, 0, 0.006289308176100629, 0, 0, 0.014492753623188406, 0.014184397163120567, 0.006024096385542169, 0.029940119760479042, 0.02631578947368421, 0, 0, 0, 0.007936507936507936, 0.013513513513513514, 0, 0, 0.0026041666666666665, 0.004672897196261682, 0.007009345794392523, 0, 0.01195219123505976, 0.008064516129032258, 0, 0.02702702702702703, 0.006756756756756757, 0, 0, 0, 0, 0.01948051948051948, 0, 0, 0.015625, 0, 0, 0, 0, 0, 0.012195121951219513, 0, 0, 0.006289308176100629, 0.00411522633744856, 0.0056179775280898875, 0.012254901960784314, 0.012875536480686695, 0, 0, 0.007518796992481203, 0, 0.003816793893129771, 0, 0.0028328611898017, 0.0055248618784530384, 0.002652519893899204, 0, 0.008368200836820083, 0, 0, 0, 0, 0.007633587786259542, 0, 0.017241379310344827, 0.01834862385321101, 0, 0, 0, 0, 0.007518796992481203, 0, 0, 0.011494252873563218, 0, 0.011583011583011582, 0.00816326530612245, 0.009389671361502348, 0.004366812227074236, 0.015625, 0.006802721088435374, 0.006535947712418301, 0, 0.00663716814159292, 0, 0, 0.008445945945945946, 0.0022727272727272726, 0.011214953271028037, 0.009950248756218905, 0, 0, 0, 0, 0.004197761194029851, 0.006493506493506494, 0, 0.028409090909090908, 0.008130081300813009, 0.012690355329949238, 0, 0.009302325581395349, 0.01282051282051282, 0, 0.007633587786259542, 0, 0.02702702702702703, 0.015873015873015872, 0, 0, 0.015748031496062992, 0, 0, 0, 0.009259259259259259, 0.0076726342710997444, 0.0049261083743842365, 0.005305039787798408, 0, 0, 0, 0.004132231404958678, 0.008146639511201629, 0, 0, 0.014492753623188406, 0.015544041450777202, 0.01141552511415525, 0.011111111111111112, 0, 0.004761904761904762, 0.00684931506849315, 0.006329113924050633, 0.011299435028248588, 0, 0.011848341232227487, 0.013513513513513514, 0, 0, 0.028985507246376812, 0, 0, 0, 0.03225806451612903, 0.007194244604316547, 0, 0.007352941176470588, 0, 0, 0.01098901098901099, 0.010582010582010581, 0, 0.0072992700729927005, 0.011583011583011582, 0, 0.00267379679144385, 0.011363636363636364, 0, 0, 0, 0.013422818791946308, 0.005128205128205128, 0.011904761904761904, 0, 0, 0.012987012987012988, 0, 0, 0, 0.010948905109489052, 0.015, 0.00963855421686747, 0.008620689655172414, 0.011363636363636364, 0.005025125628140704, 0, 0, 0.004608294930875576, 0, 0, 0.008888888888888889, 0, 0, 0.018018018018018018, 0.016, 0, 0, 0.011904761904761904, 0, 0.013333333333333334, 0, 0, 0.003703703703703704, 0.002967359050445104, 0.005847953216374269, 0.008, 0.007017543859649123, 0.012903225806451613, 0, 0, 0, 0.007194244604316547, 0, 0, 0.006779661016949152, 0.003067484662576687, 0, 0, 0, 0.004347826086956522, 0, 0, 0, 0.00546448087431694, 0.025806451612903226, 0.011627906976744186, 0.01764705882352941, 0.02564102564102564, 0.007782101167315175, 0.008620689655172414, 0, 0, 0, 0.011904761904761904, 0.009708737864077669, 0.013888888888888888, 0, 0.012195121951219513, 0.011235955056179775, 0, 0.01282051282051282, 0, 0.003968253968253968, 0, 0.0035211267605633804, 0.008064516129032258, 0.003745318352059925, 0.004739336492890996, 0, 0.010948905109489052, 0.0034482758620689655, 0, 0, 0, 0.004405286343612335, 0, 0, 0.005235602094240838, 0, 0, 0, 0.007692307692307693, 0, 0, 0.008403361344537815, 0, 0, 0.003787878787878788, 0, 0, 0.006993006993006993, 0, 0, 0.015151515151515152, 0.017341040462427744, 0.010025062656641603, 0.021621621621621623, 0, 0.006711409395973154, 0.013513513513513514, 0.009216589861751152, 0, 0, 0.00684931506849315, 0, 0, 0.013157894736842105, 0.006289308176100629, 0, 0, 0.00980392156862745, 0, 0.02631578947368421, 0.003937007874015748, 0, 0.008695652173913044, 0, 0, 0.007462686567164179, 0.004878048780487805, 0.005917159763313609, 0.007017543859649123, 0.004830917874396135, 0.007142857142857143, 0.009433962264150943, 0, 0.011560693641618497, 0, 0.009950248756218905, 0.02054794520547945, 0, 0, 0.006666666666666667, 0, 0, 0, 0, 0, 0.008771929824561403, 0.02195121951219512, 0, 0, 0.005917159763313609, 0.02040816326530612, 0, 0.015706806282722512, 0.008695652173913044, 0, 0.008333333333333333, 0.0049504950495049506, 0.02403846153846154, 0.012269938650306749, 0.024875621890547265, 0.008928571428571428, 0, 0.014423076923076924, 0.007017543859649123, 0, 0, 0, 0, 0, 0.00303951367781155, 0, 0, 0.00558659217877095, 0.022727272727272728, 0.022988505747126436, 0.003875968992248062, 0.006472491909385114, 0.07692307692307693, 0.016666666666666666, 0, 0.02040816326530612, 0.008771929824561403, 0.017994858611825194, 0, 0.014084507042253521, 0.012987012987012988, 0.011363636363636364, 0.00847457627118644, 0.012195121951219513, 0, 0.020833333333333332, 0.006024096385542169, 0.017391304347826087, 0.018633540372670808, 0.020771513353115726, 0.010526315789473684, 0.003745318352059925, 0, 0.013333333333333334, 0.01098901098901099, 0.009009009009009009, 0.00510204081632653, 0.020833333333333332, 0.012195121951219513, 0, 0.003703703703703704, 0, 0.018518518518518517, 0.014354066985645933, 0, 0, 0.010309278350515464, 0, 0.009174311926605505, 0, 0.00909090909090909, 0.025, 0, 0, 0.014285714285714285, 0, 0.018050541516245487, 0.006211180124223602, 0.007042253521126761, 0.004424778761061947, 0, 0, 0, 0.010101010101010102, 0.014492753623188406, 0, 0, 0.006666666666666667, 0.010050251256281407, 0.015625, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0.010050251256281407, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0.00641025641025641, 0.0196078431372549, 0, 0, 0.020202020202020204, 0, 0, 0.018518518518518517, 0, 0.0125, 0, 0.005050505050505051, 0.011857707509881422, 0.017391304347826087, 0.029411764705882353, 0, 0.01282051282051282, 0.018518518518518517, 0.007874015748031496, 0.012987012987012988, 0.0064516129032258064, 0, 0, 0.009009009009009009, 0, 0, 0.009708737864077669, 0, 0, 0.018518518518518517, 0.0078125, 0.012987012987012988, 0.00641025641025641, 0, 0, 0.009345794392523364, 0, 0, 0.009259259259259259, 0, 0, 0.018518518518518517, 0.010416666666666666, 0.025, 0, 0, 0, 0, 0.00909090909090909, 0, 0.007142857142857143, 0, 0, 0.018518518518518517, 0, 0.011111111111111112, 0.006493506493506494, 0, 0, 0.008620689655172414, 0, 0, 0.029411764705882353, 0, 0, 0.018518518518518517, 0.01818181818181818, 0.013513513513513514, 0.024390243902439025, 0, 0, 0.01282051282051282, 0.010830324909747292, 0, 0, 0.018518518518518517, 0, 0.02564102564102564, 0, 0, 0.008968609865470852, 0, 0.01834862385321101, 0, 0.02197802197802198, 0.018518518518518517, 0, 0.009433962264150943, 0.021505376344086023, 0, 0, 0, 0, 0, 0, 0, 0.018518518518518517, 0, 0.00684931506849315, 0, 0, 0.0053475935828877, 0, 0, 0, 0.007407407407407408, 0, 0, 0.008403361344537815, 0, 0.019230769230769232, 0.018518518518518517, 0, 0, 0, 0 ]

[ "This entry is our analysis of a study considered particularly relevant to improving outcomes from drug or alcohol interventions in the UK. ", "The original study was not published by Findings; click Title to order a copy. ", "Free reprints may be available from the authors – click prepared e-mail. ", "Links to other documents. ", "Hover over for notes. ", "Click to highlight passage referred to. ", "Unfold extra text The Summary conveys the findings and views expressed in the study. ", "Below is a commentary from Drug and Alcohol Findings.", "\n\nMarsh J.C., Shin H-C, Cao D.Evaluation and Program Planning: 2010, 33(2), p. 81–90.Unable to obtain a copy by clicking title? ", "Try asking the author for a reprint by adapting this prepared e-mail or by writing to Dr Marsh at jmarsh@uchicago.edu. ", "You could also try this alternative source.", "\n\nFrom the comprehensive treatment process data collected by a major national US study emerges the important lesson that retention in itself is not an active ingredient in post-treatment outcomes but reflects influences such having one's needs met (especially important for women) and developing a good relationship with the service and your key worker.", "\n\nSummary The US National Treatment Improvement Evaluation Study collected data between 1993 and 1995 from a nationally representative sample of treatment programmes funded by the US government, serving mainly vulnerable and underserved populations including minorities, pregnant women, young people, public housing residents, welfare recipients, and those involved in the criminal justice system. ", "It remains one of the few treatment effectiveness studies to have collected detailed information from clients on their relationships with the treatment provider and their receipt of services.", "\n\nThe source study had interviewed 6593 patients when they started treatment. ", "Of these, the featured analysis included 3027 from 59 services who had completed all intake, treatment discharge, and follow-up interviews, were not in prisons or jails, and had expressed some need for services at treatment intake. ", "Mainly they were problem drug users who may also have been drinking heavily. ", "A year after leaving treatment they had told researchers the number of days in the last 30 on which they had used the five most frequently used substances: alcohol; cannabis; crack cocaine; cocaine powder; and heroin. ", "These use days were summed to give an index of the intensity of their polydrug use. ", "The fact that the variables presumed to influence substance use were measured a year before means that they could have had a causal influence, but the study was unable to be sure of this because other influences could not be excluded.", "\n\nMain findings\n\nModels were constructed of how mechanisms and influences interrelated to influence retention and post-treatment substance use. ", "One was made for the full sample, but the same model could not be applied to men and to women – the processes were too different.", "\n\nFor the full sample, post-treatment substance use was significantly lower when a greater proportion of the patient's needs had been met during treatment, they had a better relationship with the treatment service/keyworker, and they had stayed in treatment longer. ", "Further upstream of the causal chain model, facilitating access to treatment by providing transportation and child care led to receipt of a greater range and intensity of substance abuse counselling and other treatment services, which in turn led to an improved relationship between service and client. ", "Improved relationships then seemed to lead to patients staying longer in treatment, and both were related to having more of one's needs met.", "\n\nAmong the 'fixed' factors affecting these processes were that residential treatment led to longer retention and more counselling and other treatment services being received. ", "The more educated the client the less their post-treatment substance use, while the greater use was before treatment the greater it tended to be afterwards.", "\n\nThe authors' conclusions\n\nSeveral services and service delivery mechanisms – client-provider relationship, access services, substance use counselling and other treatment services, and services matched to needs – individually and collectively contributed to retention in treatment and reduced post-treatment substance use. ", "While mechanisms affecting outcome are fundamentally the same for men and women, access services are particularly important for women, and a positive client-provider relationship is directly related to reduced substance use for men but only indirectly for women.", "\n\nThe study's modelling techniques helped establish not just which factor is related to another, but also which might be cause and which effect. ", "These analyses suggested that a positive client-provider relationship leads to better matching of services to needs and to longer treatment, but not the other way round. ", "The implication is that when providers develop a constructive relationship with clients, they are able to more effectively identify and meet service needs and encourage clients to remain in treatment. ", "These findings are consistent with a review which concluded that in substance use treatment, client-provider relationships consistently predict retention but less consistently predict substance use outcomes.", "\n\nAnother question is whether the client-provider relationship is therapeutic in its own right, or primarily a vehicle for enhancing access to and impact of specific services. ", "Modelling results suggest this relationship is both directly connected to reduced post-treatment drug use and indirectly related via greater need-service matching and longer treatment stays.", "\n\nThese linkages do however differ for men and women. ", "The client-provider relationship is directly therapeutic for the total sample and for men, but among affects post-treatment substance use only via receipt of needed services, which for women more strongly predicts outcomes than the relationship and more strongly than for men. ", "This may be because women start treatment with more needs, so addressing those is especially important.", "\n\nThe analysis was also consistent with receipt of transportation and child care leading to receipt of more substance use counselling/treatment services, which led to a higher quality client-provider relationship. ", "It seems these access services may be a necessary precondition for receiving more substance use counselling, which in turn gives clients the opportunity to connect with their provider and work on treatment goal-setting, planning and bonding, which in turn means more needs are met, encouraging or enabling longer retention. ", "For the total sample and for men, the result is to reduce post-treatment drinking and drug use.", "\n\nAccess services were identified in the models as especially valuable for women, perhaps because they are more likely to face barriers to treatment entry including lack of transportation and problems with child care. ", "Not only does providing these facilitate access, it also improves treatment in ways which improve substance use outcomes.", "\n\nRemaining in treatment for more than three months has been considered a robust predictor of reduced post-treatment substance use. ", "The featured analysis found that when other variables are taken in to account and findings for men and women analysed separately, retention is no longer directly related to substance use, but acts via improved matching of services to needs. ", "The implications are that treatment duration may in previous studies have served as a proxy for receipt of services.", "\n\nThese findings emerged from a resicted sample of treatment programmes and from a restricted sample of the patients who started treatment in those programmes; they may not be representative to all substance users in need of treatment. ", "Findings from the source study derive mainly from public sector programmes serving lower-income groups and may not generalise to other programmes and caseloads. ", "They also date from the early '90s, since when treatment services have changed, though perhaps not in ways which invalidate the core conclusions. ", "Finally, the statistical techniques used to construct the models can eliminate some theories about how treatment works, but not confirm that the final model actually reflects cause and effect. ", "This inherent limitation of the techniques is compounded by the fact that the main treatment process information was all collected at one time point (discharge from treatment); ideally the presumed causes would have been assessed before the presumed affects.", "\n\ncommentary Logical, intuitively appealing and in line with other research as the conclusions of the analysis are, it is important (as the authors acknowledge) to remember that the most which can be said is that the cause-effect explanations are consistent with the data. ", "It cannot definitely be said that this is in reality how the treatment process worked for these US clients and services in the early '90s. ", "Only studies which deliberately varied, for example, the quality of the client-provider relationship (while keeping everything else constant) could confirm that directly or indirectly this relationship causes the resulting changes in retention and substance use. ", "Such studies are however not very feasible because they would mean deliberately consigning some patients to a substandard treatment experience and possible substandard outcomes in a situation where lives are at risk from relapse. ", "Failing such studies, careful and sophisticated analyses such as the featured study offers, based on relatively comprehensive data from real-world treatment services, can help elucidate important variables affecting the success of addiction treatment. ", "More methodological considerations below.", "\n\nFindings from this analysis were foreshadowed by an analysis from the same source study focused on receipt of services matched to needs. ", "It found that receiving services matched to need was associated with greater reductions in illegal drug use generally and use of the drug(s) in relation to which the patient had sought treatment. ", "This was the case for each of the needs separately (except for mental health) and for the extent to which each individual's overall needs had been addressed. ", "The strongest links were with housing and vocational help and among patients at residential services, where these particular needs were most likely to be addressed. ", "Matching services to needs was linked to improved outcomes partly (but not entirely) via a link with increased retention. ", "However, these associations were confined to the half of the patients with multiple needs across at least four out of the five domains.", "\n\nMore generally, research is supportive of the attempt to match the intensity and type of help to patients' needs, but studies are few and usually the impacts on substance use have been moderate. ", "Research is strongest in regard to providing inpatient care and professional psychotherapy for patients with distinct but not disabling psychiatric problems who also have fewer 'recovery resources' in the form of employment opportunities and a supportive family. ", "The relative prominence of research on psychiatric severity and psychotherapy may be a function of the comparative lack of investment in meeting patients' needs for housing and employment, which are also more difficult to engineer. ", "Despite the difficulties, studies do suggest that providing such services improves outcomes in the targeted areas and also in respect of substance use problems.", "\n\nA Findings review has explored the impact of (among other forms of practical help) the access services found so influential in the featured analysis – transport and help with the child care. ", "It concluded that practical help to overcome access obstacles directly improves retention and also shows that the service is responsive and caring. ", "Transport seemed most important for impoverished populations required to attend methadone services daily for supervised consumption. ", "Direct help in the form of a driver and vehicle worked best, probably because it provides an escort and structures the patient's day. ", "Providing transport was found to augment efforts to link patients to external agencies such as housing and employment services. ", "The review also noted that for many women, child care is essential if they are to be attracted to and retained in treatment, especially in long-term residential care, but may not be used if it is unfamiliar or seems to threaten the mother's custody of the child. ", "Beyond child care and transport, flexible and realistic opening hours and attendance requirements meant patients with unpredictable lives were not set up to fail, and allowed others to maintain normal family and working lives.", "\n\nMethodological limitations\n\nIt is unclear whether characteristics of the patients before they started treatment influenced both retention and outcomes and treatment processes in ways which could have created what looked like a causal relationship between processes and outcomes. ", "This is especially relevant in respect of variables not entirely under the control of the treatment service. ", "For example, clients who were particularly motivated or well placed to overcome their dependence might have developed better therapeutic relationships, been more diligent in attending the service's counselling sessions, and attended 12-step meetings outside the service. ", "They may also have stayed in treatment longer and done better in terms of controlling their substance use after treatment, but perhaps mainly because of their pre-existing attributes rather than treatment processes. ", "Similarly, the measures of child care and transportation services were measures of the receipt of those services, not just their provision by the treatment agency. ", "Receipt may reflect not just organisational concern to help patients come to treatment, but also the eagerness of the patient to ask for these services so they can attend.", "\n\nSuch considerations may explain (for example) why the counselling sessions scheduled by the treatment service and whether it provided on-site access to ancillary services (reflecting the organisation's provision, not their use by the patient) had no impact on retention and substance use a year after leaving treatment, while whether the patient actually attended counselling sessions and whether they actually accessed needed ancillary services (potentially reflecting their impetus to get better) did have direct or indirect impacts.", "\n\nThe restricted sample is also a concern. ", "About 85% of patients starting treatment completed intake interviews for the source study. ", "From this interviewed sample were eliminated another 2179 who did not complete subsequent interviews or expressed no needs at intake. ", "The remaining sample constituted about 57% of all patients starting treatment (from whom were then excluded those in prison or jail). ", "Loss to the sample was unlikely to have been entirely random. ", "In so far as it was related to the factors used to account for treatment outcomes, estimates of the effects of these factors will be biased. ", "For example, assume (not unrealistically) that patients who developed a very poor relationship with their providers not only tended to leave treatment very early but also failed to complete all research interviews. ", "In this scenario the potential impact of this relationship on retention – estimated on the basis of the patients who did complete all interviews – will have been underestimated.", "\n\nSee this web site for more on the National Treatment Improvement Evaluation Study including a list of papers analysing the findings. ", "Also available is the main report on the study published in 1997." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.012658227848101266, 0, 0, 0, 0, 0, 0.018867924528301886, 0.015625, 0.01680672268907563, 0, 0, 0.002512562814070352, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.003663003663003663, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0051813471502590676, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007462686567164179, 0, 0, 0, 0, 0, 0.007407407407407408, 0 ]

[ "Bristol Township filmmaker, EMT finds focus telling LGBT stories\n\nTuesday\n\nBristol Township resident Ian Liberatore splits time between jobs as an EMT and a filmmaker focusing on LGBT characters and stories.", "\n\nIn starting a production company “specializing in films for LGBT characters and their stories,” as it states on Ian Liberatore’s business card, he knew it would come with a certain amount of risk.", "\n\nThe subject matter could turn some people away right off the bat.", "\n\nHe could become pigeonholed as a filmmaker.", "\n\nThe responsibility of tackling issues that are at once deeply personal and inevitably political could prove to be too much to bear.", "\n\nAnd while Liberatore admits he sometimes dwells on these reservations, he is confident that the decision will not only lead his career down a path toward success, but also lead to discussion that could inspire a greater understanding of gay culture.", "\n\n“If I become pigeonholed then so be it,” he said. “", "If I’m making movies that I enjoy and that other people enjoy then that’s all that matters to me.”", "\n\nLiberatore, 35, of Bristol Township, founded Moving Forward Films in July. ", "But he began writing his first film last October.", "\n\n“An American Hate Crime” premiered at The Newtown Theatre on Oct. 7 with another showing set for this Sunday.", "\n\nLiberatore said the film — shot mostly over the course of six days in locations across Bucks County on a shoestring budget of about $13,000 raised through Kickstarter.com donations and from his own pockets — was well received.", "\n\n“It went great,” Liberatore said Monday. “", "Way better than expected. ", "It was a sold-out show and everybody seemed to love the characters and the story. ", "People were gushing and awed and shocked.”", "\n\nSpeaking prior to the film's debut, Liberatore said he was excited to finally see the result of his last year of rigorous work. ", "But he was mostly just nervous. ", "Only he and his husband had seen the full movie before that night.", "\n\nHis apprehension, in part, was due to the tone of the film — which he admits is heavy.", "\n\nTold in three chapters, “An American Hate Crime” first focuses on a group of college-aged men who use social media apps to lure and attack gay people, as Liberatore describes it.", "\n\nThe second chapter follows Noah, a 13-year-old boy coming to terms with his homosexuality.", "\n\n“He has a crush in school, he comes out to his parents and because he really has no one like him to talk to, a friend convinces him to go on one of these apps,” Liberatore said.", "\n\nAt that point the characters intersect with violence. ", "The third act revolves around the aftermath of their choices.", "\n\nWhile the plot is intense and emotional, Liberatore says he doesn’t feel it’s controversial.", "\n\nThe assaults are not portrayed to be motivated by any political ideology and there are no religious undertones, he said.", "\n\n“They are just based on pure hatred,” he added.", "\n\nBranching out beyond LGBT storylines is something Liberatore aspires to do, too. ", "When that time comes he hopes Moving Forward Films will be in a position to work with other up and coming filmmakers who have their own stories to tell that could fit with his original vision for the company.", "\n\nAccording to Liberatore, growing up in the 80s and 90s left him searching for LGBT characters that felt real to him. ", "Or felt how he felt inside.", "\n\n“The characters you saw back then were either really flamboyant or crossdressers, which is fine, but, on a personal level, I’m gay and I’m just not like that,” he explained.", "\n\nAs he attempts to navigate the film industry, Liberatore is able to make ends meet — and save lives — through his side job.", "\n\nFor the last 11 years, the Middletown native has been working as an emergency medical technician, now splitting shifts with Warrington Community Ambulance Corps and PennDel-Middletown Emergency Squad.", "\n\nThe work takes its emotional toll.", "\n\n“Obviously we see a lot of bad things, a lot of sad things,” Liberatore said. ", "But some moments, though rare — like a recent visit to the hospital room of a man pulled from a serious wreck last month — make it all feel worth it.", "\n\n“That kind of thing inspires me to come to work every day,” he added.", "\n\nAsked what inspired him to venture into filmmaking, Liberatore had two words ready to unleash.", "\n\n“Jurassic Park,” he said. “", "My parents took me to see it for my 10th birthday party and I ended up seeing it four times (in the theater). ", "I bought it the first day it came out on VHS. ", "It has everything I love about movies. ", "I believed the characters. ", "I believed the story and I reacted to it. ", "And that’s what I hope to do. ", "I love seeing people’s reactions, seeing them laugh, and I love seeing people scream. ", "I love seeing them gasp when there’s a twist unveiled. ", "That, to me, is the fun part of moviegoing.”", "\n\nMike DelRossi, a paramedic with Warrington, recalled the first time he met Liberatore about five years ago.", "\n\n“He was a little standoffish because of his sexuality,” DelRossi said. “", "He’d tapdance around it to make sure people were accepting. ", "But when he finally brought it up to me I said ‘Hey, that’s cool’ and brushed it off like it was nothing. ", "It’s his prerogative. ", "Whoever wants to love whoever else is fine by me.”", "\n\nDelRossi says he’s come to consider Liberatore a good friend and a dedicated EMS provider.", "\n\nHe saw his passion as a filmmaker and for raising awareness about bullying and hate crimes. ", "It drove him to become a financial contributor to the film, earning him an executive producer credit.", "\n\n“It's upsetting to see somebody having to endure any mental or physical pain because of their sexual orientation,” DelRossi added. “", "That’s just not an issue we should be dealing with in today’s world.”", "\n\nTickets for Sunday’s showing of “An American Hate Crime” are available for purchase on MovingForwardFilms.com or at NewtownTheatre.com.", "\n\nNever miss a story\n\nChoose the plan that's right for you.", "\nDigital access or digital and print delivery.", "\n\nAdvertise\n\nOriginal content available for non-commercial use under a Creative Commons license, except where noted.", "\nBucks County Courier Times ~ 8400 N. Bristol Pk, Levittown, PA 19057 ~ Privacy Policy ~ Terms Of Service" ]

{ "pile_set_name": "Pile-CC" }

[ 0.01932367149758454, 0.005050505050505051, 0, 0, 0, 0.00398406374501992, 0, 0, 0.012987012987012988, 0, 0.009009009009009009, 0.0043859649122807015, 0.022727272727272728, 0, 0, 0, 0.007692307692307693, 0, 0, 0, 0.005555555555555556, 0.010869565217391304, 0.00558659217877095, 0, 0, 0.010638297872340425, 0, 0, 0.012048192771084338, 0.004807692307692308, 0.008403361344537815, 0, 0, 0.008, 0.009900990099009901, 0, 0.0125, 0, 0, 0.010416666666666666, 0, 0, 0.021739130434782608, 0, 0, 0, 0, 0, 0, 0, 0.027522935779816515, 0.013513513513513514, 0, 0, 0, 0, 0.03260869565217391, 0, 0, 0.007462686567164179, 0, 0.014598540145985401, 0, 0, 0.008620689655172414, 0.01904761904761905 ]

[ "<?", "php\n\nuse Concrete\\Core\\Support\\Facade\\Facade;\n\ndefined('C5_EXECUTE') or die('Access Denied.');", "\n$app = Facade::getFacadeApplication();\nswitch ($displayMode) {\n case 'text':\n case 'date_text':\n if ($textCustomFormat !", "== '') {\n $format = $textCustomFormat;\n } elseif ($displayMode === 'date_text') {\n $format = $date->getPHPDatePattern();\n } else {\n $format = $date->getPHPDateTimePattern();\n }\n if ($value === null) {\n $placeholder = $date->formatCustom($format, 'now');\n } else {\n $value = $date->formatCustom($format, $value);\n $placeholder = $value;\n }\n $form = $app->make('helper/form');\n echo $form->text($view->field('value'), $value, ['placeholder' => $placeholder]);\n break;\n case 'date':\n echo $form_date_time->date($view->field('value'), $value);\n break;\n default:\n echo $form_date_time->datetime($view->field('value'), $value, false, true, null, $timeResolution);\n break;\n}\n\n$timezone = $date->getUserTimeZoneID();\nif ($timezone) {\n $timezone = $date->getTimezoneDisplayName($timezone);\n echo '<div class=\"text-muted\"><small>' . ", "$timezone . '", "</small></div>';\n}\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.02127659574468085, 0, 0, 0, 0 ]

[ "Pirra Homestead\n\nPirra Homestead, in Forest Road, Lara, Victoria, was built in the mid-1860s by George Fairbairn (senior), one of Australia's most prosperous pastoralists and a pioneer of Australia's frozen meat export trade, who established the property as a premier sheep stud. ", "The homestead was originally called 'Woodlands', but by 1880 the name of the property had changed to 'Windermere'.", "\n\nIn the first decade of the twentieth century, the property was sold to the Victorian Government for closer settlement, but the homestead and were taken over by the Lara Inebriates' Institution. ", "After the Inebriates' Institution closed in 1930, the property was sold to James McDonald in 1938, who turned it into a mixed farm. ", "In 1946, he leased the former Inebriates' dormitory building to the States Tobacco Company.", "\n\nAfter the Tobacco Company folded in 1948, the property was sold to Oscar and Edna Mendelsohn. ", "The Tobacco Company workers were employed by the clothing manufacturer Pelaco, which operated a factory in the former Inebriates' dormitory. ", "The Mendelsohns renamed the property 'Serendip' and established a commercial almond orchard. ", "The water reservoir was proclaimed a sanctuary for the protection of the local bird life. ", "Oscar Mendelsohn was also appointed as an assistant inspector of the government Fisheries and Game Department. ", "In 1959, the Mendelsohns sold to the Department of Fisheries and Wildlife who assumed control of the surrounding the wildlife sanctuary.", "\n\nThe immediate homestead, reduced to , was taken over by the Victorian Government Social Welfare Department, and the two-storey mansion house and nearby buildings became the Pirra Girls' Home in 1961. '", "Pirra' is an aboriginal word for moon, being a symbol of happiness. ", "Pirra accommodated female wards of the state aged from 10 – 14 years who had come under State wardship for being \"in moral danger\" or for \"lapsing or (being) likely to lapse into a life of vice and crime\".", "\n\nThe Girls' Home closed in 1983 and Pirra was leased to Rex Keogh and Geoff Dombrain. ", "It became an accommodation and community establishment for the lessees and invited artists. ", "In 1996, the property,\nthen reduced to 6.665 hectares (16.469 acres), was sold to Rex Keogh, who continued running it as a home for artists, and as community‐based accommodation for a limited number of disabled persons. ", "In 2006 the property was sold to the Bisinella family who undertook a $2 million+ restoration of the homestead.", "\n\nSee also \n HM Prison Barwon\n HM Prison Geelong\n Marngoneet Correctional Centre\n\nReferences\n\nExternal links\n Official website\n\nCategory:Defunct prisons in Geelong\nCategory:Juvenile detention centres in Australia\nCategory:Victorian Heritage Register" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.014285714285714285, 0, 0.01015228426395939, 0.015151515151515152, 0.02197802197802198, 0.020833333333333332, 0.02127659574468085, 0, 0, 0.009009009009009009, 0.0072992700729927005, 0.0049261083743842365, 0.014705882352941176, 0.004878048780487805, 0.022988505747126436, 0, 0.004545454545454545, 0.009009009009009009, 0.008032128514056224 ]

