Datasets:

tomekkorbak

/

pii-pile-chunk3-0-50000

like 0

[ "There is an idea abroad among moral people that they should make their neighbors good. ", "One person I have to make good: Myself. ", "But my duty to my neighbor is much more nearly expressed by saying that I have to make him happy if I may." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0 ]

[ "Mugs, Teapots and Cannisters\n\nI love coffee mugs with cute sayings or neat designs or images. ", "I’ve got several of them in my kitchen, and I adore each and every one of them.", "\n\nMy Simple Knitting Shop contains affiliate links which means that if you decide to click on a link and buy something I will earn a very small commission which will help offset the cost of running this site.", "\n\nThese links do not affect the purchase price and you will not pay more when you buy a product through my link. ", "All prices in effect at time of publishing." ]

{ "pile_set_name": "Pile-CC" }

[ 0.02127659574468085, 0, 0, 0, 0 ]

[ "---\nabstract: 'In this paper, we firstly construct a Hausdorff non-submetrizable paratopological group $G$ in which every point is a $G_{\\delta}$-set, which gives a negative answer to Arhangel’skiǐ and Tkachenko’s question \\[Topological Groups and Related Structures, Atlantis Press and World Sci., ", "2008\\]. ", "We prove that each first-countable Abelian paratopological group is submetrizable. ", "Moreover, we discuss developable paratopological groups and construct a non-metrizable, Moore paratopological group. ", "Further, we prove that a regular, countable, locally $k_{\\omega}$-paratopological group is a discrete topological group or contains a closed copy of $S_{\\omega}$. Finally, we discuss some properties on non-H-closed paratopological groups, and show that Sorgenfrey line is not H-closed, which gives a negative answer to Arhangel’skiǐ and Tkachenko’s question \\[Topological Groups and Related Structures, Atlantis Press and World Sci., ", "2008\\]. ", "Some questions are posed.'", "\naddress:\n- '(Fucai Lin): Department of Mathematics and Information Science, Zhangzhou Normal University, Zhangzhou 363000, P. R. China'\n- '(Chuan Liu): Department of Mathematics, Ohio University Zanesville Campus, Zanesville, OH 43701, USA'\nauthor:\n- Fucai Lin\n- 'Chuan Liu\\*'\ntitle: On paratopological groups\n---\n\n[^1]\n\n[^2]\n\nIntroduction\n============\n\nA [*semitopological group*]{} $G$ is a group $G$ with a topology such that the product map of $G\\times G$ into $G$ is separately continuous. ", "A [*paratopological group*]{} $G$ is a group $G$ with a topology such that the product map of $G \\times G$ into $G$ is jointly continuous. ", "If $G$ is a paratopological group and the inverse operation of $G$ is continuous, then $G$ is called a [*topological group*]{}. ", "However, there exists a paratopological group which is not a topological group; Sorgenfrey line ([@E1989 Example 1.2.2]) is such an example. ", "Paratopological groups were discussed and many results have been obtained [@AR2005; @A2008; @A2009; @CJ; @LC; @LL2010; @LC1; @LP].", "\n\n\\[p0\\][@R2001] For a group with topology $(G, \\tau)$ the following conditions are equivalent:\n\n1. ", " $G$ is a paratopological group;\n\n2. ", " The following Pontrjagin conditions for basis $\\mathscr{B}=\\mathscr{B}_{\\tau}$ of the neutral element $e$ of $G$ are satisfied.", "\n\n 1. ", " ($\\forall U, V\\in\\mathscr{B}$)($\\exists W\\in\\mathscr{B}$): $W\\subset U\\cap V;$\n\n 2. ", " ($\\forall U\\in\\mathscr{B}$)($\\exists V\\in\\mathscr{B}$): $V^{2}\\subset U;$\n\n 3. ", " ($\\forall U\\in\\mathscr{B}$)($\\forall x\\in U$)($\\exists V\\in\\mathscr{B}$): $Vx\\subset U;$\n\n 4. ", " ($\\forall U\\in\\mathscr{B}$)($\\forall x\\in G$)($\\exists V\\in\\mathscr{B}$): $xVx^{-1}\\subset U;$\n\nThe paratopological group $G$ is Hausdorff if and only if\n\n\\(e) $\\bigcap\\{UU^{-1}: U\\in\\mathscr{B}\\}=\\{e\\}$;\\\nThe paratopological group $G$ is a topological group if and only if\n\n\\(f) ($\\forall U\\in\\mathscr{B}$)($\\exists V\\in\\mathscr{B}$): $V^{-1}\\subset U.$\\\n\nIn this paper, we mainly discuss the following questions.", "\n\n[@A2008 Open problem 3.3.1]\\[q2\\] Suppose that $G$ is a Hausdorff (regular) paratopological group in which every point is a $G_{\\delta}$-set. ", "Is $G$ submetrizable?", "\n\n[@A2008 Open problem 5.7.2]\\[q6\\] Let $G$ be a regular first-countable $\\omega$-narrow paratopological group . ", "Is $G$ submetrizable?", "\n\n[@AB Problem 20]\\[q1\\] Is every regular first countable (Abelian) paratopological group submetrizable?", "\n\n[@AB Problem 22]\\[q7\\] Is it true that every regular first countable (Abelian) paratopological group $G$ has a zero-set diagonal[^3]?", "\n\n[@AB Problem 21]\\[q4\\] Is every regular first countable (Abelian) paratopological group Dieudonné complete?", "\n\n[@A2008 Open problem 3.4.3]\\[q0\\] Let $G$ be a regular $\\omega$-narrow first-countable paratopological group. ", "Does there exist a continuous isomorphism of $G$ onto a regular (Hausdorff) second-countable paratopological group?", "\n\n\\[q9\\][@LC1] Is a regular symmetrizable paratopological group metrizable?", "\n\n[@A2008 Open problem 5.7.5]\\[q3\\] Is every paratopological group, which is Moore space, metrizable?", "\n\n[@A2008 Open problem 3.6.5]\\[q5\\] Must the Sorgenfrey line $S$ be closed in every Hausdorff paratopological group containing it as a paratopological subgroup?", "\n\nWe shall give negative answers to Questions \\[q2\\],  \\[q9\\],  \\[q5\\], and \\[q3\\], and give a partial answer to Question \\[q6\\]. ", "Moreover, we shall also give affirmative answers to Questions \\[q1\\],  \\[q7\\],  \\[q0\\] and  \\[q4\\] when the group $G$ is Abelian.", "\n\nPreliminaries\n=============\n\nLet $\\mathscr{P}=\\bigcup_{x\\in X}\\mathscr{P}_{x}$ be a cover of a space $X$ such that for each $x\\in X$, (a) if $U,V\\in\n\\mathscr{P}_{x}$, then $W\\subset U\\cap V$ for some $W\\in\n\\mathscr{P}_{x}$; (b) the family $\\mathscr{P}_{x}$ is a network of $x$ in $X$, i.e., $x\\in\\bigcap\\mathscr{P}_x$, and if $x\\in U$ with $U$ open in $X$, then $P\\subset U$ for some $P\\in\\mathscr P_x$.\n\nThe family $\\mathscr{P}$ is called a [*weak base*]{} for $X$ [@Ar] if, for every $A\\subset X$, the set $A$ is open in $X$ whenever for each $x\\in A$ there exists $P\\in\n\\mathscr{P}_{x}$ such that $P\\subset A$. ", "The space $X$ is [*weakly first-countable*]{} if $\\mathscr{P}_{x}$ is countable for each $x\\in X$.\n\n1. ", " A space $X$ is called an [*$S_{\\omega}$*]{}-[space]{} if $X$ is obtained by identifying all the limit points from a topological sum of countably many convergent sequences;\n\n2. ", " A space $X$ is called an [*$S_{2}$*]{}-[space]{} ([*Arens’ space*]{}) if $X=\\{\\infty\\}\\cup \\{x_{n}: n\\in \\mathbb{N}\\}\\cup\\{x_{n}(m): m, n\\in\n \\mathbb{N}\\}$ and the topology is defined as follows: Each $x_{n}(m)$ is isolated; a basic neighborhood of $x_{n}$ is $\\{x_{n}\\}\\cup\\{x_{n}(m): m>k, \\mbox{for some}\\ k\\in \\mathbb{N}\\}$; a basic neighborhood of $\\infty$ is $\\{\\infty\\}\\cup (\\bigcup\\{V_{n}:\n n>k\\ \\mbox{for some}\\ k\\in \\mathbb{N}\\})$, where $V_{n}$ is a neighborhood of $x_{n}$.\n\nLet $X$ be a space and $\\{\\mathscr{P}_{n}\\}_{n}$ a sequence of collections of open subsets of $X$.\n\n1. ", " $\\{\\mathscr{P}_{n}\\}_{n}$ is called a [*quasi-development*]{} [@Be] for $X$ if for every $x\\in U$ with $U$ open in $X$, there exists an $n\\in \\mathbb{N}$ such that $x\\in\\mbox{st}(x, \\mathscr{P}_{n})\\subset U$.\n\n2. ", " $\\{\\mathscr{P}_{n}\\}_{n}$ is called a [*development*]{} [@WJ] for $X$ if $\\{\\mbox{st}(x, \\mathscr{P}_{n})\\}_{n}$ is a neighborhood base at $x$ in $X$ for each point $x\\in X$.\n\n3. ", " $X$ is called [*quasi-developable*]{} (resp. [*", "developable*]{}), if $X$ has a quasi-development (resp. [*", "development*]{}).", "\n\n4. ", " $X$ is called [*Moore*]{}, if $X$ is regular and developable.", "\n\nA subset $B$ of a paratopological group $G$ is called [*$\\omega$-narrow*]{} in $G$ if, for each neighborhood $U$ of the neutral element of $G$, there is a countable subset $F$ of $G$ such that $B\\subset FU\\cap UF$.\n\nA space $X$ is called a [*submetrizable*]{} space if it can be mapped onto a metric space by a continuous one-to-one map. ", "A space $X$ is called a [*subquasimetrizable*]{} space if it can be mapped onto a quasimetric space by a one-to-one map.", "\n\nAll spaces are $T_0$ unless stated otherwise. ", "The notations $\\mathbb{R, Q, P, N, Z}$ are real numbers, rational numbers, irrational numbers, natural numbers and integers respectively. ", "The letter $e$ denotes the neutral element of a group. ", "Readers may refer to [@A2008; @E1989; @Gr] for notations and terminology not explicitly given here.", "\n\nSubmetrizablity of first-countable paratopological groups\n=========================================================\n\nIn this section, we firstly give a negative answer to Question \\[q2\\], then a answer to Question \\[q6\\]. ", "We also give affirmative answers to Questions \\[q1\\],  \\[q7\\],  \\[q0\\] and  \\[q4\\] when $G$ is Abelian.", "\n\n\\[p1\\][@PN] The following conditions are equivalent for an arbitrary space $X$.\n\n1. ", " The space $X$ is submetrizable.", "\n\n2. ", " The free paratopological group $F_{p}(X)$ is submetrizable.", "\n\n3. ", " The free Abelian paratopological group $A_{p}(X)$ is submetrizable.", "\n\n\\[p2\\][@PN] The following conditions are equivalent for an arbitrary space $X$.\n\n1. ", " The space $X$ is subquasimetrizable.", "\n\n2. ", " The free paratopological group $F_{p}(X)$ is subquasimetrizable.", "\n\n3. ", " The free Abelian paratopological group $A_{p}(X)$ is subquasimetrizable.", "\n\nThere exist a Hausdorff paratopological group $G$ in which every point is a $G_{\\delta}$-set, and $G$ is not submetrizable.", "\n\nLet $X$ be the lexicographically ordered set $X=(\\mathbb{R}\\times\\{0\\})\\cup (\\mathbb{P}\\times\\mathbb{Z})$. Then $X$ is a non-metrizable linearly ordered topological space without $G_{\\delta}$-diagonal ([@BH Example 2.4]), hence $X$ is not submetrizable. ", "However, $X$ is quasi-developable [@LD]. ", "It is well known that quasi-developability in a generalized ordered space is equivalent to the existence of a $\\sigma$-disjoint base, or of a $\\sigma$-point-finite base [@BL2002 Theorem 4.2]. ", "Hence $X$ has $\\sigma$-point finite base. ", "Therefore, $X$ is quasi-metrizable since a space with a $\\sigma$-point finite base is quasi-metrizable [@Gr Page 489]. ", "Let $G$ be the free Abelian paratopological group $A_{p}(X)$ over $X$. Since a totally order space endowed the order topology is Tychonoff, then $X$ is Tychonoff. ", "It follows from [@PN Proposition 3.8] that $G$ is Hausdorff. ", "By Propositions \\[p1\\] and  \\[p2\\], $G$ is subquasimetrizable and non-submetrizable. ", "Since $G$ is subquasimetrizable, every singleton of $G$ is a $G_{\\delta}$-set.", "\n\nNext we partially answer Question \\[q6\\].", "\n\nThe [*weak extent*]{} [@BD] of a space $X$, denoted by $\\omega e(X)$, is the least cardinal number $\\kappa$ such that for every open cover $\\mathscr{U}$ of $X$ there is a subset $A$ of $X$ of cardinality no greater than $\\kappa$ such that $\\mbox{st}(A; \\mathscr{U})=X$, where $\\mbox{st}(A; \\mathscr{U})=\\bigcup\\{U: U\\in\\mathscr{U}, U\\cap A\\neq\\emptyset\\}$. If $X$ is separable, then $we(X)=\\omega$.\n\n[@BD]\\[l4\\] If $X^{2}$ has countable weak extent and a regular $G_{\\delta}$-diagonal[^4], then $X$ condenses onto a second countable Hausdorff space.", "\n\n\\[l7\\][@LP] Each $\\omega$-narrow first-countable paratopological group is separable.", "\n\nIf $G$ is a regular $\\omega$-narrow first-countable paratopological group, then $G$ condenses onto a second countable Hausdorff space..\n\nIt is straightforward to prove that the product of two $\\omega$-narrow paratopological groups is an $\\omega$-narrow paratopological group. ", "Then $G^{2}$ is an $\\omega$-narrow first-countable paratopological group, and hence $G^{2}$ is separable by Theorem \\[l7\\]. ", "Then $G^{2}$ has countable weak extent. ", "Moreover, it follows from [@LC] that $G$ has a regular $G_{\\delta}$-diagonal. ", "Therefore, $G$ condenses onto a second countable Hausdorff space by Theorem \\[l4\\].", "\n\nLet $(G, \\tau)$ be a regular $\\omega$-narrow first-countable paratopological group. ", "There exists a continuous isomorphism of $G$ onto a Hausdorff second-countable space.", "\n\nA paratopological group $G$ with a base at the neutral element $\\mathscr{B}$ is a [*SIN*]{}-[*group*]{} (Small Invariant Neighborhoods), if for each $U\\in \\mathscr{B}$ there exists a $V\\in\\mathscr{B}$ such that $xVx^{-1}\\subset U$ for each $x\\in G.$\n\n\\[t0\\] If $(G, \\tau)$ is a Hausdorff SIN first-countable paratopological group, then $G$ is submetrizable.", "\n\nLet $\\{U_{n}: n\\in\\mathbb{N}\\}$ be a countable local base of $(G, \\tau)$ at the neutral element $e$, where $U_{n+1}\\subset U_{n}$ for each $n\\in \\mathbb{N}$.\n\nFor $x\\in G$, let $\\mathcal{B}_x=\\{xU_nU_n^{-1}: n\\in \\mathbb{N}\\}$. Then $\\{\\mathcal{B}_x\\}_{x\\in G}$ has the following properties.", "\n\n(BP1) For every $x\\in G$, $\\mathcal{B}_x\\neq \\emptyset$ and for every $U\\in \\mathcal{B}_x, x\\in U$.\n\n(BP2) If $x\\in U\\in \\mathcal{B}_y$, then there exists a $V\\in \\mathcal{B}_x$ such that $V\\subset U$\n\nIn fact, if $x\\in U=yU_iU_i^{-1}\\in \\mathcal {B}_y$, then $x=yu_1u_2^{-1}$ for some $u_1, u_2 \\in U_i$. Pick $U_j, U_k\\in \\{U_{n}: n\\in\\mathbb{N}\\}$ such that $U_k\\subset U_i$, $u_1U_k\\subset U_i, U_ju_2\\subset U_k, u_2^{-1}U_ju_2\\subset U_k$. Then $xU_jU_j^{-1}=yu_1u_2^{-1}U_jU_j^{-1}\\subset yu_1U_ku_2^{-1}U_j^{-1}\\subset yU_i(U_ju_2)^{-1}\\subset yU_iU_k^{-1}\\subset yU_iU_i^{-1}=U$.\n\n(BP3) For any $V_1, V_2 \\in \\mathcal{B}_x$ there exists a $V\\in \\mathcal {B}_x$ such that $V\\subset V_1 \\cap V_2$.\n\nLet $\\tau^{\\ast}$ be the topology generated by the neighborhood system $\\{\\mathcal{B}_x\\}_{x\\in G}$. Obviously, the topology of $(G, \\tau^{\\ast})$ is coarser than $(G, \\tau)$ and it is first-countable. ", "We prove that $(G, \\tau^{\\ast})$ is a Hausdorff topological group.", "\n\nIt is easy to see that (a), (d) and (f) in Proposition \\[p0\\] are satisfied. (", "BP2) implies (c). ", "We check conditions (b) and (d).", "\n\nFix $n\\in \\mathbb{N}$. Then there is $k>n$ such that $U_{k}^{2}\\subset U_{n}$ since $(G, \\tau)$ is a paratopological group. ", "$G$ is a SIN-group, there exists an $m>k$ such that $xU_{m}x^{-1}\\subset U_{k}$ for each $x\\in G$, and hence $U_{m}^{-1}U_{m}\\subset U_{k}U_{m}^{-1}$. Then $U_{m}U_{m}^{-1}U_{m}U_{m}^{-1}\\subset U_{m}U_{k}U_{m}^{-1}U_{k}^{-1}\\subset U_{k}U_{k}U_{k}^{-1}U_{k}^{-1}\\subset U_{n}U_{n}^{-1}$. Hence (b) is satisfied.", "\n\nSince $\\{U_n: n\\in \\mathbb{N}\\}$ is a network of $G$ at $e$, $\\bigcap_{n\\in\\mathbb{N}} U_nU_{n}^{-1}=\\{e\\}$ by [@A2002 Proposition 3.4, 3.5]. ", "Therefore, $(G, \\tau^{\\ast})$ is Hausdorff, and hence it is Tychonoff.", "\n\nSince first-countable topological group metrizable, we have $(G, \\tau^{\\ast})$ is metrizable. ", "Therefore, $G$ is submetrizable.", "\n\nIt is well known that all submetrizable spaces have a zero-set diagonal. ", "Therefore, Theorem \\[t0\\] gives a partial answer to Question \\[q7\\].", "\n\n\\[c5\\] If $(G, \\tau)$ is a Hausdorff Abelian first-countable paratopological group, then $G$ is submetrizable.", "\n\nIndeed, we have the following more stronger result.", "\n\n\\[t9\\] If $(G, \\tau)$ is a Hausdorff Abelian paratopological group with a countable $\\pi$-character, then $G$ is submetrizable.", "\n\nLet $\\mathscr{B}=\\{U_{\\alpha}: \\alpha<\\kappa\\}$ be a local base at the neutral element $e$. It follows from the proof of Theorem \\[t0\\] that the family $\\{U_{\\alpha}U_{\\alpha}^{-1}: \\alpha<\\kappa\\}$ is a local base at point $e$ in the Tychonoff topological group $(G, \\tau^{\\ast})$.\n\nLet $\\mathscr{C}=\\{V_{n}: n\\in\\mathbb{N}\\}$ be a local $\\pi$-base at $e$. Put $\\mathscr{F}=\\{V_{n}V_{n}^{-1}: n\\in \\mathbb{N}\\}$. Then $\\mathscr{F}'=\\{int(V_{n}V_{n}^{-1}): n\\in \\mathbb{N}\\}$ is a local base at $e$ in $\\tau^{\\ast}$.\n\nIndeed, for each $n\\in\\mathbb{N}$ and fix a point $x\\in V_{n}$, then $x^{-1}V_{n}$ is an open neighborhood at $e$ in $\\tau$, and hence there exists an $U_{\\alpha}\\in\\mathscr{B}$ such that $U_{\\alpha}\\subset x^{-1}V_{n}$. Thus $U_{\\alpha}U_{\\alpha}^{-1}\\subset x^{-1}V_{n}V_{n}^{-1}x=V_{n}V_{n}^{-1}$, which implies that $V_{n}V_{n}^{-1}$ is a neighborhood of $e$ in $\\tau^{\\ast}$. On the other hand, fix $\\alpha<\\kappa$, there is $n\\in \\mathbb{N}$ such that $V_n\\subset U_\\alpha$. $V_nV_n^{-1}\\subset U_{\\alpha}U_{\\alpha}^{-1}$. Therefore, $\\mathscr{F}'=\\{int(V_{n}V_{n}^{-1}): n\\in \\mathbb{N}\\}$ is a local base at $e$ in $\\tau^{\\ast}$.\n\nSince first-countable topological group metrizable, we have $(G, \\tau^{\\ast})$ is metrizable. ", "Therefore, $G$ is submetrizable.", "\n\nSince every submetrizable space is (hereditarily) Dieudonné complete, Corollary \\[c5\\] give a partial answer to Question \\[q4\\].", "\n\n\\[c3\\] Let $(G, \\tau)$ be a Hausdorff separable SIN first-countable paratopological group. ", "There exists a continuous isomorphism of $G$ onto a Tychonoff second-countable topological group.", "\n\nBy the proof of Theorem \\[t0\\], we know that $(G, \\tau^{\\ast})$ is metrizable. ", "Since $G$ is separable and $\\tau^{\\ast}\\subset \\tau$, $(G, \\tau^{\\ast})$ is separable, and hence $(G, \\tau^{\\ast})$ is a second-countable topological group. ", "Hence there exists a continuous isomorphism of $G$ onto a Tychonoff second-countable topological group.", "\n\nBy Theorem \\[l7\\], we have the following corollary, which gives a partial answer to Question \\[q0\\].", "\n\nLet $(G, \\tau)$ be a Hausdorff $\\omega$-narrow first-countable SIN paratopological group. ", "There exists a continuous isomorphism of $G$ onto a Tychonoff second-countable topological group.", "\n\nThe following two theorems give another answers to Questions \\[q1\\] and \\[q4\\].", "\n\nIf $(G, \\tau)$ is a Hausdorff saturated[^5] first-countable paratopological group, then $G$ is submetrizable.", "\n\nSuppose that $\\{U_{n}: n\\in\\mathbb{N}\\}$ is a countable local base at $e$. Let $$\\sigma=\\{U\\subset G: \\mbox{There exists an}\\ n\\in \\mathbb{N}\\ \\mbox{such that}\\ xU_{n}U_{n}^{-1}\\subset U\\ \\mbox{for each}\\ x\\in U\\}.$$ Since $G$ is saturated, it follows from [@BT Theorem 3.2] that $(G, \\sigma)$ is a topological group. ", "Obvious, $(G, \\sigma)$ is $T_{1}$ since $(G, \\tau)$ is a Hausdorff, and hence $(G, \\sigma)$ is regular. ", "Then $(G, \\sigma)$ is first-countable, and thus it is metrizable. ", "Therefore, $(G, \\tau)$ is submetrizable.", "\n\nIf $(G, \\tau)$ is a Hausdorff feebly compact[^6] first-countable paratopological group, then $G$ is submetrizable.", "\n\nSuppose that $\\{U_{n}: n\\in\\mathbb{N}\\}$ is a local base at $e$. Then the family $\\{\\mbox{int}\\overline{U_{n}}: n\\in\\mathbb{N}\\}$ is a local base at $e$ for a regular paratopological group topology $\\sigma$ on $G$. Obviously, $(G, \\sigma)$ is feebly compact. ", "Since $(G, \\sigma)$ is first-countable, $(G, \\sigma)$ has a regular $G_{\\delta}$-diagonal [@LC]. ", "Then $(G, \\sigma)$ is metrizable since a regular feebly compact space with a regular $G_{\\delta}$-diagonal is metrizable. ", "Therefore, $(G, \\tau)$ is submetrizable.", "\n\nNext, we gives an another answer to Question \\[q2\\].", "\n\n\\[t5\\] Let $(G, \\tau)$ be a Hausdorff SIN paratopological group. ", "If $G$ is locally countable, then $G$ is submetrizable.", "\n\nSince $G$ is locally countable, there exists an open neighborhood $U$ of $e$ such that $U$ is a countable set. ", "Then $UU^{-1}$ is also a countable set. ", "Let $UU^{-1}\\setminus\\{e\\}=\\{x_{n}: n\\in\\mathbb{N}\\}$. Since $G$ is a paratopological group, we can find a family of countably many neighborhoods $\\{V_{n}: n\\in\\omega\\}$ of $e$ satisfying the following conditions:\\\n(i) $V_{0}=U$;\\\n(ii) For each $n\\in\\omega$, then $V_{n+1}^{2}\\subset V_{n}$;\\\n(iii) For each $n\\in\\mathbb{N}$, then $x_{n}\\not\\in V_{n}V_{n}^{-1}$ (This is possible since $G$ is Hausdorff.)\\\n(iv) For each $n\\in\\omega$, then $xV_{n+1}x^{-1}\\subset V_{n}$ for each $x\\in G$.\n\nSince $G$ is a SIN group, the topology $\\sigma$ generated by the neighborhood basis $\\{V_{n}: n\\in\\mathbb{N}\\}$ is a paratopological group. ", "Clearly, ($G$, $\\sigma$) is coarser than $\\tau$. Since $\\bigcap_{n\\in\\mathbb{N}}V_{n}V_{n}^{-1}=\\{e\\}$ by (iii), $\\sigma$ is Hausdorff. ", "Therefore, $(G, \\sigma)$ is a Hausdorff SIN first-countable paratopological group, and it follows from Theorem \\[t0\\] that $G$ is submetrizable.", "\n\n\\[c6\\] Let $(G, \\tau)$ be a Hausdorff Abelian paratopological group. ", "If $G$ is locally countable, then $G$ is submetrizable.", "\n\nDevelopable paratopological groups\n==================================\n\nRecall that a topological space is [*symmetrizable*]{} if its topology is generated by a symmetric, that is, by a distance function satisfying all the usual restrictions on a metric, except for the triangle inequality [@Ar].", "\n\nNow, we give a negative answer[^7] to Question \\[q9\\] by modifying [@LL2010 Example 2.1].", "\n\nThere exists a separable, Moore paratopological group $G$ such that $G$ is not metrizable.", "\n\nLet $G=\\mathbb{R}\\times \\mathbb{Q}$ be the group with the usual addition. ", "Then we define a topology on $G$ by giving a local base at the neutral element $(0, 0)$ in $G$. For each $n\\in \\mathbb{N}$, let $$U_{n}(0, 0)=\\{(0, 0)\\}\\cup\\{(x, y): y\\geq nx, y< \\frac{1}{n}, y\\in \\mathbb{Q}, x\\geq 0\\}.$$ Let $\\sigma$ be the topology generated by the local base $\\{U_{n}: n\\in \\mathbb{N}\\}$ at the neutral element $(0, 0)$. It is easy to see that $(G, \\sigma)$ is a semitopological group. ", "Now, we prove that is a paratopological group. ", "Since $G$ is Abelian, it only need to prove that for each $n\\in \\mathbb{N}$ there exists an $m\\in \\mathbb{N}$ such that $U_{m}^{2}\\subset U_{n}$. Indeed, fix an $n\\in \\mathbb{N}$, Then we have $U_{4n}^{2}\\subset U_{n}$. For two points $(x_{i}, y_{i})\\in U_{4n} (i=1, 2)$, where $x_{i}\\geq 0, y_{i}<\\frac{1}{4n}, y_{i}\\geq 4nx_{i}, y_{i}\\in\\mathbb{Q} (i=1, 2)$. Let $$(x, y)=(x_{1}, y_{1})+(x_{2}, y_{2})=(x_{1}+x_{2}, y_{1}+y_{2}).$$ Obviously, we have $$x=x_{1}+x_{2}\\geq 0, y=y_{1}+y_{2}<\\frac{1}{4n}+\\frac{1}{4n}=\\frac{1}{2n}<\\frac{1}{n},$$ and $$y=y_{1}+y_{2}\\geq 4nx_{1}+4nx_{2}=4nx\\geq nx.$$ Then $(x, y)\\in U_{n}$, and hence $U_{4n}^{2}\\subset U_{n}$. Moreover, it is easy to see that $G$ is regular, separable and first-countable space.", "\n\nFor each $q\\in\\mathbb{Q}$, it is easy to see that the family $\\{\\{(x, q)\\}: x\\in \\mathbb{R}\\}$ is uncountable discrete and closed, hence $G$ is a $\\sigma$-space, and thus it is a $\\beta$-space[^8]. ", "$G$ is a Moore space by [@LL2010 Corollary 2.1]. ", "Hence $G$ is semi-metrizable [@Gr]. ", "Therefore $G$ is symmetrizable since a space is semi-metrizable if only if it is first-countable and symmetrizable [@Gr]. ", "However, $G$ is not metrizable since $G$ is separable and contains a uncountable discrete closed subset.", "\n\n\\[q3\\] Is every quasi-developable paratopological (semitopological) group a $\\beta$-space?", "\n\nNext, we give a partial answer to Question \\[q3\\].", "\n\n[@AR2005 Lemma 1.2]\\[l1\\] Suppose that $G$ is a paratopological group and not a topological group. ", "Then there exists an open neighborhood $U$ of the neutral element $e$ of $G$ such that $U\\cap U^{-1}$ is nowhere dense in $G$, that is, the interior of the closure of $U\\cap U^{-1}$ is empty.", "\n\n\\[t7\\] A regular Baire[^9] quasi-developable paratopological group $G$ is a metrizable topological group.", "\n\nClaim: Let $U$ be an arbitrary open neighborhood of $e$. Then $\\overline{U^{-1}}$ is also a neighborhood of $e$.\n\nSuppose that $\\{\\mathscr{U}_{n}: n\\in\\mathbb{N}\\}$ is a family of open subsets of $G$ such that for each $x\\in G$ and $x\\in V$ with $V$ open in $G$, there exists an $ n\\in\\mathbb{N}$ such that $x\\in\\mbox{st}(x, \\mathscr{U}_{n})\\subset V$. For each $\\mathbb{N}$, put $$A_{n}=\\{x\\in G: \\mbox{st}(x, \\mathscr{U}_{n})\\subset x\\cdot U\\}.$$ It is easy to see that $G=\\bigcup\\{A_{n}: n\\in\\mathbb{N}\\}$. Since $G$ is Baire, there exists $n_{0}\\in\\mathbb{N}$ such that $\\mbox{int}\\overline{A_{n_{0}}}\\neq\\emptyset$. Therefore, there exist a point $x_{0}\\in G$ and $n_{1}\\in \\mathbb{N}$ such that $\\mbox{st}(x_{0}, \\mathscr{U}_{n_{1}})\\subset \\overline{A_{n_{0}}}$. Let $\\mathscr{V}=\\{U_{1}\\cap U_{2}: U_{1}\\in\\mathscr{U}_{n_{0}}, U_{2}\\in\\mathscr{U}_{n_{1}}\\}$. Put $W=\\mbox{st}(x_{0}, \\mathscr{V})$. For each $W\\cap A_{n_{0}}$, it is easy to see $$x_{0}\\in \\mbox{st}(y, \\mathscr{V})\\subset \\mbox{st}(y, \\mathscr{U}_{n_{0}})\\subset y\\cdot U,$$hence $y^{-1}x_{0}\\in U$, so $x_{0}^{-1}y\\in U^{-1}$, hence $x_{0}^{-1}\\cdot (W\\cap A_{n_{0}})\\subset U^{-1}$. Moreover, since $W\\subset \\overline{A_{n_{0}}}$, then $W\\subset \\overline{W\\cap A_{n_{0}}}$. Therefore, we have $$e\\in x_{0}^{-1}W\\subset x_{0}^{-1}\\cdot\\overline{W\\cap A_{n_{0}}}\\subset \\overline{x_{0}^{-1}\\cdot (W\\cap A_{n_{0}})}\\subset \\overline{U^{-1}}.$$Since $x_{0}^{-1}W$ is an open neighborhood of $e$, the set $\\overline{U^{-1}}$ is also a neighborhood of $e$.\n\n$\\overline{U^{-1}}\\cap U\\subset \\overline{U\\cap U^{-1}}$, by Claim, $\\overline{U\\cap U^{-1}}$ contains a neighborhood of $e$, then $U\\cap U^{-1}$ is not nowhere dense. ", "By Lemma \\[l1\\], $G$ is a topological group. ", "Therefore $G$ is metrizable since first-countable topological groups are metrizable.", "\n\nFinally, we pose some questions about developable paratopological groups.", "\n\nIs each regular Baire quasi-developable semitopological group $G$ is a paratopological group?", "\n\nIf $G$ is developable, then the answer is affirmative. ", "Indeed, it was proved that each Baire Moore semitopological group $G$ is a metrizable topological group [@CJ].", "\n\nIs every developable or Moore paratopological group submetrizable?", "\n\nIs every normal Moore paratopological group submetrizable?", "\n\nIs every paratopological group with a base of countable order[^10] developable?", "\n\nFréchet-Urysohn paratopological groups\n======================================\n\nFirst, we need the following Lemma.", "\n\n[@A2008 Theorem 4.7.5]\\[l6\\] Every weakly first-countable Hausdorff paratopological group is first-countable.", "\n\nArhangel’skii proved that if a topological group G is an image of a separable metrizable space under a pseudo-open[^11] map, then G is metrizable [@A2011]. ", "We have the following.", "\n\n\\[t8\\] Let $G$ be a uncountable paratopological group. ", "Suppose that $G$ is a pseudoopen image of a separable metric space, then $G$ is a separable and metrizable.", "\n\nWe introduce a new product operation in the topological space $G$ by the formula: $a\\times b=ba$, for $a, b\\in G$ and denote the space with this operation by $H$. Put $T=\\{(g, g^{-1})\\in G\\times H, g\\in G\\}$. $|T| > \\omega$ since $G$ is uncountable. ", "By [@AR2005 Proposition 2.9], $H$ is a paratopological group and $T$ is closed in the space $G\\times H$ and is a topological group.", "\n\nSince $G$ is a pseusdo-open image of a separable metric space, then the space $G$ is a Fréchet-Urysohn space with a countable k-network. ", "$G\\times H$ has a countable network. ", "Hence $T$ has a countable network. ", "By the proof of [@Gr Theorem 4.9], $T$ is a one-to-one continuous image of a separable metric space $M$. Let $D$ be a countable dense subset of $M$, there is a sequence $L\\subset D$ converging to some point in $M\\setminus D$ since $M$ is uncountable. ", "Therefore, there is a non-trivial sequence $\\{(g_n, g_n^{-1}): n\\in \\mathbb{N}\\}$ converging to $(e, e)$ (note that $T$ is homogeneous), and hence there exists a sequence $C_0=\\{g_n: n\\in \\mathbb{N}\\} \\subset G$ converging to $e$ and its inverse $C_1=\\{g_n^{-1}: n\\in \\mathbb{N}\\}$ also converges to $e$. $G$ contains no closed copy of $S_2$ since $G$ is Fréchet-Urysohn. ", "By [@LC Theorem 2.4], $G$ contains no closed copy of $S_\\omega$. Since $G$ is a sequential space with a point-countable k-network and contains no closed copy of $S_\\omega$, then $G$ is weakly first-countable [@Ls7], and hence $G$ is first-countable by Lemma  \\[l6\\]. ", "Therefore $G$ is separable and metrizable [@Gr Theorem 11.4(ii)].", "\n\nA quotient image of a topological sum of countably many compact spaces is called a $k_{\\omega}$-space. ", "Every countable $k_{\\omega}$-space is a sequential $\\aleph_{0}$-space, and a product of two $k_{\\omega}$-spaces is itself a $k_{\\omega}$-space, see [@MA].", "\n\n\\[t6\\] Let $G$ be a regular countable, locally $k_{\\omega}$, paratopological group. ", "Then $G$ is a discrete topological group or contains a closed copy of $S_{\\omega}$.\n\nSuppose that $G$ is an $\\alpha_{4}$-space. ", "Then since $G$ is locally $k_{\\omega}$, $G$ is sequential and $\\aleph_{0}$, and thus $G$ is weakly first-countable [@Ls3]. ", "Then $G$ is first-countable by Lemma \\[l6\\], and hence $G$ is a separable metrizable space since $G$ is countable. ", "If $G$ is not discrete, $G$ has no isolated points. ", "Then $G$ is homeomorphic to the rational number set $\\mathbb{Q}$ since a separable metrizable space is homeomorphic to the rational number set $\\mathbb{Q}$ provided that it is infinite, countable and without any isolated points [@HP]. ", "However, $\\mathbb{Q}$ is not a locally $k_{\\omega}$-space, which is a contradiction. ", "Then $G$ is discrete, and $G$ is a topological group.", "\n\nIf $G$ is not an $\\alpha_{4}$-space, and thus $G$ contains a copy of $S_{\\omega}$. Since every point of $G$ is a $G_{\\delta}$-set, it follows from [@Ls7 Corollary 3.4] that $G$ contains a closed copy of $S_{\\omega}$.\n\nBy Theorem \\[t6\\], it is easy to obtain the following corollary.", "\n\nLet $G$ be a regular, countable, non-discrete, Fréchet-Urysohn[^12] paratopological group. ", "If $G$ is $k_{\\omega}$, then $G$ contains a closed copy of $S_{\\omega}$ and no closed copy of $S_{2}$.\n\nSince the closed image of a locally compact, separable metric space is a Fréchet-Urysohn and $k_{\\omega}$-space, we have the following corollary.", "\n\nLet $G$ be a countable non-discrete paratopological group. ", "If $G$ is a closed image of a locally compact, separable metric space, then $G$ contains a closed copy of $S_{\\omega}$, and hence $G$ is not metrizable.", "\n\nThe condition “locally $k_{\\omega}$-space” is essential in Theorem \\[t6\\], and we can not omit it.", "\n\n\\[e0\\] There exists a regular non-discrete countable second-countable paratopological group $G$ such that $G$ contains no closed copy of $S_{\\omega}$ and $G$ is not a topological group.", "\n\nLet $G=\\mathbb{Q}$ be the rational number and endow with the subspace topology of the Sorgenfrey line. ", "Then $\\mathbb{Q}$ is a second-countable paratopological group and non-discrete. ", "Obviously, $G$ contains no closed copy of $S_{\\omega}$ and $G$ is not a topological group.", "\n\nnon-H-closed paratopological groups\n===================================\n\nA paratopological group is H-closed if it is closed in every Hausdorff paratopological group containing it as a subgroup.", "\n\nLet $U$ be a neighborhood of $e$ in a paratopological group $G$. We say that a subset $A\\subset G$ is $U$-unbounded if $A\\nsubseteq KU$ for every finite subset $K\\subset G$.\n\nNow, we give a negative answer to Question \\[q5\\].", "\n\n[@RO]\\[l5\\] Let $G$ be an abelian paratopological group of the infinite exponent. ", "If there exists a neighborhood $U$ of the neutral element such that a group $nG$ is $UU^{-1}$-unbounded for every $n\\in\\mathbb{N}$, then the paratopological group $G$ is not H-closed.", "\n\n\\[t1\\] The Sorgenfrey line $(\\mathbb{R}, \\tau)$ is not H-closed.", "\n\nObvious, $\\mathbb{R}$ is an abelian paratopological group of the infinite exponent. ", "Let $U=[0, 1)$. Then $UU^{-1}=(-1, 1)$ For each $n\\in\\mathbb{N}$, it is easy to see that $n\\mathbb{R}\\nsubseteq K(-1, 1)$ for every finite subset $K$ of $\\mathbb{R}$. Indeed, for each finite subset $K$ of $\\mathbb{R}$, since $K$ is finite set, there exists an $n\\in \\mathbb{N}$ such that $|x|\\leq n$ for each $x\\in K$, and then $K\\subset (-1, 1)\\subset (-n, n)$. Therefore, we have $n\\mathbb{R}\\nsubseteq K(-1, 1)$. By Lemma \\[l5\\], $\\mathbb{R}$ is not H-closed.", "\n\nHowever, we have the following theorem.", "\n\n\\[t4\\] Let $(\\mathbb{R}, \\tau)$ be the Sorgenfrey line. ", "Then the quotient group $(\\mathbb{R}/\\mathbb{Z}, \\xi)$ is H-closed, where $\\xi$ is the quotient topology.", "\n\nLet $(\\mathbb{R}/\\mathbb{Z}, \\sigma)$ be the finest group topology such that $\\sigma\\subset \\xi$. Then $(\\mathbb{R}/\\mathbb{Z}, \\sigma)$ is compact. ", "Therefore, $(\\mathbb{R}/\\mathbb{Z}, \\sigma)$ is H-closed. ", "Hence $(\\mathbb{R}/\\mathbb{Z}, \\xi)$ is H-closed by [@RO Proposition 10].", "\n\nLet $G$ be an abelian non-periodic paratopological group. ", "We say that $G$ is [*strongly unbounded*]{} if there exists non-periodic element $x_{0}$ and open neighborhood $U$ of $e$ such that $\\langle x_{0}\\rangle\\cap UU^{-1}=\\{e\\}$ and $\\langle x_{0}\\rangle$ is closed in $G$, where $\\langle x_{0}\\rangle$ is a subgroup generated by $x_0$. Obviously, every strongly unbounded paratopological group is not H-closed.", "\n\nNext, we discuss some non-H-closed paratopological groups.", "\n\nGiven any elements $a_{0}, a_{1},\\cdots, a_{n}$ of an abelian group $G$ put $$X(a_{0}, a_{1},\\cdots, a_{n})=\\{a_{0}^{x_{0}}a_{1}^{x_{1}}\\cdots a_{n}^{x_{n}}: 0\\leq x_{i}\\leq n, 0\\leq i\\leq n\\}.$$\n\n\\[t3\\] Let $(G, \\tau)$ be a Hausdorff strongly unbounded paratopological group. ", "Then there exists a Tychonoff paratopological group topology $\\gamma$ on $G\\times \\mathbb{Z}$ satisfies the following conditions:\n\n1. ", " There exists a Hausdorff paratopological group topology $\\sigma\\subset \\gamma$ on $G\\times \\mathbb{Z}$ such that $\\sigma|_{G\\times\\{0\\}}=\\tau$ and $(G\\times \\mathbb{Z}, \\sigma)$ contains closed copies of $S_{2}$ and $S_{\\omega}$;\n\n2. ", " $(G\\times \\mathbb{Z}, \\gamma)$ is a strongly zero-dimensional, paracompact $\\sigma$-space;\n\n3. ", " The remainder $b(G\\times \\mathbb{Z}, \\gamma)\\setminus (G\\times \\mathbb{Z}, \\gamma)$ of every Hausdorff compactification $b(G\\times \\mathbb{Z}, \\gamma)$ is pseudocompact.", "\n\nSince $G$ is strongly unbounded paratopological group, there exist a non-periodic element $x_{0}$ of $G$ and open neighborhood $U$ of $e$ such that $\\langle x_{0}\\rangle\\cap UU^{-1}=\\{e\\}$ and $\\langle x_{0}\\rangle$ is closed in $G$. Obvious, $\\langle x_{0}\\rangle$ is an abelian group. ", "Then the mapping $f: (nx_{0}, m)\\mapsto (n, m)$ is is naturally isomorphic from $\\langle x_{0}\\rangle\\times \\mathbb{Z}$ onto a group $\\mathbb{Z}\\times \\mathbb{Z}$. We may assume that $\\mathbb{Z}\\times \\mathbb{Z}\\subset G\\times \\mathbb{Z}$. Now we define a zero dimensional paratopological group topology on $G\\times \\mathbb{Z}$. Obvious, we can define a positively natural number sequence $\\{a_{n}\\}$ satisfies the following conditions:\\\n(1) $a_{n}>n$;\\\n(2) $a_{n}> 2a$ for each $a\\in X(a_{1}, \\cdots, a_{n-1}).$\\\nDefine a base $\\mathscr{B}_{\\gamma}$ at the neutral element of paratopological group topology $\\gamma$ on the group $G\\times\\mathbb{Z}$ as follows. ", "Put $A^{+}_{n}=\\{(e, 0)\\}\\cup \\{(a_{k}, 1): k>n\\}$. For every strictly increasing sequence $\\{n_{k}\\}$ put $A[n_{k}]=\\bigcup_{l\\in\\mathbb{N}}A^{+}_{n_{1}}\\cdots A^{+}_{n_{l}}$. Put $\\mathscr{B}_{\\gamma}=\\{A[n_{k}]\\}$. Then $\\gamma$ is a zero dimensional paratopological group topology on $G\\times \\mathbb{Z}$, see [@RO Lemma 3].", "\n\n\\(1) By the proof of [@RO Lemma 3], we can define a topology $\\sigma$ on $G\\times \\mathbb{Z}$ such that $\\sigma|_{G\\times\\{0\\}}=\\tau$, $\\sigma\\subset \\gamma$ and $\\sigma|_{\\mathbb{Z}\\times\\mathbb{Z}}=\\gamma|_{\\mathbb{Z}\\times\\mathbb{Z}}$. Let $\\gamma|_{\\mathbb{Z}\\times\\mathbb{Z}}=\\xi$. Since $(\\mathbb{Z}\\times \\mathbb{Z}, \\xi)$ is zero dimensional and countable, the space $(\\mathbb{Z}\\times \\mathbb{Z}, \\xi)$ is Tychonoff.", "\n\n[**Claim 1**]{}: $(\\mathbb{Z}\\times \\mathbb{Z}, \\xi)$ is a closed in $(G\\times \\mathbb{Z}, \\sigma)$.\n\nSince $\\langle 1\\rangle\\cap UU^{-1}=\\{e\\}$ and $\\langle 1\\rangle$ is closed in $G$, it is easy to see that $(\\mathbb{Z}\\times \\mathbb{Z}, \\xi)$ is closed in $(G\\times \\mathbb{Z}, \\sigma)$.\n\n[**Claim 2**]{}: $(\\mathbb{Z}\\times \\mathbb{Z}, \\xi)$ contains a closed copy of $S_{\\omega}$.\n\nFor each $n\\in \\mathbb{N}$, let $\\beta_{n}=\\{(na_{n+k}, n)\\}_{k\\in\\mathbb{N}}$. Obvious, each $\\beta_{n}$ converges to $(0, 0)$ as $k\\rightarrow \\infty$.\n\nLet $X=\\{(na_{n+k}, n): k, n\\in \\mathbb{N}\\}\\cup\\{(0, 0)\\}$. It is easy to see that $X$ is a closed copy of $S_{\\omega}$.\n\n[**Claim 3**]{}: $(\\mathbb{Z}\\times \\mathbb{Z}, \\xi)$ contains a closed copy of $S_{2}$.\n\nLet $\\alpha_{0}=\\{(a_{k}, 1)\\}_{k\\in\\mathbb{N}}$. For each $n\\in \\mathbb{N}$, let $\\alpha_{n}=\\{(a_{n}+(n-1)a_{k}, n)\\}_{k\\in\\mathbb{N}}$. Obvious, $\\alpha_{0}$ converges to $(0, 0)$ as $k\\rightarrow \\infty$ and each $\\alpha_{n}$ converges to $(a_{n}, 1)$ as $k\\rightarrow \\infty$.\n\nLet $X=\\{(a_{n}+(n-1)a_{k}, n): k, n\\in \\mathbb{N}\\}\\cup\\alpha_{0} \\cup\\{(0, 0)\\}$. It is easy to see that $X$ is a closed copy of $S_{2}$.\n\n\\(2) Let $i: \\mathbb{Z\\rightarrow \\mathbb{}Z}$ be the identity map. ", "Since $\\mathbb{Q}$ is a divisible group, the map $i$ can be extended to a homomorphism $\\phi: G\\rightarrow \\mathbb{Q}$. Put $|x|=|\\phi(x)|$ for every element $x\\in G$. Then $|\\cdot|$ is a seminorm on the group $G$ such that for all $x, y\\in G$ holds $|x+y|\\leq |x|+|y|$. For each $n\\in\\mathbb{N}$, let $\\mathscr{B}_{n}=\\{\\{(x, y)\\}: \\phi (x)\\leq n, y\\in\\mathbb{Z}\\}$. Then it is easy to see that each $\\mathscr{B}_{n}$ is a discrete family of closed subsets. ", "Since it follows from Theorem \\[t5\\] that the space $(G\\times\\mathbb{Z}, \\gamma)$ is submetrizable, there exists a metrizale topology $\\mathscr{F}$ such that $\\mathscr{F}\\subset \\gamma$. Obvious, $\\bigcup_{n\\in\\mathbb{N}}\\mathscr{B}_{n}$ is a network for $(G\\times \\mathbb{Z}, \\mathscr{F})$, and it follows from [@A2008 Theorem 7.6.6] that $(G\\times\\mathbb{Z}, \\gamma)$ is a paracompact $\\sigma$-space. ", "Moreover, each subspace $F_{n}=\\bigcup\\mathscr{B}_{n}$ is strongly zero-dimensional and $G\\times\\mathbb{Z}=\\bigcup_{n\\in\\mathbb{N}}F_{n}$, and hence $(G\\times\\mathbb{Z}, \\gamma)$ is strongly zero-dimensional by [@E1978 Theorem 2.2.7].", "\n\n\\(3) [**Claim 4**]{}: $(G\\times \\mathbb{Z}, \\gamma)$ has no strong $\\pi$-base[^13] at any compact subset of $G\\times \\mathbb{Z}$.\n\nIndeed, suppose there exists a compact subset $K\\subset G\\times \\mathbb{Z}$ such that $K$ has a strong $\\pi$-base $\\varphi$. It is easy to see that the set $\\{n: K\\cap (G\\times\\{n\\})\\neq\\emptyset, n\\in \\mathbb{Z}\\}$ is finite. ", "Moreover, without loss of generalization, we may assume that strong $\\pi$-base $\\varphi$ at $K$ is countable and each element of $\\varphi$ is an open neighborhood of some point in $G\\times \\mathbb{Z}$. Let $A=\\{(b_{i}, n(i)): i\\in\\mathbb{N}, n(i)\\in\\mathbb{Z}\\}$, and let $\\varphi=\\{(b_{i}, n(i))+A[n_{k}^{i}]: i\\in \\mathbb{N}\\}$.\n\nCase 1: The set $\\{n(i): i\\in\\mathbb{N}\\}$ is infinite.", "\n\nThen it is easy to see that $A$ contains a discrete closed subset $B$ such that $B\\cap K=\\emptyset$. Let $U$ be an open neighborhood at $K$. Then $U\\setminus B$ is also an open neighborhood at $K$, and each $(b_{i}, n(i))+A[n_{k}^{i}]\\nsubseteq U\\setminus B$, which is a contradiction.", "\n\nCase 2: The set $\\{n(i): i\\in\\mathbb{N}\\}$ is finite.", "\n\nLet $n_{0}=\\mbox{max}(\\{n(i): i\\in\\mathbb{N}\\}\\bigcup\\{n: K\\cap (G\\times\\{n\\})\\neq\\emptyset, n\\in \\mathbb{Z}\\}\\bigcup\\{0\\})+1$. For each $i+n_{0}\\in\\mathbb{N}$, we can choose a $(c_{_{i}}, i+n_{0})\\in (b_{i}, n(i))+A[n_{k}^{i}]$. Then $\\{(c_{_{i}}, i+n_{0}): i\\in\\mathbb{N}\\}$ is closed and discrete subset in $(G\\times \\mathbb{Z}, \\gamma)$ and $\\{(c_{_{i}}, i+n_{0}): i\\in\\mathbb{N}\\}\\cap K=\\emptyset$. Let $U$ be an open neighborhood at $K$. Then $U\\setminus \\{(c_{_{i}}, i+n_{0}): i\\in\\mathbb{N}\\}$ is also an open neighborhood at $K$, and each $(b_{i}, n(i))+A[n_{k}^{i}]\\nsubseteq U\\setminus \\{(c_{_{i}}, i+n_{0}): i\\in\\mathbb{N}\\}$, which is a contradiction.", "\n\nIt follows from Claim 4 and [@A2009 Corollary 4.3] that $b(G\\times \\mathbb{Z})\\setminus (G\\times \\mathbb{Z})$ is pseudocompact.", "\n\n[**Remark**]{} (1) Sorgenfrey line $(\\mathbb{R}, \\tau)$ is a Hausdorff strongly unbounded paratopological group, and hence we can define a Hausdorff paratopological group topology $\\sigma$ on $G\\times \\mathbb{Z}$ such that $\\sigma|_{G\\times\\{0\\}}=\\tau$ and $(G\\times \\mathbb{Z}, \\sigma)$ contains closed copies of $S_{2}$ and $S_{\\omega}$;\n\n\\(2) Let $\\mathbb{Q}$ be the rationals with the subspace topology of usual topology $\\mathbb{R}$. Then $\\mathbb{Q}$ is a topological group. ", "It easily check that $\\mathbb{Q}$ is a strongly zero-dimensional, nowhere locally compact, paracompact $\\sigma$-space. ", "In additional, $\\mathbb{Q}$ has a strong $\\pi$-base at each point since it is first-countable. ", "It follows from [@A3 Lemma 2.1] that the remainder of any Hausdorff compactification of $\\mathbb{Q}$ is not pseudocompact.", "\n\nA paratopological group $G$ is said to have the property ($^{\\star\\star}$), if there exists a sequence $\\{x_{n}: n\\in\\mathbb{N}\\}$ of $G$ such that $x_{n}\\rightarrow e$ and $x_{n}^{-1}\n\\rightarrow e$.\n\nIn [@LC], C. Liu proved the following theorem.", "\n\n[@LC]\\[t2\\] Let $G$ be a paratopological group having the property ($^{\\star\\star}$). ", "Then $G$ has a (closed) copy of $S_{2}$ if it has a (closed) copy of $S_{\\omega}$.\n\nIt is natural to ask the following.", "\n\n[@LC]\\[q10\\] Can we omit the property ($^{\\star\\star}$) in Theorem \\[t2\\].", "\n\nBy Lemma \\[l5\\], the space $G$ in Theorem \\[t3\\] is not H-closed. ", "Moreover, it is easy to see that the paratopological group topology on $\\mathbb{Z\\times\\mathbb{Z}}$ in Theorem \\[t3\\] does not have the the property ($^{\\star\\star}$). ", "Then we have the following questions.", "\n\nLet $(G, \\tau)$ be a H-closed paratopological group. ", "Does there exist a Hausdorff paratopological group topology $\\sigma$ on $G\\times \\mathbb{Z}$ such that $\\sigma|_{G\\times\\{0\\}}=\\tau$ and $(G\\times \\mathbb{Z}, \\sigma)$ contains closed copies of $S_{2}$ and $S_{\\omega}$?", "\n\nLet $G$ be a not H-closed paratopological group. ", "Is it true that $G$ has a (closed) copy of $S_{2}$ if it has a (closed) copy of $S_{\\omega}$?", "\n\nLet $G$ be a H-closed paratopological group. ", "Is it true that $G$ has a (closed) copy of $S_{2}$ if it has a (closed) copy of $S_{\\omega}$?", "\n\n[**Acknowledgements**]{}. ", "We wish to thank the reviewers for the detailed list of corrections, suggestions to the paper, and all her/his efforts in order to improve the paper.", "\n\n[99]{} A.V. Arhangel’skiǐ, Mappings and spaces, [*Russian Math. ", "Surveys*]{}, 1966, [**21**]{}, 115–162.", "\n\nA.V. Arhangel’skiǐ, [*Topological invariants in algebraic enviroment*]{}, Recent progress in General Topology II, ed. ", "by Hušek and van Mill, ELSEVIER, (2002), 1–58.", "\n\nA. Arhangel’skiǐ, [*Two types of remainders of topological groups*]{}, Comment. ", "Math. ", "Univ. ", "Carolin., ", "49(2008), 119–126.", "\n\nA.V. Arhangel’skiǐ, [*Some classes of quotient and pseudoopen mappings and some new cardinal invariants of tightness type*]{}, International Conference on Topology and its Applications, Islamabad, Pakistan, July 4–10, 2011.", "\n\nA.V. Arhangel’skiǐ, D.K. Burke, [*Spaces with a regular $G_{\\delta}$-diagonal*]{}, Topology Appl., [**", "153**]{}(2006), 1917–1929.", "\n\nA.V. Arhangel’skiǐ, M.M. Choban, [*Remainders of rectifiable spaces*]{}, Topology Appl., [**", "157**]{}(2010), 789–799.", "\n\nA.V. Arhangel’skiǐ, E.A. Reznichenko, [*Paratopological and semitopological groups versus topological groups*]{}, Topology Appl., [**", "151**]{}(2005), 107–119.", "\n\nA.V. Arhangel’skiǐ, M. Tkachenko, [*Topological Groups and Related Structures*]{}, Atlantis Press and World Sci., ", "2008.", "\n\nD. Basile, A. Bella, G.J. Ridderbos, [*Weak extent, submetrizability and diagonal degrees*]{}, arXiv:1112.0883v1\\[math.", "GN\\].", "\n\nH.R. Bennett, [*On quasi-developable spaces*]{}, General Topology Appl., [**", "1**]{}(1971), 253–262.", "\n\nH.R. Bennett, D. Lutzer, [*Ordered spaces with special bases*]{}, Fundamenta Mathematicae, [**158**]{}(1998), 289–299.", "\n\nH.R. Bennett, D. Lutzer, [*Recent developments in the topology of ordered spaces*]{}, Recent progress in General Topology II, ed. ", "by Hušek and van Mill, ELSEVIER, (2002), 85-114.", "\n\nT. Banakh, I. Guran, O. Ravsky, [*Characterizing meager paratopological groups*]{}, Applied General Topology, [**12(1)**]{}(2011), 27–33.", "\n\nJ. Cao, R. Drozdowski, Z. Piotrowski, [*Weak continuity properties of topological groups*]{}, Czech. ", "Math. ", "J., [**60(135)**]{}(2010), 133–148.", "\n\nR. Engelking, [*Dimension theory*]{}, PWN, Polish Scientific Publ., ", "Warszawa, 1978.", "\n\nR. Engelking, [*General Topology*]{} (revised and completed edition), Heldermann Verlag, Berlin, 1989.", "\n\nG. Gruenhage, [*Generalized metric spaces*]{}, In: K. Kunen, J. E. Vaughan(Eds.), ", "Handbook of Set-Theoretic Topology, Elsevier Science Publishers B.V., Amsterdam, 1984, 423–501.", "\n\nK.P. Hart, J. Nagata, J.E. Vaughan, [*Encyclopedia of General topology*]{}, Elsevier Science Publishers B.V., Amsterdam, 2004, 337–340.", "\n\nP.Y. Li, L. Mou, S.Z. Wang, [*Notes on questions about spaces with algebraic strucures*]{}, to appear in Topology Appl.", "\n\nS. Lin, A note on the Arens’ space and sequential fan, [*Topology Appl.*]{}, [**", "81**]{}(1997), 185–196.", "\n\nS. Lin, Point-countable Covers and Sequence-covering Mappings(in Chinese): Science Press, Beijing, 2002.", "\n\nC. Liu, [*A note on paratopological groups*]{}, Comment.", "Math.", "Univ.", "Carolin., [**", "47**]{}(2006), 633–640.", "\n\nC. Liu, S. Lin, [*Generalized metric spaces with algebraic structures*]{}, [*Topology Appl.*]{}, [**", "157**]{}(2010), 1966–1974.", "\n\nC. Liu, [*Metrizability of paratopological (semitopological) groups*]{}, [*Topology Appl.*]{}, [**", "159**]{}(2012), 1415–1420.", "\n\nD. Lutzer, [*On generalized ordered spaces*]{}, Dissertationes Math., ", "89 (1971).", "\n\nE. Michael, [*A quintuple quotient quest*]{}, [*Gen. Topology Appl.*]{}, [**", "2**]{}(1972), 91–138.", "\n\nN.M. Pyrch, A.V. Ravsky, [*On free paratopological groups*]{}, Matematychni Studii, [**25**]{}(2006), 115–125.", "\n\nO. Ravsky, [*On H-closed paratopological groups*]{}, arXiv:1003.5377v1.", "\n\nO. Ravsky, [*Paratopological groups I*]{}, Mathematychni Studii, [**16**]{}(2001), 37-48.", "\n\nJ.M. Worrell, H.H. Wicke, [*Characterizations of developable topological spaces*]{}, [*Canad. ", "J. Math.*]{}, [**", "17**]{}(1965), 820–830.", "\n\n[^1]: The first author is supported by the NSFC (No. ", "10971185, 10971186) and the Natural Science Foundation of Fujian Province (No. ", "2011J05013) of China.", "\n\n[^2]: \\*corresponding author\n\n[^3]: We say that a space $X$ has a [*zero-set diagonal*]{} if the diagonal in $X\\times X$ is a zero-set of some continuous real-valued function on $X\\times X$.\n\n[^4]: A space $X$ is said to have a [*regular $G_{\\delta}$-diagonal*]{} if the diagonal $\\Delta=\\{(x, x): x\\in X\\}$ can be represented as the intersection of the closures of a countable family of open neighborhoods of $\\Delta$ in $X \\times X$.\n\n[^5]: A paratopological group $G$ is [*saturated*]{} if for any neighborhood $U$ of $e$ the set $U^{-1}$ has nonempty interior in $G$.\n\n[^6]: A space $X$ is called [*feebly compact*]{} if each locally finite family of open subsets in $X$ is finite.", "\n\n[^7]: Li, Mou and Wang [@LP] also obtained a non-metrizable Moore paratopological group.", "\n\n[^8]: Let $(X, \\tau)$ be a topological space. ", "A function $g: \\omega\\times X \\rightarrow\\tau$ satisfies that $x\\in g(n, x)$ for each $x\\in X, n \\in\\omega$. A space $X$ is a $\\beta$-space [@Gr] if there is a function $g: \\omega\\times X \\rightarrow\\tau$ such that if $x\\in g(n, x_{n})$ for each $n\\in\\omega$, then the sequence $\\{x_{n}\\}$ has a cluster point in $X$.\n\n[^9]: Recall that a space is [*Baire*]{} if the intersection of a sequence of open and dense subsets is dense.", "\n\n[^10]: A space $X$ is said to have a [*base of countable order*]{}(BCO) [@Gr] if there is a sequence $\\{\\mathcal {B}_{n}\\}$ of base for $X$ such that whenever $x\\in\n b_{n}\\in\\mathcal {B}_{n}$ and $(b_{n})$ is decreasing (by set inclusion), then $\\{b_{n}: n\\in \\mathbb{N}\\}$ is a base at $x$.\n\n[^11]: A map $f: X\\to Y$ is pseudo-open if for each $y\\in Y$ and every open set $U$ containing $f^{-1}(y)\\subset U$ one has $y\\in int(f(U))$.\n\n[^12]: A space $X$ is said to be [*Fr$\\acute{e}$chet-Urysohn*]{} if, for each $x\\in \\overline{A}\\subset X$, there exists a sequence $\\{x_{n}\\}$ such that $\\{x_{n}\\}$ converges to $x$ and $\\{x_{n}:\n n\\in\\mathbb{N}\\}\\subset A$.", "\n\n[^13]: A [*strong $\\pi$-base*]{} of a space $X$ at a subset $F$ of $X$ is an infinite family $\\gamma$ of non-empty open subsets of $X$ such that every open neighborhood of $F$ contains all but finitely many elements of $\\gamma$. Clearly, a strong $\\pi$-base can be always assumed to be countable.", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.020066889632107024, 0, 0, 0.008547008547008548, 0.013824884792626729, 0, 0, 0.016129032258064516, 0, 0, 0.0070921985815602835, 0.06153846153846154, 0.01, 0, 0, 0, 0.011363636363636364, 0, 0, 0.004819277108433735, 0.013888888888888888, 0, 0.008849557522123894, 0, 0.009615384615384616, 0.007407407407407408, 0.01834862385321101, 0.008928571428571428, 0.008695652173913044, 0.013333333333333334, 0.019801980198019802, 0.0125, 0, 0, 0.003246753246753247, 0, 0, 0, 0.004651162790697674, 0.011111111111111112, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0.011627906976744186, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0, 0, 0, 0, 0.008, 0.00390625, 0.024390243902439025, 0.005208333333333333, 0, 0.008403361344537815, 0.012269938650306749, 0.03278688524590164, 0, 0, 0, 0.009074410163339383, 0.011627906976744186, 0.0035971223021582736, 0.008064516129032258, 0, 0.01282051282051282, 0.024096385542168676, 0, 0.011764705882352941, 0.002785515320334262, 0.006825938566552901, 0.007692307692307693, 0.015151515151515152, 0, 0, 0, 0, 0.003205128205128205, 0.006944444444444444, 0.02857142857142857, 0, 0, 0, 0.014705882352941176, 0, 0, 0, 0.0023942537909018356, 0, 0, 0.021505376344086023, 0.010309278350515464, 0, 0, 0.009708737864077669, 0.00980392156862745, 0.021739130434782608, 0.010309278350515464, 0, 0, 0.00625, 0.009615384615384616, 0, 0, 0.008620689655172414, 0.007662835249042145, 0.010309278350515464, 0, 0, 0, 0.014925373134328358, 0, 0, 0, 0.0047694753577106515, 0.007352941176470588, 0.006944444444444444, 0, 0, 0.003367003367003367, 0.01098901098901099, 0.010869565217391304, 0, 0.0024630541871921183, 0, 0.0013440860215053765, 0.005, 0.02040816326530612, 0.027777777777777776, 0.00819672131147541, 0, 0, 0, 0.009900990099009901, 0, 0, 0.00411764705882353, 0.022222222222222223, 0, 0, 0, 0, 0.01818181818181818, 0.014705882352941176, 0.016666666666666666, 0, 0.008620689655172414, 0.018018018018018018, 0.012658227848101266, 0, 0, 0, 0.003968253968253968, 0.007633587786259542, 0, 0, 0, 0.00398406374501992, 0, 0.011235955056179775, 0.015384615384615385, 0, 0.006493506493506494, 0, 0, 0.008130081300813009, 0.008695652173913044, 0, 0.00425531914893617, 0, 0, 0.01056338028169014, 0.010752688172043012, 0, 0, 0, 0, 0, 0, 0, 0, 0.00510204081632653, 0, 0.011904761904761904, 0, 0, 0, 0.004329004329004329, 0, 0, 0, 0, 0, 0.0136986301369863, 0, 0, 0, 0.0035842293906810036, 0.007462686567164179, 0.00425531914893617, 0, 0.0058823529411764705, 0.0034602076124567475, 0.0015105740181268882, 0.006097560975609756, 0.00702576112412178, 0.0016012810248198558, 0.002178649237472767, 0.004962779156327543, 0.004273504273504274, 0.002777777777777778, 0, 0.003484320557491289, 0, 0.006006006006006006, 0.007751937984496124, 0.004140786749482402, 0, 0, 0.01639344262295082, 0.008, 0.011363636363636364, 0, 0.02631578947368421, 0.014705882352941176, 0, 0, 0, 0.0045662100456621, 0, 0, 0, 0, 0, 0, 0, 0, 0.008333333333333333, 0.06521739130434782, 0, 0, 0, 0, 0, 0.0044444444444444444, 0.009615384615384616, 0, 0.010638297872340425, 0, 0.007407407407407408, 0, 0.02586206896551724, 0, 0.01652892561983471, 0, 0.01282051282051282, 0, 0.025, 0.022727272727272728, 0.0625, 0.02158273381294964, 0.02912621359223301, 0, 0, 0.02857142857142857, 0, 0.009615384615384616, 0.03571428571428571, 0.010526315789473684, 0.029197080291970802, 0.024793388429752067, 0.012195121951219513, 0, 0.02830188679245283, 0.017241379310344827, 0, 0, 0, 0, 0.0196078431372549, 0, 0.01, 0, 0, 0, 0, 0, 0.008928571428571428, 0.0136986301369863, 0.02197802197802198, 0.020833333333333332, 0.058823529411764705, 0, 0, 0.012658227848101266, 0, 0, 0.05555555555555555, 0, 0.004662004662004662, 0.0014947683109118087, 0, 0 ]