[ "Prophylactic Nipple-Sparing Mastectomy and Direct-to-Implant Reconstruction of the Large and Ptotic Breast: Is Preshaping of the Challenging Breast a Key to Success?", "\nNipple-sparing mastectomy with simultaneous hammock technique direct-to-implant reconstruction is increasingly offered to patients opting for risk-reducing mastectomy. ", "Despite this promising method, patients with macromastia and ptotic breasts remain a challenging group to treat satisfactorily and more often end up undergoing a difficult corrective procedure and experience an unacceptably high rate of failed reconstruction. ", "The authors examined whether targeted preshaping mastopexy/reduction could prepare these patients for a successful nipple-sparing mastectomy/direct-to-implant reconstruction. ", "Patients seeking risk-reducing nipple-sparing mastectomy/direct-to-implant reconstruction at the authors' institutions deemed unfit for a one-stage procedure based on their previous experience were offered a targeted two-stage, risk-reducing mastopexy/reduction followed by a delayed secondary nipple-sparing mastectomy and direct-to-implant reconstruction. ", "Patients were followed up at 3 weeks and 6 or 12 months. ", "Forty-four reconstructions were performed in 22 patients aged 43 years (range, 26 to 57 years). ", "All 44 procedures were completed successfully without any failure or nipple-areola complex losses. ", "Patients' median body mass index was 30 kg/m (range, 22 to 44 kg/m). ", "Six patients were smokers and one had hypertension. ", "Two patients underwent reoperation because of hematoma and fat necrosis. ", "The authors' results demonstrate that a targeted preshaping mastopexy/reduction followed by nipple-sparing mastectomy/direct-to-implant reconstruction can be safely planned in women who opt for a risk-reducing mastectomy and can be performed successfully with a 3- to 4-month time span between operations. ", "On the basis of these results and the superior cosmetic outcome, the two-stage approach has become the authors' standard of care in all such settings. ", "Therapeutic, IV." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.01818181818181818, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Ackman or No, Air Products Is Solid\n\nTwo months ago we recommended Air Products & Chemicals (APD), and the stock has risen more than 8% since then. ", "Since early June, two significant events have taken place. ", "First, the company reported June-quarter earnings that were in line with expectations, with forward guidance tightened around the midpoint of the Street's prior expectations. ", "Second, Pershing Square Management, the vehicle of activist investor Bill Ackman, disclosed a 9.8% stake in the company at the end of July. ", "The latter event is what has caused most of the recent upward movement in the stock.", "\n\nOn Monday, Ackman came under pressure for being on the wrong side (so far) of high-profile investments in Herbalife (HLF) and J.C. Penney (JCP). ", "Since Air Products is his latest foray, to the tune of $2 billion in open-market purchases, some observers are questioning the wisdom of this investment, as well.", "\n\nWhile Ackman's history is not unblemished, Pershing Square has had a strong investment record. ", "In fact, it has been a positive catalyst in a number of cases, especially when the target company has had a strong underlying business franchise.", "\n\nWe put Air Products into this category, as its competitive position is durable and sticky. ", "Demand for its industrial gases should grow over time, given increasing worldwide manufacturing demand. ", "Many of its customers are in stable businesses, such as food and beverage and healthcare. ", "Others are more cyclical, like autos, energy and metals, and these should benefit as the global economy recovers.", "\n\nRevenue and earnings growth stands to remain modest for the rest of this year, though the Street expects better growth of about 10% for the next two years on the back of solid bookings for new projects and contracts. ", "Costs have been well contained, meanwhile, as management's priority is to maintain an attractive profit margin.", "\n\nAir Products has a strong balance sheet, and it has demonstrated good annual dividend growth of 10% for the last few years. ", "Its current yield is still above 2.7%, even with the run-up in the stock price this year. ", "With increasing investor concern about upward-trending interest rates, this higher-yielding stock should actually have better fundamentals, if in fact the rise in rates is backed by accelerating economic growth. ", "Finally, the stock is valued at 19x this year's earnings estimate -- which is not expensive, given the predictable nature of its business. ", "It still trades at a discount to its peers.", "\n\nWe don't have any opinion on Ackman's plays in other stocks. ", "But we do think that, in Air Products, he has uncovered a solid business at a reasonable price that will benefit from continuing economic recovery. ", "If his activism can focus the company to pursue improved financial performance and shareholder returns, the stock can do even better.", "\n\nWe like Air Products at these levels, and if you own it, we recommend you continue to do so. ", "For those who aren't invested, we suggest buying some based on Ackman's likely pressure on the company. ", "With Ackman stirring the pot, we think the stock could move higher over the next year, into the $120-to-$125 range.", "\n\nGet an email alert each time I write an article for Real Money. ", "Click the \"+Follow\" next to my byline to this article." ]

{ "pile_set_name": "Pile-CC" }

[ 0.013513513513513514, 0, 0, 0.014285714285714285, 0, 0.02040816326530612, 0, 0.010309278350515464, 0, 0.010752688172043012, 0, 0, 0, 0.0045662100456621, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0.006756756756756757, 0, 0.010526315789473684, 0.009615384615384616, 0, 0.015151515151515152, 0 ]

[ "Dr Sevag Kertechian, a researcher based at Paris-Sorbonne University in the French capital, is to reveal the full findings of his study at the Appearance Matters Conference - the world’s largest event on body image and disfigurement - being held between Tuesday and Thursday.", "\n\nThe conference will see more than 200 appearance experts from across the world tackle issues including weight loss surgery, eating disorders and ‘ultra-thin’ dolls.", "\n\nDr Kertechian decided to research the impact clothing had on the recruitment process after realising it had never been studied.", "\n\nAs job advertisements came up over a period of three years he put two women forward for the roles." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.01090909090909091, 0, 0, 0 ]

[ "Q:\n\nProve that if $\\quad\\max\\{\\text{size(t.left),size(t.right)\\}}\\leqslant 2/3\\text{ size(t)}\\}$ than the height of T is $O(\\log n)$\n\nGiven the following definition of binary search tree:\n$$\\text{size}(t)=\\cases{0\\qquad\\qquad\\qquad\\qquad\\qquad\\qquad t=\\text{ null}\\\\\n1+\\text{size(t.left)+size(t.right)}\\qquad\\text{otherwise}}$$\nfor each vertex in the tree t.size contain the size of it's subtree\n\nProve that if $\\quad\\max\\{\\text{size(t.left),size(t.right)\\}}\\leqslant 2/3\\text{ size(t)}\\}$\nthan the height of T is $O(\\log n)$ if it is given that $n=\\text{size(T)}$\n\nAttempt:\nI discovered that the size of a vertex is the number of vertices that there are in the specific root:\ne.g:\n V_1\n / \\\n V_2 V_3\n / / \\\n V_4 V_5 V_6\n\nThe size of $V_4,V_5,V_6$ is: $1+0=1$\nThe size of $V_2$ is: $1+1=2$\nThe size of $V_3$ is: $1+1+1=3$\nThe size of $V_1$ is: $1+3+2=6$\nBut how can I prove about T's height\n\nA:\n\nIn this tree, when you go from one tree to a child tree, no matter what the number of nodes in the new tree is at most $2/3$ the number of nodes in the parent tree. ", "How many times can you multiply $n$ by $2/3$ before it is less than or equal to $1$? ", "Well:\n$$n (2/3)^k = 1 \\\\\nk = -\\ln(n)/\\ln(2/3)$$\nSo in particular the height of the tree is at most $-\\ln(n)/\\ln(2/3)+1$. (The $+1$ comes about because I assume a singleton tree has height $1$). ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008278145695364238, 0, 0, 0 ]

[ "Both the party and the Central government are soon expected to launch programmes to promote Tamil language (File) Both the party and the Central government are soon expected to launch programmes to promote Tamil language (File)\n\nWHILE THE BJP awaits the merger of the two factions of ruling AIADMK in Tamil Nadu, with speculation that the step is a precursor to the party joining the NDA fold, the saffron party has finalised a plan to go local in order to gain a foothold in the southern states. ", "To begin with, a senior BJP leader said, the party will try and appropriate Tamil poet and philosopher Thiruvalluvar to endear itself to the Tamil electorate. ", "Besides, both the party and the Central government are soon expected to launch programmes to promote Tamil language.", "\n\n“There will be installation of Thiruvalluvar statues, programmes to celebrate him, and institutions will be named after him. ", "He will be the first southern hero the BJP will celebrate in a big way,” the party leader said. ", "This effort comes after BJP’s attempts to make electoral inroads with pre-election alliance with a clutch of regional parties and social groups in 2014 came unstuck after the polls. ", "This, party leaders believe, resulted in its dismal performance in the 2016 Assembly elections — therefore the eagerness to get the AIADMK join the NDA.", "\n\nBJP leaders said the party has “sensed” that it will be difficult to emerge as a strong alternative in Tamil Nadu without the backing of a party identified with the state. “", "The AIADMK is key for the BJP’s 2019 plans,” a source in the party said. “", "As the party could lose some seats in northern bastions — especially where it had almost swept the Lok Sabha polls — every seat from the South is significant.”", "\n\nAccording to the party leader, there is a vacuum in Tamil Nadu, “and we do not want to leave it to anyone else”. ", "As of now, the leader said, an alliance with AIADMK seems to be the “only way for the party to win seats in Parliament from the state in 2019”. ", "But the perception battle the party is set to fight goes beyond Tamil Nadu — as seen in the recent controversy over linguistic identity in Karnataka, where BJP leaders, faced with a dilemma, found it difficult to take a stand on the charge of “imposition of Hindi”.", "\n\nAt The Indian Express Idea Exchange programme recently, P Muralidhar Rao, BJP general secretary and the party’s Karnataka and Tamil Nadu in-charge, admitted that the biggest challenge for BJP would be finding space for different social, linguistic, religious and communal identities of the people. “…", "how different identities — social, linguistic and other kinds of identities — how they get the space they deserve. ", "That we have to prove, the government has to perform and show it,” he said.", "\n\nAccording to BJP leaders, the party has to “seize” the situation at a time the Congress has failed to address and incorporate different identities. “", "The party has prepared its strategy in such a way that we will argue that there is no contradiction in the BJP’s approach to (different) issues,” the senior BJP leader said.", "\n\n📣 The Indian Express is now on Telegram. ", "Click here to join our channel (@indianexpress) and stay updated with the latest headlines\n\nFor all the latest India News, download Indian Express App." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.012072434607645875, 0.018867924528301886, 0.008620689655172414, 0, 0.010416666666666666, 0.005494505494505495, 0.013157894736842105, 0.005714285714285714, 0.02702702702702703, 0.006289308176100629, 0, 0.013888888888888888, 0.007547169811320755, 0.009933774834437087, 0, 0, 0.013245033112582781, 0.011560693641618497, 0.023255813953488372, 0.019867549668874173 ]

[ "const path = require('path');\nconst Utils = require('../../../lib/build/utils');\n\ndescribe('the Utils.runSequentially function', () => {\n it('calls the callback function for all items', (d) => {\n let items = [{ name: 'first' }, { name: 'second' }];\n let cb = jasmine.createSpy('cb').and.returnValue(Promise.resolve());\n Utils.runSequentially(items, cb).then(() => {\n expect(cb.calls.count()).toBe(2);\n expect(cb.calls.argsFor(0)[0].name).toBe('first');\n expect(cb.calls.argsFor(1)[0].name).toBe('second');\n d();\n });\n });\n\n it('runs in sequence', (d) => {\n let items = [{ name: 'first' }, { name: 'second' }, { name: 'third' }];\n let cb = jasmine.createSpy('cb').and.callFake((item) => {\n return new Promise(resolve => {\n if (item.name === 'first' || item.name === 'second') {\n setTimeout(() => resolve(), 200);\n } else {\n resolve();\n }\n });\n });\n Utils.runSequentially(items, cb).then(() => {\n expect(cb.calls.argsFor(0)[0].name).toBe('first');\n expect(cb.calls.argsFor(1)[0].name).toBe('second');\n expect(cb.calls.argsFor(2)[0].name).toBe('third');\n d();\n });\n });\n\n it('handles empty items array', (done) => {\n let items = [];\n Utils.runSequentially(items, () => {})\n .catch(e => {\n done.fail(e, '', 'expected no error');\n throw e;\n })\n .then(() => {\n done();\n });\n });\n});\n\ndescribe('the Utils.createSrcFileRegex function', () => {\n it('matches script tag with double quotes', () => {\n expect('<script src=\"scripts/vendor-bundle.js\"></script>'.match(Utils.createSrcFileRegex('scripts', 'vendor-bundle'))).not.toBeFalsy();\n });\n it('matches script tag with single quotes', () => {\n expect('<script src=\\'scripts/vendor-bundle.js\\'></script>'.match(Utils.createSrcFileRegex('scripts', 'vendor-bundle'))).not.toBeFalsy();\n });\n it('matches script tag without quotes', () => {\n expect('<script src=scripts/vendor-bundle.js></script>'.match(Utils.createSrcFileRegex('scripts', 'vendor-bundle'))).not.toBeFalsy();\n });\n it('does not match other bundles', () => {\n expect('<script src=scripts/app-bundle.js></script>'.match(Utils.createSrcFileRegex('scripts', 'vendor-bundle'))).toBeFalsy();\n });\n});\n\ndescribe('the Utils.moduleIdWithPlugin function', () => {\n it('generates requirejs style module id', () => {\n expect(Utils.moduleIdWithPlugin('foo/bar', 'plugin', 'require')).toBe('plugin!foo/bar');\n });\n\n it('generates systemjs style module id', () => {\n expect(Utils.moduleIdWithPlugin('foo/bar', 'plugin', 'system')).toBe('foo/bar!plugin');\n });\n\n it('complains unknown type', () => {\n expect(() => Utils.moduleIdWithPlugin('foo/bar', 'plugin', 'unknown')).toThrow();\n });\n});\n\ndescribe('the Utils.couldMissGulpPreprocess function', () => {\n it('returns false for js/html/css files', () => {\n expect(Utils.couldMissGulpPreprocess('foo/bar')).toBeFalsy();\n expect(Utils.couldMissGulpPreprocess('foo/bar.js')).toBeFalsy();\n expect(Utils.couldMissGulpPreprocess('foo/bar.html')).toBeFalsy();\n expect(Utils.couldMissGulpPreprocess('bar.css')).toBeFalsy();\n });\n\n it('returns true for unknown file extension', () => {\n expect(Utils.couldMissGulpPreprocess('foo/bar.json')).toBeTruthy();\n expect(Utils.couldMissGulpPreprocess('foo/bar.yaml')).toBeTruthy();\n });\n});\n\ndescribe('the Utils.nodejsLoad function', () => {\n let mockfs;\n\n beforeEach(() => {\n mockfs = require('mock-fs');\n const fsConfig = {};\n mockfs(fsConfig);\n });\n\n afterEach(() => {\n mockfs.restore();\n });\n\n it('load file first', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar')] = 'bar';\n fsConfig[path.join('foo', 'bar.js')] = 'js';\n fsConfig[path.join('foo', 'bar.json')] = 'json';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar'));\n });\n\n it('load .js file first', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar.js')] = 'js';\n fsConfig[path.join('foo', 'bar.json')] = 'json';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar.js'));\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar.js'))).toBe(path.resolve('foo', 'bar.js'));\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar.json'))).toBe(path.resolve('foo', 'bar.json'));\n });\n\n it('load .json file', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar.json')] = 'json';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar.json'));\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar.json'))).toBe(path.resolve('foo', 'bar.json'));\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar.js'))).toBeUndefined();\n });\n\n it('load directory', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'index.js')] = 'bar/index';\n fsConfig[path.join('foo', 'bar', 'index.json')] = 'bar/index.json';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'index.js'));\n });\n\n it('load directory .json', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'index.json')] = 'bar/index.json';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'index.json'));\n });\n\n it('load directory with package.json', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'package.json')] = '{\"main\": \"lo.js\"}';\n fsConfig[path.join('foo', 'bar', 'lo.js')] = 'bar/lo.js';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'lo.js'));\n });\n\n it('load directory with package.json browser field', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'package.json')] = '{\"main\": \"lo2.js\", \"browser\": \"lo.js\"}';\n fsConfig[path.join('foo', 'bar', 'lo.js')] = 'bar/lo.js';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'lo.js'));\n });\n\n it('load directory with package.json browser \".\" ", "mapping', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'package.json')] = '{\"main\": \"lo2.js\", \"browser\": {\".\": \"", "lo.js\"}}';\n fsConfig[path.join('foo', 'bar', 'lo.js')] = 'bar/lo.js';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'lo.js'));\n });\n\n it('load directory with package.json browser field', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'package.json')] = '{\"main\": \"lo2.js\", \"module\": \"lo.js\"}';\n fsConfig[path.join('foo', 'bar', 'lo.js')] = 'bar/lo.js';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'lo.js'));\n });\n\n it('load directory with package.json, case2', () => {\n const fsConfig = {};\n fsConfig[path.join('foo', 'bar', 'package.json')] = '{\"main\": \"lo.js\"}';\n fsConfig[path.join('foo', 'bar', 'lo.js', 'index.js')] = 'bar/lo.js/index.js';\n mockfs(fsConfig);\n expect(Utils.nodejsLoad(path.resolve('foo', 'bar'))).toBe(path.resolve('foo', 'bar', 'lo.js', 'index.js'));\n });\n});\n\ndescribe('the Utils.removeJsExtension function', () => {\n it('keep other extension', () => {\n expect(Utils.removeJsExtension('a.html')).toBe('a.html');\n expect(Utils.removeJsExtension('c/d.css')).toBe('c/d.css');\n expect(Utils.removeJsExtension('c/d.min')).toBe('c/d.min');\n });\n it('strips .js extension', () => {\n expect(Utils.removeJsExtension('a.js')).toBe('a');\n expect(Utils.removeJsExtension('c/d.js')).toBe('c/d');\n expect(Utils.removeJsExtension('c/d.min.js')).toBe('c/d.min');\n });\n});\n" ]

{ "pile_set_name": "Github" }

[ 0.0011295788284653866, 0, 0.0020242914979757085 ]

[ "Project Abstract The long-term goals of the proposed project are to understand the complicated origins of the spinal cord injury (SCI) induced muscle paresis, atrophy, weakness, and muscle contractures that often result in a limited range of joint motion and progressive changes in intrinsic muscle mechanical properties. ", "In particular, our proposed research plan relies on several recently developed novel surface electromygram (EMG) techniques to investigate controversial concepts about caudal motoneuron degeneration after a spinal injury. ", "Using motor unit number index measurements and high-density surface EMG recording and processing techniques, we will determine whether motor unit structure and function changes of paralyzed muscles, potentially due to caudal motoneuron degeneration, can be captured via three specific aims. ", "Namely, we plan to assess whether there is evidence for motoneuron degeneration caudal to spinal injury using estimates of motor unit numbers in paralyzed muscles (Aim 1), and using the recorded spontaneous EMG activities in resting paralyzed muscles (Aim 2). ", "In addition, we will examine alterations in motor unit action potential propagation patterns and innervation zones, as a marker of motoneuron loss and subsequent muscle fiber reinnervation in paralyzed muscles, thus providing secondary evidence for motoneuron degeneration caudal to spinal injury (Aim 3). ", "The methods used in this study are noninvasive, potentially convenient to use, and offer valuable information beyond that provided by needle-based EMG and other routine electrophysiological methods. ", "The findings from these novel methods will enhance our understanding of the pathophysiology of potential motoneuron degeneration in SCI. ", "This will provide guidance for the development of rehabilitation strategies and devices for restoration of normal muscle functions. ", "The findings from this study also have important clinical value for the diagnosis and treatment of spinal injury, improve outcome measurements, and help evaluate the effects of medication or therapies." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.006211180124223602, 0.0045045045045045045, 0.003436426116838488, 0.0038461538461538464, 0, 0.005025125628140704, 0.0072992700729927005, 0, 0 ]

[ "Table 5f lists 36 tools for which Caribbean coastal region respondents were asked to rate importance for planning practice, analysis, and research. ", "The five tools with the highest percentage of very high or high importance ratings from respondents are:\n\nImpervious Surface Analysis Tool (86%);\n\nHazard Assessment Template1 (73%);\n\nHazards U.S. Multi-Hazard (HAZUS-MH) (73%);\n\nHistorical Hurricane Tracks IMS (73%); and\n\nSea Level Rise & Coastal Flood Frequency Viewer2 (73%).", "\n\nThe two tools with the highest percentage of low or very low importance or \"Not Applicable\" ratings from respondents are:" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.0030581039755351682, 0 ]

[ "House and Land Package\n\nLot 1298 Yatala Street, Pimpama - Gainsborough Greens\n\n$468,600.00 Complete Turn-Key Package\n\nOur Driftwood 223 design in a fantastic house and land package. ", "It is based on our Primo inclusions including features like fixed site costs, full turf and landscaping, colorbond roof and sarking, exposed aggregate driveway, carpets and main floor tiling, dishwasher, clothes line, letterbox and much more.", "\n\nThe Driftwood 223 is a 3 bedroom home, with a study and multi-purpose room, both of which could easily be converted to that 4th bedroom. ", "The Driftwood features a Master Suite that includes a huge ensuite and WIR, a walk in pantry with refridgerator space and preparation bench, and an under roof alfresco off the spacious living area. ", "All this in a compact home that can sit on a 12.5m wide block, without sacrificing any design features." ]

{ "pile_set_name": "Pile-CC" }

[ 0.016483516483516484, 0.004132231404958678, 0, 0.015151515151515152, 0 ]

[ "CHAPEL HILL, N.C. – North Carolina has reached an agreement with Mack Brown to once again coach the Tar Heels, multiple sources have confirmed.", "\n\nA press conference is expected Tuesday. ", "Brown has already begun efforts to assemble his coaching staff, according to sources.", "\n\nUNC was intent on completing the coaching search quickly despite making the decision to dismiss Larry Fedora in the final days of the regular season, according to a source. ", "The Tar Heels concluded their 2018 season with a loss to N.C. State on Saturday to fall to 2-9 (1-7 ACC). ", "Fedora was 45-43 in his seven seasons in Chapel Hill.", "\n\nBrown, 67, has spent the past five years as a college football analyst for ESPN after an illustrious coaching career. ", "The Cookeville, Tenn. native amassed a 244-122 record in 30 years as a head coach. ", "After stints at Appalachian State (1983) and Tulane (1985-87), he first took the UNC job in 1988 and rebounded from back-to-back 1-10 records to deliver winning seasons in each of the next eight years, highlighted by top-10 national rankings in the final AP Poll in 1996-97.", "\n\nBrown, known for his southern gentleman charm and shrewd recruiting ability, placed an emphasis on in-state rivalries by awarding his Tar Heel teams with plaques for successfully beating N.C. State, Duke and Wake Forest in a season. ", "UNC was 21-3 against its in-state opponents from 1990-97 and was a perfect 15-0 in Brown’s final five seasons in Chapel Hill.", "\n\nFollowing the 1997 season, Brown left UNC to accept the head coaching position at Texas and compiled a 158-48 record in Austin over the next 16 seasons. ", "The Longhorns won the 2005 national championship and played in the title game again in 2009. ", "Texas also won the Big 12 Championship twice and Big 12 South Division six times. ", "Brown has won national coach of the year honors twice, Big 12 Coach of the Year twice and ACC Coach of the Year once.", "\n\nHis teams have won double-digit games in a season 12 times in his last 21 years of coaching.", "\n\nDespite living in Austin and working for ESPN, Brown has been a frequent visitor to Chapel Hill. ", "He served as a mentor to Fedora, who thanked Brown during his introductory press conference at UNC, and was honored at Kenan Stadium in August for his induction into the College Football Hall of Fame. ", "Brown has been open about his desire to return to the sideline. ", "He expressed interest in the Arizona State job in November 2017, telling Arizona Sports 98.7 FM, “I’ve got one more good run in me.”", "\n\nBrown discussed the requirements of a potential return to coaching in an interview with Austin TV station KVUE ABC in April.", "\n\n“I talked to Dick Vermeil when I first quit and he waited 17 years before he went back,” Brown said. “", "I've interviewed a couple of places. ", "Sally and I have talked about it. ", "I won't go back unless it's somewhere that they really need us, it's somewhere we want to live.”", "\n\nBrown’s 244 career wins rank 10th all-time at the FBS level of college football. ", "His 69 wins at UNC are tied for second-most all-time. ", "He needs four wins to become the school’s all-time winningest football coach, surpassing Dick Crum (72)." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.013986013986013986, 0, 0.011764705882352941, 0.011428571428571429, 0.009433962264150943, 0, 0.008333333333333333, 0, 0.014598540145985401, 0.00851063829787234, 0.016, 0.012903225806451613, 0.010752688172043012, 0, 0.017094017094017096, 0, 0.030303030303030304, 0.01990049751243781, 0.015625, 0.007575757575757576, 0.023809523809523808, 0.019230769230769232, 0, 0.029411764705882353, 0, 0.012048192771084338, 0.018518518518518517, 0.009615384615384616 ]

[ "Read all about it - You can't afford to be without this twice-weekly newsletter - sign up today to get your breaking streaming and digital media news!", "\n\nOccasional announcements sent by Streaming Media, or on behalf of our advertising partners, on what we feel are important offers, developments, publications, and events in the streaming/online video industry.", "\n\nLearn more about the companies mentioned in this article in the Sourcebook:\n\nWhere will streaming media and entertainment go now that we have the skinny bundle? ", "2016 will be remembered as the year the skinny bundle finally took off. ", "For years, we’d been looking forward to the day when we could ditch our overpriced pay TV service and choose a low-cost skinny bundle instead.", "\n\nNow that skinny bundles are a reality—thanks to Sling TV, DirecTV Now, and Sony PlayStation Vue— consumers find that their bloated pay TV packages aren’t so bad, after all. ", "For one thing, they have all the channels people want. ", "Skinny bundles are great, but only if viewers can get the programs they love. ", "Many consumers find they don’t like limits when it comes to TV content.", "\n\nSo far, no skinny bundle offers a la carte channel selection, and none of them offer cloud DVRs, either. ", "Since they make money serving targeted ads, they don’t let subscribers skip commercials.", "\n\nIf 2016 was the year skinny bundles became a reality, 2017 will be the year they become truly useful. ", "Sling TV began beta testing a cloud DVR late in 2016, and it should be part of the bundle sometime this year. ", "Tablo, which makes over-the-air antennas, is also testing a cloud DVR.", "\n\nSkinny bundle options are limited, but that will also change in 2017. ", "Companies were just dipping their toes in the water last year. ", "DirecTV launched DirecTV Now in November, making the choice to cannibalize its own business before someone else did. ", "The number of cord-cutters increased steadily in 2016 and pay TV subscriber losses mounted, but the major cable and satellite companies aren’t going anywhere just yet.", "\n\nMore streaming options in 2017 will convince more people to cut the cord. ", "While skinny bundles got a lot of attention in 2016, over-the-top (OTT) subscription services got a lot of action. ", "Viewers flocked to them and revenue surged; Digital TV Research Ltd. forecast that global OTT revenues will grow to $64.8 billion by 2021. ", "Last year saw high-profile debuts such as NBCUniversal’s Seeso, Legendary’s Alpha, and an on-demand service from Fullscreen.", "\n\nIt’s no surprise that Netflix continued to dominate in the SVOD market in 2016. ", "The company started the year with a bang when it announced a 130-country rollout at CES, making it available in nearly every country in the world. ", "Netflix has found a winning formula in creating its own original series and movies, which helps it avoid licensing fees while keeping subscribers happy with a steady stream of buzzy releases. ", "People couldn’t stop talking about surprise hit Stranger Things in 2016, although Luke Cage, Orange Is the New Black, and The Crown all had successful releases.", "\n\nNetflix continued to dominate the SVOD market in 2016, beginning with the January announcement that it had rolled out service to 130 more countries, making it available nearly everywhere in the world.", "\n\nHulu ran a distant second during 2016, but that just means it’s trying harder. ", "Hulu released its own original shows, including The Path and 11.22.63. ", "It also announced an ad-free tier in August that let subscribers pay $4 more per month for the pleasure of never sitting through ads. ", "While company CEO Mike Hopkins downplayed the popularity of the tier, fan reaction seems to be strong.", "\n\nHulu spent much of 2016 putting together its own skinny bundle, expected to launch this year and cost around $40 per month. ", "So far, Disney and Twenty-First Century Fox have signed on. ", "Expect Hulu’s bundle to be a major story this year.", "\n\nHulu bet big on original content in 2016, and in 2017 it is set to launch a skinny bundle to compete with DirecTV Now and Sling TV.", "\n\nOne area that finally found its niche in 2016 was TV Everywhere (TVE). ", "While TVE has been around since 2010, it was choked by limited offerings and difficult authentication requirements. ", "This year, comScore and Nielsen finally started measuring views on connected TVs and set-top boxes, giving networks a way to monetize their connected living room views. ", "With that financial incentive, the networks finally started creating living room apps and stocking them with catch-up programs and full seasons. ", "Viewers quickly latched on, making network apps popular on set-top boxes. ", "TVE authentication requirements didn’t get any simpler (despite Adobe announcing support for Apple TV single sign-on APIs in June), but with more premium content freely available, viewers figured out how to input their passwords.", "\n\nOne topic that was everywhere in 2016 was virtual reality (VR) video, as well as 360° video and augmented reality (AR) video. ", "While the actual number of people watching VR video is still low and largely limited to gaming, that didn’t stop it from being one of the hottest areas of the year. ", "Tech companies are rushing to create VR headsets, hoping to cash in on the growing sales (companies sold around 300,000 VR headsets over the 2016 holiday season).", "\n\nVR has more than a few skeptics—people who think the devices are too expensive and too cumbersome— but even more die-hard believers. ", "VR is absolutely not going to be another 3D TV, they said all year. ", "This is not a fad, they insist. ", "They’re probably right, but if we learned one thing about VR in 2016, it’s that this is just the beginning of a long period of research and development. ", "VR won’t truly go mainstream for 5 to 10 years. ", "By that time, headsets will be much smaller and more comfortable, and their price tags will have shrunk. ", "That hasn’t stopped publishers and brands from jumping in now, however, hoping to get an early lead in the hot new area.", "\n\nFinally, no discussion of streaming media and entertainment in 2016 would be complete without mentioning the Summer Olympics in Rio. ", "NBC once again had the U.S. rights to the games, and it partnered with Akamai and its own Playmaker Media to bring more streamed content than ever to American viewers. ", "It streamed live every minute of every event.", "\n\nBy the end of the games, Akamai announced it streamed 3.3 billion minutes from Rio, with 2.7 billion of that live. ", "NBC’s Olympics coverage reached 100 million unique viewers. ", "With the Summer Games being bigger and more popular that its Winter Games counterparts, that’s a record that should stand for about 4 years. ", "In a year that saw tremendous growth in live video events, there was nothing bigger than the Rio Games.", "\n\nAkamai announced that it streamed 3.3 billion minutes from the 2016 Rio Olympics (2.7 billion of those were live), making it the biggest online Olympics ever—until the next one.", "\n\nThat’s the year we left behind, but what about the year to come? ", "To predict how the streaming video world will change in 2017, we called in a few experts.", "\n\nPredicting 2017\n\nOur professional prognosticators include Greg Ireland, research director with IDC, and Joel Espelien, senior advisor with The Diffusion Group (TDG). ", "Americans will see some major skinny bundles launch this year, including entrants from Hulu and YouTube. ", "The area faces challenges in 2017, Ireland believes, and part of that is because the entrenched pay TV services treat skinny bundles as simply a new lower tier of service. ", "They’re a lifeline to keep customers who might otherwise drift away, and a way to maintain subscriber numbers, but they’re not attractive offerings on their own. ", "The limited nature of these bundles makes them unacceptable to many.", "\n\n“The saying goes everyone only watches about 15 channels but everyone’s 15 is different from everyone else’s,” Ireland says. “", "There may be an attractively priced skinny bundle that has 80% of what you want or 70% of what you want but if it doesn’t have those three or four or five other channels are essential then the skinny bundle becomes a nonstarter or it forces you to shift your viewing behavior.”", "\n\nWhat skinny bundles promise consumers are lower-priced options, but what consumers really want are more choices and more content. ", "There’s a way to provide both, and it involves creating strong user experiences and discovery options so that subscribers can find shows and movies that interest them while paying for a small bundle of channels.", "\n\n“The way really to unlock the value of content subscriptions are great user experiences that have elegant and robust content discovery mechanisms whether it’s search, whether it’s recommendations, whether it’s other ways in which consumers can fully exploit all of the content that they subscribe to,” Ireland says. “", "I think consumers want content choice. ", "They want access to lots of content, but that content can’t be valued if it’s not discoverable. ", "I think the efforts around user experience and content discovery have to go hand-in-hand with thinking about adding skinny bundles to the existing portfolio of other larger bundle services.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.004761904761904762, 0.006134969325153374, 0, 0, 0.011428571428571429, 0, 0, 0, 0.009345794392523364, 0, 0, 0.00909090909090909, 0.014285714285714285, 0, 0, 0, 0, 0, 0, 0.007194244604316547, 0.008064516129032258, 0.012195121951219513, 0, 0.005208333333333333, 0.0125, 0, 0, 0.014084507042253521, 0, 0.00980392156862745, 0, 0.016666666666666666, 0, 0, 0, 0, 0.005917159763313609, 0, 0, 0.008733624454148471, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.017857142857142856, 0, 0.017094017094017096, 0.016666666666666666, 0, 0, 0, 0, 0, 0.02976190476190476, 0.009523809523809525, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "package jzhu.com.libdata;\n\nimport android.content.", "Context;\nimport androidx.test.", "InstrumentationRegistry;\nimport androidx.test.runner.", "AndroidJUnit4;\n\nimport org.junit.", "Test;\nimport org.junit.runner.", "RunWith;\n\nimport static org.junit.", "Assert.*;", "\n\n/**\n * Instrumented test, which will execute on an Android device.", "\n *\n * @see <a href=\"http://d.android.com/tools/testing\">Testing documentation</a>\n */\n@RunWith(AndroidJUnit4.class)\npublic class ExampleInstrumentedTest {\n @Test\n public void useAppContext() {\n // Context of the app under test.", "\n Context appContext = InstrumentationRegistry.getTargetContext();\n\n assertEquals(\"jzhu.com.myarchitecture\", appContext.getPackageName());\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0, 0, 0.018867924528301886, 0.030303030303030304, 0, 0.029411764705882353, 0.1111111111111111, 0.014705882352941176, 0.016597510373443983, 0.006211180124223602 ]