[ "/*\n *\tFILE \tbitfield.h\n *\n *\tVersion \t1.1\n *\tAuthor \tCopyright (c) Marc A. Viredaz, 1998\n *\t \tDEC Western Research Laboratory, Palo Alto, CA\n *\tDate \tApril 1998 (April 1997)\n *\tSystem \tAdvanced RISC Machine (ARM)\n *\tLanguage\tC or ARM Assembly\n *\tPurpose \tDefinition of macros to operate on bit fields.", "\n */\n\n\n\n#ifndef __BITFIELD_H\n#define __BITFIELD_H\n\n#ifndef __ASSEMBLY__\n#define UData(Data)\t((unsigned long) (Data))\n#else\n#define UData(Data)\t(Data)\n#endif\n\n\n/*\n * MACRO: Fld\n *\n * Purpose\n * The macro \"Fld\" encodes a bit field, given its size and its shift value\n * with respect to bit 0.", "\n *\n * Note\n * A more intuitive way to encode bit fields would have been to use their\n * mask. ", "However, extracting size and shift value information from a bit\n * field's mask is cumbersome and might break the assembler (255-character\n * line-size limit).", "\n *\n * Input\n * Size \tSize of the bit field, in number of bits.", "\n * Shft \tShift value of the bit field with respect to bit 0.", "\n *\n * Output\n * Fld \tEncoded bit field.", "\n */\n\n#define Fld(Size, Shft)\t(((Size) << 16) + (Shft))\n\n\n/*\n * MACROS: FSize, FShft, FMsk, FAlnMsk, F1stBit\n *\n * Purpose\n * The macros \"FSize\", \"FShft\", \"FMsk\", \"FAlnMsk\", and \"F1stBit\" return\n * the size, shift value, mask, aligned mask, and first bit of a\n * bit field.", "\n *\n * Input\n * Field \tEncoded bit field (using the macro \"Fld\").", "\n *\n * Output\n * FSize \tSize of the bit field, in number of bits.", "\n * FShft \tShift value of the bit field with respect to bit 0.", "\n * FMsk \tMask for the bit field.", "\n * FAlnMsk \tMask for the bit field, aligned on bit 0.", "\n * F1stBit \tFirst bit of the bit field.", "\n */\n\n#define FSize(Field)\t((Field) >> 16)\n#define FShft(Field)\t((Field) & 0x0000FFFF)\n#define FMsk(Field)\t(((UData (1) << FSize (Field)) - 1) << FShft (Field))\n#define FAlnMsk(Field)\t((UData (1) << FSize (Field)) - 1)\n#define F1stBit(Field)\t(UData (1) << FShft (Field))\n\n\n/*\n * MACRO: FInsrt\n *\n * Purpose\n * The macro \"FInsrt\" inserts a value into a bit field by shifting the\n * former appropriately.", "\n *\n * Input\n * Value \tBit-field value.", "\n * Field \tEncoded bit field (using the macro \"Fld\").", "\n *\n * Output\n * FInsrt \tBit-field value positioned appropriately.", "\n */\n\n#define FInsrt(Value, Field) \\\n \t(UData (Value) << FShft (Field))\n\n\n/*\n * MACRO: FExtr\n *\n * Purpose\n * The macro \"FExtr\" extracts the value of a bit field by masking and\n * shifting it appropriately.", "\n *\n * Input\n * Data \tData containing the bit-field to be extracted.", "\n * Field \tEncoded bit field (using the macro \"Fld\").", "\n *\n * Output\n * FExtr \tBit-field value.", "\n */\n\n#define FExtr(Data, Field) \\\n \t((UData (Data) >> FShft (Field)) & FAlnMsk (Field))\n\n\n#endif /* __BITFIELD_H */\n" ]