[ "30 F.3d 1488\nSaab (Linward)v.", "U.S., Caldwell (Hon. ", "William W.), U.S. District Judge,Daniel (Kim Douglas), Assistant U.S. Attorney,Herrinton (Agent), West (James), U.S. Attorney\nNO. ", "93-7393\nUnited States Court of Appeals,Third Circuit.", "\nJune 01, 1994\n\nAppeal From: M.D.Pa.,", "\nMcClure, J.\n\n\n1\nAFFIRMED.", "\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.06896551724137931, 0.047619047619047616, 0.03076923076923077, 0.03773584905660377, 0, 0.038461538461538464, 0 ]

[ "A Muslim man called Imran has been arrested by the Special Cell of Delhi Police on that charge of attempting to create communal tension in Delhi. ", "According to a report by Jagran, Imran, along with his friends Parvez, Lukmaan and Inshallahum had conspired to create communal disharmony on the day of Holi.", "\n\nAccording to the Jagran report, during interrogation, Imran has admitted that on the day of Holi, he had deliberately slaughtered a cow in Delhi’s Harsh Vihaar to incite communal tension between Hindus and Muslims.", "\n\nIt is also being reported that Imran has a criminal background and currently the Delhi police is in the process of interrogating him.", "\n\nImran comes from a family that has traders and businessmen who deal in selling cows and buffaloes.", "\n\nOn 23rd March 2019, Navbharat Times had reported that body parts of slaughtered animals were found in a farm in Harsh Vihar. ", "Some women had found the body parts in the farm on Holi. ", "The body parts were reportedly found only 500 meters away from the Harsh Vihar police station.", "\n\nAfter the women found the slaughtered animals on Holi, a businessman from the area called Deepak Mawi alerted the police. ", "He informed the police that the body parts of slaughtered animals were found on the boundary wall of Arora Farmhouse.", "\n\nIn fact, reports indicate that after the slaughtered animals were found, a large crowd had gathered in the area who were visibly enraged by the situation. ", "The police informed the nearby police stations as well and the Rapid Action Force was deployed in the area.", "\n\nAccording to reports, the police spoke to the agitated crowd and pacified them. ", "The police then filed a case under IPC section 429 and started their investigation." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0136986301369863, 0.006329113924050633, 0.013888888888888888, 0.007407407407407408, 0, 0.015748031496062992, 0, 0.010638297872340425, 0, 0.008547008547008548, 0, 0.009345794392523364, 0, 0.012048192771084338 ]

[ "Q:\n\nCan not understand ngDoCheck method in lifecycle Hooks for component\n\nFrom Angular documentation:\n\nDetect and act upon changes that Angular can't or won't detect on its own.", "\nCalled during every change detection run, immediately after ngOnChanges and ngOnInit.", "\n\nHow this method can be called during every change detection run if angular can't or won't detect on its own?", "\nCan somebody explain and give an example?", "\n\nA:\n\nAngular calls it when change detection is run instead of or in addition to doing actual change detection of bindings in your component (\"instead of\" if change detection is disabled for your component) so you can do some custom checks or notifications in your custom code. ", "You can check the source of NgClass or NgFor for examples.", "\nYour custom change detection might be more efficient than Angulars default CD.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0 ]

[ "Best Street Art Photography of 2014\n\nArtists from all over the world has created some fascinating art pictures, showcasing here the best of the best street art photography and pictures collected in 2014, enjoy the new year with some art, and that too on the street.", "\n\nNew Banksy\n\nArt in a Frame is like an Eagle in a Birdcage – Blissestraße\n\nGraffiti tribute to Robin Williams\n\nWork of Iranian artist, a1one – Berlin\n\nClique Vodka: Odeith, probably Greece, July 2014\n\nNew Banksy Peice\n\nBanksy proverb, taken 2009 in Graz/AUT. ", "Its already gone by now\n\nWoman in a jar of strawberries, Richmond VA\n\nNearly the whole street were taken to create this earth cracking effect. ", "Brilliant piece of art!", "\n\nThe Origins and Work of Banksy\n\nSpray Paint, Not Bullets – Artist Unknown [5152 * 2898] Chicago, IL\n\nMouse on Leaf by David Zinn in Michigan, USA\n\nHouston, Texas: Malala meets Rosie the Riveter\n\nFound in Paris\n\nAshop Mural, Montreal\n\nIf You Stare At This And Stroke Your Chin You May Feel Intelligent And Cultured”\n\nBest Street Art Photography of 2014\n\nArtists from all over the world has created some fascinating art pictures, showcasing here the best of the best street art photography and pictures collected in 2014, enjoy the new year with some art, and that too on the street.", "\n\nNew Banksy\n\nArt in a Frame is like an Eagle in a Birdcage – Blissestraße\n\nGraffiti tribute to Robin Williams\n\nWork of Iranian artist, a1one – Berlin\n\nClique Vodka: Odeith, probably Greece, July 2014\n\nNew Banksy Peice\n\nBanksy proverb, taken 2009 in Graz/AUT. ", "Its already gone by now\n\nWoman in a jar of strawberries, Richmond VA\n\nNearly the whole street were taken to create this earth cracking effect. ", "Brilliant piece of art!", "\n\nThe Origins and Work of Banksy\n\nSpray Paint, Not Bullets – Artist Unknown [5152 * 2898] Chicago, IL\n\nMouse on Leaf by David Zinn in Michigan, USA\n\nHouston, Texas: Malala meets Rosie the Riveter\n\nFound in Paris\n\nAshop Mural, Montreal\n\nIf You Stare At This And Stroke Your Chin You May Feel Intelligent And Cultured”" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.015384615384615385, 0, 0, 0.0017152658662092624, 0.015384615384615385, 0, 0, 0.0031645569620253164 ]

[ "How much can I get as a tax-free gift?", "\n\nHow much money can my father give me as a gift without paying tax on it?Corbie, Peterhead, Scotland.", "\n\nCash gift: How much can my father give me tax-free?", "\n\nLaura Howard, of This is Money, replies: If you are gifted money then you will not have to pay income tax on the sum.", "\n\nYour father can gift a maximum of £3,000 each year to you without creating a potential Inheritance Tax liability (plus any unused balance of £3,000 from the previous tax year).", "\n\nHowever, IHT only applies if your father was to die within seven years of making the gift and his estate was worth over £325,000 – a threshold which the government says it will freeze until 2015.", "\n\nAssets and cash over this threshold will be taxed at 40%.", "\n\nMarried couples and civil partners can transfer their IHT allowance to a surviving partner, so if your parents are married and both still alive they could potentially increase their IHT allowance to £650,000.", "\n\nHMRC adds: 'Any regular gifts you make out of your after-tax income, not including your capital, are exempt from Inheritance Tax. ", "These gifts will only qualify if you have enough income left after making them to maintain your normal lifestyle.'" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.0196078431372549, 0, 0.008403361344537815, 0.0056179775280898875, 0.005076142131979695, 0, 0, 0.007575757575757576, 0 ]

[ "Amounts for tuition and books & supplies will be reduced for less than full-time enrollment which can affect your loan eligibility. ", "Please reference the following link for less than full-time enrollment, and for full details regarding the costs of attendance: http://finserve.byu.edu/content/tuition-and-general-fees\n\n*Personal expenses include the cost of BYU health insurance premiums for a single student. ", "BYU health insurance is required if you are not covered by another annual policy. ", "Students are billed each semester and term for the entire academic year including future periods of non-attendance.", "\n\nFinancial Verification for International Applicants\n\nInternational students who are admitted to the university will need to verify finances covering the cost of attendance for the first year. ", "You will need to complete the following requirements:\n\nDeposit Policy\nIn order for students to be successful academically at BYU, they must have a solid financial plan. ", "All international applicants for undergraduate degrees are required to deposit $4,000 in an escrow account at BYU following notification of their admission. ", "Students will not be able to register for classes, nor will any student visa paperwork be initiated until the deposit is paid. ", "Read the full Deposit Policy here.", "\n\nFinancial Verification\nAll admitted international students are required to provide verification of financial ability. ", "Admitted international students must complete the affidavit of support accompanied with the most recent copy of a bank statement for them and/or their sponsor. ", "A registration hold is placed on the student's file until finances have been adequately proven.", "\n\nSponsors\nGenerally speaking, international students require the support of a sponsor to prove financial ability. ", "Students are responsible for securing this sponsor (i.e., parents, government, other). ", "This individual (or these individuals) should be a viable financial resource to the student." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.0036101083032490976, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nSL DVI-D + HDMI = DL DVI-D, Possible?", "\n\nUsing Intel HD 3000 graphics card, is it possible to combine the bandwidth of a single link DVI-D and HDMI (using an adapter?) ", "and support a monitor with resolution 2560x1600 monitor instead of 2 1920x1200 monitors?", "\n\nA:\n\nFirst, the reverse:\nA single connector with a dual-link DVI port usually drives a single display. ", "\nIt is not capable of getting split in two and driving two independent low resolution displays.", "\nYou can use extra hardware to clone the signal and drive two monitors (with identical contents on the screen) or you can use extra hardware like the (now older) \nMatrox dualhead2go's\nBoth options require extra hardware.", "\n\nVice versa, you can not combine two single-link DVI connections into a dual-link DVI connection. ", "Not without using extra hardware. (", "and I have found none of those during a quick search on the web).", "\nHowever, assuming such hardware exists:\n\nYou will need some active (high resolution, else why would you need dual-link) convertors. ", "These are unlikely to be cheap.", "\nEntry level video cards (easily surpassing the performance of a HD3000) are cheap and do come with dual-link DVI.", "\n\nPS: If you do search the web, do not get confused with the DMS59 connector, you can not use that 'reversed' to solve you problem. ", "Even though it looks a lot like DVI.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0.009615384615384616, 0, 0.004545454545454545, 0.010101010101010102, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0 ]

[ "Quick Bytes with Ralph Pagano: Fried Yakisoba Noodle Sandwich\n\nJuly 7, 2016\n\nGreat Tips for Yakisoba Noodles\n\nJoin chef Ralph Pagano as he inspires viewers to create fried noodle sandwiches with Maruchan’s yakisoba noodles. ", "Yakisoba noodles in Japan are commonly referred to as noodles that are pan-fried, and yakisoba refers to a dish of pan-fried noodles mixed with seasonings, vegetables, and sliced meat. ", "Maruchan Yakisoba products cook in only four minutes and feature hearty vegetables and noodles." ]

{ "pile_set_name": "Pile-CC" }

[ 0.022321428571428572, 0.005405405405405406, 0.010526315789473684 ]

[ "Soccer Supporters Clash Over IP Rights Ahead of World Cup\n\nQuinn New York partners Robert Raskopf, Todd Anten and Julia Beskin are on the complaint., ", "which says the Federation has “threatened to hijack the foundation’s trademarks for its own use—likely in an effort to capitalize on lucrative business opportunities when the United States hosts the World Cup in 2026.\"", "\n\nThe foundation says it’s been using the name to support youth soccer in the United States, particularly among disadvantaged kids, for more than 20 years. ", "But the federation—the governing body that oversees the U.S. national teams and world-class competition—registered the name with the U.S. Patent and Trademark Office in the late 1990s and recently told the foundation to stop using it.", "\n\nThat led to Thursday’s complaint, filed in the District of Columbia by Quinn Emanuel Urquhart & Sullivan. ", "It alleges the groups have “co-existed peacefully” while the foundation raised more than $100 million for soccer pitches, uniforms and equipment.", "\n\nNow the Federation has “threatened to hijack the foundation’s trademarks for its own use—likely in an effort to capitalize on lucrative business opportunities when the United States hosts the World Cup in 2026,” according to the complaint, which is signed by Quinn D.C. associate Scott Lerner. ", "Quinn New York partners Robert Raskopf, Todd Anten and Julia Beskin are also on the complaint.", "\n\nThe foundation describes itself as the major charitable organization of soccer in the United States. ", "It was set up with $50 million in surplus funds from the 1994 World Cup. ", "Since then it’s used the U.S. Soccer Foundation name on fundraising material sent to prospective donors, on kids’ soccer jerseys, on its website and social media pages and on the surface of pitches across the country, according to the complaint. ", "The organization says it raised $18 million in the last year alone.", "\n\nThe complaint acknowledges that the federation is listed as the owner of the U.S. Soccer Foundation marks. ", "But, it contends, the two organizations “have shared the understanding that the foundation is the actual owner.”", "\n\nThe governing federation operates its own U.S. Soccer Development Fund. ", "The complaint alleges that the federation hasn’t used the U.S. Soccer Foundation mark in at least the last three years, if ever. ", "But the federation has “recently and abruptly done an about-face, demanding that the foundation cease using the Foundation Marks and indicating an intention to use them in the future.”", "\n\nThe complaint seeks a declaration of non-infringement, an order canceling the federation’s registrations and an award of damages for unfair or deceptive trade practices.", "\n\nLawrence Siskind, a trademark attorney at Coblentz Patch Duffy & Bass who’s not involved in the case, said a key issue is likely to be abandonment. ", "If there is indeed no evidence the federation used the marks over the last three years, that could create a legal presumption that the marks have been abandoned. “", "It can be rebutted,” he said, “but the longer the time period that’s gone by, the harder it is to rebut.”", "\n\nScott Graham\n\nScott Graham focuses on intellectual property and the U.S. Court of Appeals for the Federal Circuit. ", "He writes ALM's Skilled in the Art IP briefing. ", "Contact him at sgraham@alm.com.", "\n\nThe stipulation does not affect the rest of the litigation, which seeks $2.8 million in restitution from the Trump Foundation and to ban Trump and his children from serving on the board of a nonprofit for a number of years.", "\n\nA look at several unique trademark cases where the plaintiff fashion brand proactively sought to invalidate a competitor’s non-traditional trademarks, an action which reflects a push back on increasingly aggressive litigation tactics by fashion brands seeking to blur the lines between a non-protectable fashion trend and a protectable trademark.", "\n\nFeatured Firms\n\nLaw Offices of Mark E. Salomone\n\n2 Oliver St #608\n\nBoston,\nMA02109\n\n857-444-6468\n\nwww.marksalomone.com\n\nGary Martin Hays & Associates\nP.C.\n\n235 Peachtree St NE #400\n\nAtlanta,\nGA30303\n\n800-898-4297\n\nwww.garymartinhays.com\n\nSmith & Hassler\n\n225 N Loop W #525\n\nHouston,\nTX77008\n\n(877) 777-1529\n\nwww.smithandhassler.com\n\nPresented by BigVoodoo\n\nMore from ALM\n\nPremium Subscription\n\nWith this subscription you will receive unlimited access to high quality, online, on-demand premium content from well-respected faculty in the legal industry. ", "This is perfect for attorneys licensed in multiple jurisdictions or for attorneys that have fulfilled their CLE requirement but need to access resourceful information for their practice areas.", "\n\nTeam Accounts\n\nOur Team Account subscription service are for legal teams of four or more attorneys. ", "Each attorney is granted unlimited access to high quality, on-demand premium content from well-respected faculty in the legal industry along with administrative access to easily manage CLE for the entire team.", "\n\nBundle Subscriptions\n\nGain access to some of the most knowledgeable and experienced attorneys with our 2 bundle options! ", "Our Compliance bundles are curated by CLE Counselors and include current legal topics and challenges within the industry. ", "Our second option allows you to build your bundle and strategically select the content that pertains to your needs. ", "Both option are priced the same.", "\n\nFrom Data to Decisions\n\nExclusive Depth and Reach.", "\n\nLegal Compass includes access to our exclusive industry reports, combining the unmatched expertise of our analyst team with ALM’s deep bench of proprietary information to provide insights that can’t be found anywhere else.", "\n\nBig Pictures and Fine Details\n\nLegal Compass delivers you the full scope of information, from the rankings of the Am Law 200 and NLJ 500 to intricate details and comparisons of firms’ financials, staffing, clients, news and events.", "\n\nGOLD, ALBANESE, BARLETTI & LOCASCIO, LLC\n\nALM Legal Publication Newsletters\n\nSign Up Today and Never Miss Another Story.", "\n\nAs part of your digital membership, you can sign up for an unlimited number of a wide range of complimentary newsletters.", "\nVisit your My Account page to make your selections. ", "Get the timely legal news and critical analysis you cannot afford to miss.", "\nTailored just for you. ", "In your inbox. ", "Every day." ]

{ "pile_set_name": "Pile-CC" }

[ 0.02666666666666667, 0, 0, 0.004273504273504274, 0.009259259259259259, 0, 0.0033783783783783786, 0.0425531914893617, 0, 0, 0.0040650406504065045, 0, 0.009174311926605505, 0, 0.013513513513513514, 0.007751937984496124, 0.005434782608695652, 0, 0.013333333333333334, 0, 0, 0.03418803418803419, 0.041666666666666664, 0.03225806451612903, 0.008888888888888889, 0, 0.021621621621621623, 0.005208333333333333, 0, 0.004784688995215311, 0, 0.00819672131147541, 0, 0, 0.019230769230769232, 0.008928571428571428, 0.008583690987124463, 0.02459016393442623, 0, 0, 0, 0, 0, 0 ]

[ "/*\n ***************************************************************************************\n * Copyright (C) 2006 EsperTech, Inc. All rights reserved. ", " *\n * http://www.espertech.com/esper *\n * http://www.espertech.com *\n * ---------------------------------------------------------------------------------- *\n * The software in this package is published under the terms of the GPL license *\n * a copy of which has been included with this distribution in the license.txt file. ", " *\n ***************************************************************************************\n */\npackage com.espertech.esper.common.internal.supportunit.util;\n\npublic class SupportCtorObjectArray {\n private Object[] arguments;\n\n public SupportCtorObjectArray(Object[] arguments) {\n this.arguments = arguments;\n }\n\n public Object[] getArguments() {\n return arguments;\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.008492569002123142, 0 ]

[ "this is how i feel when someone tells me to meet them at the jaffa gate then i remember i live in jerusalem\n\n1,633 shares" ]

{ "pile_set_name": "OpenWebText2" }

[ 0 ]

[ "Immunoasssay based on the antibody-conjugated PAMAM-dendrimer-gold quantum dot complex.", "\nAn immunoassay based upon photoluminescent gold quantum dots aimed at detecting human IgG in aqueous solution from micromolar to nanomolar concentrations is described." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.022988505747126436, 0.005952380952380952 ]

[ "Patterns of outpatient care utilization by seniors under the National Health Insurance in Taiwan.", "\nTaiwan has one of the fastest growing aging populations in the world, which makes the effective allocation of scarce medical resources a key issue. ", "This paper investigates patterns in the use of outpatient services by elderly individuals in Taiwan under the National Health Insurance (NHI) program. ", "We assembled a random sample from the NHI Research Database in Taiwan, comprising 50% of all claims made for elderly people (65 years old) in 2010 (n 1,239,836 beneficiaries) including 14 variables. ", "In 2010, individuals aged 65 years or older comprised 10.74% of the population of Taiwan, and accounted for 11.39% of all physician and outpatient visits. ", "The rate of medical care visits was 28.54 ± 21.23 (Standard deviation) times per person per annum, with a higher rate for women, those in the 80-84 age group, low-income beneficiaries, and the inhabitants of offshore islands. ", "The three most frequent diagnoses for elderly patients were hypertension, diabetes, and acute upper respiratory infections. ", "The mean insured medical costs per person per annum were US Dollars 1,132, with higher expenses for men, those in the 80-84 age group, and those inhabiting urban areas. ", "This study employed nationally representative data in the detection of patterns in outpatient care utilization by elderly individuals in Taiwan. ", "Medical care providers and policymakers should be fully aware of the complex patterns unique to older patients. ", "The results of this study could be used as a benchmark with which to assess the impact of future medical care policy on elderly people." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.010309278350515464, 0, 0.013245033112582781, 0.005025125628140704, 0, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nCloning WebService\n\nIs there a way to clone WebService object in as3? ", "The ObjectUtil method seems to throw an error.", "\nIf not is there a way to cache wsdl and assign it to new WebService object so that constant loading of wsdl can be omitted?", "\n\nA:\n\nI can acomplish what I need using AsyncToken class. ", "It is the correct solution to my problem. ", "With AsyncToken I can re-use the same WebService object.", "\nIt does not address the issue of someone needing to make a clone of WebService class.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.02702702702702703, 0.021739130434782608, 0.008064516129032258, 0.017241379310344827, 0, 0.017857142857142856, 0.011627906976744186, 0 ]