{ "pile_set_name": "Github" }

[ 0.00949367088607595, 0.030405405405405407, 0, 0, 0.014084507042253521, 0, 0.02040816326530612, 0.014184397163120567, 0, 0, 0, 0.024390243902439025, 0, 0, 0.014705882352941176, 0, 0, 0, 0.00881057268722467, 0, 0, 0, 0.03787878787878788 ]

[ "Callout: guest fiction editor\n\nPaid guest editorship\n\nEvery year, Overland publishes several online editions showcasing fiction by new and emerging writers, or specially curated themed fiction editions. ", "An opportunity exists for an emerging editor to work on one of these online fiction editions, to be published in April or May 2019.", "\n\nOften our guest editors are taken from our team of volunteer fiction (and poetry) readers, but this is an opportunity for an emerging editor or writer in the broader literary community.", "\n\nThe successful applicant will receive a payment of $500 to read a large number of submitted stories and to select four for online publication. ", "The emerging editor will be an Overland subscriber with sufficient familiarity with the journal to curate writing that is appropriate. ", "They will also have a demonstrable interest in contemporary fiction and will be capable of writing a short editorial to introduce the edition. ", "As the fiction will be read and assessed online, the applicant can be based anywhere in Australia or New Zealand." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0049261083743842365, 0, 0, 0, 0, 0, 0 ]

[ "He is my only child: Hollywood stars create a heart-wrenching video, share story of immigrant mother whose child was taken away\n\n\"He is my only child\". ", "Four words, one sentence. ", "The gravity could break a heart into zillions. ", "A mother, away from her child, carries in a grief, incomparable and unshareable. ", "But the least this world can do is to stand by her. ", "Hollywood is doing that. ", "Around 30 celebrities have come forward to lend shoulders to Mirian, whose 18-month-old baby was taken away from her, thanks to Donald Trump Government's zero-tolerance policy.", "\n\nRyan Reynolds, Jake and Maggie Gyllenhaal, Amy Schumer along with others have come up with a video, and titled it as 'My Name is Mirian'. ", "Mirian wrote a letter to Trump, which is read by them. ", "They narrate Mirian's story and we come to know why they left Hondurus.", "\n\nListen to Maggie Gyllenhaal and over 30 other Hollywood stars read an affidavit from a mother, known as Mirian, who was separated from her 18-month-old son at the US-Mexico border. ", "https://t.co/OzwLZkkVko\n\n\"I brought my son to the United States so that we could seek protection from violence in Honduras, We fled Honduras after the military tear-gased our home,\" actor Lena Waithe reads.", "\n\n\"The US officers then told me that they were taking my son from me...they did not provide any reason,\" narrates Jamie Lee Curtis.", "\n\n\"I need to be able to hold him and reassure him that he is safe and that his mother is here for him,\" says Gyllenhaal.", "\n\nTrump's zero-tolerance police seeking a prosecution on adult immigrants came to an end after meeting with global outrage. ", "But what about the over 2000 children who are away from their parents, the warmth of home and the sense of minimum security?" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0.005681818181818182, 0.03571428571428571, 0.01818181818181818, 0.028169014084507043, 0.00546448087431694, 0.009708737864077669, 0.007633587786259542, 0.008333333333333333, 0.008064516129032258, 0 ]

[ "/* Device numbers of devices used in the implementation. ", " Hurd version.", "\n Copyright (C) 2001-2018 Free Software Foundation, Inc.\n This file is part of the GNU C Library.", "\n\n The GNU C Library is free software; you can redistribute it and/or\n modify it under the terms of the GNU Lesser General Public\n License as published by the Free Software Foundation; either\n version 2.1 of the License, or (at your option) any later version.", "\n\n The GNU C Library is distributed in the hope that it will be useful,\n but WITHOUT ANY WARRANTY; without even the implied warranty of\n MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the GNU\n Lesser General Public License for more details.", "\n\n You should have received a copy of the GNU Lesser General Public\n License along with the GNU C Library; if not, see\n <http://www.gnu.org/licenses/>. ", " */\n\n#ifndef _DEVICE_NRS_H\n#define _DEVICE_NRS_H\t1\n\n#include <hurd/hurd_types.h>\n\n/* Check whether a given device is a tty. ", " */\n#define DEV_TTY_P(statp) ((statp)->st_fstype == FSTYPE_TERM)\n\n#endif\t/* device-nrs.h */\n" ]

{ "pile_set_name": "Github" }

[ 0, 0.07142857142857142, 0.009900990099009901, 0.00749063670411985, 0.01020408163265306, 0, 0.012658227848101266, 0, 0 ]

[ "Q:\n\nApache2 - disable cache for internet explorer\n\nI've tried to find this on documentation, search egines, and so on... no solution found but maybe you have one.", "\nI cannot use NGinx for some reason.", "\nI have to use Apache2 (on debian).", "\nI have to disable javascript cache (set an exprire header) only for Internet Explorer ( IE < v9 if possible)\nBrowserMatch options doesn't give any possibility as far as I know. ", "Is anybody can give me some idea ?", "\n\nA:\n\nI foudn my own solution that can help some others users...\nThe idea is to set envvar and use \"header\" directives that can check this var:\nBrowserMatch \"MSIE 9.0\" ie9\n<FilesMatch \\.js>\n # for javascripts, if ie9, set cache and expires\n header set Cache-Control no-cache env=ie9\n header set Expires \"Thu, 01 Dec 1994 16:00:00 GMT\" env=ie9\n</FilesMatch>\n\nThat seems to be ok for our configuration, if someone has other ideas.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.027777777777777776, 0.02857142857142857, 0, 0, 0.00684931506849315, 0 ]

[ "Q:\n\nWhy do scripts define common commands in variables?", "\n\nI see this all the time at my place of work:\n#!", "/bin/sh\n\n.....\n\nCAT=/usr/bin/cat # An alias for cat\nMAIL=/usr/bin/mail # An alias for mail\nWC=/usr/bin/wc # An alias for word count\nGREP=/usr/bin/grep # An alias for grep\nDIRNAME=/usr/bin/dirname # An alias for dirname\nRM=/usr/bin/rm # An alias for rm\nMV=/usr/bin/mv # An alias for mv\n\n.....\n\nIs it just my company that does this? ", " Is there a reason why you would want to spell out where these extremely common commands are? ", " Why would I want $CAT to refer to /usr/bin/cat when cat already refers to /usr/bin/cat? ", " Am I missing something? ", " It seems like its needlessly redundant.", "\n\nA:\n\nUsing the full pathname ensures that the script operates correctly even if it's run by a user who customizes their PATH environment variable so that it finds different versions of these commands than the script expects.", "\nUsing variables simplifies writing the script, so you don't have to write the full pathname of a command each time it appears in the script.", "\n\nA:\n\nIs it just my company that does this?", "\n\nNo.", "\n\nIs there a reason why you would want to spell out where these extremely common commands are?", "\n\nYes.", "\n\nWhy would I want $CAT to refer to /usr/bin/cat when cat already refers to /usr/bin/cat?", "\n\nAre you sure cat always refers to /usr/bin/cat? ", " What if your script happens to be run in an environment where there is a different cat earlier in the path? ", " Or where there is simply a user-controlled directory earlier in the path, where a user could install a rogue cat command? ", " If your script ever happens to be run with elevated privileges, then do you really want to give random users the ability to do anything they want to your system?", "\nAre you sure cat is supposed always to refer to /usr/bin/cat? ", " If ever the script were installed in an environment where a different cat were needed (say /usr/local/bin/gnucat), then would you prefer to modify one line or twenty?", "\n\nAm I missing something? ", "It seems like its needlessly redundant.", "\n\nYes, you are missing something.", "\nOne would like to avoid writing out /usr/bin/cat everywhere they want to run cat, and one would like to be able to choose a different cat where needed (or more likely a different make or grep or sed). ", " On the other hand, one wants to avoid potentially unsafe external influence on the behavior of a trusted script. ", " Defining the full path to the command in a shell variable and then using that variable to run the command accomplishes these objectives.", "\n\nA:\n\nOne way to avoid this and still have the safety of ignoring the user's environment is to explicitly spell out the variables in the script\n#!", "/bin/sh\n\nPATH=/bin:/usr/bin # maybe you need something in /usr/sbin, add that\nLC_ALL=C # ignore the user's locale\nLD_LIBRARY_PATH=something # or unset it if you want nothing\n\n# then\ncat /a/file # have confidence you're using /bin/cat\n\nThere may well be others: check the man pages of the programs you use in your code.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.00539568345323741, 0, 0.011235955056179775, 0, 0, 0.0044444444444444444, 0, 0, 0, 0, 0, 0.011235955056179775, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "Q:\n\nModern CPU for highly concurrent server applications?", "\n\nI am looking for a hardware, which must run about 256 computationally intensive real-time concurrent tasks in 24 hour mode. ", "Each task takes about 40-50 MFLOPs, so all tasks require about 10 GFLOPs. ", "CPU-RAM speed is insignificant. ", "All tasks must be managed by a Linux Kernel (32 bit, with SMP).", "\nI am looking for a one-mainboard solution with one multi-core CPU (if such CPU exist). ", "If such CPU doesn't exist, then I need one multi-socket mainboard solution (with multiple CPUs).", "\nCan you please recommend me any professional CPU/Mainboard solution which will satisfy such requirements? ", "It is also very important that there are no issues with Linux Kernel (2.6.25). ", "I also would prefer Intel architecture and well-proved stability. ", "I still have doubts that it is feasible at all.", "\n\nA:\n\nWell you can get single socket, multi-core until the cows come home. ", "I have a quad core for my home desktop (4x3.0ghz). ", "They are common, and reasonably cheap.", "\nWhether that will meet your compatibility needs is a whole different story. ", "I've installed Fedora 11 (Kernel 2.6.29.4) on dual quad-core Xeon machines, more than once, without any major difficulties (and the ones I had were raid based, not processor based). ", "I've got Fedora 12 on my laptop (which meets your requirements, even though it's only got 2 cores.) ", "I don't think you'll have processor problems.", "\nAs for 10 gigaflops, that's no problem...Almost all modern intel desktop processors are capable of at least that.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0.03125, 0.031746031746031744, 0, 0, 0, 0.012658227848101266, 0.015151515151515152, 0.02127659574468085, 0, 0, 0, 0, 0.01098901098901099, 0.01, 0, 0, 0 ]

[ "People celebrated in the streets following the news that Sudanese President Omar al-Bashir has been arrested and forced from power in a military coup.", "\n\nSource: CNN" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.006666666666666667, 0.07692307692307693 ]

[ "Soil Savvy™ Soil Test Kit\n\nSoil Testing Simplified! ", "Soil Savvy™ is a Ready-To-Use professional-grade soil test kit available to the general public that provides an Easy-To-Understand fertilizer recommendation tailored to your specific soil or growing medium. ", "Take your soil sample, mail back with the paid postage, and receive your full media report in 3-5 days. ", "Ok to use on all outdoor types of media, indoor medias including peat, coco, soils, composts. ", "The analysis provides a full report, comprised of soil pH and 14 nutrients including (N,P,K) and access to all reports online. ", "Soil Savvy™ is a truly sustainable approach to fertilizer management, by determining what nutrients are needed by your plants and eliminates over application of the nutrients they don’t need. ", "The same soil testing technology used by leading agricultural producers, turf managers and landscapers is now available to YOU the home gardener! ", "Each Kit includes all needed components and instructions for use." ]

{ "pile_set_name": "Pile-CC" }

[ 0.019230769230769232, 0.004830917874396135, 0, 0, 0, 0.005208333333333333, 0, 0 ]

[ "Metal strip after the strip-forming process, e.g. rolling, may have defects with respect to planarity of the strip which can be length differences with respect to longitudinal zones of the strip across the width thereof. ", "The defects generally are detectable as planarity defects and it is customary to subject the strip to leveling depending upon the deviation of the strip from true planarity. ", "Indeed, deviation from planarity may arise not only in strip-rolling lines but also in strip-processing lines and the lack of planarity can be a function of the deformation by rolling, of various leveling methods and annealing or heat treatment generally of the strip.", "\nEspecially in the cold rolling of strip, it can be observed that there is a certain tendency toward corrugation of the strip which can arise because of differences in strip thickness across the strip or longitudinally therealong and as a consequence of the different degrees of plastic deformation which can be carried out on the strip or can arise from the cold rolling process. ", "Apart from deviations in planarity there may be distortion in the strip itself which are evident as strip camber or edge waviness.", "\nAs a consequence, it has been customary to carry out planarity measurements in metal strip traversing a strip-rolling line or a processing line. ", "For example, the tension force in the strip can be determined and divided by the strip width and strip thickness and utilized to provide a feedback signal which is used to control strip tension. ", "Corrugations in the strip have created problems where the strip was to be used in some industries, for example in the automobile sector, especially when the lack of planarity of the strip exceeded certain limits. ", "As a measure of deviation from planarity, a so-called I-unit (IU) has been developed. ", "An IU corresponds to a tension difference of 10−5 across a strip or across a longitudinal segment of the strip. ", "For example, when the tension differences across the strip are measured in length differences, for example Δl/l is less than 10−5, the lack of planarity is deemed to be less than 1 IU. ", "In this relationship Δl is, of course, the difference in length as measured cross the strip while l is the length over which that difference is applicable.", "\nAny producer of strip must as a rule determine the planarity limits of the product and thus planarity measurements must be taken and these measurements utilized within the rolling line or strip processing line to control the rolling or strip processing line or to identify the quality of the strip produced. ", "Where such measurements are taken, they can be used in real time to regulate a shaping or processing process, i.e. in parallel therewith.", "\nEP 1 116 952 A2 describes a contactless method of measuring planarity while a system utilizing measurement rollers in contact with a continually traveling strip to determine the tension therein is described for example DE 199 18 699 A1.", "\nWhile the contactless measurement process mainly utilizes acoustic waves, ultrasonic waves or electromagnetic measurements to detect the planarity, the roller approach provides a magnetic measurement system and has the greatest use in practice. ", "The measurement roll approach of DE 199 18 699 A1 utilizes a multiplicity of measurement pickups which can be received in recesses and spaced from the wall of the measurement roller. ", "The measurement roller can then be subdivided into so-called disk segments which have been described for example in EP 1 182 424 A1. ", "With the aid of the sensors, radial force measurements are made where the strip is looped around a roller and the output signals are measurements of the local tension which can be divided by the width of the segment and the strip thickness.", "\nThe planarity defects resulting from length differences correspond to varying tensions at the respective segments since the latter are measurements of the extent of elongation in the metal strip and the effect thereof on the planarity. ", "Reference may be to the work “Formabweichungen in Bändern: Einteilung, Entstehung, Messung und Beseitigung sowie quantitative Bewertungsmethoden” (Shape Deviations in Strip: Classification, Creation, Measurement and Evidence as well as Quantitative Evaluation Methods by Gert Mücke, Kai F. Karhausen and Paul-Dieter Pütz (Stahl and Eisen 122 (2002) No. ", "2, Pages 33 ff).", "\nThe known mechanical measurement methods have some basic drawbacks in that only a limited number of measurement points are obtained over the strip width with local tension measurement techniques. ", "That means that a sufficiently precise resolution requires a large number of sensors and hence a comparatively costly measurement roller and thus significant expense in evaluating the results. ", "Furthermore, measurements at edges of the strip are especially problematical because it is there possible that a sensor will only partially cover the strip edge or be looped by the strip. ", "The result can be errors. ", "Errors can also be produced when the position of the strip edge is measured." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.004524886877828055, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00546448087431694, 0.007518796992481203, 0, 0, 0.0113314447592068, 0, 0, 0, 0, 0, 0 ]

[ "Aortic stiffness and diastolic flow abnormalities in end-stage renal disease assessed by magnetic resonance imaging.", "\nArterial stiffness is associated with adverse cardiovascular outcomes, particularly in end-stage renal disease (ESRD). ", "One mechanism linking arterial stiffness with cardiovascular events may be the changes in pressure wave reflection on ventricular ejection and coronary perfusion during diastole. ", "We illustrate this using MRI to describe aortic elastic properties and alterations of diastolic flow in comparison to derived central pressure characteristics. ", "Ten patients with ESRD and ten control subjects were studied. ", "Transverse images of the ascending aorta were obtained by cardiac MRI. ", "Aortic distensibility was calculated using brachial pulse pressure. ", "MRI flow maps were obtained from the ascending aorta and aortic pressure was calculated using SphygmoCor. ", "ESRD patients had reduced aortic distensibility compared to the controls (median 0.00464 mm Hg(-1) vs. 0.00152 mm Hg(-1), p = 0.0057). ", "Furthermore, in diastole, normal subjects show net reversal of blood flow in the ascending aorta, with a mean of -19.6 versus +7.6 ml/min in the ESRD group; p = 0.045. ", "Using non-invasive methods we have demonstrated a marked reduction in aortic distensibility along with disturbances in aortic flow, providing insight into the pathophysiology of ventricular-vascular interaction. ", "The normal group showed reversal of diastolic blood flow, which may have a direct relationship with coronary perfusion parameters, which was absent in the ESRD group." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.008333333333333333, 0, 0, 0.016129032258064516, 0, 0, 0.009433962264150943, 0.007407407407407408, 0.005952380952380952, 0, 0.006024096385542169 ]

[ "using System;\r\nusing System.", "Collections.", "Generic;\r\nusing System.", "Linq;\r\nusing System.", "Text;\r\n\r\nnamespace EnergyProjects.", "Tests.", "Utils\r\n{\r\n public class Differ : diff_match_patch\r\n {\r\n public List<Diff> LineByLine(string text1, string text2)\r\n {\r\n var a = diff_linesToChars(text1, text2);\r\n var lineText1 = (string)a[0];\r\n var lineText2 = (string)a[1];\r\n var lineArray = (List<string>)a[2];\r\n\r\n var diffs = diff_main(lineText1, lineText2, false);\r\n\r\n diff_charsToLines(diffs, lineArray);\r\n return diffs;\r\n }\r\n\r\n public string PrettyLineByLine(List<Diff> diffs)\r\n {\r\n var s = new StringBuilder();\r\n foreach (var aDiff in diffs)\r\n {\r\n var lines = aDiff.text.", "Split(new[] { \"\\r\\n\" }, StringSplitOptions.", "None).ToList();\r\n if (lines.", "Last() == \"\")\r\n {\r\n lines.", "Remove(lines.", "Last());\r\n }\r\n\r\n foreach (var line in lines)\r\n {\r\n switch (aDiff.operation)\r\n {\r\n case Operation.", "INSERT:\r\n s.Append(\"+ \").AppendLine(line);\r\n break;\r\n case Operation.", "DELETE:\r\n s.Append(\"- \").AppendLine(line);\r\n break;\r\n case Operation.", "EQUAL:\r\n s.Append(\" \").AppendLine(line);\r\n break;\r\n }\r\n }\r\n }\r\n\r\n return s.ToString();\r\n }\r\n }\r\n\r\n}" ]

{ "pile_set_name": "Github" }

[ 0.06896551724137931, 0, 0.08695652173913043, 0.1, 0.029411764705882353, 0, 0.007215007215007215, 0, 0, 0, 0, 0.0049261083743842365, 0.0136986301369863, 0.0136986301369863, 0 ]

[ "Super Smash Bros. Brawl\n\nHow can you beat Target Smash Level 5 in under 20 seconds? ", "What are some tips in beating Cruel Brawl in Multi-Man Brawl? ", "What characters have the highest KO rates in their attacks? ", "How do you control R.O.B.’s Final Smash? ", "Which high-jumping character would be good for beating Boss Battle Mode? ", "What is a good technique for beating Master Hand and Crazy Hand? ", "Thank you.", "\n\nGames Guru: Wow. ", "You have a lot of questions. ", "Answers for beating Boss Battle mode might help you with your other questions, too:\n\nDon’t button mash. ", "Wait for a pause in their fighting, then hit once or twice. ", "But don’t go wild or they’ll get you. ", "Do a quick multiple attack. ", "Then retreat to somewhere safe to shoot missiles. ", "Dodge the boss’s moves. ", "Use your most powerful strikes like Hammer. ", "Don’t use your heart containers all at once since you don’t have many.", "\n\nFox and Ness are great against Duon and Meta Ridley since Fox and Ness have reflectors or absorbers. ", "Pikachu works great with any boss who flies. ", "Just use Thunder. ", "Marth works against a ton of bosses. ", "Just use Counter.", "\n\nI heard some talk on comments a while back that you can unlock Ridley as a playable character. ", "How can I do that?", "\n\nGames Guru: You might be able to unlock Ridley by beating Tabuu on any difficulty with Samus playing first on your lineup, as long as you play and die three times straight.", "\n\nAre there any codes for this game?", "\n\nGames Guru: There are tons of codes out there. ", "Here are some ways to unlock bonus stages:\n\nGames Guru: He’s really hard. ", "The short answer to your question is to use characters that fly because Tabuu is quite a flier. ", "So get Diddy Kong, Peach, Meta Knight, Marth and Game & Watch together because they have the finest air attacks.", "\n\nHere’s one other tip: Avoid Tabuu’s whip by using the shield and dodge functions. ", "To avoid Tabuu’s other attacks, you’ll be sidestepping, jumping and rolling a lot.", "\n\nI can’t get anyone to shoot the sandbag far in the homerun derby minigame. ", "Any advice?", "\n\nGames Guru: Try Bowser. ", "Check out this YouTube link as well. ", "Using Bowser, this guy sent the sandbag over 2,100 feet." ]