[ "The current research work, entitled ?", "Milton Santos: Global Thought and Education? ", "presents a study on the intellectual Milton Santos (1926 ? ", "2001), a professor who…\n(more)\n\n▼\n\nThe current research work, entitled ?", "Milton Santos: Global Thought and Education? ", "presents a study on the intellectual Milton Santos (1926 ? ", "2001), a professor who intensely fuels the debate about elements which are part of the world reality and, especially the Brazilian one. ", "The questioning that surrounded such study was based on the need of constant investigations about the historical complexity of present, the contradictory reality in which Education is inserted, as well as that Education might be understood and transformed into this social-historical context and take some posture which is contrary to the capital logic. ", "We kept our research into the study of the concepts of ?", "Space?, ?", "Globalization?, ", "`Globalitarism?, ?", "Only thought?, ?", "Universal Thought?, ?", "Citizenship? ", "and ?", "Experience?, ?", "wisdom of lack? ", "which represent some of the theoretical elements that match with professor Milton Santos?s thoughts, making a parallel with the formal contemporary Brazilian Education. ", "Based on the theoretical methodological assumptions of the Marxist theory, we sought to locate the problematic in the macro-structural context, relating it to the particularities of the concepts studied, trying to make a parallel with the totality social classes struggle, contradiction and hegemony. ", "The study about MILTON concepts provide analytical subsidies for the understanding of the social-historical contemporary context in which the policies for the formal Brazilian Education are and where discussions regarding its transformation are postulated. ", "We tried to establish, according to the MILTON concept of intellectual, its relevancy for the organization and social mobilization, as well as its relation to Education. ", "The research made by the intellectual Milton Santos shows the dimension of the fundaments of a new Geography, and although it is not a common reference in the Education field, the concepts made by him contribute to the comprehension of a real representation of the social context in which Education is inserted, and therefore, we considered the importance of the detailed examination about his thought. ", "However, we do not intend to use up the discussions around Professor Milton Santos thoughts with this research, but only raise the knowledge and debate about part of the concepts present in his work for the real theoretical and practical coping turned to the debate on Education, History of Education, Education Policy, development and performance of intellectuals throughout history Brazil.", "\n\n▼ Resumo: Este estudo teve por objetivo reconstituir historicamente a forma??o do saber e das pr?ticas de enfermagem no campo da assist?ncia psiqui?trica no Brasil, no per?odo compreendido entre os anos 20 e 50, utilizando-se dahist?ria oral corno m?todo de pesquisa. ", "Atrav?s da an?lise documental e da an?lise do conte?do dos depoimentos de 49 informantes que atuaram nas primeiras institui??es psiqui?tricas p?blicas criadas no pa?s foi poss?vel identificar as motiva??es que levavam o pessoal de enfermagem a ingressar no campo da assist?ncia psiqui?trica no referido per?odo; as formas de prepara??o utilizadas para qualificar o pessoal de enfermagem para irnplementar o projeto de transforma??o dos hospitais psiqui?tricos em instrumento terap?utico o modo de participa??o da enfermagem na implementa??o dos m?todos de tratamento ent?o adotados e as condi??es de trabalho a que estes agentes submetiam-se. ", "Deste modo, verificou-se que tanto os agentes de enfermagem quanto as pr?ticas por eles implementadas constituiram um elemento fundamental para a constitui??o e consolida??o das institui??es psiqui?tricas enquanto dispositivos disciplinares.; ", "Abstract: This study had as its aim to reconstitute historically the formation of knowledge and practices of nursing in the field of psychiatric assistance in Brazil, in the period from the 20s to 50s, utilizing the \"Oral History\" as a method of research. ", "Through the documental and contend analysis of the declar?tions of 49 informants who acted in the earliest public psychiatric institutions established in this country, it was possible to identify the motivations that drove the staff of nursing to ingress in the field of psychiatric assistance in the period mentioned; the ways of preparing utilized to qualify the staff af nursing to introduce the project of transformation of the psychiatlic hospitais in therapeutic instruments; the way of the participation of nursing in the implantation of the methods of treatment adopted at that epoch and the conditions of work that those agents were submitted. ", "Thus, it was verified that both the agents and the practices implanted by them constituted a fundamental element to the constitution and consolidation of the psychiatric institutions as discipline environrnents.", "\nAdvisors/Committee Members: Cabral, Mara Aparecida Alves, 1951- (advisor).", "\n\n► The general objective of this academic work is to discuss and to reflect on the contribution of philosophical studies in understanding concepts and learning transmitted…\n(more)\n\n▼ The general objective of this academic work is to discuss and to reflect on the contribution of philosophical studies in understanding concepts and learning transmitted in Accounting. ", "The specific objective came outlining the research issue itself that is to know which are the elements or philosophical presuppositions applied to Accounting. ", "The research methodology is based on two bibliographic surveys: one to know the issues and concerns of the Philosophy and the other to locate them in the various disciplines and researches developed in Accounting. ", "To ensure the scientific character, was observed if had the employment or treatment of the questions or philosophical concerns to explain accounting or organizational matters, with the preservation of its connotative or denotative direction assimilated in the Philosophy. ", "This academic production is qualitative and is treaty at essay format to achieve its objectives and provide flexibility to display ideas and articulation of reasonings. ", "In the data analysis, is verified the satisfaction of the conditional terms of the hypothesis and the attending to its variables, being observed its validity for each element or philosophical presupposition positioned in the delimitation of the research, that does to conclude its applied into Accountancy. ", "It is also at this moment that is answered the research question. ", "And the complex whole formed by the elements or presuppositions applied to Accountancy shows the revealing perspective of an philosophical system in Accounting. ", "At final, the concluding remarks are presented.", "\nAdvisors/Committee Members: Peters, Marcos Reinaldo Severino (advisor), CPF:02312039850 (advisor), http://lattes.cnpq.br/2958522536547146 (advisor).", "\n\n► Through this bibliographic and documental research we have prepared an analysis of the bookkeeping evolution from 20th century on. ", "We has also made a retrospect…\n(more)\n\n▼ Through this bibliographic and documental research we have prepared an analysis of the bookkeeping evolution from 20th century on. ", "We has also made a retrospect of past years to base the work development. ", "During the research evolution we came to the conclusion that accounting, was the beginning use by tradesmen only to control their business without concerning formal, normative and technical aspects in order to elaborate this same accounting and its results. ", "Evolution of accounting along the times has determined the preoccupation with standardization, and normalization regarding the correct application of the law, with clear goals of achieving criterion and bookkeeping systems as well a regulation of the verification of taxes over the results. ", "In the Brazilian context the evolution of accounting demonstrates clear influence of legislation being through the commercial code published in 1850 or through special laws of income taxes. ", "We also have the legislation of public governmental departments over the financial market (Banco Central) and movable market (CVM - Comiss??o de Valores Mobili??rios). ", "During the research development we have come to the conclusion that the fight of Brazilian scholars in order to recognize this profession, create a labour union, regulation, fiscalization and the creation of special courses to guide new professionals was also very important. ", "In this work, through bibliographic and documental research we tried to show all the steps taken to ensure the solidification, harmonization and standardization of accounting or bookkeeping rules, making it possible to developing Brazilian accounting.", "\nAdvisors/Committee Members: Cei, Nena Geruza (advisor), CPF:88888888888 (advisor).", "\n\nThe present study aims to analyze the perceptions of students and parents of a 2nd Cycle of a Secondary Education Angolan School, with the objective of preventing bullying, through individual and collective dialogue and accountability in the educational community. ", "The selection of bullying for this study is due to the fact that it is a worrying phenomenon, which has been increasing the levels of violence in the school. ", "This has contributed to the dissatisfaction of many students, given the confrontation between victims and perpetrators, in the indoor and outdoor school spaces, especially in the playground. ", "With the above presented objective, a quantitative research has been carried out, developing and applying two questionnaire surveys to students and their respective parents/ caregivers. ", "The analysis of the obtained data confirms that, in relation to the bullying issue, the respondents are aware of the importance of dialogue, empathy, accountability and information/\ntraining of members of the educational community. ", "Globally, the teacher is considered essential in helping victims and preventing cases of bullying. ", "However, there is not always the necessary family dialogue, and many parents are unaware of the involvement of children in situations of violence. ", "Then, it can be concluded that the prevention of bullying involves a joint effort between the school and the family, based on dialogue and collaborative work in the community.", "\n\nThe thesis analyses Rubem Fonsecas and Pedro Juan Gutiérrezs fiction under the point of view of abjection, disgust, shock and trauma, their similarities and differences, starting with the different notions of Realism and reaching dirty realism expression used to identify a generation of young American and Latinamerican writers that started to publish in the 1980s. ", "It also broaches the strategies to deal with dictatorship in Brazil and in Cuba, drawing a brief map of the contemporary Cuban literary scenario. ", "Finally, the work discusses the empty realism, which is marked by the loss of the faith in the Utopia. ", "The project is supported by the theoretical categories used by Hal Foster, Julia Kristeva and Mário Perniola.", "\n\n► The main purpose of this work is to study the historical evolution of the Accounting, within the approach of European and American schools, in order…\n(more)\n\n▼ The main purpose of this work is to study the historical evolution of the Accounting, within the approach of European and American schools, in order to show clearly their contributions to the statements of accounting information in Brazil. ", "The research starts with the historical evolution of the accounting in its general context, since the basic knowledge of the registration systems, the dissemination of the writing, the influences of the peoples and the society in general, reaching the double entries and their adaptation to the accounting customs and uses in each respective period of time. ", "After that, the involved schools are analysed separately in order to understand their theorical conceptions and structural and methodological aspects, concomitantly with the presentation of their contributors with their respective currents of thought. ", "The American school has its current of thought directed to a financial accounting focusing the business management, with its reports aiming the takings of decisions, while the European school is more involved with the philosophy and science of the accounting. ", "We come to the conclusion that the American school is the one that has brought more contribution to the evidences in the accounting information in Brazil, with its effective and objective managerial reports, facilitating the takings of decisions and the management of the involved business. ", "However, we do not neglect the importance of the European school, whit its contribution to the scientific development of the accounting.", "\nAdvisors/Committee Members: Pereira, Anisio Candido (advisor), CPF:04122291887 (advisor), http://lattes.cnpq.br/5798574967417360 (advisor).", "\n\nThis dissertation is the result of an investigation about the practice of the pedagogue who acts in Technology-Mediated Teaching in the Center of Media of Education of the State of Amazonas (CEMEAM) and intends to show how its performance is constituted in a perspective in which Information and Communication Technologies Are in the process. ", "In order to have a better understanding of the development of the study, a brief analysis of the trajectory of Pedagogy in Brazil was carried out in the light of theoretical references, identifying the historical processes until the pedagogical reflection in the digital era. ", "In this bias, the changes in pedagogical work were punctuated with the inclusion of Information and Communication Technologies (ICTs) in the teaching and learning process. ", "The main objective was to know how the work process of the pedagogical team developed at CEMEAM was built, addressing the advances / retreats, strengths / weaknesses, with the purpose of\nevaluating and presenting suggestions for strengthening pedagogical actions at the study site. ", "The research uses a qualitative approach and was carried out at the CEMEAM locus, being produced by methodological steps configured by procedural steps that organized the entire structure of the study. ", "The results show that the CEMEAM pedagogy has peculiarities in its practice, because its attributions require a specialization in the light of the use of ICTs, in a context of relationship with distance education and presence mediated by technology.", "\n\nThe software reengineering becomes important because of the need that organizations have in adjusting to new trends, technologies and user requirements. ", "The term organization should…\n(more)\n\n▼\n\nThe software reengineering becomes important because of the need that organizations have in adjusting to new trends, technologies and user requirements. ", "The term organization should be understood like universities or companies that develop software for use by a large number of people. ", "Thinking about the adequacy of users requirements, is presented in this work the reengineering process of a software called Cognitor, which is a tool designed to support teachers in the process of creating electronic teaching materials. ", "The need to reengineer Cognitor was perceived through a case study where several changes were pointed by users. ", "Some of these changes are: text editor improvement, preview of the images that are inserted in the content pages, feedback to the users, among others. ", "During the reengineering of this software, it was formalized a software reengineering process model, user-centered, for the conversion of desktop applications in RIAs (Rich Internet Application), called UC-RIA (User Centered Rich Internet Application). ", "The process model was named as UC-RIA due to the participation of the potential users during the applications reengineering process, because they were involved in prototyping and in validation of the graphical interfaces of the new version. ", "The results of this study show the capability of the proposed software reengineering model to be used as a support in organizations for the reengineering of their software, mainly because it inserts the users in the reengineering process during the applications Prototyping phase, bringing software to users real needs.", "\n\nBased on educational sociolinguistics, this work presents results of a research whose objective was to analyze how schools face the linguistic variety of their public in the teaching of Portuguese language. ", "To perform this research, I employed a mixed methodology - qualitative and quantitative - through questionnaires and interviews. ", "The individuals chosen were teachers and students of a school of the municipal network of Geraniums, in the state of Pernambuco. ", "The theoretical support included the following categories: Linguistic Variety, School Culture and Pedagogical Practice. ", "I worked especially with the next authors: Bortone Ricardo (2007), Bagno (1999, 2002), Bakhtin (2009, 2012), Bourdieu (1996, 2008), Burke (2010), Saussure (1989), Williams (1999, 2011). ", "The analysis of the qualitative data was according to the French line Discourse Analysis (DA) (Orlandi, 2005). ", "I analyzed quantitative data according to the SPSS (Statistical Pack for the Social Science). ", "The\nresults pointed to a pedagogical practice based on traditional methods, centered on the systematic teaching of the language from an authoritative way, disregarding the…" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.044444444444444446, 0.01694915254237288, 0, 0.044444444444444446, 0.01694915254237288, 0, 0.005649717514124294, 0, 0, 0.0625, 0, 0, 0, 0, 0, 0, 0, 0.011834319526627219, 0, 0.007782101167315175, 0.011764705882352941, 0.009925558312655087, 0.010230179028132993, 0.007407407407407408, 0, 0, 0, 0, 0, 0.013333333333333334, 0, 0.006289308176100629, 0, 0, 0, 0.003257328990228013, 0, 0, 0, 0.020134228187919462, 0, 0, 0, 0, 0, 0, 0.005952380952380952, 0, 0, 0.03614457831325301, 0, 0, 0, 0, 0, 0, 0, 0, 0.0027100271002710027, 0, 0, 0.027522935779816515, 0.0049504950495049506, 0, 0, 0, 0, 0, 0.014285714285714285, 0.005797101449275362, 0, 0, 0.0035460992907801418, 0.0049504950495049506, 0.004016064257028112, 0, 0, 0, 0, 0, 0, 0.003952569169960474, 0, 0.003134796238244514, 0, 0, 0.015503875968992248, 0.016666666666666666, 0.026881720430107527, 0.009009009009009009, 0.02127659574468085, 0 ]

[ "Q:\n\nChange directory in pipe line bitbucket\n\nMy folder structure:\n-backend\n-frontend\n\nMy reactapp is placed in frontend directory.", "\nimage: node:10.15.3\n\npipelines:\n default:\n - step:\n caches:\n - node\n script: # Modify the commands below to build your repository.", "\n - yarn install\n - yarn test\n - yarn build\n\nThis one fails. ", "How do I go to the frontend-directory to run this?", "\n\nA:\n\nBitbucket Pipeline run in one bitbucket cloud server.", "\nSo, similar as using a local command line interface, you can navigate using comands like cd, mkdir.", "\nimage: node:10.15.3\n\npipelines:\n default:\n - step:\n caches:\n - node\n script: # Modify the commands below to build your repository.", "\n - cd frontend\n - yarn install\n - yarn test\n - yarn build\n - cd ../ #if you need to go back\n #Then,probably you will need to deploy your app, so you can use:\n - apt-get update\n - apt-get -qq install git-ftp\n - git ftp push --user $FTP_USERNAME --passwd $FTP_PASSWORD $FTP_HOST\n\nIf you need to test syntax of your yml file, try here\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0.01, 0, 0 ]

[ "(NaturalNews) Those of you who are regular readers of- and your numbers are many - may not always agree with points of view expressed here, but we believe you at least consider us a trustworthy news source, a point driven home by the tens of millions of page views we receive every month.", "That said, how much trust would you place in us if, say, we were being paid to put out certain information or relate only a singular point of view? ", "We're guessing that number would be much, much smaller.", "Yet that's what one establishment media organization -- appears to be doing, according to multiple sources who say the network has begun engaging in a practice of killing stories that portray governments and countries which have become the network's sugar daddies in a bad light.", "In March 2011, you may recall, much of the Middle East began to erupt. ", "This \"Arab Spring,\" as the general movement has been labeled, began as simple protests by seething opposition groups against long-time Arab dictators but soon exploded into full-fledged revolution and, in the case of Libya and Syria, civil war.", "Early on,sent a four-person crew to Bahrain to do an investigative piece \"on the use of internet technologies and social media by democracy activists in the region,\" Glenn Greenwald, of Britain'snewspaper, reported in September.", "The team, led by veteran reporter Amber Lyon, a three-time Emmy Award-winning journalist, had a most eventful eight-day stay in the small Washington-backed kingdom, which is home, by the way, to the U.S. Navy's Fifth Fleet By the time Lyon and her crew arrived, a number of sources who had previously agreed to speak to them had either disappeared or took to hiding. ", "Opponents of the Bahraini regime whospeak to them suffered government-led recriminations, \"as did ordinary citizens who worked with them as fixers,\" Greenwald wrote.", "In one case, leading human rights activist Nabeel Rajab was arrested for allegedly fabricating a photo of a dead man who appears to be on a table in a medical examiner's office (no details were provided by the Bahraini police site about how the man died).In another case, Saeed Ayyad, a doctor who gave the crew a tour of his village before arranging meetings with government opponents, had his house burned down shortly thereafter.", "In still another case, the crew's local fixer was fired 10 days after working with them.", "Lyon and her crew were even violently detained by agents of the regime in front of Rajab's house. ", "They later described the encounter after returning to the U.S. as being accosted by \"20 heavily armed men\" whose faces were \"covered with black ski masks\" and who \"jumped from military vehicles\" before they \"pointed machine guns at\" them, then forcing them all to the ground. ", "The security forces proceeded to seize the crew's cameras, deleting photos and video footage before interrogating them against their will for six hours.", "The experience \"both shocked and emboldened\" Lyon, Greenwald wrote.", "The following morning after her detention, she said newspapers in the kingdom prominently featured reports about the incident that contained what she described as \"outright fabrications\" by the government.", "\"It made clear just how willing the regime is to lie,\" Lyon told Greenwald last month.", "But the episode strengthened her resolve as well; she committed to exposing how abusive and thug-like the regime had become in attempting to quash the fledgling democracy movement, as well as any negative coverage of the government's inevitable response.", "\"I realized there was a correlation between the amount of media attention activists receive and the regime's ability to harm them, so I felt an obligation to show the world what our sources, who risked their lives to talk to us, were facing,\" she said.", "'s cost for the team to travel to Bahrain to get the story was north of $100K, \"an unusually high amount for a one-hour program of this type,\" according to; the story was titled, \"iRevolution: Online Warriors in the Arab Spring,\" and it took up a 13-minute segment of the program, (it is now available on YouTube ).Per Greenwald:The highly award-winning segment, which was praised by thousands of Bahrainis on Facebook as well, aired just once in the U.S.Internationally, on's sister network,, itaired.", "An expensive piece of hard-hitting, award-winning journalism never aired overseas. ", "Why?has aggressively pursued a business strategy of extensive, multifaceted financial arrangements between the network and several of the most repressive regimes around the world which the network purports to cover,\" writes Greenwald. \"", "Its financial dealings with Bahrain are deep and longstanding.", "\"Specifically, he notes, the network aggressively pursued - and then came to rely on - revenue from several Middle East regimes, in order to remain viable, especially after the 2008 economic recession, \"which caused the network to suffer significant losses in corporate sponsorships.", "\"The result: The employment of journalistically dubious ways to earn revenue from the very governments the network was created to cover.", "The arrangement goes far beyond simple advertising agreements. ", "According to, programming is produced in what the network describes as an \"in association with\" type of arrangement with a government.", "\"These programs are then featured as part of CNNi's so-called 'Eye on' series ('Eye on Georgia,' 'Eye on the Philippines,' 'Eye on Poland'), or 'Marketplace Middle East,' all of which is designed to tout the positive economic, social and political features of that country,\" says Greenwald.", "As you might have guessed, disclosure of these arrangements is often deft and wholly unnoticeable by all but the most trained journalistic eye.", "In mid-July, Myles Smith, a Central Asia-based consultant, pointed out that a seriesproduced on oil-rich Kazakhstan was similarly skewed - and similarly government-sponsored.", "\"Most of the spots are quirky, soft-core reportage and travelogue sprinkled with carefully framed shots of the glitziest parts of Astana and Almaty. ", "Topics include economic diversification, transportation infrastructure, skiing, and dating games,\" he writes. \"", "offers no coverage of labor strikes, human rights abuses, nascent violent insurgencies, violence against women, or any other diversions from the narrative of relentless growth and limitless opportunity.", "\"Smith notes, \"...[W]hat looks to the unsuspecting viewer like more ofat its finest appears in fact to be sponsored advertisements paid for by none other than Kazakhstan's oil-rich government.", "\"As for Lyon, she says that China and many other foreign, authoritarian regimes also payand other mainstream networks to run flowery, flattering propaganda pieces. ", "And what's more, she says a number of reporters and producers at the network have privately complained about the paid-sponsorship of programming, but believe they can't complain publicly out of fear they will be blacklisted within the news industry and branded troublemakers.", "Couple this revelation with our earlier coverage of an admission by The New York Times that many mainstream media stories are actually scripted by the White House, and you get a sense of whyand a number of other leading \"alternative\" sites are where information consumers are increasingly turning to for honest reporting." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.003472222222222222, 0, 0, 0, 0, 0, 0.0043859649122807015, 0.013623978201634877, 0.006060606060606061, 0.004629629629629629, 0, 0.02040816326530612, 0, 0, 0.029850746268656716, 0, 0.023255813953488372, 0, 0, 0.00398406374501992, 0, 0.00423728813559322, 0, 0, 0, 0, 0, 0.0034482758620689655, 0, 0.005747126436781609, 0, 0, 0, 0, 0.006097560975609756, 0, 0.006230529595015576 ]

[ "var specify = require('specify')\n , async = require('async')\n , helpers = require('../helpers')\n , timeout = helpers.timeout\n , nano = helpers.nano\n , nock = helpers.nock\n ;\n\nvar mock = nock(helpers.couch, \"design/list\")\n , db = nano.use(\"design_list\")\n ;\n\nspecify(\"design_list:setup\", timeout, function (assert) {\n nano.db.create(\"design_list\", function (err) {\n assert.equal(err, undefined, \"Failed to create database\");\n db.insert(\n { \"views\":\n { \"by_name_and_city\":\n { \"map\": function(doc) { emit([doc.name, doc.city], doc._id); } }\n },\n \"lists\": { \"my_list\": function(head, req) { send('Hello'); } }\n }, '_design/people', function (error, response) {\n assert.equal(error, undefined, \"Failed to create views\");\n assert.equal(response.ok, true, \"Response should be ok\");\n async.parallel(\n [ function(cb) { db.insert(\n { name: \"Derek\", city: \"San Francisco\" }, \"p_derek\", cb); }\n , function(cb) { db.insert(\n { name: \"Randall\", city: \"San Francisco\" }, \"p_randall\", cb); }\n , function(cb) { db.insert(\n { name: \"Nuno\", city: \"New York\" }, \"p_nuno\", cb); }\n ]\n , function(error, results) {\n assert.equal(error, undefined, \"Should have stored docs\");\n });\n });\n });\n});\n\nspecify(\"design_list:test\", timeout, function (assert) {\n db.view_with_list('people','by_name_and_city', 'my_list',\n {key: [\"Derek\",\"San Francisco\"]}, function (error, list) {\n assert.equal(error, undefined, \"View didn't respond\");\n assert.equal(list,\"Hello\");\n });\n});\n\nspecify(\"design_list:teardown\", timeout, function (assert) {\n nano.db.destroy(\"design_list\", function (err) {\n assert.equal(err, undefined, \"Failed to destroy database\");\n assert.ok(mock.isDone(), \"Some mocks didn't run\");\n });\n});\n\nspecify.run(process.argv.slice(2));\n" ]

{ "pile_set_name": "Github" }

[ 0.0010615711252653928 ]