{ "pile_set_name": "Pile-CC" }

[ 0.011904761904761904, 0.016129032258064516, 0.016666666666666666, 0.024390243902439025, 0.0136986301369863, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.041666666666666664, 0.022727272727272728, 0, 0.02912621359223301, 0, 0, 0, 0, 0.010309278350515464, 0, 0.011494252873563218, 0, 0, 0, 0.010416666666666666, 0.017857142857142856, 0.011904761904761904, 0.012195121951219513, 0, 0, 0, 0.02702702702702703, 0 ]

[ "1952 Washington Senators season\n\nThe 1952 Washington Senators won 78 games, lost 76, and finished in fifth place in the American League. ", "They were managed by Bucky Harris and played home games at Griffith Stadium.", "\n\nRegular season\n\nSeason standings\n\nRecord vs. opponents\n\nRoster\n\nPlayer stats\n\nBatting\n\nStarters by position \nNote: Pos = Position; G = Games played; AB = At bats; H = Hits; Avg. ", "= Batting average; HR = Home runs; RBI = Runs batted in\n\nOther batters \nNote: G = Games played; AB = At bats; H = Hits; Avg. ", "= Batting average; HR = Home runs; RBI = Runs batted in\n\nPitching\n\nStarting pitchers \nNote: G = Games pitched; IP = Innings pitched; W = Wins; L = Losses; ERA = Earned run average; SO = Strikeouts\n\nOther pitchers \nNote: G = Games pitched; IP = Innings pitched; W = Wins; L = Losses; ERA = Earned run average; SO = Strikeouts\n\nRelief pitchers \nNote: G = Games pitched; W = Wins; L = Losses; SV = Saves; ERA = Earned run average; SO = Strikeouts\n\nFarm system \n\nLEAGUE CHAMPIONS: Charlotte\n\nNotes\n\nReferences \n1952 Washington Senators at Baseball-Reference\n1952 Washington Senators team page at www.baseball-almanac.com\n\nCategory:Minnesota Twins seasons\nWashington Senators season\nWashing" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0072992700729927005, 0.013157894736842105, 0, 0.008, 0.017518248175182483 ]

[ "NEW DELHI: The Indira Gandhi International Airport (IGI) here could overtake London 's Heathrow airport in traffic volume by 2020 financial year, a Sydney-based aviation research body has said.", "In its latest report, the Centre for Asia Pacific Aviation (CAPA) India said that IGI airport , which handled 65.7 million passengers in the 2017-18 fiscal, is likely to cross 80 million passengers by 2019-20.\"India's largest airport, Delhi, which handled 65.7 million passengers in FY 2018, is likely to cross 80 million passengers in FY 2020, which would see it approach or even overtake London Heathrow in traffic volumes,\" the report said.", "The IGI airport handles over 1,200 flight operations a day. ", "Earlier this year, the Airports Council International had adjudged the airport as number one in the world in the category of over 40 million passengers per annum. ", "At present, it remains among the top 20 busiest airports globally.", "Talking about the overall growth of airports in the country, the CAPA report said that during the 2017-18 fiscal, India's airports handled 309 million passengers, which was 16.5 per cent rise year-on-year.", "During the first quarter of this year, traffic was up 17.1 per cent, and a similar or possibly even slightly higher rate is expected for the full year, it said.", "\"That would mean that India's airport system will handle 50 million incremental passengers this year, which is more than all of India's airports handled in total in financial year 2004,\" the report said." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.010362694300518135, 0.009029345372460496, 0.016666666666666666, 0.006134969325153374, 0, 0.004878048780487805, 0, 0 ]

[ "Vakhtang Kapanadze\n\nVakhtang Kapanadze () (born August 17, 1960) is a Georgian major general who was Chief of General Staff of the Georgian Armed Forces from November 22, 2013 to November 22, 2016. ", "He held the same command from August 2004 to February 2005. ", "Prior he was in charge of the Georgian peacekeeping battalion deployed in South Ossetia before the war broke out.", "\n\nKapanadze graduated from the Faculty of Geography and Geology, Tbilisi State University, in 1983. ", "He then studied at Georgia's Academy of Interior and has also been trained at the George C. Marshall European Center for Security Studies, National Academy of the Armed Forces of Ukraine, and U.S. Army War College. ", "A veteran of the civil wars of the early 1990s, Kapanadze commanded a Georgian peacekeeping battalion in South Ossetia in 2004 and served as the Chief of the General Staff from August 2004 to February 2005. ", "In 2005, he briefly served as a military aide to the President of Georgia, and was then employed as a special envoy at the Ministry of Foreign Affairs of Georgia in Poland from 2007 to 2008. ", "He was deputy head of the foreign intelligence service of Georgia from 2008 until October 2012, when Brigadier General Kapanadze was appointed Deputy Chief of Joint Staff of the Georgian Armed Forces. ", "He again became Chief of General Staff, succeeding Colonel Irakli Dzneladze, on November 22, 2013. ", "On this occasion, he was promoted to major general. ", "His term expired on November 22, 2016, and was succeeded by Brigadier General Vladimer Chachibaia. ", "He was appointed as Georgia's top military representative to NATO. ", "Kapanadze is the recipient of the orders of Honor and Vakhtang Gorgasali, 3rd Rank.", "\n\nReferences\n\n|-\n\nCategory:1960 births\nCategory:Generals from Georgia (country)\nCategory:Generals of the Georgian Armed Forces ( 1991 - )\nCategory:Living people\nCategory:Recipients of the Order of Honor (Georgia)\nCategory:Military personnel from Georgia (country)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.020100502512562814, 0, 0, 0.02, 0.013953488372093023, 0.004830917874396135, 0.005235602094240838, 0.009950248756218905, 0.020202020202020204, 0, 0.010101010101010102, 0.014925373134328358, 0.04819277108433735, 0.0076045627376425855 ]

[ "Interwar unemployment and poverty in the United Kingdom\n\nInterwar unemployment and poverty in the United Kingdom describes a period of poverty in Interwar Britain between the end of the First World War in 1918 and the start of the Second World War in 1939. ", "Unemployment was the dominant issue of British society during the interwar years. ", "Unemployment levels rarely dipped below 1,000,000 and reached a peak of more than 3,000,000 in 1933, a figure which represented more than 20% of the working population. ", "The unemployment rate was even higher in areas including South Wales and Liverpool. ", "The Government extended unemployment insurance schemes in 1920 to alleviate the effects of unemployment.", "\n\nCauses\nThere were several reasons for the decline in industry after the First World War. ", "The end of the war brought a boom. ", "In the shipping industry, businesses expanded rapidly in order to take advantage of the increase in demand. ", "However, the boom was short-lived and this rapid expansion caused a slump from oversupply. ", "Structural weaknesses in the British economy meant a disproportionate number of jobs were in the traditional industries. ", "A combination of a lack of pre-war technological development and post-war competition damaged the economy and the new industries which emerged employed fewer people. ", "At the same time, Britain began to lose her overseas markets due to strong foreign competition. ", "Some have argued than an overly generous unemployment insurance system worsened the state of the economy. ", "The Wall Street Crash in 1929 was responsible for a worldwide downturn in trade and led to the Great Depression.", "\n\nApart from the major pockets of unemployment, Britain was generally prosperous. ", "Historian Piers Brendon writes:\nHistorians, however, have long since revised this grim picture, presenting the devil's decade as the cradle of the affluent society. ", "Prices fell sharply between the wars and average incomes rose by about a third. ", "The term \"property-owning democracy\" was coined in the 1920s, and 3,000,000 houses were built during the 1930s. ", "Land, labour and materials were cheap: a bungalow could be purchased for £225 and a semi for £450. ", "The middle-class also bought radiograms, telephones, three-piece suites, electric cookers, vacuum cleaners and golf clubs. ", "They ate Kellogg's Corn Flakes (\"never miss a day\"), drove to Odeon cinemas in Austin Sevens (costing £135 by 1930) and smoked Craven A cigarettes, cork-tipped \"to prevent sore throats\". ", "The depression spawned a consumer boom.", "\n\nResponse\n\nLloyd George's coalition\nAs the Government had funded the Great War largely through borrowing, Britain had run up a large national debt. ", "A boom in the economy occurred in 1919 causing unemployment rates to decrease. ", "The boom stopped in 1920 when unemployment began to increase, by the time that the Liberal-Conservative coalition lost power at the 1922 general election, the unemployment rate had reached 2,500,000. ", "A committee on unemployment was set up in 1920 and recommended public work schemes to ease unemployment, this led to the establishment of the Unemployment Grants Committee. ", "As unemployment was not uniform across Britain, it was decided to concentrate schemes in areas of the country that were particularly affected by the economic downturn. ", "However, the government wished, also, to return to the gold standard, a move which would have required cuts in public spending. ", "The Unemployment Insurance Act 1920 extended unemployment benefits to cover all workers who earned less than £250. ", "The \"Seeking Work Test\" was introduced in 1921, it stated to receive full unemployment benefit there had to be evidence the recipient was looking for work.", "\n\nConservative policy\nThe Unemployment Insurance Act 1927 returned to the principle that workers had to contribute to insurance schemes in order to be a part of them. ", "The workhouse system was abolished and replaced with a system of Public Assistance Committees.", "\n\nLabour Policy\nRamsay MacDonald's Government passed the Development (Loan Guarantees and Grants) Act 1929.", "\n\nNational Government\nIn 1931, a National Government formed after Cabinet splits resulting from the financial crisis. ", "National Governments would stay in power from 1931-1940 until Winston Churchill became Prime Minister of a Coalition Government during the Second World War.", "\n\nLocal government was reorganised so that local authorities provided school dinners and health services, means testing was introduced and the Unemployment Assistance Board was set up in 1934. ", "Economic measures included the devaluation of the pound and taking Britain's currency off of the gold standard, borrowing also increased. ", "The Special Areas Act 1934 attempted to inject finance into depressed areas and British industry was protected by protectionist measures such as state subsidies and import quotas. ", "The Unemployment Act 1934 increased the numbers covered by unemployment insurance.", "\n\nLegislation\n\nUnemployment Insurance Act 1920\nUnemployment Insurance Act 1921\nUnemployment Insurance Act 1924\nUnemployment Insurance Act 1927\nUnemployment Insurance Act 1930\nCoal Mines Act 1930\nImport Duties Act 1932\nUnemployment Act 1934\nSpecial Areas Act 1934\nBritish Shipping (Assistance) Act 1935\nCotton Industry (Reorgainsation) Act 1936\nSpecial Areas (Amendment) Act 1937\nCotton Industry (Reorgainsation) Act 1939\n\nUnrest\nThere were several examples of unrest during this period, most notably the General Strike of 1926 and the Jarrow March of October 1936. ", "There were also protests against the introduction of means testing and hunger marches organized by the National Unemployed Workers Movement.", "\n\nReferences\n\nFurther reading\n Benjamin, Daniel K. & Levis A. Kochin, \"Searching for an Explanation for Unemployment in Interwar Britain\" Journal of Political Economy 87 (1979), pp. ", "441-478.", "\n Cole, Harold L., and Lee E. Ohanian. \"", "The Great UK Depression: A puzzle and possible resolution.\" ", "Review of Economic Dynamics 5.1 (2002): 19-44.", "\n Eichengreen, Barry J., and Timothy J. Hatton, eds. ", "Interwar unemployment in international perspective (Springer, 2012).", "\n Eichengreen, Barry. \"", "Unemployment in Interwar Britain.\" ", "Institute for Research on Labor and Employment (1988). ", "online\n Hatton, Timothy J. \"Unemployment and the labour market, 1870-1939.\" ", "in The Cambridge economic history of modern Britain: vol 2 1860-1939 (2004)\n Hatton, Timothy J., and Roy E. Bailey. \"", "Unemployment incidence in interwar London.\" ", "Economica 69.276 (2002): 631-654.", "\n McKibbin, Ross. ", "Classes and Cultures: England 1918-1951 (2000) pp 111-26.", "\n Pugh, Martin. ", " 'We Danced All Night': A Social History of Britain Between the Wars (2008) review by Piers Brendon in The Guardian 4 July 2008\n Srinivasan, Naveen, and Pratik Mitra. \"", "Interwar Unemployment in the UK and the US: Old and New Evidence.\" ", "South Asian Journal of Macroeconomics and Public Finance 5.1 (2016): 96-112. ", "online\n\nExternal links\nUnemployment in interwar Britain\n\nCategory:Poverty in the United Kingdom\nCategory:Poor Law in Britain and Ireland\nCategory:20th century in the United Kingdom\nCategory:Unemployment in the United Kingdom\nCategory:Interwar period\nCategory:Interwar Britain" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0, 0, 0, 0, 0, 0, 0.016042780748663103, 0, 0, 0, 0.005, 0.005780346820809248, 0, 0, 0, 0, 0, 0, 0.018691588785046728, 0.01694915254237288, 0.019230769230769232, 0.0051813471502590676, 0, 0, 0, 0.0017699115044247787, 0.007142857142857143, 0.01092896174863388, 0, 0.05, 0, 0.021739130434782608, 0.03773584905660377, 0, 0.043478260869565216, 0, 0.01818181818181818, 0.013157894736842105, 0.017094017094017096, 0, 0.030303030303030304, 0.05555555555555555, 0, 0.0625, 0.011904761904761904, 0, 0.012987012987012988, 0 ]

[ "InfoSci®-Journals Annual Subscription Price for New Customers: As Low As US$ 4,950\n\nThis collection of over 175 e-journals offers unlimited access to highly-cited, forward-thinking content in full-text PDF and XML with no DRM. ", "There are no platform or maintenance fees and a guarantee of no more than 5% increase annually.", "\n\nReceive the complimentary e-books for the first, second, and third editions with the purchase of the Encyclopedia of Information Science and Technology, Fourth Edition e-book. ", "Plus, take 20% off when purchasing directly through IGI Global's Online Bookstore.", "\n\nAbstract\n\nThe purpose of this chapter is to define information, mainly in terms of cognition units, and also to find out its other perspectives and images. ", "Once we understand information, it becomes possible to define its role in an organization, particularly at the level of information systems. ", "The issue of how more complex information systems may advance an organization to higher levels of structure (configuration) will be investigated. ", "Modern complex organization is still very recent, about 50 years old, but can already be perceived to have some evolutionary phases. ", "Finally, the transformation from the industrial to the informated model of an enterprise is described and both models are compared, with some conclusions about meaning for civilization’s well-being.", "\n\nPerspectives Of Information\n\nThe Quantitative Perspective of Information\n\nThis is one of the oldest perspectives on information meaning. ", "From a quantitative perspective, information is the successful selection of signs or words that form a given list, rejecting all “semantic meaning” as a subjective factor [1]. ", "Hartley (1928) showed that a message of N signs chosen from an “alphabet” or a code book of S signs has SN possibilities, and that the “quantity of information” is most reasonably defined as a logarithmic equation:\n\nH = N log S [1]\n\nSince Hartley’s time, this definition of information as a selection of symbols has been generally accepted, although widely interpreted. ", "As a result, Hartley’s theory crystallized into an exact mathematical definition, provided by Shannon (1948). ", "According to him, the probability p of event α is:\n\nI = - log2 p(α) [2]\n\nThis approach is not useful in business decision-making. ", "Let us assume, for example, that a message: “the distance from Kalamazoo to Chicago α =150 miles” has p=1 and therefore I = 0, since Log2 1 = 0 (because 20 = 1). ", "In other words, from the quantitative perspective, this message contains no information. ", "However, for the individual using his personal car for a business purpose, this message contains information that can be measured monetarily: if for each mile driven the individual receives compensation of $0.40, those 150 miles mean $60 in information value for him/her.", "\n\nAn increase in information yields a resultant reduction of chaos or entropy. ", "Entropy, in statistical thermodynamics (Second Law), is a function of the probability of the states of the particles that form a gas. ", "In the quantitative communication theory, entropy means how much information one must introduce into a given information-oriented system to make it informationally organized and at the same time reduce its chaos. ", "The relationship between information and entropy is expressed most objectively by the Shannon-Weaver formula (1949):\n\nH(α) = - Σ p(α) log2 (α) (BIT) (Binary digIT) [3]\n\nIn a descriptive thermodynamic sense, entropy is referred to as a “measure of disorder.” ", "Information introduced to a given system eliminates that disorder and is therefore said to be “like” negative entropy or order. ", "Starr (1971) demonstrates the idea of entropy using the following example: suppose that eight different commands can be transmitted from the bridge of a ship to the engine room. ", "If each of those commands is equally likely, then the probability of any of these being sent is p=1/8. ", "Knowing p, entropy H can be determined:\n\nH = 8[1/8 log2 (1/8)] = log2 8 = 3 [4]\n\nThis result indicates that eight different orders coded into a binary format (as shown below) can be transmitted via a 3-bit-wide channel of communication:\n\nThe entropy function is widely used in communication networks in coding for the assessment of channel capacity and code efficiency. ", "However, from the human communication point of view, this perspective has limited applications, because it does not provide any human-oriented meaning to the “bits and probabilities.” ", "This approach has a technical significance concerning how to design a technical communication channel. ", "Finally, the entropy function lacks the semantic meaning of information, which can drive human communication." ]

{ "pile_set_name": "Pile-CC" }

[ 0.00881057268722467, 0, 0.0056179775280898875, 0.012195121951219513, 0, 0, 0, 0.007518796992481203, 0, 0, 0, 0.005405405405405406, 0.00909090909090909, 0, 0, 0, 0, 0, 0, 0, 0.003875968992248062, 0, 0.0056179775280898875, 0, 0, 0, 0, 0 ]