[ " Opinions of the United\n2007 Decisions States Court of Appeals\n for the Third Circuit\n\n\n3-12-2007\n\nUSA v. Rivas\nPrecedential or Non-Precedential: Precedential\n\nDocket No. ", "05-3380\n\n\n\n\nFollow this and additional works at: http://digitalcommons.law.villanova.edu/thirdcircuit_2007\n\nRecommended Citation\n\"USA v. Rivas\" (2007). ", "2007 Decisions. ", "Paper 1389.", "\nhttp://digitalcommons.law.villanova.edu/thirdcircuit_2007/1389\n\n\nThis decision is brought to you for free and open access by the Opinions of the United States Court of Appeals for the Third Circuit at Villanova\nUniversity School of Law Digital Repository. ", "It has been accepted for inclusion in 2007 Decisions by an authorized administrator of Villanova\nUniversity School of Law Digital Repository. ", "For more information, please contact Benjamin.Carlson@law.villanova.edu.", "\n\f PRECEDENTIAL\n\n UNITED STATES COURT OF APPEALS\n FOR THE THIRD CIRCUIT\n\n\n No. ", "05-3380\n\n\n UNITED STATES OF AMERICA\n\n v.\n\n JOSE RAMON RIVAS,\n also known as RAY,\n\n Jose Ramon Rivas,\n Appellant\n\n\n On Appeal from the United States District Court\n for the Eastern District of Pennsylvania\n (D.C. No. ", "03-cr-00599-1)\n District Judge: Hon. ", "Timothy J. Savage\n\n\n\n Argued January 18, 2007\n\n Before: SLOVITER, RENDELL, and CUDAHY,* Circuit\n Judges\n\n (Filed: March 12, 2007)\n\n\n\n\n *\n Hon. ", "Richard D. Cudahy, United States Senior Circuit\nJudge for the United States Court of Appeals for the Seventh\nCircuit, sitting by designation.", "\n\fPatrick L. Meehan, Esq.", "\nRobert A. Zaumzer, Esq.", "\nAnne Whatley Chain, Esq. ", " [ARGUED]\nAndrea B. Grace, Esq.", "\nUnited States Attorney’s Office\n615 Chestnut Street\nPhiladelphia, PA 19106\n Counsel for Appellee\n\nPeter Goldberger, Esq. ", " [ARGUED]\nPamela A. Wilk\n50 Ritenhouse Place\nArdmore, PA 19003-2276\n\nLouis T. Savino, Jr.\nLouis T. Savino & Associates\n15th & John F. Kennedy Boulevard\nTwo Penn Center\nSuite 1516\nPhiladelphia, PA 19102\n Counsels for Appellant\n\n\n ____________\n\n OPINION OF THE COURT\n ____________\n\nCUDAHY, Circuit Judge.", "\n\n A jury convicted Jose Ramon Rivas of conspiring to\ndistribute crack cocaine in violation of 21 U.S.C. § 846. ", "The\ncourt, acting in part because of a prior drug offense for which\nRivas had been convicted, sentenced him to 240 months in\nprison. ", "Rivas now appeals, arguing that his conviction is flawed\nby numerous alleged errors in his trial and that the district court\nerred in finding that the prosecution had properly filed and\nserved upon Rivas an information charging the prior drug\nconviction on the basis of which the government sought to\nenhance Rivas’s sentence. ", "For the reasons given below, we\naffirm.", "\n\n 2\n\fI. Background\n\n The government indicted Rivas for conspiring with\nDarrin Culler and Juan Johnson to distribute crack, and for\naiding and abetting Darrin Culler’s distribution of approximately\n80.1 grams of crack on August 7, 2002. ", "The government’s case\nat trial can be divided into two parts: the testimony of\nconfidential informant Charles Mobley and his chief handler,\nPhiladelphia Police Officer Ronald Jones, who explained a sting\noperation involving four controlled purchases of crack cocaine\nnear the corner of Reed and 7th Streets in Philadelphia, and the\ntestimony of Rivas’s alleged co-conspirators, who had pleaded\nguilty and were cooperating with the government.", "\n\n Mobley and Jones described a series of police-monitored\ncrack purchases that occurred on April 25, June 25, August 7\nand September 12, 2002. ", "Mobley purchased the crack; Jones\nobserved and searched Mobley and his car before and after and\nobserved the purchases, which were also videotaped. ", "Most of\nthe transactions involved Rivas’s alleged co-conspirator Culler.", "\nMobley testified that on April 25 he called Culler and asked to\nbuy an ounce and a half of crack; he met Culler in the 700 block\nof Reed Street and exchanged government-supplied buy money\nfor crack. (", "Supp. ", "App. ", "at 20-24.) ", "Mobley similarly purchased\ntwo ounces of crack from Culler on June 25, 2002.", "\n\n Mobley first implicated Rivas in his testimony concerning\nan August 7, 2002 purchase. ", "Mobley testified that on that day he\ncalled Rivas and ordered three ounces of crack. ", "Rivas agreed to\nsupply it and selected the 700 block of Reed for the transaction.", "\nWhen Mobley arrived, both Rivas and Culler were there. ", "They\nwalked to Mobley’s car; Rivas got in and exchanged the crack\nfor Mobley’s buy money while Culler stood at the driver’s\nwindow. ", "Then Rivas and Culler left. ", "Officer Jones testified that\nfrom his vantage point he could see Culler go to Mobley’s\ndriver’s side window and see Rivas enter the car’s passenger\ndoor, but he could not see what was going on inside the car.", "\n(App. ", "at 41-42.) ", "The transaction was videotaped, but Mobley\nadmitted on cross-examination that due to the camera angle the\ntape did not show Rivas getting into Mobley’s car. (", "Supp. ", "App.", "\nat 65-66.) ", "Jones testified that when he met Mobley after the buy,\n\n 3\n\fMobley gave him three ounces of crack.", "\n\n Mobley also testified that Rivas set up, though did not\nphysically participate in, a purchase on September 12, 2002.", "\nMobley called Rivas and asked to purchase crack. ", "Rivas said\nthat he couldn’t meet Mobley himself, but that he would send\nsomeone named “Voo.” ", "Mobley found someone matching\nVoo’s description at the location Mobley and Rivas had agreed\nupon, and exchanged the buy money for the drugs. ", "After the\npurchase, Rivas called Mobley to ask if everything had gone\nwell with Voo. ", "Rivas’s alleged co-conspirator Johnson,\nnicknamed “Voo,” confirmed his and Rivas’s roles in the sale,\ntestifying that the crack he delivered belonged to Rivas and that\nhe only made a small commission on the deal. (", "App. ", "at 112,\n114-15; Supp. ", "App. ", "at 80-82.)", "\n\n Rivas responded by attacking the credibility of the\ngovernment’s witnesses; Mobley, Culler and Johnson were all\nheavily impeached by their prior crimes and by lies they told\nabout the details of those crimes while on the stand in the present\ncase. ", "Rivas’s strategy made use of Culler and Johnson’s guilty\nplea agreements, which Rivas introduced into evidence. ", "The\ncourt instructed the jury that the guilty pleas of the\ncoconspirators were “not evidence of the guilt of any other\nperson, including the defendant.” (", "App. ", "at 107, 167.) ", "The jury\nacquitted Rivas of the aiding and abetting count, but convicted\nhim of the conspiracy count.", "\n\n At sentencing, the government sought to increase Rivas’s\nstatutory minimum sentence on the basis of a prior felony drug\ntrafficking conviction. ", "On November 6, 2004, a few weeks prior\nto the trial, the government filed an information charging the\nprior conviction as required by 21 U.S.C. § 851. ", "After trial\nRivas moved to strike the information, contending that it had\nbeen “neither filed nor served” on him or his attorney “in\naccordance with the governing law and rules of procedure.”", "\n(App. ", "at 181.) ", "He claimed that the information was not “filed”\nwithin the meaning of § 851 because, among other things, it bore\nno signature, “electronic or otherwise,” and had failed to comply\nwith a local order governing electronic filing. ", "He also claimed\nthat while the government had faxed the information to his\n\n 4\n\fcounsel it was required to mail the information under applicable\nrules, and that his lawyers had never received a copy by mail.", "\nThe government rejoined that any flaws in the information were\nexcusable and that it had mailed the information as required,\neven if Rivas’s counsel had not received it.", "\n\n The court denied Rivas’s motion to strike. ", "It concluded\nthat the clerk had properly excused any noncompliance with the\nlocal electronic filing order and that the government had mailed\na copy of the information to Rivas’s attorney. ", "The court\nsentenced Rivas to twenty years in prison–the statutory\nminimum to which he could be sentenced, given his prior\nconviction. ", "See 21 U.S.C. § 841(b)(1)(A).", "\n\n Rivas now appeals, alleging that the court erred several\ntimes during trial: by failing to strike testimony that Rivas was a\ntarget of a drug investigation, by allowing the prosecution to\npurportedly vouch for its witnesses’ credibility, by improperly\ninstructing the jury on the use of the alleged co-conspirators’\nguilty pleas and by failing to grant a mistrial after the prosecutor\nsuggested that defense counsel was attempting to distract the\njury from important issues. ", "He also appeals the denial of his\nmotion to strike the information charging his prior conviction.", "\n\nII. ", "Discussion\n\n A. Trial Errors\n\n Rivas alleges that his conviction was so heavily tainted by\nerrors that it must be reversed despite his failure to timely object\nto almost all of the purported errors. ", "Generally, failure to object\nforfeits claims of error. ", "In criminal cases we may always\nconsider a “plain error that affects substantial rights,” Fed. ", "R.\nCrim. ", "P. 52(b), but several hurdles must be cleared before the\njudgment is reversed. ", "The defendant must show not only that\nerror affected the outcome of the trial, but that the error was\nclear or obvious under current law. ", "If these requirements are\nmet, we may reverse, if the error “seriously affect[ed] the\nfairness, integrity, or public reputation of judicial proceedings.”", "\nJohnson v. United States, 520 U.S. 461, 476 (1997); United\nStates v. Olano, 507 U.S. 725, 732-35 (1993).", "\n\n 5\n\f In the present case, none of Rivas’s claims establish\nreversible error. ", "We discuss them in turn.", "\n\n 1. “", "Target” Testimony\n\n Rivas first argues that Officer Jones’s testimony that\nRivas was the target of a drug investigation was improper\nhearsay and other-crimes evidence. ", "The government called\nJones as its first witness and used him to lay out the background\nof the controlled buys. ", "Jones explained that in the spring of\n2002 he was investigating crack distribution in the 700 block of\nReed Street. ", "He was then asked:\n\n Q: Who were the individuals or the people that ended up\n being the targets of your investigation beginning in April\n of 2002? ", "What were their names?", "\n A: Darrin Culler, Ramon Rivas. ", "There was one more,\n Voo, Juan Johnson. (", "App. ", "at 68-69.)", "\n\n Rivas argues that although the government purported to\noffer this evidence to help the jury understand the subsequent\ncontrolled buys, it in fact suggested to the jury that there was\nunseen evidence that Rivas had committed earlier, uncharged\ndrug crimes, violating the hearsay prohibition of Federal Rule of\nEvidence 802 and the “other-crimes” evidence prohibition of\nRule 404(b). ", "Prosecutors often abuse their right to show the jury\nthe context of police behavior by unnecessarily suggesting that\nthe police had evidence (not presented to the jury) that led them\nto believe the defendant was involved in crime. ", "United States v.\nPrice, 458 F.3d 202, 208 (3d Cir. ", "2006) (citing United States v.\nSallins, 993 F.2d 344, 346 (3d Cir. ", "1993)), cert. ", "denied, 75\nU.S.L.W. 3353 (U.S. Jan 8, 2007) (No. ", "06-8006). ", "Testimony\nthat the police “targeted” a defendant for an investigation into a\nspecific type of offense is an example of such abuse. ", "United\nStates v. Brown, 451 F.2d 1231, 1234-35 (5th Cir. ", "1971)\n(holding that testimony that defendants were on a “primary\ntarget list” of drug dealers “known to the Sheriff’s department”\nwas prejudicial error). ", "But see United States v. Scarfo, 685 F.2d\n842, 847-48 (3d Cir. ", "1982) (holding that there is no error where\nthe jury is not told that the defendant was being targeted or the\nnature of the crime).", "\n\n 6\n\f The testimony Rivas challenges here is quite difficult to\ndistinguish from the “target list” testimony held inadmissible in\nBrown; if Rivas was targeted in April 2002 it was probably\nbecause of information, possibly supplied by Mobley, about\nearlier drug transactions. ", "The government argues it did not ask\nwhom the investigation targeted in April of 2002, but rather who\n“ended up being the target” of the investigation (App. ", "at 69)\n(emphasis added), and that therefore the question served only to\nexplain where Jones’s story was going. ", "But the question is\nambiguous and the jury already knew where Jones was going (if\nit did not already have the targets’ names in the indictment, the\nprosecutor explained in its opening statement that it would hear\nevidence that the three sold crack to an informant). (", "App. ", "at 56-\n57.) ", "The absence of a legitimate reason for the question suggests\nthe testimony was offered for an illegitimate one. ", "Sallins, 993\nF.3d at 347; see also Price, 458 F.3d at 210-11 (holding that\ncourts must exclude evidence not legitimately needed to explain\nthe background of police behavior).", "\n\n Nonetheless, it does not matter whether the testimony was\nimproper, because any error was not plain. ", "The government at\nleast suggested a possible legitimate reason for the question (to\nput the controlled buys in context), indicating that the error was\nnot plain. ", "Further, Rivas bears the burden of demonstrating that\nthe purported error affected the outcome of the trial, Olano, 507\nU.S. at 734-35, and he has not done so. ", "The government never\nreferred back to the “target” testimony; Rivas claims that it may\nhave briefly suggested in its opening statement that Mobley had\ntold the police incriminating facts about Rivas, but any such\nsuggestion is obscure and unlikely. ", "Even assuming there was a\nbrief suggestion of extra-record evidence against Rivas, the jury\nwas instructed to disregard it. (", "See App. ", "at 148 (“You must make\nyour determination of the facts solely on the basis of the\nevidence you have heard and seen and not for any reason outside\nof this courtroom.”); ", "id. at 150 (“You should confine your\nconsiderations to the evidence presented from the witnesses and\nfrom any exhibits that have been admitted into evidence.”).) ", "We\nare not convinced that the “target” testimony affected the\noutcome of the trial, so any error cannot be a ground of reversal.", "\n\n 2. ", "Vouching for Witnesses\n\n 7\n\f Next, Rivas contends that the prosecution improperly\n“vouched” for the truthfulness of its witnesses. ", "Improper\n“vouching” occurs where a prosecutor suggests that she has\nreasons to believe a witness that were not presented to the jury.", "\nUnited States v. Harris, 471 F.3d 507, 512 (3d Cir. ", "2006);\nUnited States v. Dispoz-O-Plastics, Inc., 172 F.3d 275, 283 (3d\nCir. ", "1999). ", "By contrast, a prosecutor may urge that a witness is\ntrustworthy by arguing from record evidence; vouching occurs\nonly where the prosecutor implicitly refers to information\noutside the record. ", "United States v. Walker, 155 F.3d 180, 187\n(3d Cir. ", "1998).", "\n\n In the present case the prosecution properly argued that\nits witnesses were telling the truth. ", "First, in its opening\nstatement the prosecution described Mobley’s decision to\ncooperate with the DEA:\n\n He decides to come forward and cooperate with the DEA,\n provide the information he knows about other drug\n dealers and actively participate in this investigation. ", "To\n help himself, sure. ", "But also to give DEA an accurate\n picture of what was going on in the streets with these\n sales that he was involved in. (", "App. ", "at 57.)", "\n\nRivas urges that the phrase “accurate picture” improperly\nvouched for Rivas’s credibility, but we cannot see why. ", "The\nprosecution discussed Mobley’s possible motives for\ncooperation and suggested that one of them was a pure moral\ninterest in aiding law enforcement. ", "There was no suggestion that\nthe police cooperate only with honest witnesses, that the\nprosecution could assure the jury that Mobley’s testimony would\nbe accurate, or the like.", "\n\n Second, Rivas argues that the prosecution vouched for\nJohnson and Culler in its closing argument when it said that\n“they came here and they told you the truth about what\nhappened.” (", "App. ", "at 123.) ", "But again, the prosecution did not\nsuggest it knew from extra-record evidence that Johnson and\nCuller were telling the truth. ", "The conclusion was based upon an\nargument from their reluctance to speak and their “demeanor,”\nboth of which the jury could observe for itself. (", "Id.) The\n\n 8\n\fprosecution did not improperly vouch for its witnesses.", "\n\n 3. ", "Jury Instructions on Co-Conspirator Guilty\n Pleas\n\n Rivas claims that the court improperly instructed the jury\non the use of Culler’s and Johnson’s guilty pleas. ", "The court\ninstructed the jury that “Darrin Culler and Juan Johnson may be\nconsidered to be alleged accomplices in this case. ", "The fact that\nan alleged accomplice has entered a plea of guilt in this case, is\nnot evidence of the guilt of any other person, including the\ndefendant.” (", "App. ", "at 167.)", "\n\n Rivas argues that this instruction improperly permitted\nthe jury to infer his guilt from the guilty pleas. ", "Although it is\ntrue that a jury may not do that, see United States v. Universal\nRehabilitation Servs. (", "PA), Inc., 205 F.3d 657, 668 (3d Cir.", "\n2003); United States v. Gaev, 24 F.3d 473, 478 (3d Cir. ", "1994),\none is hard pressed to see how the instruction was unclear on this\npoint given that it explicitly said the pleas were not evidence of\nRivas’s guilt. ", "He suggests that the jury might have used this\nroundabout reasoning: because the pleas are not evidence of the\nguilt of “any other person,” they must be evidence of Culler and\nJohnson’s guilt. ", "But Culler and Johnson pleaded guilty to\nconspiring with Rivas. ", "Cf. ", "Universal Rehab., ", "205 F.3d at 671\n(Roth, J., dissenting) (“If two defendants allegedly conspired,\nand one defendant has been convicted or has pleaded guilty, the\nclear implication is that the other defendant is also guilty.”) ", "Aha,\nRivas’s hypothetical jury concludes, the pleas are therefore\nevidence that Rivas is guilty, despite the clear instruction stating\nthat they are not. ", "To follow such reasoning the jury would have\nto possess an unlikely combination of shrewdness (to invent the\nargument) and obtuseness (to ignore the obvious meaning of the\ninstruction). ", "We have previously held it was error to instruct the\njury that although a co-conspirator’s guilty plea was not\nevidence of the defendant’s guilt, the plea could nonetheless be\nused as the jury “saw fit” in accordance with “common sense,”\nremaining studiously vague about what such a use would be.", "\nUnited States v. Toner, 173 F.2d 140, 142 (3d Cir. ", "1949); see\nalso Universal Rehab., ", "205 F.3d at 670-71 (Roth, J., dissenting)\n(discussing Toner). ", "But that instruction clearly invited misuse of\n\n 9\n\fthe pleas while paying lip-service to proper evidence law; the\nalleged flaw in the present instruction is much less clear.", "\n\n At any rate, even assuming there was error, there was no\nplain error. ", "The parties only used the pleas appropriately, to\nimpeach Culler and Johnson. ", "Having failed to object to the\ninstruction below, the burden is on Rivas to prove that the jury in\nfact adopted the unlikely reasoning described above. ", "He has not\ndone so.", "\n\n 4. ", "Prosecutorial Misconduct\n\n Finally, Rivas argues that the prosecution improperly\n“impugn[ed]” the “function and integrity of defense counsel”\nduring its closing argument. ", "During his own closing, Rivas’s\nattorney hammered Mobley, Culler and Johnson for lies they had\ntold the jury about details of their prior crimes, arguing that they\nwere untrustworthy. ", "During rebuttal closing, the prosecutor\nsaid:\n\n In his closing argument, Mr. Savino spent an awful lot of\n time discussing with you discrepancies and what he terms\n as mistruths and lies and differences in plea agreements\n and language. ", "I will return the compliment to Mr.\n Savino, he’s a very good advocate, he does his job well\n and his job is to take your focus off the issue. (", "App. ", "at\n 146.)", "\n\n Unlike most of the errors Rivas ascribes to the district\ncourt, he lodged a timely objection to this one, which was\nsustained. ", "He then moved for a mistrial, which was denied.", "\nRivas argues that the district court erred in denying his motion\nfor a mistrial, a decision which we review for abuse of\ndiscretion. ", "United States v. Hakim, 344 F.3d 324, 328 (3d Cir.", "\n2003).", "\n\n To find that the court abused its discretion in failing to\norder a mistrial for prosecutorial misconduct, we must first be\nconvinced that the prosecution did in fact misconduct itself. ", "We\nare not; the comment that defense counsel’s “job is to take your\nfocus off the issue” was not, in this context, improper argument.", "\n\n 10\n\fRivas notes that no lawyer may make “unfounded and\ninflammatory attacks on the opposing advocate,” Gov’t of Virgin\nIslands v. Isaac, 50 F.3d 1175, 1185 n.7 (3d Cir. ", "1995) (quoting\nUnited States v. Young, 470 U.S. 1, 9 (1985)). ", "But the\ngovernment correctly rejoins that attacks on the opposing\nadvocate’s arguments and tactics are acceptable, and indeed that\nattacking and exposing flaws in one’s opponent’s arguments is a\nmajor purpose of closing argument. ", "United States v. Lore, 430\nF.3d 190, 213 (3d Cir. ", "2005) (citing United States v. Hartmann,\n958 F.2d 774, 785 (7th Cir. ", "1992)).", "\n\n If this distinction is unclear, it may be helpful to note that\nthe prohibition against personal attacks on attorneys is rooted\nless in a sense of decorum than in the same rule underlying the\nprohibition on vouching: one cannot make arguments\nunsupported by the record evidence. ", "Dispoz-O-Plastics, 172\nF.3d at 285 (holding that the invited response doctrine is\ntriggered only when the defense attacks the prosecution “for\nreasons unsupported by the evidence”); United States v. Pelullo,\n964 F.2d 193 (3d Cir. ", "1992) (holding that attorneys may not\naccuse each other of “misconduct, such as subornation of\nperjury, unless there is a foundation in the record to support such\ncharges”). ", "In all of the cases Rivas cites as examples of\nimproper attacks on counsel, the discussion of the attorney’s\ncharacter included some sort of suggestion that the attorney had\nheld back or hidden evidence that was not in the record, or faked\nevidence that was. ", "See Young, 470 U.S. at 4 (reporting that the\ndefense counsel “intimated that the prosecution deliberately\nwithheld exculpatory evidence”); United States v. Rios, 611 F.2d\n1335, 1342 (10th Cir. ", "1979) (reporting that the prosecutor\nsuggested that the defense counsel conspired to fake exculpatory\nevidence). ", "Claims that the defendant’s lawyer is lying often fall\ninto this category by implying that the defense counsel has extra-\nrecord reason to believe her client guilty, such as the defendant\nconfessing to her or the attorney’s being part of the crime\nherself. ", "See Berger v. United States, 295 U.S. 78, 88 (1934)\n(reporting that the prosecutor stated that defense lawyers “sit up\nin their offices and devise ways to pass counterfeit money”); cf.", "\nUnited States v. Gross, 961 F.2d 1097, 1108 (3d Cir. ", "1992);\nHartmann, 958 F.2d at 785 (finding no error where “the\nprosecution argued that certain statements were lies, not that the\n\n 11\n\fattorneys were liars”). ", "The rule can therefore be implicated even\nwhere the prosecution refrains from intemperate language or\nimputing evil motives to the defense counsel, so long as the\nprosecution improperly argues from the defense counsel’s\nmental state in a way not supported by record evidence. ", "See,\ne.g., United States v. Manriquez-Abrizo, 833 F.2d 244, 247 (10th\nCir. ", "1987); cf. ", "United States v. Pungitore, 910 F.2d 1084, 1142\n(3d Cir. ", "1990) (permitting a prosecutor to present evidence of a\ndefense counsel’s involvement in a crime where that evidence\nwas relevant to the charges against the defendant).", "\n\n In the present case, the prosecution attacked only Rivas’s\nargument, not his counsel. ", "Stating that the defense counsel’s\n“job is to take your focus off the issue” did not suggest that\nRivas’s lawyer had some mysterious reason to believe him\nguilty. ", "The comment was a fair attack on Rivas’s strategy of\nimpeaching the government’s witnesses and arguing for\nreasonable doubt, which in fact did refocus the jury’s attention\non whether lies about other subjects rendered the witnesses’\ntestimony about Rivas incredible, rather than the details of their\ntestimony about Rivas. ", "The prosecution made the same\nlegitimate argument when it said that Rivas’s counsel spent an\n“inordinate amount of time” cross-examining and arguing on\nthose issues. (", "App. ", "at 146.)", "\n\n Even if we were to find prosecutorial misconduct, the\ndistrict court was still within its discretion to deny a mistrial. ", "A\nmistrial is not required where improper remarks were harmless,\nconsidering their scope, their relation to the context of the trial,\nthe ameliorative effect of any curative instructions and the\nstrength of the evidence supporting the conviction. ", "United\nStates v. Gambone, 314 F.3d 163, 179 (3d Cir. ", "2003) (citing\nUnited States v. Zehrbach, 47 F.3d 1252, 1265 (3d Cir. ", "1995)).", "\nHere, the remark was a single sentence in the middle of a\nperfectly permissible line of argument against the defense’s\nimpeachment strategy. ", "It is clear that it did not affect the\noutcome of the trial.1 Consequently, Rivas’s conviction must\n\n\n 1\n Rivas also argues in a footnote that the prosecutor\nsuggested facts not supported by the evidence by saying that\n\n 12\n\fstand.", "\n\n B. Motion to Strike Information Charging Prior\n Conviction\n\n We now turn to Rivas’s sentencing challenge, based on\nthe district court’s denial of his motion to strike an information\ncharging him with a prior drug felony conviction. ", "Under 21\nU.S.C. § 851(a)(1):\n\n No person who stands convicted of an offense under this\n part shall be sentenced to increased punishment by reason\n of one or more prior convictions, unless before trial . . .", "\n the United States attorney files an information with the\n court (and serves a copy of such information on the\n person or counsel for the person) stating in writing the\n previous conviction to be relied upon. . . . ", "Clerical\n mistakes in the information may be amended at any time\n prior to the pronouncement of sentence.", "\n\n In this case, the government sought to subject Rivas to a\nstatutory minimum sentence of twenty years in prison based on a\nprior drug trafficking conviction. ", "Consequently, it filed an\ninformation charging that conviction on November 6, 2004, prior\nto trial. ", "However, Rivas moved to strike the information as not\nhaving been “file[d] . . . ", "with the court” or “serve[d] . . . ", "on the\nperson or counsel for the person” as required by the statute.", "\n(Rivas admits that he was aware of the government’s intentions,\nbut we have held that compliance with § 851’s filing and service\nrequirements is mandatory, regardless of whether a defendant\n\n\nwitnesses were afraid that Rivas had agents stationed in the\ncourtroom who would harm those who testified against him.", "\nBecause the argument is made only in a footnote, it is forfeited.", "\nJohn Wyeth & Bro. ", "Ltd. v. CIGNA Intern. ", "Corp., 119 F.3d 1070,\n1076 n.6 (3d Cir. ", "1997). ", "Even if it were not, it is clear that the\nprosecutor was not suggesting that witnesses were afraid of being\nharmed but that witnesses were embarrassed by having to testify to\nthe details of their past crimes on cross-examination. (", "App. ", "at 144-\n45.)", "\n\n 13\n\fhas actual notice of the government’s plans to enhance his\nsentence. ", "United States v. Weaver, 267 F.3d 231, 247 (3d Cir.", "\n2001) (citing Harris v. United States, 149 F.3d 1304, 1307 (11th\nCir. ", "1998)).)", "\n\n 1. ", "Filing\n\n Rivas’s argument that the information was not “filed” is\nbased on its noncompliance with a standing order of the District\nCourt for the Eastern District of Pennsylvania governing\nelectronic filing. ", "Section 851(a)(1) does not define “file[],” but\nboth parties agree that it incorporates by reference federal and\nlocal rules governing filing. ", "See, e.g., United States v. Severino,\n315 F.3d 939, 945 (9th Cir. ", "2003) (holding that federal rules are\nincorporated by reference into § 851(a)). ", "The standing order\nstates that the “user log-in and password required to submit\ndocuments . . ", "serve as the Filing User’s signature” for any court\npurpose, but goes on to state that each document filed\nelectronically must, if possible, indicate that it has been\nelectronically filed, must include a signature block and must\ninclude the name of the Filing User preceded by the characters\n“s/” in the space where a written signature would normally\nappear. ", "Electronic Case Filing Procedural Order ¶8.a, available\nat\nhttp://www.paed.uscourts.gov/documents/CMECF/locrules/cvor\nd14.pdf. ", "Although a government attorney properly logged in to\nsubmit the information and thus signed it, the document fails to\ncomply with the order’s other requirements–it does not indicate\nthat it has been electronically filed, and so forth.", "\n\n Despite the clerk’s acceptance of the information as filed\n(the reason why Rivas had to bring a motion to strike rather than\nmerely note the absence of any information in the record), Rivas\nclaims that the information’s shortcomings render it not “filed”\nwithin the meaning of § 851. ", "But if § 851 incorporates by\nreference local rules and orders governing filing, it should also\nincorporate the law governing those rules and orders, and we\nhave recognized that a district court has discretion to “depart\nfrom the strictures of its own procedural rules where (1) it has a\nsound rationale for doing so, and (2) doing so does not unfairly\nprejudice” a party who has relied on the rule. ", "United States v.\n\n 14\n\fEleven Vehicles, Their Equipment & Accessories, 200 F.3d 203,\n215 (3d Cir. ", "2000); see also Prof’l Programs Group v. Dept. ", "of\nCommerce, 29 F.3d 1349, 1353 (9th Cir. ", "1994) (holding that a\nviolation of local rules can be excused where it is “so slight and\nunimportant that the sensible treatment is to overlook it.”);", "\nBraxton v. Bi-State Dev. ", "Agency, 728 F.2d 1105, 1107 (8th Cir.", "\n1984) (same). ", "Here, the clerk accepted the information despite\nits shortcomings. ", "When the issue was brought to the court’s\nattention, it indicated that it was not concerned with the failure to\ncomply with the order. ", "We find that the signature requirement\nalone creates an incentive for responsible litigation, see\nScarborough v. Principi, 541 U.S. 401, 416 (2004), and\ntherefore that the district court had a sound rationale to excuse\nthe other, minor violations of the formatting rules. ", "See Phoenix\nGlobal Ventures, LLC v. Phoenix Hotel Assocs., ", "Ltd., 442 F.3d\n72, 76 (2d Cir. ", "2005) (per curiam) (holding that a district court\ndid not abuse its discretion by excusing the inclusion of too-large\nexhibits and an invalid hearing date in violation of electronic\nfiling requirements); Somlyo v. J. Lu-Rob Enters., ", "Inc., 932 F.2d\n1043, 1049 (2d Cir. ", "1991) (holding that a district court did not\nerr by excusing noncompliance with certain local rules, in part\nbecause the rules were “technical” and “designed to regulate, for\nconvenience sake, how papers look”). ", "Further, Rivas admits he\nhas not suffered prejudice. ", "Consequently, the court’s decision to\npermit the information to stand was entirely proper.", "\n\n Rivas argues that although § 851 generally incorporates\nlocal rules, it implicitly precludes normal discretionary\nexceptions to them. ", "It states that “[c]lerical mistakes in the\ninformation may be amended at any time prior to the\npronouncement of sentence.” ", "21 U.S.C. § 851(a)(1). ", "Rivas\ncontends that Congress’s provision for correction of clerical\nerrors suggests that Congress intended that clerical errors not be\nsimply ignored or excused. ", "Consequently, he urges, if the\nfailures to comply with the local order on electronic filing were\n“clerical mistakes,” they were never corrected and thus cannot\nbe excused. ", "Cf. ", "Weaver, 267 F.3d at 247-50 (discussing the\ncorrection of erroneous descriptions of prior convictions by an\namended information).", "\n\n Whatever other faults this argument might have, see\n\n 15\n\fUnited States v. Hamilton, 208 F.3d 1165 (9th Cir. ", "2000)\n(excusing a clerical error despite the failure to file a correct\namended information); United States v. Steen, 55 F.3d 1022 (5th\nCir. ", "1995) (same), we need only address one: the failures to fully\ncomply with the local order were not “clerical mistakes”; these\nare limited to erroneous descriptions of “the previous\nconvictions to be relied upon.” ", "Section 851 is focused on the\nfacts to be included in the information, not on the specific\nprocedures to be used in filing and service (which both parties\nagree it simply leaves to the general federal procedural rules),\nand the phrase “clerical mistakes in the information” is best read\nto refer only to errors in those facts. ", "Different readings would\nproduce awkward inconsistencies, as there seems to be no good\nreason to excuse certain filing or service errors that are not part\nof the information itself (and hence not “in the information”),\nbut to forbid any excuse for those that are. ", "We are aware of no\ncases where the “clerical mistake” provision was addressed to\nanything other than inaccurate descriptions of prior convictions;\nindeed, most courts (including this one) strongly distinguish\nbetween the procedural filing and service requirements and\nerrors of description, amenable to amendment through § 851’s\nclerical mistakes provision. ", "See Weaver, 267 F.3d at 247; Perez\nv. United States, 249 F.3d 1261, 1265-66 (11th Cir. ", "2001).", "\nConsequently we limit the “clerical mistakes” provision to\ninaccurate descriptions of prior convictions, and hold that the\ndistrict court properly excused the government’s minor\ndeviations from the electronic filing order and treated the\ninformation as filed within the meaning of § 851.", "\n\n 2. ", "Service\n\n Rivas also argued below that there was insufficient\nevidence to permit the court to conclude that the government had\n“serve[d] a copy of [the] information” on him or his counsel. ", "21\nU.S.C. § 851(a)(1). ", "Again, both parties agree that § 851\nincorporates the normal rules governing service. ", "Further, Rivas\nclaims that the government had the duty to prove beyond a\nreasonable doubt that it complied with the service rules. ", "See id.\n§ 851(c)(1). ", "This seems doubtful, but the government does not\ncontest it, and at any rate, even assuming Rivas is correct, the\ncourt was within its rights to conclude that the government had\n\n 16\n\fproved its compliance beyond a reasonable doubt.", "\n\n The government complied with the service requirements\nif it mailed a copy to the last known address of Rivas’s attorney.", "\nFed. ", "R. Crim. ", "P. 49(b); Fed. ", "R. Civ. ", "P. 5(b)(2)(B). ", "The record\ncontains a certificate of service, signed by Assistant United\nStates Attorney Andrea Grace, stating that she served the\ninformation by “first class mail, postage prepaid.” (", "App. ", "at 204.)", "\nRivas argues that this certificate must be read in light of Grace’s\nunsworn representations before the court that she put the\ninformation in an envelope, addressed the envelope, and put it in\nthe United States Attorney’s Office’s mail room’s bin for service\nby U.S. mail, but did not herself deliver the letter to a U.S. Postal\nService mailbox. ", "But even if that is so, the record still supports\nfinding beyond a reasonable doubt that the information was\nserved. ", "To prove mailing through a mail room, the government\nmust present testimony about how the mail room works. ", "United\nStates v. Cohen, 171 F.3d 796, 800 (3d Cir. ", "1999) (citing United\nStates v. Hannigan, 27 F.3d 890, 892-94 (3d Cir. ", "1994)). ", "It is\nnot necessary to produce someone who actually works in the\nmail room so long as the witness has personal knowledge of the\nmail room’s practices. ", "Hannigan, 27 F.3d at 893-94. ", "Grace\ntestified that she had personal knowledge of how the mail room\nworked: she was familiar with the bin into which she dropped\nthe letter, which was used for letters requiring service by U.S.\nmail. ", "This was sufficient personal knowledge of the mail room’s\npractices. ", "It would have been pointless to require the\ngovernment to produce a mail room employee to testify to what\nis already implicit in Grace’s statement; when letters go into the\nmail room’s box for U.S. mail service, the mail room generally\nsends those letters by U.S. mail–that’s why they call it the “mail\nroom.” ", "Cf. ", "Hannigan, 27 F.3d at 894 (finding that mail room\ntestimony was required when a witness was uncertain whether\nher company sent checks by U.S. mail or private carrier). ", "The\ndistrict court did not err by concluding that the information was\nproperly served on Rivas’s attorney.", "\n\nIII. ", "Conclusion\n\n For the foregoing reasons, we affirm Rivas’s conviction\nand his sentence.", "\n\n 17\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.005703422053231939, 0.006578947368421052, 0, 0, 0.01556420233463035, 0.007042253521126761, 0.013888888888888888, 0.0111731843575419, 0.004975124378109453, 0, 0.017937219730941704, 0.02127659574468085, 0.04, 0.041666666666666664, 0.038461538461538464, 0.023255813953488372, 0.015625, 0.023316062176165803, 0.008403361344537815, 0, 0, 0, 0.014388489208633094, 0.006787330316742082, 0.013245033112582781, 0.013513513513513514, 0.027777777777777776, 0.014925373134328358, 0, 0, 0, 0.02631578947368421, 0.021052631578947368, 0.011764705882352941, 0, 0.05357142857142857, 0.022727272727272728, 0.07142857142857142, 0.014423076923076924, 0.14285714285714285, 0, 0.006329113924050633, 0, 0, 0, 0.007751937984496124, 0.015873015873015872, 0.02, 0.021505376344086023, 0.02127659574468085, 0.03529411764705882, 0.009345794392523364, 0, 0.045454545454545456, 0, 0, 0.011673151750972763, 0.026785714285714284, 0, 0, 0, 0.009900990099009901, 0.006493506493506494, 0, 0, 0.14285714285714285, 0, 0, 0, 0.0058823529411764705, 0.018867924528301886, 0.005319148936170213, 0.007462686567164179, 0, 0.004123711340206186, 0, 0, 0, 0, 0.010526315789473684, 0, 0.012658227848101266, 0, 0, 0.01904761904761905, 0, 0, 0, 0, 0, 0, 0, 0, 0.05128205128205128, 0.0425531914893617, 0, 0, 0.007653061224489796, 0, 0, 0, 0, 0, 0, 0, 0.03508771929824561, 0.006493506493506494, 0, 0, 0.006369426751592357, 0.006369426751592357, 0.009009009009009009, 0.003745318352059925, 0, 0, 0, 0.011494252873563218, 0, 0, 0.00625, 0.008032128514056224, 0.008, 0, 0, 0, 0, 0, 0.005952380952380952, 0, 0.018867924528301886, 0.013157894736842105, 0, 0, 0.038461538461538464, 0, 0, 0.006993006993006993, 0, 0.007462686567164179, 0, 0, 0.008620689655172414, 0, 0.005681818181818182, 0.015706806282722512, 0, 0, 0.015873015873015872, 0, 0, 0, 0.011049723756906077, 0.008, 0, 0, 0, 0.008547008547008548, 0, 0.02702702702702703, 0, 0, 0.010362694300518135, 0.03125, 0, 0.05555555555555555, 0.009615384615384616, 0.006493506493506494, 0, 0, 0.019230769230769232, 0.029411764705882353, 0.04838709677419355, 0, 0, 0.02564102564102564, 0.006578947368421052, 0, 0, 0.011299435028248588, 0.021739130434782608, 0.0038314176245210726, 0, 0, 0, 0.007352941176470588, 0, 0, 0.02, 0, 0, 0, 0.0049261083743842365, 0, 0, 0, 0.014492753623188406, 0, 0, 0, 0.005747126436781609, 0, 0.0051813471502590676, 0, 0, 0.005434782608695652, 0, 0.005235602094240838, 0, 0.013333333333333334, 0, 0.03508771929824561, 0, 0.010416666666666666, 0, 0.0030959752321981426, 0.005988023952095809, 0, 0, 0, 0, 0.018867924528301886, 0.014492753623188406, 0, 0, 0.0036363636363636364, 0.0038910505836575876, 0.004347826086956522, 0, 0, 0.005952380952380952, 0, 0.012345679012345678, 0, 0, 0.003215434083601286, 0, 0.05263157894736842, 0.045454545454545456, 0, 0, 0, 0, 0, 0, 0, 0.014084507042253521, 0, 0, 0, 0, 0, 0, 0, 0, 0.007874015748031496, 0, 0.0034129692832764505, 0, 0.015503875968992248, 0.02127659574468085, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0.01694915254237288, 0, 0.008583690987124463, 0, 0, 0.018867924528301886, 0, 0.006944444444444444, 0, 0, 0.012345679012345678, 0, 0, 0, 0.006666666666666667, 0, 0, 0, 0, 0, 0.011494252873563218, 0, 0, 0, 0, 0, 0, 0, 0, 0.0038022813688212928, 0.007692307692307693, 0, 0.1111111111111111, 0.06666666666666667, 0.125, 0.06666666666666667, 0.010869565217391304, 0, 0, 0.008670520231213872, 0, 0, 0.058823529411764705, 0.02857142857142857, 0, 0, 0.034482758620689655, 0.004975124378109453, 0, 0.0032258064516129032, 0, 0, 0.009433962264150943, 0, 0.010869565217391304, 0 ]

[ "Q:\n\nIn a conventional boiler setup, is hot water usually dispensed from the hot water tank quicker than it refills?", "\n\nIn homes that I've visited that have a conventional boiler setup (where hot water is stored in a tank usually contained within the airing cupboard), I've noticed that after the hot water has been used continuously for several minutes, the tank appears to then take several minutes more to refill. ", "As an example, if a shower is used for 15 minutes, the sound of the tank being refilled is audible for around 10 minutes afterwards.", "\nTaking this into account, does this then mean that the tank is typically filled slower than hot water is taken from it? ", "If a shower was to stay on continuously for several hours, for example, could the hot water tank then run out of water completely (including cold water that is yet to be heated)?", "\n\nA:\n\nWhen you take hot water from the tank cold water flows into the tank to replace the hot at the same rate.", "\nThe trick employed by tank designers is that hot water is lighter than cold water and floats on top.", "\nso the cold water is introduced at the bottom of the tank and does not disturb the pool of hot water floating on top. ", "thus you can draw hot water from the tank until the tank is full of cold water.", "\n\nAs an example, if a shower is used for 15 minutes, the sound of the tank being refilled is audible for around 10 minutes afterwards.", "\n\nwhat you are hearing is not the hot water tank filling, but instead the header tank of the low pressure hot water system filling, this is a tank of about the same volume as the hot water tank located somewhere above it, perhaps in the attic space.", "\nso, water flows though a float operated valve into the header tank, and on demand flows by gravity to underneath the hot water tank, it then enters the tank, is heated and comes through a pipe at the top and flows to the outlets.", "\nThe float valve starts gradually so when the header tank begins to empty the flow rate is quite low, but increases as tank empties ans the float drops, after the shower the tank is still catching up with the water used.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "The role of the cytoskeleton in hormone action.", "\nThe structure and functions of microfilaments and microtubules is briefly reviewed. ", "Based on evidence from a variety of cells with various experimental approaches, it is proposed that the cytoskeleton is important in the functions of cells as follows: the cytoskeleton appears to be involved in attachment (to other cells and to substrata used in cell culture) and in movement; the cytoskeleton appears to be involved in the complex relationship between the surface and the interior of the cell. ", "This is a two-way relationship in which the cell uses the cytoskeleton to influence the distribution of proteins within the plasma membrane and perhaps as a go-between to transmit information from the surface of the cell to the interior. ", "Within the cell, the cytoskeleton appears to coordinate intracellular activities (e.g., between nucleus and cytoplasm) and to provide a compartmentation which restricts the movements of intracellular structures (from molecules to organelles), thereby facilitating productive encounters between such structures with an efficiency that is presumed to exceed that of random motion. ", "The cytoskeleton may arrange the various components of the cell in space; it may direct intracellular traffic and promote intracellular movement. ", "This loose picture of cytoskeletal activity may be more emphatic than the available data warrant. ", "It should be regarded as informed extrapolation based upon fragments of information. ", "When these ideas are applied to endocrine function, we can see that the secretion of hormones (exemplified by thyroid hormones and insulin) requires cytoskeletal activity to provide direction and perhaps to promote movement. ", "In steroidogenic cells the movement of cholesterol from cytoplasm to mitochondria requires microfilaments. ", "The antidiuretic hormone requires microfilaments and microtubules to promote transport of water through cells in response to osmotic gradients. ", "Microfilaments adjust the compliance of the cell to provide a path for water and microtubules influence the permeability of the cell membrane to water." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.007281553398058253, 0, 0.002638522427440633, 0.00684931506849315, 0, 0, 0, 0, 0, 0.006622516556291391 ]

[ "On 04/05/2011 07:55, Jacob Carlborg wrote:\n> On 2011-04-29 18:55, Bruno Medeiros wrote:\n>> DDT 0.4.2 has been released.", "\n>>>> Software Update Site: http://ddt.eclipselabs.org.codespot.com/hg.updates/>>>> Changelog:\n>>>> == DDT 0.4.2 (2011-04-29) ==\n>> * Fixed #33, bug with spaces in projects names: made all variables in\n>> DMD response file resolve to quote escaped values.", "\n>> * Fixed bug where all D comments where considered DDoc comments for\n>> documentation hover.", "\n>> * Fixed limitation where problem hovers where not more prioritary than\n>> documentation hovers.", "\n>> * Fixed #37: F2 always brings up empty documentation hover.", "\n>> * Fixed #38: autocomplete crashing / very slow. (", "Content Assist takes\n>> very long to show up when many completion options are available)\n>> * Added support for editor code templates in Content Assist.", "\n>> * Fixed bug in cast expression, where the cast type reference was\n>> ignored by the parser/semantic-engine;\n>> * Fixed bug where DDoc comments where not associated with the\n>> corresponding symbol definition if that definition had protection,\n>> storage, linkage, or certain other kinds of attributes;\n>> * Implemented #35: format immutable keyword and @annotations.", "\n>> * Added (nothrow, pure, shared, immutable) keywords to syntax coloring\n>> * Added @annotations to syntax coloring (spaces after @ not supported,\n>> any identifier accepted)\n>> * Changed syntax coloring example in preferences\n>> * Fixed minor Content Assist bug where completions would not appear when\n>> requested on certain syntax errors.", "\n>>>>>> Also I've chosen to move the DDT discussion forum from the DSource\n>> forums to a Google Groups:\n>> http://groups.google.com/group/ddt-ide>> BTW, is there a page, or similar, that compare DDT and Descent? ", "Or if\n> you could do a quick listing of the differences.", "\n>\nThere a few major differences (features implemented in one IDE, but not the other), and many minor/finer-grained differences (same overall feature but with different quality, stability, etc.) ", "which actually do add up.", "\nYou can look at the features page for both:\nhttp://code.google.com/a/eclipselabs.org/p/ddt/wiki/Featureshttp://www.dsource.org/projects/descent\nalthough it may not give a complete picture, especially with regards to the minor details. ", "From what I can see and remember, the differences are something like this:\nDescent has:\n* debugger integration (ddbg and GDC)\n* in-editor, as-you-type, semantic error reporting (DDT reports syntax errors only)\n* formatter (seems to work quite well)\n* type hierarchy\n* Some compile-time function evaluation/debugging (seems a bit brittle though)\n* TODO/FIXME/XXX tasks tags. (", "this should be coming soon to DDT)\nDDT has:\n* integrated builder (a simple one though, delegates to another tool)\n* search for references (the inverse of find declaration)\nThere some other minor differences. ", "Descent has better icon/decoration support, wizards for creating new classes/modules, and other things I don't remember. ", "Then there is code completion (aka Content Assist) which both IDEs support, but the quality varies a lot. ", "Descent's is generally smarter and works in more contexts, and supports completing function calls (IIRC), but is very brittle and more unstable, and very tied to a specific D version (the latest one being D2 as of 1-2 years ago, I think).", "\nPS:\nI want to soon add debugger integration to DDT as well, as that is a very nice feature to have, but I have been caught up in other dev tasks/features (mostly more DLTK integration). ", "These tasks are not as important to the IDE user as debugging, but it is important to me as a contributor to finish them first (because there is still DLTK 2.0 functionality I haven't extended/finished, yet DLTK 3.0 is already coming next month, with Eclipse 3.7 (Indigo), and I'm trying to keep up).", "\n--\nBruno Medeiros - Software Engineer\n\nOn 2011-05-06 13:52, Bruno Medeiros wrote:\n> On 04/05/2011 07:55, Jacob Carlborg wrote:\n>> On 2011-04-29 18:55, Bruno Medeiros wrote:\n>>> DDT 0.4.2 has been released.", "\n>>>>>> Software Update Site:\n>>> http://ddt.eclipselabs.org.codespot.com/hg.updates/>>>>>> Changelog:\n>>>>>> == DDT 0.4.2 (2011-04-29) ==\n>>> * Fixed #33, bug with spaces in projects names: made all variables in\n>>> DMD response file resolve to quote escaped values.", "\n>>> * Fixed bug where all D comments where considered DDoc comments for\n>>> documentation hover.", "\n>>> * Fixed limitation where problem hovers where not more prioritary than\n>>> documentation hovers.", "\n>>> * Fixed #37: F2 always brings up empty documentation hover.", "\n>>> * Fixed #38: autocomplete crashing / very slow. (", "Content Assist takes\n>>> very long to show up when many completion options are available)\n>>> * Added support for editor code templates in Content Assist.", "\n>>> * Fixed bug in cast expression, where the cast type reference was\n>>> ignored by the parser/semantic-engine;\n>>> * Fixed bug where DDoc comments where not associated with the\n>>> corresponding symbol definition if that definition had protection,\n>>> storage, linkage, or certain other kinds of attributes;\n>>> * Implemented #35: format immutable keyword and @annotations.", "\n>>> * Added (nothrow, pure, shared, immutable) keywords to syntax coloring\n>>> * Added @annotations to syntax coloring (spaces after @ not supported,\n>>> any identifier accepted)\n>>> * Changed syntax coloring example in preferences\n>>> * Fixed minor Content Assist bug where completions would not appear when\n>>> requested on certain syntax errors.", "\n>>>>>>>>> Also I've chosen to move the DDT discussion forum from the DSource\n>>> forums to a Google Groups:\n>>> http://groups.google.com/group/ddt-ide>>>> BTW, is there a page, or similar, that compare DDT and Descent? ", "Or if\n>> you could do a quick listing of the differences.", "\n>>>> There a few major differences (features implemented in one IDE, but not\n> the other), and many minor/finer-grained differences (same overall\n> feature but with different quality, stability, etc.) ", "which actually do\n> add up.", "\n>> You can look at the features page for both:\n> http://code.google.com/a/eclipselabs.org/p/ddt/wiki/Features> http://www.dsource.org/projects/descent>> although it may not give a complete picture, especially with regards to\n> the minor details. ", "From what I can see and remember, the differences are\n> something like this:\n>> Descent has:\n> * debugger integration (ddbg and GDC)\n> * in-editor, as-you-type, semantic error reporting (DDT reports syntax\n> errors only)\n> * formatter (seems to work quite well)\n> * type hierarchy\n> * Some compile-time function evaluation/debugging (seems a bit brittle\n> though)\n> * TODO/FIXME/XXX tasks tags. (", "this should be coming soon to DDT)\n>> DDT has:\n> * integrated builder (a simple one though, delegates to another tool)\n> * search for references (the inverse of find declaration)\n>> There some other minor differences. ", "Descent has better icon/decoration\n> support, wizards for creating new classes/modules, and other things I\n> don't remember. ", "Then there is code completion (aka Content Assist) which\n> both IDEs support, but the quality varies a lot. ", "Descent's is generally\n> smarter and works in more contexts, and supports completing function\n> calls (IIRC), but is very brittle and more unstable, and very tied to a\n> specific D version (the latest one being D2 as of 1-2 years ago, I think).", "\n>>> PS:\n> I want to soon add debugger integration to DDT as well, as that is a\n> very nice feature to have, but I have been caught up in other dev\n> tasks/features (mostly more DLTK integration). ", "These tasks are not as\n> important to the IDE user as debugging, but it is important to me as a\n> contributor to finish them first (because there is still DLTK 2.0\n> functionality I haven't extended/finished, yet DLTK 3.0 is already\n> coming next month, with Eclipse 3.7 (Indigo), and I'm trying to keep up).", "\n>\nOk, thanks for the list. ", "I was wondering if it's time to try DDT instead of Descent. ", "I've basically given up on Descent, too slow and buggy. ", "Content assist is very nice but isn't not worth it if it takes 5-10 seconds to complete, and that is when eclipse doesn't freeze completely.", "\n--\n/Jacob Carlborg\n\nOn 06/05/2011 13:52, Jacob Carlborg wrote:\n> On 2011-05-06 13:52, Bruno Medeiros wrote:\n>> Ok, thanks for the list. ", "I was wondering if it's time to try DDT instead\n> of Descent. ", "I've basically given up on Descent, too slow and buggy.", "\n> Content assist is very nice but isn't not worth it if it takes 5-10\n> seconds to complete, and that is when eclipse doesn't freeze completely.", "\n>\nAs you can see DDT is less featured, but it should be /fairly/ better in terms of performance and stability (especially with stuff like http://code.google.com/a/eclipselabs.org/p/ddt/issues/detail?id=38 fixed). ", "But I haven't been working on large (or even medium-sized) D projects to know for sure. ", "It would be nice to hear the opinion of others who have extensively tried either IDEs.", "\n--\nBruno Medeiros - Software Engineer\n\nOn 5/6/11 7:52 PM, Bruno Medeiros wrote:\n> On 04/05/2011 07:55, Jacob Carlborg wrote:\n>> On 2011-04-29 18:55, Bruno Medeiros wrote:\n>>> DDT 0.4.2 has been released.", "\n>>>>>> Software Update Site:\n>>> http://ddt.eclipselabs.org.codespot.com/hg.updates/>>>>>> Changelog:\n>>>>>> == DDT 0.4.2 (2011-04-29) ==\n>>> * Fixed #33, bug with spaces in projects names: made all variables in\n>>> DMD response file resolve to quote escaped values.", "\n>>> * Fixed bug where all D comments where considered DDoc comments for\n>>> documentation hover.", "\n>>> * Fixed limitation where problem hovers where not more prioritary than\n>>> documentation hovers.", "\n>>> * Fixed #37: F2 always brings up empty documentation hover.", "\n>>> * Fixed #38: autocomplete crashing / very slow. (", "Content Assist takes\n>>> very long to show up when many completion options are available)\n>>> * Added support for editor code templates in Content Assist.", "\n>>> * Fixed bug in cast expression, where the cast type reference was\n>>> ignored by the parser/semantic-engine;\n>>> * Fixed bug where DDoc comments where not associated with the\n>>> corresponding symbol definition if that definition had protection,\n>>> storage, linkage, or certain other kinds of attributes;\n>>> * Implemented #35: format immutable keyword and @annotations.", "\n>>> * Added (nothrow, pure, shared, immutable) keywords to syntax coloring\n>>> * Added @annotations to syntax coloring (spaces after @ not supported,\n>>> any identifier accepted)\n>>> * Changed syntax coloring example in preferences\n>>> * Fixed minor Content Assist bug where completions would not appear when\n>>> requested on certain syntax errors.", "\n>>>>>>>>> Also I've chosen to move the DDT discussion forum from the DSource\n>>> forums to a Google Groups:\n>>> http://groups.google.com/group/ddt-ide>>>> BTW, is there a page, or similar, that compare DDT and Descent? ", "Or if\n>> you could do a quick listing of the differences.", "\n>>>> There a few major differences (features implemented in one IDE, but not\n> the other), and many minor/finer-grained differences (same overall\n> feature but with different quality, stability, etc.) ", "which actually do\n> add up.", "\n>> You can look at the features page for both:\n> http://code.google.com/a/eclipselabs.org/p/ddt/wiki/Features> http://www.dsource.org/projects/descent>> although it may not give a complete picture, especially with regards to\n> the minor details. ", "From what I can see and remember, the differences are\n> something like this:\n>> Descent has:\n> * debugger integration (ddbg and GDC)\n> * in-editor, as-you-type, semantic error reporting (DDT reports syntax\n> errors only)\n> * formatter (seems to work quite well)\n> * type hierarchy\n> * Some compile-time function evaluation/debugging (seems a bit brittle\n> though)\n> * TODO/FIXME/XXX tasks tags. (", "this should be coming soon to DDT)\n* Descent is not developed anymore :-P\n>> DDT has:\n> * integrated builder (a simple one though, delegates to another tool)\n> * search for references (the inverse of find declaration)\n>> There some other minor differences. ", "Descent has better icon/decoration\n> support, wizards for creating new classes/modules, and other things I\n> don't remember. ", "Then there is code completion (aka Content Assist) which\n> both IDEs support, but the quality varies a lot. ", "Descent's is generally\n> smarter and works in more contexts, and supports completing function\n> calls (IIRC), but is very brittle and more unstable, and very tied to a\n> specific D version (the latest one being D2 as of 1-2 years ago, I think).", "\n>>> PS:\n> I want to soon add debugger integration to DDT as well, as that is a\n> very nice feature to have, but I have been caught up in other dev\n> tasks/features (mostly more DLTK integration). ", "These tasks are not as\n> important to the IDE user as debugging, but it is important to me as a\n> contributor to finish them first (because there is still DLTK 2.0\n> functionality I haven't extended/finished, yet DLTK 3.0 is already\n> coming next month, with Eclipse 3.7 (Indigo), and I'm trying to keep up).", "\nFor the debugger, you can check out Descent code. ", "I think you should be able to use most of it, it was made from scratch and almost without using any of the copied JDT logic. ", "It made a front-end for gdb and ddbg (IIRC the name), so you should be able to implement the interfaces just fine to support another debugger.", "\nDescent was too an ambitious project and coupled with the way D evolves (which I don't quite like, but I'm not developing my own language either, so...) made me quit it.", "\n\nOn 2011-05-06 16:36, Ary Manzana wrote:\n> Descent was too an ambitious project and coupled with the way D evolves\n> (which I don't quite like, but I'm not developing my own language\n> either, so...) made me quit it.", "\nDescent was a great IDE but I can see why you quit. ", "It's to hard and takes to much time to keep up with the changes to the language.", "\n--\n/Jacob Carlborg\n\nOn 06/05/2011 15:36, Ary Manzana wrote:\n> For the debugger, you can check out Descent code. ", "I think you should be\n> able to use most of it, it was made from scratch and almost without\n> using any of the copied JDT logic. ", "It made a front-end for gdb and ddbg\n> (IIRC the name), so you should be able to implement the interfaces just\n> fine to support another debugger.", "\nYeah, I know, and I'll definitely look at Descent code when working the debugger functionality, but I just haven't got to that task yet.", "\n--\nBruno Medeiros - Software Engineer" ]

{ "pile_set_name": "Pile-CC" }

[ 0.01680672268907563, 0.011764705882352941, 0, 0, 0, 0, 0.013157894736842105, 0.002702702702702703, 0.008746355685131196, 0.018779342723004695, 0, 0.005128205128205128, 0, 0.00423728813559322, 0.010666666666666666, 0.004807692307692308, 0, 0.009433962264150943, 0.004201680672268907, 0.0053475935828877, 0.006666666666666667, 0.019417475728155338, 0.00749063670411985, 0, 0, 0, 0, 0.012987012987012988, 0.0026595744680851063, 0.008595988538681949, 0.01818181818181818, 0, 0.0049504950495049506, 0, 0.008097165991902834, 0.007575757575757576, 0.0045871559633027525, 0, 0.009259259259259259, 0.004098360655737705, 0.005076142131979695, 0.006493506493506494, 0, 0.03333333333333333, 0.017857142857142856, 0, 0.021897810218978103, 0.03225806451612903, 0.01818181818181818, 0, 0.009345794392523364, 0, 0, 0.024509803921568627, 0.00749063670411985, 0, 0, 0, 0, 0.012987012987012988, 0.0026595744680851063, 0.008595988538681949, 0.01818181818181818, 0, 0.0049504950495049506, 0, 0.008097165991902834, 0.007575757575757576, 0.0038910505836575876, 0, 0.009259259259259259, 0.004098360655737705, 0.005076142131979695, 0.006493506493506494, 0, 0, 0, 0, 0.004608294930875576, 0, 0, 0.017699115044247787, 0, 0, 0, 0.02631578947368421 ]

[ "9:19 PM,\nMar. 19, 2014\n\nNashville Predators head coach Barry Trotz talks with his players during a game against the Colorado Avalanche.", "\n\nWritten by\n\nMax Smith\n| The Tennessean\n\nA compromise between the Memphis Grizzlies, the Nashville Predators, their leagues and players' unions might allow the state House to pass a bill to repeal a tax on professional athletes' earnings, one they've fought for more than a year.", "\n\nTennessee is one of 18 states with a tax requiring certain professions to pay for the privilege of operating in the state. ", "The \"Occupational Privilege Tax\" lists engineers, pharmacists, architects and others as taxable occupations, but it often is called the \"jock tax\" because of the high-profile athletes who also must pay." ]

{ "pile_set_name": "Pile-CC" }

[ 0.007407407407407408, 0.017857142857142856, 0, 0 ]

[ "The role of recombination in the evolvement of the fragile X mutation.", "\nThe frequency of recombination in the regions adjacent to the fragile X locus was studied in two groups of carriers: daughters of transmitting males and transmitters of maternally inherited fragile X chromosomes. ", "Approximately one-half of the offspring of the former and one quarter of the offspring of the latter are recombinant. ", "Recombinants and parentals are equally distributed among affected and normal offspring in the two groups. ", "These results indicate that crossing-over at or around the fragile X locus occurs in every meiosis in daughters of transmitting males, although the recombinant chromatids do not necessarily carry the fragile X mutation. ", "Hence, crossing-over is unequivocally associated with, but is not the direct cause of, the transition from the primary genetic lesion to the final mutation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0 ]

[ "Casey536\n\nThis is a beautiful working monastery in the Golden Ring between Vladimir and Suzdal. ", "The grounds are immaculately kept and the blue domes on the white buildings are beautiful Definitely worth a stop....\nmore »\n\nOnce on the site of the monastery was a Kremlin, Andrei Bogolyubsky's Palace. ", "Preserved till our days is the stone niche in the stair Tower Palace, where many centuries ago Prince was killed. ", "Now it's a bright, bright place no recalls the massacre. ", "The current monastery, is popular with tourists.", "\n\nFor Business Owners\n\nEvery day, we help thousands of travelers plan great vacations. ", "Here are some tips on how to use your Listing Page to attract more travelers to your business - Svyato-Bogolyubsky monastery.", "\n\nReview Your Listing\nReview information on this page and make sure it is accurate. ", "If you have photos, descriptions, contact information,\nsocial media handles, etc. ", "you would like to add, please send us an email.", "\n\nPromote Your Listing\nPromote your permanent link - https://www.inspirock.com/russia/bogolyubovo/svyato-bogolyubsky-monastery-a2246745135 - on your website, your blog, and social media.", "\nWhen a traveler builds a plan from this page, the itinerary automatically includes Svyato-Bogolyubsky monastery.", "\nThis is a great way for travelers looking for a great vacation in your city or country to also experience\nSvyato-Bogolyubsky monastery.", "\nPromoting your link also lets your audience know that you are featured on a rapidly growing travel site.", "\nIn addition, the more this page is used, the more we will promote Svyato-Bogolyubsky monastery to other Inspirock users.", "\n\nSetup Your Trip Planning Widget\nFor best results, use the customized Trip Planning Widget for Svyato-Bogolyubsky monastery on your website.", "\nIt has all the advantages mentioned above, plus users to your site can conveniently access it directly on your site.", "\nVisitors to your site will appreciate you offering them help with planning their vacation.", "\nSetting this up takes just a few minutes - Click here for instructions." ]

{ "pile_set_name": "Pile-CC" }

[ 0.020833333333333332, 0.00980392156862745, 0, 0, 0, 0.011494252873563218, 0, 0, 0, 0, 0.005376344086021506, 0.008849557522123894, 0, 0, 0.01652892561983471, 0.0070921985815602835, 0, 0, 0 ]

[ "Q:\n\nMatlab-style Find in Mathematica? ", "Value list and Boolean List, how to select values according to the boolean list?", "\n\nI want to select elements with the true value (Indices list) in the corresponding point to the value list (MCS). ", "Is there anything like Matlab-style Find to get the indices of true values in the boolean list and then use it like MCS[[indicesNumbers]]?", "\n\nA:\n\nAs Rojo suggested, Pick works -- yet there may be other solutions.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.0125, 0, 0, 0.013888888888888888, 0 ]

[ "I can not offer you any personal tasting notes but in September 1998 Wine Spectator gave it 87 points and said the following:\n\nAn earthy yet complex style, with mushroom, dried cherry and leather notes. ", "Shows more funk and personality than the best Steeles from 1996, but it's a challenging bottle that's fun to drink, now through 2000. (", "5500 cases produced)" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0.007407407407407408, 0 ]

[ "Glucocorticoid-regulated trafficking of mouse mammary tumor virus proteins in permeabilized hepatoma cells. ", "Requirements of intracellular membrane transport for maturation of the cytoplasmic phosphorylated polyprotein.", "\nGlucocorticoids coincidentally regulate the localization of mouse mammary tumor virus (MMTV) glycoproteins and maturation of viral phosphoproteins in viral infected rat hepatoma cells. ", "To test for a functional interaction between MMTV transmembrane glycoproteins and cytoplasmic phosphoproteins, the bacterial cytolysin streptolysin-O was utilized to selectively permeabilize the plasma membrane and reconstitute exocytic trafficking. ", "Streptolysin-O-permeabilized M1.54 cells pretreated with glucocorticoids retained the capability for proteolytic processing, cell surface delivery, and externalization of MMTV glycoproteins as determined by immunoprecipitation and immunofluorescence microscopy. ", "The efficient maturation of MMTV phosphoproteins indicated that these viral proteins are properly transported near or to the plasma membrane in permeabilized cells. ", "These maturation events in semi-intact cells were dependent on the addition of cell cytosol and were specifically inhibited by the membrane impermeant GTP analog guanosine 5'3-O-(thio)triphosphate, an agent known to impede vesicular transport of membrane proteins, but which has not previously been shown to alter cytoplasmic protein maturation or transport. ", "The addition of anti-MMTV antibodies directed against the cytoplasmic domain of the glycoprotein precursor to transport competent semi-intact M1.54 cells resulted in the dramatic inhibition of both MMTV glycoprotein and phosphoprotein maturation. ", "These results were not obtained using either preimmune sera or antiserum specific for the luminal portion of the glycoprotein precursor. ", "Our findings suggest that the functional interaction of cytosolic MMTV phosphoproteins with the cytoplasmic domain of the viral membrane glycoprotein is required for the efficient transport and processing of each class of proteins in glucocorticoid-treated cells and provides the first evidence for the involvement of vesicular transport in the delivery and maturation of cytoplasmic viral proteins at the plasma membrane or the pericellular region." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.009259259259259259, 0, 0.005376344086021506, 0, 0.003816793893129771, 0, 0, 0, 0, 0 ]

[ "\n\nMobile HTML Frameworks that work with PhoneGap - y0ghur7_xxx\nhttp://s2.diffuse.it/blog/show/14823-Mobile_HTML_Frameworks_that_work_with_PhoneGap\n\n======\nnobleach\nEven though I'm a fan of what you get \"for free\" with Sencha Touch, it's\nobvious they desire to charge up the wazoo. ", "Their framework is a complete pain\nwhen you want to step outside of their box. ", "Support for non-paying customers\nis abysmal... and they expect you to understand what they were thinking when\nthey designed the product. ", "If they would bring Jack Slocum back, they might\nhave a fighting chance.", "\n\nI DID like the demo videos showing what you could build in a quick 20 minutes.", "\nReality is, they're just not there for the rest of your project yet.", "\n\nI'm currently thinking native widgets, native panels and all of that are the\nway to go. ", "jQuery Mobile is ok for phones, and hideous on tablets. ", "But it's\nboring. ", "That's the issue. ", "We need something that provides beautiful buttons\nand widgets that isn't trying to emulate an iPhone. ", "We need something that\nunderstands JSON APIs and how mobile apps really work.", "\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.0035587188612099642, 0, 0, 0.013888888888888888, 0, 0, 0, 0.017857142857142856, 0, 0, 0.00980392156862745, 0, 0 ]

[ "One of the most famous singers in China\n\nPosted by: anave | May 7, 2009 Comments Off on One of the most famous singers in China |\n\nJay Chou (traditional Chinese: 周杰倫; simplified Chinese: 周杰伦; pinyin: Zhōu Jiélún; (born January 18, 1979) is a Taiwanese musician, singer, producer, actor and director who has won the World Music Award four times. ", "He is well-known for composing all his own songs and songs for other singers.", "\n\nIn 1998 he was discovered in a talent contest where he displayed his piano and song-writing skills. ", "Over the next two years, he was hired to compose for popular Chinese singers. ", "Although he was trained in classical music, Chou combines Chinese and Western music styles to produce songs that fuse R&B, rock and pop genres, covering issues such as domestic violence, war, and urbanization.", "\nIn 2000, Chou released his first album, titled Jay, under the record company Alfa Music. ", "Since then he has released one album per year, selling several million copies each. ", "His music has gained recognition throughout Asia, most notably in regions such as mainland China, Japan, Hong Kong, Malaysia, Indonesia, Singapore, Vietnam, Taiwan, and in overseas Asian communities, winning more than 20 awards each year. ", "He has sold over 25 million albums worldwide. ", "He debuted his acting career in Initial D (2005), for which he won Best Newcomer Actor in Golden Horse Awards, and was nominated for Best Supporting Actor by Hong Kong Film Awards for his role in Curse of the Golden Flower (2006). ", "His career now extends into directing and running his own record company JVR Music. ", "He has also endorsed various models of Media Players released by Onda in which he appears on the box, and his signature and likeness is printed on the back of certain models of these players." ]

{ "pile_set_name": "Pile-CC" }

[ 0.008695652173913044, 0, 0, 0, 0.004784688995215311, 0.022222222222222223, 0, 0, 0, 0.012987012987012988, 0.011904761904761904, 0.010471204188481676 ]

[ "Climate and cholera in KwaZulu-Natal, South Africa: the role of environmental factors and implications for epidemic preparedness.", "\nA cholera epidemic that took place in KwaZulu-Natal, South Africa (2000-2001) was employed to investigate the impact of climatic and environmental drivers on cholera dynamics. ", "Precipitation (PRE), sea surface temperature (SST) and chlorophyll-a (CHL-a) data acquired from publicly available satellite and ground measurements were analysed together with disease incidence in an effort to assess the environmental contribution to the outbreak. ", "SST (r(2)=0.749, lag=0 months) and PRE (r(2)=0.744, lag=2 months) showed strong associations with incidence. ", "CHL-a showed a moderately strong (r(2)=0.656, lag=6 months) association with incidence while sea surface height (SSH) demonstrated a weak relationship with incidence (r(2)=0.326, lag=5 months). ", "Our analysis tentatively supports a coastal transmission hypothesis, heavily influenced by localized PRE extremes. ", "The role of SSH is likely attenuated by local coastal topography. ", "Future work should clarify the mechanism linking coastal cholera reservoirs and the regional climate system to outbreaks in this region. ", "Finally, we discuss benefits of further research in this area using extended remotely sensed and epidemiological datasets towards the development of early-warning systems and enhanced epidemic preparedness." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.015503875968992248, 0.011299435028248588, 0, 0, 0.015463917525773196, 0, 0.015151515151515152, 0, 0 ]

[ "[Surgical and anesthetic coordination during tracheal and carinal resections and reconstruction].", "\nA retrospective study of anesthetic and surgical techniques involved in 55 consecutive cases of tracheal and carinal resections completed from 2001 to 2007, is presented. ", "The anesthetic maneuvers and surgical approach differed in relation with the site of the tracheal lesions (upper, middle, lower trachea or carinal), the degree of the obstruction, the emergency of the surgical intervention and the concomitant presence of the eso-tracheal fistula. ", "Ventilatory support during anesthesia involved special equipment adapted to the particular techniques used in this type of surgery. ", "Cross field intubation of trachea or a mainstem bronchus, and High Frequency Jet Ventilation-HFJV- have been frequently used. ", "Perfect coordination of the anesthetic techniques with every surgical step is mandatory and for good long term results special anesthetic equipment and a good preoperative anesthetic and surgical assessment of the strategy is needed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0 ]