[ "Stereoselective synthesis of naturally occurring alpha-methylenebis-gamma-butyrolactones: an application of novel oxiranyl \"remote\" anions.", "\nStereospecific deprotonation of the epoxy proton at the beta-position of the alpha,beta-epoxy esters 5 and 6 yielded oxiranyl \"remote\" anions 7 and 8, which could then be used for alkylation. ", "The anions 7 and 8 underwent a consecutive aldol lactonization to give, respectively, epoxy lactones 11 and 13 with high stereoselectivity. ", "Generation of the remote anions as well as their stereoselective reactions served as a new synthetic route to the naturally occurring alpha-methylenebis-gamma-butyrolactones, 1." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0 ]

[ "Robert M. Guion (1924-2012).", "\nPresents an obituary for Robert M. Guion (1924-2012). ", "Bob received his bachelor's degree from the University of Iowa in 1948 and his master's degree (1950) and doctorate (1952) from Purdue University, the latter in I-O psychology. ", "His doctoral mentor, about whom he always spoke with gratitude, was C. H. Lawshe. ", "Although Bob found employment opportunities limited on graduation, he knew that he wanted the freedom and independence of an academic position. ", "He joined the faculty at Bowling Green State University (BGSU) in 1952. ", "Bob served as chair of the department from 1966 to 1971 and edited the Journal of Applied Psychology from 1983 to 1988. ", "He continued to rise through the professorial ranks and was ultimately named a Distinguished University Professor. ", "In 1965, Bob won the James McKeen Cattell Award for research design from Division 14 (Society for Industrial and Organizational Psychology; SIOP) of the American Psychological Association (APA). ", "He won it again in 1981. ", "His landmark text Personnel Testing (1965, McGraw-Hill) was required reading for almost every I-O graduate student. ", "In 1998 he published another classic, Assessment, Measurement, and Prediction for Personnel Decisions (Erlbaum). ", "As an educator, Bob led the development of the master's and doctoral programs at BGSU and served as mentor for many of today's leaders in the field. ", "As a contributor to professional psychology, he served as the president of two APA divisions, 14 and 5 (Evaluation, Measurement and Statistics), and also chaired APA's Board of Scientific Affairs. ", "His career is a model of the blend of theory, research, and application. ", "Bob was a model of integrity and deeply believed that the waste of human resources should pain the professional conscience of I-O psychologists. ", "Bob worked tirelessly toward the development of a fundamental science that promotes human welfare at work." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.03571428571428571, 0.01818181818181818, 0.01694915254237288, 0.012195121951219513, 0.006944444444444444, 0.013888888888888888, 0.016666666666666666, 0.008695652173913044, 0.02564102564102564, 0, 0.017241379310344827, 0.008849557522123894, 0.013422818791946308, 0.015228426395939087, 0, 0.006896551724137931, 0.018867924528301886 ]

[ "Lisa Wilkinson\n\nLisa Wilkinson (born 19 December 1959) is an Australian television presenter and journalist.", "\n\nWilkinson is currently host of Network 10 news-current affairs and talk show The Project.", "\n\nWilkinson has previously co-hosted the Nine Network's breakfast television program, Today, with Karl Stefanovic from 2007 until 2017 and Weekend Sunrise on the Seven Network from 2005 until 2007.", "\n\nCareer\nWilkinson was born in Wollongong and attended Campbelltown High School (now Campbelltown Performing Arts High School) in the Sydney suburb of Campbelltown. ", "She began her career working for the magazine Dolly. ", "At age 21, she became the youngest editor of the magazine. ", "After four years she was appointed editor of the magazine Cleo and went on to become International Editor-in-Chief. ", "Her television career began in the late 1990s when she was a regular panelist on Network Ten and Foxtel's Beauty and the Beast. ", "During the 2000 Summer Olympics, she (along with Duncan Armstrong) co-hosted The Morning Shift on the Seven Network.", "\n\nIn April 2005, Wilkinson began hosting Weekend Sunrise on the Seven Network with Chris Reason, later with Andrew O'Keefe. ", "On 10 May 2007, it was confirmed that Wilkinson was to co-host Today on the Nine Network after Jessica Rowe left the network. ", "Wilkinson's last appearance on Weekend Sunrise was 6 May 2007, and she began appearing on Today on 28 May 2007.", "\n\nSince 2008, Wilkinson has been the co-host of the Nine Network's Carols by Candlelight, replacing long time host Ray Martin when Martin semi-retired. ", "Wilkinson's co-host from 2008 until 2012 was Karl Stefanovic, and in 2013 she was joined by David Campbell.", "\n\nIn August 2015 Wilkinson was appointed as The Huffington Post, Australian Editor-at-large.", "\n\nOn 16 October 2017, Wilkinson resigned from the Nine Network and Today due to a contract dispute and citing 'lots of reasons' after 10 years with the network, effective immediately. ", "Wilkinson has been contracted to Network Ten and will join The Project as a co-host two nights a week on the weekly edition and host the program's Sunday edition from January 2018.", "\n\nIn 2018, she joined The Project, a nightly TV current affairs programme.", "\n\nPersonal life\n\nWilkinson married media personality Peter FitzSimons on 26 September 1992; they have two sons and one daughter.", "\n\nHonours\nWilkinson was appointed a Member of the Order of Australia in the 2016 Australia Day Honours list for significant service to the print and broadcast media as a journalist and presenter, and to a range of youth and women's health groups.", "\n\nIn 2017, Wilkinson's portrait by artist Peter Smeeth was a finalist in the Archibald Prize, and winner of the Packing Room Prize.", "\n\nReferences\n\nExternal links \n\n \n\nCategory:1959 births\nCategory:Living people\nCategory:People from Wollongong\nCategory:People from Sydney\nCategory:Australian television presenters\nCategory:Australian women journalists\nCategory:Australian journalists\nCategory:Members of the Order of Australia\nCategory:Women television presenters\nCategory:20th-century Australian journalists" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.01834862385321101, 0.01098901098901099, 0.02030456852791878, 0.01818181818181818, 0, 0, 0.017241379310344827, 0.0078125, 0.017241379310344827, 0.03225806451612903, 0.023809523809523808, 0.009009009009009009, 0.03289473684210526, 0.018691588785046728, 0.010869565217391304, 0.005434782608695652, 0, 0.013513513513513514, 0.0078125, 0.008130081300813009, 0.015267175572519083, 0.00267379679144385 ]

[ "Background {#Sec1}\n==========\n\nPost-infectious Irritable Bowel Syndrome (PI-IBS) is a functional bowel disorder in which recurrent abdominal pain is associated with defecation or a change in bowel habits after \"an episode of acute gastroenteritis in individuals who did not have IBS before the infection\" \\[[@CR1]\\]. ", "Recent meta-analyses \\[[@CR2]\\] found more than 10% of patients who had infectious enteritis within the previous 12 months had a 4-fold higher risk of developing IBS compared to patients without a previous infection. ", "Additionally, 6--17% of patients believe their IBS began after an infection \\[[@CR3], [@CR4]\\]. ", "Since no IBS specific biomarkers exist, primary care physicians (PCPs) and general practitioners (GPs) rely on evaluation of patient symptoms and IBS is often diagnosed only after other conditions are excluded \\[[@CR5], [@CR6]\\]. ", "While formal diagnostic tools including the Rome IV and Manning criteria are available, a minority of PCPs are aware of these tools (2--36%) and even less (0--21%) use them \\[[@CR7]\\]. ", "Despite being a non-life threatening illness, IBS can greatly affect a patient's quality of life and is associated with high rates of depression. ", "Therefore, it is important physicians recognize and treat IBS based on evidence-based therapies \\[[@CR7]\\]. ", "Many studies have assessed physician's evaluation and treatment of IBS around the world, with two in the US \\[[@CR8], [@CR9]\\] but none have focused on PI-IBS. ", "The objective of this pilot study is to assess physician knowledge and treatment specific to PI-IBS within their practice.", "\n\nMethods {#Sec2}\n=======\n\nFollowing a literature review, the survey was drafted and reviewed by members of a workgroup that is focused on the chronic outcomes associated with foodborne illnesses. ", "The workgroup consists of experts in epidemiology, gastroenterology, foodborne diseases and government regulation. ", "With the goal of focusing the survey on PI-IBS, questions were edited and tailored to fit a non-gastroenterologist physician audience. ", "The survey questions were piloted with a medical resident (JF), and a gastroenterology fellow (LB) to develop face validity. ", "Any questions deemed not effective were re-worded and re-piloted until the intended aims of the question were reached.", "\n\nThe survey included four major sections: 1) basic demographics (no personal identifiers were collected) and knowledge of chronic outcomes from common foodborne diseases; 2) knowledge and practices related to diagnoses, treatment steps of PI-IBS, and prescription of medications; 3) knowledge and practices of assessing quality of life; and 4) attitudes around utilizing a hypothetical risk score and modes of use. ", "By knowledge we mean the facts, information, and skills acquired by the physician through their experiences in clinic or through education. ", "To reduce respondent confusion we framed some questions on patient interactions using the general IBS term because 1) there is not a widely used diagnostic test to distinguish PI-IBS and general IBS and 2) general IBS and PI-IBS do not currently have different treatment recommendations. ", "The online survey included 40 questions, was available in English, and was estimated to take 11 min.", "\n\nOur team worked with Qualtrics (Provo, UT) an online survey company to recruit a sample of 50 U.S. physicians. ", "We did not provide qualifications on age, race, or gender for sampling in this survey. ", "Physicians were screened on three questions: 1) \"Do you personally see and treat patients for Irritable Bowel Syndrome (IBS) in your practice?\" ", "2) \"Do you personally see and treat patients for foodborne illness in your practice?\" ", "and 3) \"Which best describes your current occupation?\" ", "Survey respondents were required to answer \"Yes\" to the first two questions and select \"Primary Care Physician or General Practitioner\" in order to participate in the survey. ", "The subjects were not screened on the type of residency or prior training completed, only that they currently practice as a PCP or GP. ", "The survey was launched online July 11, 2019 and remained open until July 16, 2019.", "\n\nAll data were analyzed using embedded analysis programming within Qualtrics (Provo, UT) and Stata 14.0 (STATA Corp, College Station, TX). ", "Sample size (*n* = 50) for this pilot study was based on availability of resources to complete the survey. ", "If responses to a question followed a normal distribution, mean proportion with standard deviation (SD) and range are provided. ", "If responses to a question followed a non-normal distribution, the median proportion and interquartile range (IQR) are provided. ", "There was no missing data in the dataset.", "\n\nThe University of Arizona Institutional Review Board reviewed this project and determined that the research is considered exempt human subjects research. ", "Qualtrics provided an incentive (\\~\\$100 USD) for each physician to complete the survey.", "\n\nResults {#Sec3}\n=======\n\nThe survey took an average of 9.9 min to complete (Range: 3.4--38.5 min). ", "The majority of survey respondents were male, had an MD, were practicing for 10 years or more, and resided in the Midwest or Northeast regions of the USA (Table [1](#Tab1){ref-type=\"table\"}). ", "As part of eligibility requirements to take the survey, all respondents (*n* = 50) affirmed that they were currently a PCP or GP and they personally treat and see patients for foodborne illness and IBS within their current practice. ", "Two participants indicated that their residency specialty was Anesthesiology and Pathology, respectively; however they did confirm \"yes\" to both of the eligibility questions and their answers were not outliers from the other 48 participants. ", "Table 1Demographics of primary care physician and general practitioner survey respondents (*N* = 50), July, 2019CategoryN (%) Gender Male35 (70) Female15 (30)Medical Degree MD43 (86) DO7 (14)Residency Specialty Family Practice25 (50) Internal Medicine23 (46) Other (Anesthesiology, Pathology)2 (4)Length of Practice (years) 1--4 years3 (6) 5--10 years6 (12) 10 years or more41 (82)Region of the United States (state abbreviation) West (WA, OR, CA, CO, UT, HI)8 (16) Midwest (KS, MO, IA, WI, IN, IL, MI)16 (32) Southwest (AZ, TX)4 (8) Southeast (FL, GA, TN, KY, WV)9 (18) Northeast (CT, MA, MD, NJ, NY, PA)13 (26)\n\nMost physicians saw multiple patients with an acute foodborne illness each month (62%), multiple within a week (22%), or multiple within a day (10%). ", "Almost all physicians (88%) noted that they are aware of specific foodborne pathogens that can cause functional gastrointestinal disorders including: *E. coli* (*n* = 33, 66%), *Salmonella* (*n* = 30, 60%), *Campylobacter* (*n* = 28, 56%), *Giardia* (*n* = 27, 54%), *Cryptosporidium* (*n* = 24, 48%), or all listed pathogens (*n* = 22, 45%; other pathogens listed include *Shigella*, *Listeria*, *Yersinia*, *Cyclospora*, and *Norovirus*). ", "Among a list of gastrointestinal disorders, the majority of physicians (*n* = 33, 66%) noted IBS, followed by chronic diarrhea (*n* = 29, 58%), and dyspepsia (*n* = 22, 45%) as gastrointestinal conditions most commonly linked to foodborne illness or which could have resulted from infection with a foodborne pathogen. ", "Forty-eight percent responded they often or always discuss possible long-term outcomes of chronic conditions that might occur after foodborne or gastrointestinal illness.", "\n\nWhen considering diagnoses for suspect PI-IBS patients, 40% of physicians review the patients' history for a previous gastrointestinal illness and the majority look up to 1 year prior (54%). ", "Almost all physicians (90%) review previous diagnostic lab results or ask their patients if a sample tested positive for a specific pathogen. ", "Physicians estimated that 42% (SD = 22.9, range: 5--94%) of their patients diagnosed with IBS report a gastrointestinal illness prior to their diagnosis. ", "The majority of physicians (74%) agreed that knowing a patient had a previously diagnosed foodborne infection would change the way they approached treatment of their IBS patients. ", "As their first diagnostic step after a patient developed PI-IBS, 32% of physicians ordered a follow-up stool culture (32%) or other laboratory test (16%). ", "For physicians who selected \"I would order a follow-up stool sample\" (*n* = 13), their reasons included wanting to rule out ongoing/persistent infection (*n* = 11) or parasitic infection (*n* = 2).", "\n\nIn general, the physicians' first treatment step for PI-IBS patients was prescriptions for probiotics (66%) or antibiotics (28%). ", "No physicians prescribe antidepressants as their first treatment step, and 46% made recommendations for dietary changes. ", "For a patient with PI-IBS, most physicians would treat the patient themselves (54%) and manage the illness through treatment modality modification depending on severity of the PI-IBS (44%). ", "Only one PCP noted they would refer the patient to a specialist. ", "Of the 20 physicians who provided additional comment, physicians estimated 16.5% on average (range: 5--30%) of their IBS patients are severe (no specific definition). ", "PI-IBS was deemed as \"severe\" when physicians saw the patient more often, referred them to a gastroenterologist for additional management, or considered other modalities such as referring to a psychiatrist or trying a different antibiotic.", "\n\nPhysicians prescribed laxatives for general IBS patients with the constipation sub-type and anti-diarrheal medications or gut antispasmodics for general IBS patients with the diarrhea sub-type most often (Table [2](#Tab2){ref-type=\"table\"}). ", "Physicians believed that patients stayed on these medications for less than 6 months (36%) or from 6 months to 1 year (36%). ", "Physicians typically see their IBS patients every 3 months (84%) and most estimate less than 10% of their patients (median: 8.5%, IQR: 4--19%) are hospitalized one or more times per year for their IBS. ", "Table 2List and count of common medications (*N* = 123) prescribed by primary care physician and general practitioner survey respondents (*N* = 50), July, 2019MedicationNPrescription Anti-Constipation (Lubiprostone, Linaclotide)30OTC Anti-constipation (Polyethylene glycol, Docusate, Senna)8Antispasmodic (Dicyclomine, Hyoscyamine)18Prescription Anti-diarrheal (alosetron hydrochloride, eluxadoline, loperamide hydrocholride)9OTC Anti-diarrheal (loperamide, constipating agents)13Antibiotics (rifaximin)9Fiber9Serotonin or norepinephrine reuptake inhibitors6Tri-cyclic Antidepressants (amitriptyline, nortriptyline)5Probiotics4Aminosalicylates (mesalamine)1Other (acid reducer, motility agents, stool softeners)11**Total123**\n\nPhysicians were split on whether they discuss psychological health impacts resulting from their patient\\'s PI-IBS (never 4%, sometimes 20%, half the time 16%, most of the time 34%, always 26%). ", "More than half the physicians ask about impacts to their patients' quality of life (most 34%, always 36%) and provided in-depth examples of those impacts. ", "Physicians noted avoidance of social events, impacts to work life, and impacts to their mental health and relationships most often; quotes from survey respondents are shared in (Table [3](#Tab3){ref-type=\"table\"}). ", "Most physicians estimate that their IBS patients lose less than 10 h per week out of a 40-h work week (median: 8 h, IQR: 3--18 h) and less than 5% (median: 5%, IQR: 1--16%) go on permanent disability due to their IBS. ", "Twenty percent of physicians believe IBS resolves after 1--5 years, another 22% believe IBS resolves after 6--12 months, one physician believed IBS resolves in less than 6 months, while 42% (SD = 25.45, range 5--100%) believe IBS patients never resolve their IBS symptoms. ", "Most physicians believed IBS patients spend \\$100--500 USD (40%) or \\$500--1000 USD (38%) in out-of-pocket medical expenses over the course of their illness. ", "Table 3Impacts to IBS patient Quality of Life provided by general physician survey respondents (*N* = 50), July, 2019DimensionQuality of Life ImpactSocial• \"Unable to socialize due to fear of unexpected diarrhea\"• \"Frequent trips to the bathroom and limiting their social life\"• \"Afraid to travel, afraid to go out with friends or family, afraid to go to public events\"• \"Can't work, can't go on trips, have to know where all bathrooms are, can't do activities outdoors\"• \"Reduced social activities due to bathroom needs\"Employment• \"Loss of employment/number of sick days\"• \"Not being able to hold down a job\"• \"Missing work, or unable to keep appointments due to symptoms of IBS\"• \"They plan a Saturday to take laxatives and stay by the toilet or they know where every bathroom is on the drive from one place to the next; they don't want to leave the house or go out to eat\"Mental Health• \"Hesitation to participate in social functions, decreased confidence\"• \"Anxiety. ", "Depression\"• \"Afraid to leave home\"• \"Anxiety, fear of eating out, fear of dining, embarrassment\"• \"Constant awareness of where a bathroom is\"• \"Absence from work, Social Withdrawal, Social Isolation.\"", "\n\nFinally, 60% of physicians agreed that they would use a user-friendly risk score that would help them predict whether a patient would develop PI-IBS. ", "Among the formats available, physicians said they would be most likely to use a printout with a risk score (36%), a website with a risk score calculator (30%), or a phone application with a risk score calculator and informational materials for their patient (28%).", "\n\nDiscussion {#Sec4}\n==========\n\nThis study is the first to identify interesting and relevant descriptions to PCP and GP knowledge and treatment of PI-IBS. ", "Overall, we found a wide range of understanding of which common foodborne pathogens can lead to functional gastrointestinal disorders such as PI-IBS. ", "Awareness of PI-IBS as a phenomenon is present in a majority, but less than half of the physicians surveyed would discuss this as a possible outcome in their infectious GI patients. ", "Given the known frequency of PI-IBS after GI infections, universal discussion with the patient of chronic consequences may be important.", "\n\nThe estimate that 42% of new IBS diagnoses are suspected to have a post-infectious etiology is higher than has been previously reported \\[[@CR2]\\]. ", "It may be that as awareness of PI-IBS among physicians has grown, more providers are taking detailed histories of antecedent acute GI illness and identifying a higher proportion of patients with such a trigger. ", "Alternatively, the sample selection may have been biased or the survey design led respondents to inflate estimates of an infectious trigger. ", "While most physicians agreed that knowing a patient had a previously diagnosed foodborne infection would change the way they approached treatment of their patients IBS, we did not ask how it would change their approach or how often they find a result. ", "Given that there are no targeted therapies for PI-IBS at this time, we expect treatment should not change from IBS recommendations. ", "However, it is possible that the time from diagnosis to treatment for the patients IBS may be shorter as there would be less diagnostic work-up to rule out potential etiologies.", "\n\nIn our survey, physicians frequently prescribed a probiotic for therapy. ", "This management approach is not consistent with current guidelines for practice. ", "The American College of Gastroenterology guidelines give the following recommendation, \"We suggest probiotics, taken as a group, to improve global symptoms, as well as bloating and flatulence in IBS patients. (", "Recommendation: weak; Quality of evidence: low)\". ", "Similarly, the Canadian Association of Gastroenterology states, \"We suggest offering IBS patients probiotics to improve IBS symptoms (GRADE: Conditional recommendation, low-quality evidence)\" \\[[@CR10]\\]. ", "While these recommendations don't discourage use of probiotics, we are unsure why there is an observed practice variation between current practice guidelines and reported practice of this sample population. ", "It is possible that patients are driving demand for probiotics based on their review and awareness of medical information from online sources and marketing. ", "Most probiotics are OTC and, thus, it could be that while physicians did not recall them as often in the list of common medications they prescribe (as seen in our results for Table [2](#Tab2){ref-type=\"table\"}) physicians are supportive in recommending OTC probiotics for therapy when patients ask. ", "In any case, given the lack of evidence for probiotics in the effectiveness of IBS therapy \\[[@CR11]\\] physicians may not be fully helping their patients to avoid the excess costs (most often out of pocket) associated with therapies that lack proven effectiveness.", "\n\nInterestingly, the estimate that roughly 4 out of 10 patients who develop PI-IBS will continue to have symptoms throughout their life is an important observation. ", "Reported literature have only followed up subjects for up to 8 years \\[[@CR12]\\]. ", "To determine the prevalence of PI-IBS among Walkerton Health Study participants, 28.3% (*n* = 210) of patients enrolled into the PI-IBS cohort reported the condition after 2--3 years. ", "At the 8-year follow-up, the overall prevalence within the cohort dropped to 15.4%, but over 50% of those diagnosed at year 2--3 were still symptomatic at year 8. ", "These findings are consistent with the estimates given in this survey. ", "While there exist no studies that have estimated the lifelong impact of PI-IBS, for some, IBS remains a chronic condition.", "\n\nIn addition to management, this survey focused on providers' assessment of the functional impact associated with PI-IBS. ", "While there may be cognitive bias (e.g. physicians will often focus on the more severe patients as representative of the general population of patients), the sample respondents describe significant impacts for the PI-IBS patient populations they manage. ", "Because quantitative techniques may not be feasible in measuring symptom management, quality of life assessments remain an imperative aspect in follow up care among this patient population. ", "In this sense, physicians will be able to gain a better understanding of treatment efficacy based on quality of life discussions prior to and during the treatment course. ", "Buono et al. ", "\\[[@CR13]\\] found that patients with IBS-D reported significantly lower health-related quality of life than controls; these findings are consistent with our response from physicians. ", "For example, physicians from our survey estimated an average loss of 10 h per week in their patients suffering from IBS, and also noted multiple employment-based impacts on quality of life due to their symptoms (Table [3](#Tab3){ref-type=\"table\"}). ", "Buono et al. ", "\\[[@CR14]\\] found IBS-D patients had a 20.7% productivity loss compared to controls and had a significant daily activity impairment (29.5%) whereas Tack et al. ", "\\[[@CR15]\\] found those with IBS-C had a 27.7--51.5% productivity loss and an overall daily activity impairment from 36.4--56.8%.", " By discussing baseline symptoms and impacts on quality of life and subsequently comparing original answers to those after starting the treatment course, physicians can more easily recognize whether treatment is alleviating or aggregating symptoms \\[[@CR16]\\].", "\n\nIn addition to an assessment of psychological and social impacts on patient life, it is important to address the economic burden incurred due to this chronic disease. ", "The physicians in our survey estimated the average patient incurs \\$100--500 USD (40%) or \\$500--1000 USD (38%) in out-of-pocket expenses during the course of their illness which can be a significant financial burden for some. ", "Buono et al. ", "\\[[@CR14]\\] demonstrated a significant economic burden associated with IBS-D in a US population, however they did not estimate out of pocket medical expenses in this population. ", "These estimates could also vary widely given a patients insurance coverage, even if only considering the range of coverage for the recommended medications the survey participants noted. ", "Together, these descriptions describe PI-IBS as a condition with significant economic and societal burden for which improved diagnostics, preventive strategies and effective treatments are sorely needed.", "\n\nWhile no physicians initially prescribed antidepressant medication, 9% of the medications listed are nerve pain medication or antidepressants, SSRIs, or SNRIs. ", "The American College of Gastroenterology recommends tricyclic anti-depressants (TCAs) for overall symptom improvement in IBS patients with a strong recommendation and high quality of evidence \\[[@CR11]\\]. ", "In addition, SSRIs are recommended for overall symptom improvement in IBS patients though with a weak recommendation, and low quality of evidence. ", "TCAs and SSRIs have effects on central pain and psychological distress and may also impact bowel function by improving diarrhea by slowing GI transit (TCAs), and ameliorating constipation by accelerating GI transit (SSRIs) \\[[@CR17], [@CR18]\\].", "\n\nWhile we did not ask physicians if they were aware of any current risk scores for PI-IBS \\[[@CR19]\\] or how using a risk score would change their current practice, the finding that the majority of physicians would use a risk score if available is promising. ", "However previous studies have shown that PCPs are not aware of these tools and do not use them \\[[@CR6], [@CR7]\\]. ", "This is understandable, given there is only one risk score currently published \\[[@CR19]\\], and only one study that has used the score in a different patient population \\[[@CR20]\\]. ", "Future research in this area should focus on how existing or newly developed risk scores change current practice, diagnostic strategies, or patient outcomes for treatment of PI-IBS.", "\n\nStrengths & Limitations {#Sec5}\n-----------------------\n\nThis survey contributes to the literature about treatment and management of PI-IBS as no previous literature has focused on physician knowledge and treatment of PI-IBS. ", "The small sample size is a noted limitation which likely affects the precision and generalizability of the estimates we described. ", "Additionally we did not include nurse practitioners or physician assistants which are often \"frontline\" providers for treatment of IBS. ", "Finally, after reviewing the wording of some of the questions in the survey, it is possible that some physicians responded to the questions given how they \"should\" approach a treatment or diagnostic step rather than what they actually do in their practice.", "\n\nConclusion {#Sec6}\n==========\n\nThese data need to be validated with larger systematic and representative surveys as well as direct patient surveys among those diagnosed with a high probability of PI-IBS. ", "Furthermore, the current literature lacks estimates specifically for health utility/QALY impacts of PI-IBS specifically and these should be an immediate priority for future survey research.", "\n\nPCPs\n\n: Primary care physicians\n\nPI-IBS\n\n: Post-infectious Irritable Bowel Syndrome\n\nIBS\n\n: Irritable Bowel Syndrome\n\nGPs\n\n: General practitioners\n\nSD\n\n: Standard deviation\n\nIQR\n\n: Interquartile range\n\nQALY\n\n: Quality-Adjusted Life Years\n\nTCAs\n\n: Tricyclic anti-depressants\n\nSNRI\n\n: Serotonin or norepinephrine reuptake inhibitors\n\nSSRI\n\n: Selective Serotonin Reuptake Inhibitor\n\n**Publisher's Note**\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.", "\n\nNot applicable.", "\n\nEA was the major contributor in writing the manuscript, assisted in questionnaire design and study design, and analyzed the results. ", "KS assisted in writing the manuscript and helped develop figures and Tables. ", "JF and LB assisted in questionnaire development, manuscript writing, and interpretation of the results for clinical practice. ", "MR was the senior gastroenterologist for the paper, providing guidance and contributed significantly to the manuscript writing. ", "KPB was the principal investigator for this study, contributed to the manuscript writing, analysis and interpretation of results, and overall design. ", "All authors read and approved the final manuscript.", "\n\nThis work was supported by the United States Food and Drug Administration \\[FDA Grant Number HHSF223201710181P\\]. ", "The funders provided expert guidance on development of the questionnaire and study design.", "\n\nThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.", "\n\nThe University of Arizona Institutional Review Board reviewed this project and determined that the research is considered exempt human subjects research.", "\n\nNot applicable.", "\n\nAuthor Mark Riddle is an Associate Editor of this journal.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.012618296529968454, 0.009216589861751152, 0.03125, 0.017391304347826087, 0.005405405405405406, 0.00684931506849315, 0.018518518518518517, 0.025, 0.00819672131147541, 0, 0, 0.007407407407407408, 0.008, 0, 0.002403846153846154, 0, 0.017361111111111112, 0, 0.008849557522123894, 0, 0.013888888888888888, 0, 0, 0, 0.007407407407407408, 0, 0.02142857142857143, 0, 0, 0.007751937984496124, 0, 0.00641025641025641, 0.022727272727272728, 0, 0, 0.008583690987124463, 0.004132231404958678, 0.024869109947643978, 0.0022675736961451248, 0.0031446540880503146, 0, 0.0051813471502590676, 0, 0.012987012987012988, 0.011111111111111112, 0.0064516129032258064, 0, 0.007575757575757576, 0, 0.010526315789473684, 0, 0.005988023952095809, 0.0041841004184100415, 0.00819672131147541, 0, 0.01485148514851485, 0.004343105320304018, 0, 0, 0.01834862385321101, 0.02197802197802198, 0.006329113924050633, 0.0030864197530864196, 0.009950248756218905, 0.006578947368421052, 0, 0.00641025641025641, 0.006666666666666667, 0.005494505494505495, 0.014705882352941176, 0.013333333333333334, 0.009478672985781991, 0, 0.003968253968253968, 0.015151515151515152, 0.005649717514124294, 0, 0, 0.009523809523809525, 0, 0.01951219512195122, 0, 0, 0, 0.007575757575757576, 0.006060606060606061, 0.012195121951219513, 0.016304347826086956, 0, 0, 0.01639344262295082, 0.008130081300813009, 0.003937007874015748, 0, 0, 0, 0.01092896174863388, 0.004016064257028112, 0, 0.0125, 0.015503875968992248, 0.0038461538461538464, 0, 0, 0, 0.011235955056179775, 0, 0.0049261083743842365, 0, 0.014634146341463415, 0.006802721088435374, 0.01639344262295082, 0.007692307692307693, 0.017391304347826087, 0.01098901098901099, 0.0055248618784530384, 0.008771929824561403, 0, 0.007352941176470588, 0, 0.0048543689320388345, 0.010582010582010581, 0.007380073800738007, 0, 0.007407407407407408, 0.012987012987012988, 0.007936507936507936, 0, 0, 0, 0.008620689655172414, 0, 0, 0.0064516129032258064, 0, 0.016666666666666666, 0 ]