[ "#\r\n# Git Servlet Settings\r\n#\r\n\r\n# Base folder for repositories.", "\r\n# This folder may contain bare and non-bare repositories but Gitblit will only\r\n# allow you to push to bare repositories.", "\r\n# Use forward slashes even on Windows!!", "\r\n# e.g. c:/gitrepos\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\ngit.repositoriesFolder = ${baseFolder}/git\r\n\r\n# Build the available repository list at startup and cache this list for reuse.", "\r\n# This reduces disk io when presenting the repositories page, responding to rpcs,\r\n# etc, but it means that Gitblit will not automatically identify repositories\r\n# added or deleted by external tools.", "\r\n#\r\n# For this case you can use curl, wget, etc to issue an rpc request to clear the\r\n# cache (e.g. https://localhost/rpc?req=CLEAR_REPOSITORY_CACHE)\r\n#\r\n# SINCE 1.1.0\r\ngit.cacheRepositoryList = true\r\n\r\n# Search the repositories folder subfolders for other repositories.", "\r\n# Repositories MAY NOT be nested (i.e. one repository within another)\r\n# but they may be grouped together in subfolders.", "\r\n# e.g. c:/gitrepos/libraries/mylibrary.git\r\n# c:/gitrepos/libraries/myotherlibrary.git\r\n#\r\n# SINCE 0.5.0\r\ngit.searchRepositoriesSubfolders = true\r\n\r\n# Maximum number of folders to recurse into when searching for repositories.", "\r\n# The default value, -1, disables depth limits.", "\r\n#\r\n# SINCE 1.1.0\r\ngit.searchRecursionDepth = -1\r\n\r\n# List of regex exclusion patterns to match against folders found in\r\n# *git.repositoriesFolder*.", "\r\n# Use forward slashes even on Windows!!", "\r\n# e.g. test/jgit\\.git\r\n#\r\n# SPACE-DELIMITED\r\n# CASE-SENSITIVE\r\n# SINCE 1.1.0\r\ngit.searchExclusions =\r\n\r\n# List of regex url patterns for extracting a repository name when locating\r\n# submodules.", "\r\n# e.g. git.submoduleUrlPatterns = .*?://github.com/(.*) ", "will extract\r\n# *gitblit/gitblit.git* from *git://github.com/gitblit/gitblit.git*\r\n# If no matches are found then the submodule repository name is assumed to be\r\n# whatever trails the last / character. (", "e.g. gitblit.git).", "\r\n#\r\n# SPACE-DELIMITED\r\n# CASE-SENSITIVE\r\n# SINCE 1.1.0\r\ngit.submoduleUrlPatterns = .*?://github.com/(.*)", "\r\n\r\n# Allow push/pull over http/https with JGit servlet.", "\r\n# If you do NOT want to allow Git clients to clone/push to Gitblit set this\r\n# to false. ", " You might want to do this if you are only using ssh:// or git://.\r\n# If you set this false, consider changing the *web.otherUrls* setting to\r\n# indicate your clone/push urls.", "\r\n#\r\n# SINCE 0.5.0\r\ngit.enableGitServlet = true\r\n\r\n# If you want to restrict all git servlet access to those with valid X509 client\r\n# certificates then set this value to true.", "\r\n#\r\n# SINCE 1.2.0\r\ngit.requiresClientCertificate = false\r\n\r\n# Enforce date checks on client certificates to ensure that they are not being\r\n# used prematurely and that they have not expired.", "\r\n#\r\n# SINCE 1.2.0\r\ngit.enforceCertificateValidity = true\r\n\r\n# List of OIDs to extract from a client certificate DN to map a certificate to\r\n# an account username.", "\r\n#\r\n# e.g. git.certificateUsernameOIDs = CN\r\n# e.g. git.certificateUsernameOIDs = FirstName LastName\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 1.2.0\r\ngit.certificateUsernameOIDs = CN\r\n\r\n# Only serve/display bare repositories.", "\r\n# If there are non-bare repositories in git.repositoriesFolder and this setting\r\n# is true, they will be excluded from the ui. ", "\r\n#\r\n# SINCE 0.9.0\r\ngit.onlyAccessBareRepositories = false\r\n\r\n# Allow an authenticated user to create a destination repository on a push if\r\n# the repository does not already exist.", "\r\n#\r\n# Administrator accounts can create a repository in any project.", "\r\n# These repositories are created with the default access restriction and authorization\r\n# control values. ", " The pushing account is set as the owner.", "\r\n#\r\n# Non-administrator accounts with the CREATE role may create personal repositories.", "\r\n# These repositories are created as VIEW restricted for NAMED users.", "\r\n# The pushing account is set as the owner.", "\r\n#\r\n# SINCE 1.2.0\r\ngit.allowCreateOnPush = true\r\n\r\n# The default access restriction for new repositories.", "\r\n# Valid values are NONE, PUSH, CLONE, VIEW\r\n# NONE = anonymous view, clone, & push\r\n# PUSH = anonymous view & clone and authenticated push\r\n# CLONE = anonymous view, authenticated clone & push\r\n# VIEW = authenticated view, clone, & push\r\n#\r\n# SINCE 1.0.0\r\ngit.defaultAccessRestriction = NONE\r\n\r\n# The default authorization control for new repositories.", "\r\n# Valid values are AUTHENTICATED and NAMED\r\n# AUTHENTICATED = any authenticated user is granted restricted access\r\n# NAMED = only named users/teams are granted restricted access\r\n#\r\n# SINCE 1.1.0\r\ngit.defaultAuthorizationControl = NAMED\r\n\r\n# Enable JGit-based garbage collection. (!!", "EXPERIMENTAL!!)", "\r\n#\r\n# USE AT YOUR OWN RISK!", "\r\n#\r\n# If enabled, the garbage collection executor scans all repositories once a day\r\n# at the hour of your choosing. ", " The GC executor will take each repository \"offline\",\r\n# one-at-a-time, to check if the repository satisfies it's GC trigger requirements.", "\r\n#\r\n# While the repository is offline it will be inaccessible from the web UI or from\r\n# any of the other services (git, rpc, rss, etc).", "\r\n#\r\n# Gitblit's GC Executor MAY NOT PLAY NICE with the other Git kids on the block,\r\n# especially on Windows systems, so if you are using other tools please coordinate\r\n# their usage with your GC Executor schedule or do not use this feature.", "\r\n#\r\n# The GC algorithm complex and the JGit team advises caution when using their\r\n# young implementation of GC.", "\r\n#\r\n# http://wiki.eclipse.org/EGit/New_and_Noteworthy/2.1#Garbage_Collector_and_Repository_Storage_Statistics\r\n#\r\n# EXPERIMENTAL\r\n# SINCE 1.2.0\r\n# RESTART REQUIRED\r\ngit.enableGarbageCollection = false\r\n\r\n# Hour of the day for the GC Executor to scan repositories.", "\r\n# This value is in 24-hour time.", "\r\n#\r\n# SINCE 1.2.0\r\ngit.garbageCollectionHour = 0\r\n\r\n# The default minimum total filesize of loose objects to trigger early garbage\r\n# collection.", "\r\n#\r\n# You may specify a custom threshold for a repository in the repository's settings.", "\r\n# Common unit suffixes of k, m, or g are supported.", "\r\n#\r\n# SINCE 1.2.0\r\ngit.defaultGarbageCollectionThreshold = 500k\r\n\r\n# The default period, in days, between GCs for a repository. ", " If the total filesize\r\n# of the loose object exceeds *git.garbageCollectionThreshold* or the repository's\r\n# custom threshold, this period will be short-circuited. ", "\r\n#\r\n# e.g. if a repository collects 100KB of loose objects every day with a 500KB\r\n# threshold and a period of 7 days, it will take 5 days for the loose objects to\r\n# be collected, packed, and pruned.", "\r\n#\r\n# OR\r\n#\r\n# if a repository collects 10KB of loose objects every day with a 500KB threshold\r\n# and a period of 7 days, it will take the full 7 days for the loose objects to be\r\n# collected, packed, and pruned.", "\r\n#\r\n# You may specify a custom period for a repository in the repository's settings.", "\r\n#\r\n# The minimum value is 1 day since the GC Executor only runs once a day.", "\r\n#\r\n# SINCE 1.2.0\r\ngit.defaultGarbageCollectionPeriod = 7\r\n\r\n# Number of bytes of a pack file to load into memory in a single read operation.", "\r\n# This is the \"page size\" of the JGit buffer cache, used for all pack access\r\n# operations. ", "All disk IO occurs as single window reads. ", "Setting this too large\r\n# may cause the process to load more data than is required; setting this too small\r\n# may increase the frequency of read() system calls.", "\r\n#\r\n# Default on JGit is 8 KiB on all platforms.", "\r\n#\r\n# Common unit suffixes of k, m, or g are supported.", "\r\n# Documentation courtesy of the Gerrit project.", "\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\ngit.packedGitWindowSize = 8k\r\n\r\n# Maximum number of bytes to load and cache in memory from pack files. ", "If JGit\r\n# needs to access more than this many bytes it will unload less frequently used\r\n# windows to reclaim memory space within the process. ", "As this buffer must be shared\r\n# with the rest of the JVM heap, it should be a fraction of the total memory available.", "\r\n#\r\n# The JGit team recommends setting this value larger than the size of your biggest\r\n# repository. ", "This ensures you can serve most requests from memory.", "\r\n#\r\n# Default on JGit is 10 MiB on all platforms.", "\r\n#\r\n# Common unit suffixes of k, m, or g are supported.", "\r\n# Documentation courtesy of the Gerrit project.", "\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\ngit.packedGitLimit = 10m\r\n\r\n# Maximum number of bytes to reserve for caching base objects that multiple deltafied\r\n# objects reference. ", "By storing the entire decompressed base object in a cache Git\r\n# is able to avoid unpacking and decompressing frequently used base objects multiple times.", "\r\n#\r\n# Default on JGit is 10 MiB on all platforms. ", "You probably do not need to adjust\r\n# this value.", "\r\n#\r\n# Common unit suffixes of k, m, or g are supported.", "\r\n# Documentation courtesy of the Gerrit project.", "\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\ngit.deltaBaseCacheLimit = 10m\r\n\r\n# Maximum number of pack files to have open at once. ", "A pack file must be opened\r\n# in order for any of its data to be available in a cached window.", "\r\n#\r\n# If you increase this to a larger setting you may need to also adjust the ulimit\r\n# on file descriptors for the host JVM, as Gitblit needs additional file descriptors\r\n# available for network sockets and other repository data manipulation.", "\r\n#\r\n# Default on JGit is 128 file descriptors on all platforms.", "\r\n# Documentation courtesy of the Gerrit project.", "\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\ngit.packedGitOpenFiles = 128\r\n\r\n# Largest object size, in bytes, that JGit will allocate as a contiguous byte\r\n# array. ", "Any file revision larger than this threshold will have to be streamed,\r\n# typically requiring the use of temporary files under $GIT_DIR/objects to implement\r\n# psuedo-random access during delta decompression.", "\r\n#\r\n# Servers with very high traffic should set this to be larger than the size of\r\n# their common big files. ", "For example a server managing the Android platform\r\n# typically has to deal with ~10-12 MiB XML files, so 15 m would be a reasonable\r\n# setting in that environment. ", "Setting this too high may cause the JVM to run out\r\n# of heap space when handling very big binary files, such as device firmware or\r\n# CD-ROM ISO images. ", "Make sure to adjust your JVM heap accordingly. ", "\r\n#\r\n# Default is 50 MiB on all platforms.", "\r\n#\r\n# Common unit suffixes of k, m, or g are supported.", "\r\n# Documentation courtesy of the Gerrit project.", "\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\ngit.streamFileThreshold = 50m\r\n\r\n# When true, JGit will use mmap() rather than malloc()+read() to load data from\r\n# pack files. ", " The use of mmap can be problematic on some JVMs as the garbage\r\n# collector must deduce that a memory mapped segment is no longer in use before\r\n# a call to munmap() can be made by the JVM native code.", "\r\n#\r\n# In server applications (such as Gitblit) that need to access many pack files,\r\n# setting this to true risks artificially running out of virtual address space, \r\n# as the garbage collector cannot reclaim unused mapped spaces fast enough.", "\r\n#\r\n# Default on JGit is false. ", "Although potentially slower, it yields much more\r\n# predictable behavior.", "\r\n# Documentation courtesy of the Gerrit project.", "\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\ngit.packedGitMmap = false\r\n\r\n#\r\n# Groovy Integration\r\n#\r\n\r\n# Location of Groovy scripts to use for Pre and Post receive hooks.", "\r\n# Use forward slashes even on Windows!!", "\r\n# e.g. c:/groovy\r\n#\r\n# RESTART REQUIRED\r\n# SINCE 0.8.0\r\ngroovy.scriptsFolder = ${baseFolder}/groovy\r\n\r\n# Specify the directory Grape uses for downloading libraries.", "\r\n# http://groovy.codehaus.org/Grape\r\n#\r\n# RESTART REQUIRED\r\n# SINCE 1.0.0\r\ngroovy.grapeFolder = ${baseFolder}/groovy/grape\r\n\r\n# Scripts to execute on Pre-Receive.", "\r\n#\r\n# These scripts execute after an incoming push has been parsed and validated\r\n# but BEFORE the changes are applied to the repository. ", " You might reject a\r\n# push in this script based on the repository and branch the push is attempting\r\n# to change.", "\r\n#\r\n# Script names are case-sensitive on case-sensitive file systems. ", " You may omit\r\n# the traditional \".groovy\" from this list if your file extension is \".groovy\" \r\n#\r\n# NOTE:\r\n# These scripts are only executed when pushing to *Gitblit*, not to other Git\r\n# tooling you may be using. ", " Also note that these scripts are shared between\r\n# repositories. ", "These are NOT repository-specific scripts! ", " Within the script\r\n# you may customize the control-flow for a specific repository by checking the\r\n# *repository* variable.", "\r\n#\r\n# SPACE-DELIMITED\r\n# CASE-SENSITIVE\r\n# SINCE 0.8.0\r\ngroovy.preReceiveScripts =\r\n\r\n# Scripts to execute on Post-Receive.", "\r\n#\r\n# These scripts execute AFTER an incoming push has been applied to a repository.", "\r\n# You might trigger a continuous-integration build here or send a notification.", "\r\n#\r\n# Script names are case-sensitive on case-sensitive file systems. ", " You may omit\r\n# the traditional \".groovy\" from this list if your file extension is \".groovy\" \r\n#\r\n# NOTE:\r\n# These scripts are only executed when pushing to *Gitblit*, not to other Git\r\n# tooling you may be using. ", " Also note that these scripts are shared between\r\n# repositories. ", "These are NOT repository-specific scripts! ", " Within the script\r\n# you may customize the control-flow for a specific repository by checking the\r\n# *repository* variable.", "\r\n# \r\n# SPACE-DELIMITED\r\n# CASE-SENSITIVE\r\n# SINCE 0.8.0\r\ngroovy.postReceiveScripts =\r\n\r\n# Repository custom fields for Groovy Hook mechanism\r\n#\r\n# List of key=label pairs of custom fields to prompt for in the Edit Repository\r\n# page. ", " These keys are stored in the repository's git config file in the \r\n# section [gitblit \"customFields\"]. ", " Key names are alphanumeric only. ", " These\r\n# fields are intended to be used for the Groovy hook mechanism where a script\r\n# can adjust it's execution based on the custom fields stored in the repository\r\n# config.", "\r\n#\r\n# e.g. \"commitMsgRegex=Commit Message Regular Expression\" anotherProperty=Another\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 1.0.0\r\ngroovy.customFields = \r\n\r\n#\r\n# Authentication Settings\r\n#\r\n\r\n# Require authentication to see everything but the admin pages\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nweb.authenticateViewPages = false\r\n\r\n# Require admin authentication for the admin functions and pages\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nweb.authenticateAdminPages = true\r\n\r\n# Allow Gitblit to store a cookie in the user's browser for automatic\r\n# authentication. ", " The cookie is generated by the user service.", "\r\n#\r\n# SINCE 0.5.0\r\nweb.allowCookieAuthentication = true\r\n\r\n# Config file for storing project metadata\r\n#\r\n# SINCE 1.2.0\r\nweb.projectsFile = ${baseFolder}/projects.conf\r\n\r\n# Either the full path to a user config file (users.conf)\r\n# OR the full path to a simple user properties file (users.properties)\r\n# OR a fully qualified class name that implements the IUserService interface.", "\r\n#\r\n# Alternative user services:\r\n# com.gitblit.", "LdapUserService\r\n# com.gitblit.", "RedmineUserService\r\n#\r\n# Any custom user service implementation must have a public default constructor.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nrealm.userService = test-ui-users.conf\r\n\r\n# How to store passwords.", "\r\n# Valid values are plain, md5, or combined-md5. ", " md5 is the hash of password.", "\r\n# combined-md5 is the hash of username.toLowerCase()+password.", "\r\n# Default is md5.", "\r\n#\r\n# SINCE 0.5.0 \r\nrealm.passwordStorage = md5\r\n\r\n# Minimum valid length for a plain text password.", "\r\n# Default value is 5. ", " Absolute minimum is 4.", "\r\n#\r\n# SINCE 0.5.0 \r\nrealm.minPasswordLength = 5\r\n\r\n#\r\n# Gitblit Web Settings\r\n#\r\n# If blank Gitblit is displayed.", "\r\n#\r\n# SINCE 0.5.0\r\nweb.siteName =\r\n\r\n# If *web.authenticateAdminPages*=true, users with \"admin\" role can create\r\n# repositories, create users, and edit repository metadata.", "\r\n#\r\n# If *web.authenticateAdminPages*=false, any user can execute the aforementioned\r\n# functions. ", "\r\n#\r\n# SINCE 0.5.0 \r\nweb.allowAdministration = true\r\n\r\n# Allows rpc clients to list repositories and possibly manage or administer the \r\n# Gitblit server, if the authenticated account has administrator permissions.", "\r\n# See *web.enableRpcManagement* and *web.enableRpcAdministration*.", "\r\n#\r\n# SINCE 0.7.0 \r\nweb.enableRpcServlet = true\r\n\r\n# Allows rpc clients to manage repositories and users of the Gitblit instance,\r\n# if the authenticated account has administrator permissions.", "\r\n# Requires *web.enableRpcServlet=true*.", "\r\n#\r\n# SINCE 0.7.0 \r\nweb.enableRpcManagement = false\r\n\r\n# Allows rpc clients to control the server settings and monitor the health of this\r\n# this Gitblit instance, if the authenticated account has administrator permissions.", "\r\n# Requires *web.enableRpcServlet=true* and *web.enableRpcManagement*.", "\r\n#\r\n# SINCE 0.7.0 \r\nweb.enableRpcAdministration = false\r\n\r\n# Full path to a configurable robots.txt file. ", " With this file you can control\r\n# what parts of your Gitblit server respectable robots are allowed to traverse.", "\r\n# http://googlewebmastercentral.blogspot.com/2008/06/improving-on-robots-exclusion-protocol.html\r\n#\r\n# SINCE 1.0.0\r\nweb.robots.txt = \r\n\r\n# If true, the web ui layout will respond and adapt to the browser's dimensions.", "\r\n# if false, the web ui will use a 940px fixed-width layout.", "\r\n# http://twitter.github.com/bootstrap/scaffolding.html#responsive\r\n#\r\n# SINCE 1.0.0\r\nweb.useResponsiveLayout = true\r\n\r\n# Allow Gravatar images to be displayed in Gitblit pages.", "\r\n#\r\n# SINCE 0.8.0\r\nweb.allowGravatar = true\r\n\r\n# Allow dynamic zip downloads.", "\r\n#\r\n# SINCE 0.5.0 \r\nweb.allowZipDownloads = true\r\n\r\n# If *web.allowZipDownloads=true* the following formats will be displayed for\r\n# download compressed archive links:\r\n#\r\n# zip = standard .zip\r\n# tar = standard tar format (preserves *nix permissions and symlinks)\r\n# gz = gz-compressed tar\r\n# xz = xz-compressed tar\r\n# bzip2 = bzip2-compressed tar\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 1.2.0\r\nweb.compressedDownloads = zip gz\r\n\r\n# Allow optional Lucene integration. ", "Lucene indexing is an opt-in feature.", "\r\n# A repository may specify branches to index with Lucene instead of using Git\r\n# commit traversal. ", "There are scenarios where you may want to completely disable\r\n# Lucene indexing despite a repository specifying indexed branches. ", " One such\r\n# scenario is on a resource-constrained federated Gitblit mirror.", "\r\n#\r\n# SINCE 0.9.0\r\nweb.allowLuceneIndexing = false\r\n\r\n# Allows an authenticated user to create forks of a repository\r\n#\r\n# set this to false if you want to disable all fork controls on the web site\r\n#\r\nweb.allowForking = true\r\n\r\n# Controls the length of shortened commit hash ids\r\n#\r\n# SINCE 1.2.0\r\nweb.shortCommitIdLength = 6\r\n\r\n# Use Clippy (Flash solution) to provide a copy-to-clipboard button.", "\r\n# If false, a button with a more primitive JavaScript-based prompt box will\r\n# offer a 3-step (click, ctrl+c, enter) copy-to-clipboard alternative.", "\r\n#\r\n# SINCE 0.8.0\r\nweb.allowFlashCopyToClipboard = true\r\n\r\n# Default maximum number of commits that a repository may contribute to the\r\n# activity page, regardless of the selected duration. ", " This setting may be valuable\r\n# for an extremely busy server. ", " This value may also be configed per-repository\r\n# in Edit Repository. ", "0 disables this throttle.", "\r\n#\r\n# SINCE 1.2.0\r\nweb.maxActivityCommits = 0\r\n\r\n# Default number of entries to include in RSS Syndication links\r\n#\r\n# SINCE 0.5.0\r\nweb.syndicationEntries = 25\r\n\r\n# Show the size of each repository on the repositories page.", "\r\n# This requires recursive traversal of each repository folder. ", " This may be\r\n# non-performant on some operating systems and/or filesystems. ", "\r\n#\r\n# SINCE 0.5.2\r\nweb.showRepositorySizes = true\r\n\r\n# List of custom regex expressions that can be displayed in the Filters menu\r\n# of the Repositories and Activity pages. ", " Keep them very simple because you\r\n# are likely to run into encoding issues if they are too complex.", "\r\n#\r\n# Use !!! ", "to separate the filters \r\n#\r\n# SINCE 0.8.0\r\nweb.customFilters =\r\n\r\n# Show federation registrations (without token) and the current pull status\r\n# to non-administrator users. ", "\r\n#\r\n# SINCE 0.6.0\r\nweb.showFederationRegistrations = false\r\n\r\n# This is the message displayed when *web.authenticateViewPages=true*.", "\r\n# This can point to a file with Markdown content.", "\r\n# Specifying \"gitblit\" uses the internal login message.", "\r\n#\r\n# SINCE 0.7.0\r\nweb.loginMessage = gitblit\r\n\r\n# This is the message displayed above the repositories table.", "\r\n# This can point to a file with Markdown content.", "\r\n# Specifying \"gitblit\" uses the internal welcome message.", "\r\n#\r\n# SINCE 0.5.0\r\nweb.repositoriesMessage = gitblit\r\n\r\n# Ordered list of charsets/encodings to use when trying to display a blob.", "\r\n# If empty, UTF-8 and ISO-8859-1 are used. ", " The server's default charset\r\n# is always appended to the encoding list. ", " If all encodings fail to cleanly\r\n# decode the blob content, UTF-8 will be used with the standard malformed\r\n# input/unmappable character replacement strings.", "\r\n# \r\n# SPACE-DELIMITED\r\n# SINCE 1.0.0\r\nweb.blobEncodings = UTF-8 ISO-8859-1\r\n\r\n# Manually set the default timezone to be used by Gitblit for display in the \r\n# web ui. ", " This value is independent of the JVM timezone. ", " Specifying a blank\r\n# value will default to the JVM timezone.", "\r\n# e.g. America/New_York, US/Pacific, UTC, Europe/Berlin\r\n#\r\n# SINCE 0.9.0\r\n# RESTART REQUIRED\r\nweb.timezone =\r\n\r\n# Use the client timezone when formatting dates.", "\r\n# This uses AJAX to determine the browser's timezone and may require more\r\n# server overhead because a Wicket session is created. ", " All Gitblit pages\r\n# attempt to be stateless, if possible.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nweb.useClientTimezone = false\r\n\r\n# Time format\r\n# <http://download.oracle.com/javase/6/docs/api/java/text/SimpleDateFormat.html>\r\n#\r\n# SINCE 0.8.0\r\nweb.timeFormat = HH:mm\r\n\r\n# Short date format\r\n# <http://download.oracle.com/javase/6/docs/api/java/text/SimpleDateFormat.html>\r\n#\r\n# SINCE 0.5.0\r\nweb.datestampShortFormat = yyyy-MM-dd\r\n\r\n# Long date format\r\n#\r\n# SINCE 0.8.0\r\nweb.datestampLongFormat = EEEE, MMMM d, yyyy\r\n\r\n# Long timestamp format\r\n# <http://download.oracle.com/javase/6/docs/api/java/text/SimpleDateFormat.html>\r\n#\r\n# SINCE 0.5.0\r\nweb.datetimestampLongFormat = EEEE, MMMM d, yyyy HH:mm Z\r\n\r\n# Mount URL parameters\r\n# This setting controls if pretty or parameter URLs are used.", "\r\n# i.e.\r\n# if true:\r\n# http://localhost/commit/myrepo/abcdef\r\n# if false:\r\n# http://localhost/commit/?r=myrepo&h=abcdef\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nweb.mountParameters = true\r\n\r\n# Some servlet containers (e.g. Tomcat >= 6.0.10) disallow '/' (%2F) encoding\r\n# in URLs as a security precaution for proxies. ", " This setting tells Gitblit\r\n# to preemptively replace '/' with '*' or '!' ", "for url string parameters.", "\r\n#\r\n# <https://issues.apache.org/jira/browse/WICKET-1303>\r\n# <http://tomcat.apache.org/security-6.html#Fixed_in_Apache_Tomcat_6.0.10>\r\n# Add *-Dorg.apache.tomcat.util.buf.", "UDecoder.", "ALLOW_ENCODED_SLASH=true* to your\r\n# *CATALINA_OPTS* or to your JVM launch parameters\r\n#\r\n# SINCE 0.5.2\r\nweb.forwardSlashCharacter = /\r\n\r\n# Show other URLs on the summary page for accessing your git repositories\r\n# Use spaces to separate urls. {", "0} is the token for the repository name.", "\r\n# e.g.\r\n# web.otherUrls = ssh://localhost/git/{0} git://localhost/git/{0}\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.5.0\r\nweb.otherUrls = \r\n\r\n# Choose how to present the repositories list.", "\r\n# grouped = group nested/subfolder repositories together (no sorting)\r\n# flat = flat list of repositories (sorting allowed)\r\n#\r\n# SINCE 0.5.0\r\nweb.repositoryListType = grouped\r\n\r\n# If using a grouped repository list and there are repositories at the\r\n# root level of your repositories folder, you may specify the displayed\r\n# group name with this setting. ", " This value is only used for web presentation.", "\r\n#\r\n# SINCE 0.5.0\r\nweb.repositoryRootGroupName = main\r\n\r\n# Display the repository swatch color next to the repository name link in the \r\n# repositories list. ", "\r\n#\r\n# SINCE 0.8.0\r\nweb.repositoryListSwatches = true\r\n\r\n# Choose the diff presentation style: gitblt, gitweb, or plain\r\n#\r\n# SINCE 0.5.0\r\nweb.diffStyle = gitblit\r\n\r\n# Control if email addresses are shown in web ui\r\n#\r\n# SINCE 0.5.0\r\nweb.showEmailAddresses = true\r\n\r\n# Shows a combobox in the page links header with commit, committer, and author\r\n# search selection. ", " Default search is commit.", "\r\n#\r\n# SINCE 0.5.0\r\nweb.showSearchTypeSelection = false\r\n\r\n# Generates a line graph of repository activity over time on the Summary page.", "\r\n# This uses the Google Charts API.", "\r\n#\r\n# SINCE 0.5.0 \r\nweb.generateActivityGraph = true\r\n\r\n# The number of days to show on the activity page.", "\r\n# Value must exceed 0 else default of 14 is used\r\n#\r\n# SINCE 0.8.0\r\nweb.activityDuration = 14\r\n\r\n# The number of commits to display on the summary page\r\n# Value must exceed 0 else default of 20 is used\r\n#\r\n# SINCE 0.5.0\r\nweb.summaryCommitCount = 16\r\n\r\n# The number of tags/branches to display on the summary page.", "\r\n# -1 = all tags/branches\r\n# 0 = hide tags/branches\r\n# N = N tags/branches\r\n#\r\n# SINCE 0.5.0\r\nweb.summaryRefsCount = 5\r\n\r\n# The number of items to show on a page before showing the first, prev, next\r\n# pagination links. ", " A default if 50 is used for any invalid value.", "\r\n#\r\n# SINCE 0.5.0\r\nweb.itemsPerPage = 50\r\n\r\n# Registered file extensions to ignore during Lucene indexing\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.9.0\r\nweb.luceneIgnoreExtensions = 7z arc arj bin bmp dll doc docx exe gif gz jar jpg lib lzh odg odf odt pdf ppt png so swf xcf xls xlsx zip\r\n\r\n# Registered extensions for google-code-prettify\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.5.0\r\nweb.prettyPrintExtensions = c cpp cs css frm groovy htm html java js php pl prefs properties py rb scala sh sql xml vb\r\n\r\n# Registered extensions for markdown transformation\r\n#\r\n# SPACE-DELIMITED\r\n# CASE-SENSITIVE\r\n# SINCE 0.5.0\r\nweb.markdownExtensions = md mkd markdown MD MKD\r\n\r\n# Image extensions\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.5.0\r\nweb.imageExtensions = bmp jpg jpeg gif png ico \r\n\r\n# Registered extensions for binary blobs\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.5.0\r\nweb.binaryExtensions = jar pdf tar.gz zip\r\n\r\n# Aggressive heap management will run the garbage collector on every generated\r\n# page. ", " This slows down page generation a little but improves heap consumption. ", "\r\n#\r\n# SINCE 0.5.0\r\nweb.aggressiveHeapManagement = false\r\n\r\n# Run the webapp in debug mode\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nweb.debugMode = false\r\n\r\n# Enable/disable global regex substitutions (i.e. shared across repositories)\r\n#\r\n# SINCE 0.5.0\r\nregex.global = true\r\n\r\n# Example global regex substitutions\r\n# Use !!! ", "to separate the search pattern and the replace pattern\r\n# searchpattern!!!replacepattern\r\n# SINCE 0.5.0\r\nregex.global.bug = \\\\b(Bug:)(\\\\s*[#]?|-){0,1}(\\\\d+)\\\\b!!!<a href=\"http://somehost/bug/$3\">Bug-Id: $3</a>\r\n# SINCE 0.5.0\r\nregex.global.changeid = \\\\b(Change-Id:\\\\s*)([A-Za-z0-9]*)\\\\b!!!<a href=\"http://somehost/changeid/$2\">Change-Id: $2</a>\r\n\r\n# Example per-repository regex substitutions overrides global\r\n# SINCE 0.5.0\r\nregex.myrepository.bug = \\\\b(Bug:)(\\\\s*[#]?|-){0,1}(\\\\d+)\\\\b!!!<a href=\"http://elsewhere/bug/$3\">Bug-Id: $3</a>\r\n\r\n#\r\n# Mail Settings\r\n# SINCE 0.6.0\r\n#\r\n# Mail settings are used to notify administrators of received federation proposals\r\n#\r\n\r\n# ip or hostname of smtp server\r\n#\r\n# SINCE 0.6.0\r\nmail.server =\r\n\r\n# port to use for smtp requests\r\n#\r\n# SINCE 0.6.0\r\nmail.port = 25\r\n\r\n# debug the mail executor\r\n#\r\n# SINCE 0.6.0\r\nmail.debug = false\r\n\r\n# if your smtp server requires authentication, supply the credentials here\r\n#\r\n# SINCE 0.6.0\r\nmail.username =\r\n# SINCE 0.6.0\r\nmail.password =\r\n\r\n# from address for generated emails\r\n#\r\n# SINCE 0.6.0\r\nmail.fromAddress = \r\n\r\n# List of email addresses for the Gitblit administrators\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.6.0\r\nmail.adminAddresses = \r\n\r\n# List of email addresses for sending push email notifications.", "\r\n#\r\n# This key currently requires use of the sendemail.groovy hook script.", "\r\n# If you set sendemail.groovy in *groovy.postReceiveScripts* then email\r\n# notifications for all repositories (regardless of access restrictions!)", "\r\n# will be sent to these addresses.", "\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 0.8.0\r\nmail.mailingLists =\r\n\r\n#\r\n# Federation Settings\r\n# SINCE 0.6.0\r\n#\r\n# A Gitblit federation is a way to backup one Gitblit instance to another.", "\r\n#\r\n# *git.enableGitServlet* must be true to use this feature.", "\r\n\r\n# Your federation name is used for federation status acknowledgments. ", " If it is\r\n# unset, and you elect to send a status acknowledgment, your Gitblit instance\r\n# will be identified by its hostname, if available, else your internal ip address.", "\r\n# The source Gitblit instance will also append your external IP address to your\r\n# identification to differentiate multiple pulling systems behind a single proxy.", "\r\n#\r\n# SINCE 0.6.0\r\nfederation.name =\r\n\r\n# Specify the passphrase of this Gitblit instance.", "\r\n#\r\n# An unspecified (empty) passphrase disables processing federation requests.", "\r\n#\r\n# This value can be anything you want: an integer, a sentence, an haiku, etc.", "\r\n# Keep the value simple, though, to avoid Java properties file encoding issues.", "\r\n#\r\n# Changing your passphrase will break any registrations you have established with other\r\n# Gitblit instances.", "\r\n#\r\n# CASE-SENSITIVE\r\n# SINCE 0.6.0\r\n# RESTART REQUIRED *(only to enable or disable federation)*\r\nfederation.passphrase =\r\n\r\n# Control whether or not this Gitblit instance can receive federation proposals\r\n# from another Gitblit instance. ", " Registering a federated Gitblit is a manual\r\n# process. ", " Proposals help to simplify that process by allowing a remote Gitblit\r\n# instance to send your Gitblit instance the federation pull data.", "\r\n#\r\n# SINCE 0.6.0\r\nfederation.allowProposals = false\r\n\r\n# The destination folder for cached federation proposals.", "\r\n# Use forward slashes even on Windows!!", "\r\n#\r\n# SINCE 0.6.0\r\nfederation.proposalsFolder = ${baseFolder}/proposals\r\n\r\n# The default pull frequency if frequency is unspecified on a registration\r\n#\r\n# SINCE 0.6.0\r\nfederation.defaultFrequency = 60 mins\r\n\r\n# Federation Sets are named groups of repositories. ", " The Federation Sets are \r\n# available for selection in the repository settings page. ", " You can assign a\r\n# repository to one or more sets and then distribute the token for the set.", "\r\n# This allows you to grant federation pull access to a subset of your available\r\n# repositories. ", " Tokens for federation sets only grant repository pull access.", "\r\n#\r\n# SPACE-DELIMITED\r\n# CASE-SENSITIVE\r\n# SINCE 0.6.0\r\nfederation.sets = \r\n\r\n# Federation pull registrations\r\n# Registrations are read once, at startup.", "\r\n#\r\n# RESTART REQUIRED\r\n#\r\n# frequency:\r\n# The shortest frequency allowed is every 5 minutes\r\n# Decimal frequency values are cast to integers\r\n# Frequency values may be specified in mins, hours, or days\r\n# Values that can not be parsed or are unspecified default to *federation.defaultFrequency*\r\n#\r\n# folder:\r\n# if unspecified, the folder is *git.repositoriesFolder*\r\n# if specified, the folder is relative to *git.repositoriesFolder*\r\n#\r\n# bare:\r\n# if true, each repository will be created as a *bare* repository and will not\r\n# have a working directory.", "\r\n#\r\n# if false, each repository will be created as a normal repository suitable\r\n# for local work.", "\r\n#\r\n# mirror:\r\n# if true, each repository HEAD is reset to *origin/master* after each pull.", "\r\n# The repository will be flagged *isFrozen* after the initial clone.", "\r\n#\r\n# if false, each repository HEAD will point to the FETCH_HEAD of the initial\r\n# clone from the origin until pushed to or otherwise manipulated.", "\r\n#\r\n# mergeAccounts:\r\n# if true, remote accounts and their permissions are merged into your \r\n# users.properties file \r\n#\r\n# notifyOnError:\r\n# if true and the mail configuration is properly set, administrators will be\r\n# notified by email of pull failures\r\n#\r\n# include and exclude:\r\n# Space-delimited list of repositories to include or exclude from pull\r\n# may be * wildcard to include or exclude all\r\n# may use fuzzy match (e.g. org.eclipse.*)", "\r\n\r\n#\r\n# (Nearly) Perfect Mirror example\r\n#\r\n\r\n#federation.example1.url = https://go.gitblit.com\r\n#federation.example1.token = 6f3b8a24bf970f17289b234284c94f43eb42f0e4\r\n#federation.example1.frequency = 120 mins\r\n#federation.example1.folder =\r\n#federation.example1.bare = true \r\n#federation.example1.mirror = true \r\n#federation.example1.mergeAccounts = true\r\n\r\n#\r\n# Advanced Realm Settings\r\n#\r\n\r\n# URL of the LDAP server.", "\r\n# To use encrypted transport, use either ldaps:// URL for SSL or ldap+tls:// to\r\n# send StartTLS command.", "\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.server = ldap://localhost\r\n\r\n# Login username for LDAP searches.", "\r\n# If this value is unspecified, anonymous LDAP login will be used.", "\r\n# \r\n# e.g. mydomain\\\\username\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.username = cn=Directory Manager\r\n\r\n# Login password for LDAP searches.", "\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.password = password\r\n\r\n# The LdapUserService must be backed by another user service for standard user\r\n# and team management.", "\r\n# default: users.conf\r\n#\r\n# SINCE 1.0.0\r\n# RESTART REQUIRED\r\nrealm.ldap.backingUserService = test-ui-users.conf\r\n\r\n# Delegate team membership control to LDAP.", "\r\n#\r\n# If true, team user memberships will be specified by LDAP groups. ", " This will\r\n# disable team selection in Edit User and user selection in Edit Team.", "\r\n#\r\n# If false, LDAP will only be used for authentication and Gitblit will maintain\r\n# team memberships with the *realm.ldap.backingUserService*.", "\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.maintainTeams = false\r\n\r\n# Root node for all LDAP users\r\n#\r\n# This is the root node from which subtree user searches will begin.", "\r\n# If blank, Gitblit will search ALL nodes.", "\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.accountBase = OU=Users,OU=UserControl,OU=MyOrganization,DC=MyDomain\r\n\r\n# Filter criteria for LDAP users\r\n#\r\n# Query pattern to use when searching for a user account. ", "This may be any valid \r\n# LDAP query expression, including the standard (&) and (|) operators.", "\r\n#\r\n# Variables may be injected via the ${variableName} syntax.", "\r\n# Recognized variables are:\r\n# ${username} - The text entered as the user name\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.accountPattern = (&(objectClass=person)(sAMAccountName=${username}))\r\n\r\n# Root node for all LDAP groups to be used as Gitblit Teams\r\n#\r\n# This is the root node from which subtree team searches will begin.", "\r\n# If blank, Gitblit will search ALL nodes. ", " \r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.groupBase = OU=Groups,OU=UserControl,OU=MyOrganization,DC=MyDomain\r\n\r\n# Filter criteria for LDAP groups\r\n#\r\n# Query pattern to use when searching for a team. ", "This may be any valid \r\n# LDAP query expression, including the standard (&) and (|) operators.", "\r\n#\r\n# Variables may be injected via the ${variableName} syntax.", "\r\n# Recognized variables are:\r\n# ${username} - The text entered as the user name\r\n# ${dn} - The Distinguished Name of the user logged in\r\n#\r\n# All attributes from the LDAP User record are available. ", "For example, if a user\r\n# has an attribute \"fullName\" set to \"John\", \"(fn=${fullName})\" will be \r\n# translated to \"(fn=John)\".", "\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.groupMemberPattern = (&(objectClass=group)(member=${dn}))\r\n\r\n# LDAP users or groups that should be given administrator privileges.", "\r\n#\r\n# Teams are specified with a leading '@' character. ", " Groups with spaces in the\r\n# name can be entered as \"@team name\".", "\r\n#\r\n# e.g. realm.ldap.admins = john @git_admins \"@git admins\"\r\n#\r\n# SPACE-DELIMITED\r\n# SINCE 1.0.0\r\nrealm.ldap.admins = @Git_Admins\r\n\r\n# Attribute(s) on the USER record that indicate their display (or full) name.", "\r\n# Leave blank for no mapping available in LDAP.", "\r\n#\r\n# This may be a single attribute, or a string of multiple attributes. ", " Examples:\r\n# displayName - Uses the attribute 'displayName' on the user record\r\n# ${personalTitle}. ", "${givenName} ${surname} - Will concatenate the 3 \r\n# attributes together, with a '.' ", "after personalTitle\r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.displayName = displayName\r\n\r\n# Attribute(s) on the USER record that indicate their email address.", "\r\n# Leave blank for no mapping available in LDAP.", "\r\n#\r\n# This may be a single attribute, or a string of multiple attributes. ", " Examples:\r\n# email - Uses the attribute 'email' on the user record\r\n# ${givenName}.${surname}@gitblit.com -Will concatenate the 2 attributes\r\n# together with a '.' ", "and '@' creating something like first.last@gitblit.com \r\n#\r\n# SINCE 1.0.0\r\nrealm.ldap.email = email\r\n\r\n# The RedmineUserService must be backed by another user service for standard user\r\n# and team management.", "\r\n# default: users.conf\r\n#\r\n# RESTART REQUIRED\r\nrealm.redmine.backingUserService = test-ui-users.conf\r\n\r\n# URL of the Redmine.", "\r\nrealm.redmine.url = http://example.com/redmine\r\n\r\n#\r\n# Server Settings\r\n#\r\n\r\n# The temporary folder to decompress the embedded gitblit webapp. ", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.tempFolder = ${baseFolder}/temp\r\n\r\n# Use Jetty NIO connectors. ", " If false, Jetty Socket connectors will be used.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.useNio = true\r\n\r\n# Context path for the GO application. ", " You might want to change the context\r\n# path if running Gitblit behind a proxy layer such as mod_proxy.", "\r\n#\r\n# SINCE 0.7.0\r\n# RESTART REQUIRED\r\nserver.contextPath = /\r\n\r\n# Standard http port to serve. ", " <= 0 disables this connector.", "\r\n# On Unix/Linux systems, ports < 1024 require root permissions.", "\r\n# Recommended value: 80 or 8080\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.httpPort = 0\r\n\r\n# Secure/SSL https port to serve. ", "<= 0 disables this connector.", "\r\n# On Unix/Linux systems, ports < 1024 require root permissions.", "\r\n# Recommended value: 443 or 8443\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.httpsPort = 8443\r\n\r\n# Port for serving an Apache JServ Protocol (AJP) 1.3 connector for integrating\r\n# Gitblit GO into an Apache HTTP server setup. ", " <= 0 disables this connector.", "\r\n# Recommended value: 8009\r\n#\r\n# SINCE 0.9.0\r\n# RESTART REQUIRED\r\nserver.ajpPort = 0\r\n\r\n# Specify the interface for Jetty to bind the standard connector.", "\r\n# You may specify an ip or an empty value to bind to all interfaces.", "\r\n# Specifying localhost will result in Gitblit ONLY listening to requests to\r\n# localhost.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.httpBindInterface = localhost\r\n\r\n# Specify the interface for Jetty to bind the secure connector.", "\r\n# You may specify an ip or an empty value to bind to all interfaces.", "\r\n# Specifying localhost will result in Gitblit ONLY listening to requests to\r\n# localhost.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.httpsBindInterface = localhost\r\n\r\n# Specify the interface for Jetty to bind the AJP connector.", "\r\n# You may specify an ip or an empty value to bind to all interfaces.", "\r\n# Specifying localhost will result in Gitblit ONLY listening to requests to\r\n# localhost.", "\r\n#\r\n# SINCE 0.9.0\r\n# RESTART REQUIRED\r\nserver.ajpBindInterface = localhost\r\n\r\n# Alias of certificate to use for https/SSL serving. ", " If blank the first\r\n# certificate found in the keystore will be used. ", "\r\n#\r\n# SINCE 1.2.0\r\n# RESTART REQUIRED\r\nserver.certificateAlias = localhost\r\n\r\n# Password for SSL keystore.", "\r\n# Keystore password and certificate password must match.", "\r\n# This is provided for convenience, its probably more secure to set this value\r\n# using the --storePassword command line parameter.", "\r\n#\r\n# If you are using the official JRE or JDK from Oracle you may not have the\r\n# JCE Unlimited Strength Jurisdiction Policy files bundled with your JVM. ", " Because\r\n# of this, your store/key password can not exceed 7 characters. ", " If you require\r\n# longer passwords you may need to install the JCE Unlimited Strength Jurisdiction\r\n# Policy files from Oracle.", "\r\n#\r\n# http://www.oracle.com/technetwork/java/javase/downloads/index.html\r\n#\r\n# Gitblit and the Gitblit Certificate Authority will both indicate if Unlimited\r\n# Strength encryption is available.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.storePassword = gitblit\r\n\r\n# If serving over https (recommended) you might consider requiring clients to\r\n# authenticate with ssl certificates. ", " If enabled, only https clients with the\r\n# a valid client certificate will be able to access Gitblit.", "\r\n#\r\n# If disabled, client certificate authentication is optional and will be tried\r\n# first before falling-back to form authentication or basic authentication.", "\r\n#\r\n# Requiring client certificates to access any of Gitblit may be too extreme,\r\n# consider this carefully.", "\r\n#\r\n# SINCE 1.2.0\r\n# RESTART REQUIRED\r\nserver.requireClientCertificates = false\r\n\r\n# Port for shutdown monitor to listen on.", "\r\n#\r\n# SINCE 0.5.0\r\n# RESTART REQUIRED\r\nserver.shutdownPort = 8081\r\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.008130081300813009, 0.024390243902439025, 0.010810810810810811, 0.0049504950495049506, 0, 0, 0, 0.02040816326530612, 0.006666666666666667, 0.024390243902439025, 0.015306122448979591, 0, 0, 0, 0.01904761904761905, 0, 0.02197802197802198, 0, 0, 0, 0, 0.009302325581395349, 0, 0, 0, 0, 0, 0.011363636363636364, 0.014285714285714285, 0, 0, 0.01675977653631285, 0, 0.06666666666666667, 0, 0, 0.014492753623188406, 0.021897810218978103, 0.01652892561983471, 0.02654867256637168, 0.011363636363636364, 0, 0, 0, 0, 0.007751937984496124, 0, 0.004975124378109453, 0.014084507042253521, 0, 0, 0, 0, 0, 0, 0, 0, 0.02040816326530612, 0.006993006993006993, 0.006944444444444444, 0, 0, 0, 0, 0, 0.02040816326530612, 0.005681818181818182, 0.006493506493506494, 0, 0, 0, 0.02040816326530612, 0.015873015873015872, 0, 0.00816326530612245, 0, 0.02040816326530612, 0.0125, 0, 0, 0.006060606060606061, 0.006493506493506494, 0, 0.023809523809523808, 0, 0.02040816326530612, 0.005952380952380952, 0.0049504950495049506, 0.00411522633744856, 0, 0, 0.02040816326530612, 0.012048192771084338, 0.024390243902439025, 0.018072289156626505, 0.012269938650306749, 0, 0, 0, 0.004651162790697674, 0, 0, 0, 0.03225806451612903, 0, 0, 0, 0.004651162790697674, 0, 0, 0, 0.01702127659574468, 0, 0, 0.005649717514124294, 0.007207207207207207, 0, 0.007894736842105263, 0, 0.029411764705882353, 0, 0.009345794392523364, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0.0045662100456621, 0, 0.0056179775280898875, 0, 0.004228329809725159, 0.02702702702702703, 0.019801980198019802, 0, 0.013157894736842105, 0.002506265664160401, 0.006711409395973154, 0, 0, 0.014084507042253521, 0, 0.004464285714285714, 0, 0, 0.011494252873563218, 0, 0, 0.005747126436781609, 0.007518796992481203, 0, 0, 0, 0, 0, 0, 0.022222222222222223, 0, 0.006289308176100629, 0.005917159763313609, 0.020833333333333332, 0.016129032258064516, 0.024539877300613498, 0.007575757575757576, 0, 0.01366120218579235, 0.006153846153846154, 0.013333333333333334, 0, 0.011627906976744186, 0.1111111111111111, 0.004081632653061225, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0, 0.027777777777777776, 0, 0, 0.004524886877828055, 0, 0.015432098765432098, 0, 0.0030959752321981426, 0.007036747458952306, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0.006097560975609756, 0.01098901098901099, 0, 0, 0.012345679012345678, 0, 0, 0.017543859649122806, 0.0072992700729927005, 0.008771929824561403, 0.024390243902439025, 0.0038022813688212928, 0, 0, 0, 0, 0.006493506493506494, 0.0034904013961605585, 0, 0, 0, 0, 0, 0.007142857142857143, 0, 0, 0, 0.015151515151515152, 0, 0.0125, 0, 0.024390243902439025, 0.00684931506849315, 0, 0.022727272727272728, 0.025380710659898477, 0, 0.015625, 0.0031446540880503146, 0.022222222222222223, 0.031578947368421054, 0, 0.015625, 0, 0, 0.006211180124223602, 0, 0.015151515151515152, 0.018779342723004695, 0, 0, 0, 0, 0.006802721088435374, 0, 0, 0.005780346820809248, 0.004807692307692308, 0.023809523809523808, 0.013793103448275862, 0.01818181818181818, 0.020833333333333332, 0.019417475728155338, 0.009615384615384616, 0.010309278350515464, 0, 0.015384615384615385, 0.015384615384615385, 0, 0.015384615384615385, 0.008733624454148471, 0, 0.01948051948051948, 0, 0, 0.013986013986013986, 0, 0, 0.02127659574468085, 0, 0, 0.015151515151515152, 0, 0.018691588785046728, 0, 0, 0.01282051282051282, 0, 0, 0.015463917525773196, 0.005235602094240838, 0, 0, 0, 0.008, 0.014705882352941176 ]

[ "Heterogeneous properties of individual molecules of beta-galactosidase from the thermophilic bacteria Geobacillus stearothermophilus.", "\nSingle enzyme molecule assays were performed on beta-galactosidase from the thermophilic bacteria Geobacillus stearothermophilus using a capillary electrophoresis-based continuous flow assay and the substrate DDAO-beta-D: -galactoside. ", "The enzyme was found to be heterogeneous with respect to catalytic rate, electrophoretic mobility and activation energy of catalysis. ", "Catalytic rate was also found to vary over time for individual molecules at elevated temperature. ", "Comparison with beta-galactosidase from the mesophilic bacteria Escherichia coli showed that the variation in activity over time was less pronounced and the average activation energy of catalysis was lower for the Geobacillus stearothermophilus enzyme. ", "Attempts to measure the properties of individual beta-galactosidase molecules from the thermophilic bacteria Thermus thermophilus and the cold-adapted bacteria Pseudoalteromas haloplanktis using this assay were unsuccessful." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0.007905138339920948, 0.004464285714285714 ]

[ "Monday, 6 November 2017\n\nForced Marriage: 13-Year-Old Girl Regains Freedom From Emir's Palace\n\nOn Sunday, 13-year-old, Hauwa Dadi, regained her freedom, four days after being allegedly abducted for the purpose of been forced into a marriage.", "\nHauwa, an SS1 student of the Brighter Academy Secondary School, Gashua, is a daughter of a former Secretary of the Christian Association of Nigeria.", "\n\nShe was abducted and allegedly kept at the palace of the Emir of Gashua for ‘Islamic evangelism.’", "\n\nHauwa was, however, released on Sunday from the palace of the Emir, Alhaji Abubakar Suleman.", "\n\nA civil rights organisation, Stefanos Foundation, which blew the lid off the alleged plot to force the teenager into marriage, had vowed that it would pursue the case till the girl was released.", "\n\nThe Executive Director of SF, Mark Lipdo, had then appealed to the relevant authorities “to step in and help this poor woman who has been nursing her sick husband for the past six years.”", "\n\nHauwa’s elder brother, Jonathan Dadi, broke the news of her release to Northern City News in Jos on Sunday.", "\n\nHe said, “Thank you, Mr. Journalist, thank you, The PUNCH. ", "I am pleased to inform you that my sister has been released to us.", "\n\n“The Emir ordered that my sister, Hauwa Dadi, should be released to us. ", "But we signed an undertaking that she should not be punished. ", "We have just left the Emir’s palace. ", "I will call you later to give you the details.”", "\n\nWhen contacted, the Gashua Police Area Commander, Joseph Aloefuna, confirmed that the case was brought to his knowledge by the Gashua Divisional Police Officer\n\nHe said,\n\n“I wasn’t directly involved but the DPO said he was involved and he confirmed that he was invited into the matter.", "\n\n“There was this boy who was said to have insisted on marrying the girl (Hauwa). ", "They are in the same school. ", "The matter was reported to the school management and the boy was punished and warned to stop harassing the girl.", "\n\n“Later, the girl was abducted and the boy was the prime suspect. ", "The boy was arrested but claimed that the girl ran to the Emir’s palace because she wanted to convert to Islam.", "\n\n“The Emir took her to the Chief Imam; the Chief Imam said the girl was scared but he was asked to take her to the welfare officials instead of keeping her in his custody.", "\n\n“We took the statement of everybody concerned. ", "The Chief Imam said there was going to be a meeting on the matter,” Aloefuna explained.", "\n\nBefore her release, the mother of the girl, Deborah, had, in an interview, given a detailed account of how the abduction plot was perfected.", "\n\nShe said, “On Thursday afternoon, I had a meeting in ECWA Church, Gashua. ", "Her twin brother, Zachariah, took wheelbarrow to fetch water for us. ", "My daughter removed her uniform, put on her personal clothes and left. ", "When one of her sisters asked her where she was going, Hauwa said she was going to fetch water with Zachariah and disappeared.", "\n\n“But before the incident, there has been one boy who claimed to love her and wanted to marry her. ", "He told her to convert to Islam.”", "\n\nThe mother said when she went to look for her daughter in the area, she heard that she had been abducted by her neighbours and was taken to the Imam of Gashua, Babu Alkali Mamman.", "\n\nShe then reported the matter to one Inspector Melody Habila at the Gashua Police Command.", "\n\nBut when Imam Alkali was invited to the police command, he pleaded to be allowed to take the Jumma’at prayers before coming but he never came.", "\n\nInstead, the Imam’s lawyer later came to the police station and invited Deborah to the Emir’s palace.", "\n\nWhen Deborah went to the palace, she was asked to come back, but on reaching there at 4pm, she was neither given her daughter nor allowed to see the Emir again" ]

{ "pile_set_name": "Pile-CC" }

[ 0.004149377593360996, 0.020134228187919462, 0, 0.02127659574468085, 0.00510204081632653, 0.005291005291005291, 0.009174311926605505, 0.03278688524590164, 0, 0.013513513513513514, 0, 0, 0, 0.010452961672473868, 0.012195121951219513, 0, 0, 0, 0.009009009009009009, 0, 0, 0, 0.007042253521126761, 0.02631578947368421, 0.014492753623188406, 0, 0.007936507936507936, 0, 0.030303030303030304, 0.0055248618784530384, 0.01098901098901099, 0.013888888888888888, 0.009708737864077669, 0.006211180124223602 ]

[ "I know they're overreactions, but dude, *GROAN*... '02 Notre Dame, started 8-0 and 10-1 under Ty Willingham...'05 Notre Dame, blitzed Pitt by 21, lost the \"Bush Push\" game under Chuckles Weis...I'm sure like those two teams, if they go 9-3 they'll be gifted some BCS game they don't belong in and get nuked, and then we won't hear from them again until the next \"messiah\" gets hired...\n\n\"I feel very strongly that the name Whalers is synonymous with Connecticut hockey. ", "The Cleveland Browns should always be the Cleveland Browns.\"", "\n\nMountain West (TCU, Utah, BYU, Air Force) is more BCS Conference worthy than the Big Least.", "\n\nFormer Browns DC Todd Grantham is gonna help lead the UGA Bulldogs back to national prominence.", "\n\nNotre Dame finally got it right with Brian Kelly.", "\n\nDenard Robinson is Pat White.", "\n\nBob Stoops is the most overrated coach in NCAAF.", "\n\nChip Kelly is already a top ten coach ... and Oregon will be playing in a BCS game.", "\n\nArizona is this years sleeper team, and week 3 Iowa/Arizona is the huge early season game no one is talking about.", "\n\nBoise and TCU are both going unbeaten, yet will not play in the title game, finally providing the ammo for a 8 team playoff starting in 2015.", "\n\nTotally agree with everythig. ", "Looking fwd to the Iowa / Zona game. ", "I'm glad I'm not the only one that thinks this : Boise and TCU are both going unbeaten, yet will not play in the title game, finally providing the ammo for a 8 team playoff starting in 2015 I looked up V/T schedule and I see 4-5 losses which won't look good on Boise's resume.", "Va Tech 1-25 all time vs top 5 teams." ]

{ "pile_set_name": "Pile-CC" }

[ 0.01276595744680851, 0.03333333333333333, 0.03225806451612903, 0.020618556701030927, 0.0392156862745098, 0.03225806451612903, 0.04, 0.011764705882352941, 0, 0, 0, 0, 0.0036231884057971015, 0 ]

[ "Q:\n\nIs it possible to attack a user password with known salt\n\nI've been told that email is a bad salt, because it's not unique and connected to the user.", "\nAnd if a user uses the same password on 2 sites, there will be equal hash. ", "\nSo, what's wrong with it? ", "what is attack scenario?", "\nSuppose we have both hash and salt. ", "So, other site has the same hash in their database. ", "\nHow can we do any harm to this user on the other site? ", "Can we at all?", "\nI don't see any possibility, but I am not an expert in security, so, I'd like to hear from ones who are, with practical and concrete answers, of course.", "\nI am not going to break anything. ", "I am asking this question in the context of this one: is email or (registration timestamp) a good salt?", "\nCertain and practical answers, please. ", "\n\nA:\n\nThe point of a salt is not to be unknown, it is to prevent attackers from amortizing the cost of a brute force or dictionary attack across all users of a site (or even all users of many sites).", "\nThus, the problem of using a non-random salt like the email address is that it would show an attacker which users are using the same password on several sites, and which would therefore yield access to several accounts at once if cracked via brute force or dictionary attack. ", "For the email address (and everything that is unique per user), this is a rather hypothetical problem since it assumes the attacker has the account data of several sites with considerable overlap in users.", "\nAnother problem with using the email address is that users will want to change it - which would be impossible if you use it as salt unless you store it in a separate salt column as well or require people to always change their password together with their email. ", "\n\nA:\n\nThis is mostly a theoretical question. ", "So, how does \"cracking a hashed value\" work? ", "There are so called \"rainbow tables\", that are just list with common words and theire hash value. ", "For salted hashes an attacker needs such tables also with salted hashes. ", "So in theory with unique salts for every user an attacker needs one table for every salt (=> user). ", "If you have a static salt, he \"just\" needs one table for your db. ", "Its quite expensive to create such tables, so in most cases its not worth to create it just for a single page.", "\nConclusion: Its (of course) safer, to use unique salts for every user, but on a veeery high level. ", "A static salts is usually \"safe enough\".", "\n\nA:\n\nThe first attack I can think of is:\n\na user has the same salt and password at two sites\nboth sites have a flaw to allow reading the salted passwords\none site makes reading a password or brute-force guessing a password easy\n\nAn attacker could quickly look at identical salted passwords on both sites and find users with identical passwords at both sites. ", "Then read the password or guess the password on the weaker site, and use it on the more secure site.", "\nGranted, different salts wouldn't make the problem significantly better because all million passwords can be tried eventually. ", "But knowing which users have identical passwords would be much 'quieter' than just blindly trying all the users' passwords on the stronger site.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "U.S. Sen. Sherrod Brown, a Democrat from Ohio, scolded the Zionist Organization of America for what he perceived to be its support for Steve Bannon, U.S. President Donald Trump’s senior strategist.", "\n\nSpeaking on Tuesday at the conservative pro-Israel group’s annual Washington conference, Brown appeared upset that the room had applauded the mention of Bannon’s name by a prior speaker, Sebastian Gorka, another Trump adviser. ", "The exchange came to light in a video posted of the event on Thursday on the Axios political news site.", "\n\n“I know that Mr. Gorka mentioned Stephen Bannon,” he said. “", "I saw some people cheer when he mentioned Stephen Bannon.”", "\n\nBrown’s remarks spurred murmurs, cheers and boos.", "\n\n“I know the history of Breitbart,” he added.", "\n\nBannon is the former CEO of the Breitbart News website, which he has called a platform for the “alt-right” — a loose assemblage of anti-establishment conservatives that has been accused of promoting racism, anti-Semitism, anti-feminism and homophobia. ", "But the movement also includes libertarians and fierce defenders of Israel.", "\n\nBannon started a Breitbart subsidiary aimed at pushing back against anti-Israel bias in the media, although his ex-wife has accused him of being hostile to Jews. ", "Gorka himself has been subject to scrutiny because of his past associations with the Hungarian far right.", "\n\nAt the ZOA event, Brown mentioned that he told Prime Minister Benjamin Netanyahu in a meeting a month ago that he understood why Israel was pleased with Trump’s support for the Jewish state and his push to enact new sanctions on Iran. ", "But Brown said he also told Netanyahu to be wary of the current White House.", "\n\n“There are a whole lot of members of the Senate, and both parties, and a whole lot of people in my state, that are very concerned about the bigotry and anti-Semitism in the White House,” Brown said he told Netanyahu.", "\n\nBrown alluded to Trump’s broadsides against Muslims during his campaign, as well as to his proposed travel bans that critics say target Muslims exclusively.", "\n\n“I will always stand strong on Israel,” he said to applause. “", "But I also find it’s my duty to speak out when I see what’s more and more common in my country — where its issues of race or issues of religion — that bother me.”", "\n\nMorton Klein, the ZOA president, on Friday told JTA that he wished Brown had confined his remarks to Israel.", "\n\n“We were pleased that Sen. Brown came to speak at our luncheon, but this was a mission focusing only on Israel and U.S-Israel relations and we were disappointed and surprised that he spoke on that issue, on issues unrelated to that, in addition to making an inaccurate statement that Steve Bannon is an anti-Semite,” he said. “", "He is a strong supporter of Israel and it is simply untrue he has negative feelings toward Jews.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.02030456852791878, 0.017467248908296942, 0, 0.03225806451612903, 0.017241379310344827, 0, 0.021739130434782608, 0.003937007874015748, 0, 0.006097560975609756, 0, 0.016877637130801686, 0.039473684210526314, 0.01834862385321101, 0.006329113924050633, 0, 0, 0.03636363636363636, 0.0060790273556231, 0 ]

[ "Q:\n\nHow to add span element inside td element while using .html(value To show) in jquery\n\nMy aim is to append data using <span> element inside of <td>. ", "But I have to use .html() in jquery used inside loop.", "\nNow I'm getting the result using this code as,\n$(\"td\", row).eq(2).html(dateval);\n\nThe result i'm getting is,\n<td>XYZ</td>\n\nBut I needs, the result as,\n<td><span>My calculated value</span>XYZ</td>\n\nHow to append this span element inside td using this .html method. ", "Any suggestions welcomed!.", "\n\nA:\n\nTry:\n.html('<span>My calculated value</span>' + dateval);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0 ]

[ "Here’s Wilmer Valderrama’s — sorry, Eduardo Fresco’s — new music video for a song called “The Way I Fiesta,” directed by The Lonely Island’s Akiva Schaffer. ", "I am not quite sure I understand what this is for, if anything, but apparently Valderrama’s alter-ego “started in a boy band named Chicos en Fuego, a group whom rejected Enrique Iglesias,” and this is his big comeback video. ", "OK! ", "In any case, this is what The Lonely Island would make if it were a Ricky Martin joke cover band instead of three dorky white dudes from Berkeley." ]

{ "pile_set_name": "Pile-CC" }

[ 0.01910828025477707, 0.013333333333333334, 0, 0.0136986301369863 ]