[ "103 F.3d 144\nNOTICE: Although citation of unpublished opinions remains unfavored, unpublished opinions may now be cited if the opinion has persuasive value on a material issue, and a copy is attached to the citing document or, if cited in oral argument, copies are furnished to the Court and all parties. ", " See General Order of November 29, 1993, suspending 10th Cir. ", "Rule 36.3 until December 31, 1995, or further order.", "\nRonald Dean LOWE, Plaintiff-Appellant,v.Wesley GIBSON; Rust Eddy, Defendants-Appellees.", "\nNo. ", "96-6217.(D.C.No. ", "96-CV-729-L)\nUnited States Court of Appeals, Tenth Circuit.", "\nDec. 13, 1996.", "\n\nBefore SEYMOUR, KELLY and LUCERO, Circuit Judges.", "\n\n\n1\nORDER AND JUDGMENT*\n\n\n2\nPlaintiff, a state prisoner, filed this 42 U.S.C. § 1983 action alleging a denial of adequate medical care when he was a pretrial detainee. ", " He named as defendants two employees of the Oklahoma Indigent Defense System (OIDS): Rust Eddy, an OIDS investigator, and Wesley Gibson, an OIDS attorney. ", " Plaintiff alleges that he never received medical and neurological exams that were prescribed in Eddy's presence. ", " The magistrate judge recommended dismissing the complaint as frivolous, pursuant to 28 U.S.C. § 1915, because plaintiff failed to allege that defendants had any duty to monitor plaintiff's medical care or were otherwise involved in the purported denial of care. ", " The district court adopted the magistrate judge's report and recommendation. ", " We review the § 1915 dismissal for abuse of discretion. ", " Denton v. Hernandez, 504 U.S. 25, 33 (1992). ", " We affirm.", "\n\n\n3\nPlaintiff claims the district court erred by: (1) denying his recusal motion; (2) failing to construe his complaint liberally; (3) dismissing his case before the complaint had been amended or served; and (4) ruling that he failed to state a nonfrivolous claim. ", " Plaintiff's recusal motion asked the district and magistrate judges to whom his case had been assigned to recuse themselves on account of their previous denial of his habeas petition. ", " The motion alleged that the district and magistrate judges \"deliberately and maliciously confused\" the record in another proceeding so as to deny him habeas relief. ", " R. doc. ", "7 at 1.", "\n\n\n4\nWe find no abuse of discretion, Nichols v. Alley, 71 F.3d 347, 350 (10th Cir.1995), in the denial of the recusal motion. ", " A judge's prior rulings rarely provide valid grounds for recusal. ", " See Liteky v. United States, 510 U.S. 540, 555 (1994); see also Lopez v. Behles (In re American Ready Mix, Inc.), 14 F.3d 1497, 1501 (10th Cir.1994) (\"Adverse rulings alone are insufficient grounds for disqualification.\"). ", " Prior rulings or opinions \"do not constitute a basis for a bias or partiality motion unless they display a deep-seated favoritism or antagonism that would make fair judgment impossible.\" ", " Liteky, 510 U.S. at 555. ", " Nothing in the record suggests that the district or magistrate judge displayed such favoritism or antagonism. ", " Plaintiff's allegations of bias are unsupported. ", " See In re American Ready Mix, Inc., 14 F.3d at 1501 (\"A judge should not recuse ... on unsupported, irrational, or highly tenuous speculation.\" ", " (quotation omitted)).", "\n\n\n5\nWe also reject plaintiff's remaining arguments. ", " It is well settled that 28 U.S.C. § 1915 authorizes the dismissal of a complaint filed in forma pauperis if the action is frivolous. ", " See Neitzke v. Williams, 490 U.S. 319, 324 (1989). ", " Such dismissals frequently occur before the complaint has been served on defendants. ", " Id. A frivolous complaint is one based on an \"indisputably meritless legal theory\" or \"clearly baseless\" facts. ", " Id. at 327.", "\n\n\n6\nEven liberally construing plaintiff's complaint, see Haines v. Kerner, 404 U.S. 519, 520-21 (1972), it is evident that his claim against the OIDS employees for inadequate medical care lacks an arguable legal basis. ", " We affirm the § 1915 dismissal substantially for the reasons stated by the magistrate judge and adopted by the district court.", "\n\n\n7\nAFFIRMED.", "\n\n\n\n*\n The case is unanimously ordered submitted without oral argument pursuant to Fed. ", " R.App. ", "P. 34(a) and 10th Cir. ", " R. 34.1.9. ", " This order and judgment is not binding precedent, except under the doctrines of law of the case, res judicata, and collateral estoppel. ", " The court generally disfavors the citation of orders and judgments; nevertheless, an order and judgment may be cited under the terms and conditions of 10th Cir. ", " R. 36.3\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0032679738562091504, 0, 0, 0.0449438202247191, 0, 0, 0.03389830508474576, 0, 0.058823529411764705, 0, 0.012738853503184714, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0, 0.008888888888888889, 0, 0, 0, 0, 0.006896551724137931, 0, 0, 0, 0.019230769230769232, 0, 0, 0, 0, 0, 0, 0.011363636363636364, 0, 0, 0, 0, 0, 0 ]

[ "Complete sequence of p53 gene in 20 patients with lung cancer: comparison with chemosensitivity and immunohistochemistry.", "\nIn this study the entire p53 complementary DNA has been sequenced in 20 non-small cell lung carcinomas (NSCLC) and the results correlated with chemosensitivity, immunohistochemistry and clinical data. ", "Ten patients had mutations in p53, 8 missense mutations and 2 nonsense mutations. ", "The method discovered two mutations never described previously and two other mutations that have never been described before in connection with NSCLC tumours. ", "Chemosensitivity data, according to a short-term assay (FMCA), indicated that tumours with p53 mutation were more resistant to cisplatin and cyclophosphamide. ", "Immunohistochemical studied demonstrated a 70% concordance between over-expression of p53 protein and mutation in p53. ", "No conclusions or trends could be drawn from the immunohistochemical studies of Bcl-2 and Bax." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0.0049504950495049506, 0, 0.006289308176100629, 0.006289308176100629, 0, 0.010638297872340425 ]

[ "Q:\n\nAre answers that state \"We Don't Know\" acceptable?", "\n\nI know there have been some posts that already state that providing an answer of \"We Don't Know\" can be acceptable provided that the answer still follows the site guidelines of a good answer (i.e. referenced, well reasoned, support from the works).", "\nHowever, I feel it is a good idea to have a \"final\" discussion on the matter with a direct answer. ", "Most of the other posts I found related to a single question and do not address the policy as whole. ", "I am writing this post that get the direct answer so that it can be linked to any further discussions or when new users ask; \nAre We Don't Know Answers Acceptable?", "\n\nA:\n\nYes.", "\nFor many questions, \"we don't know\" is the correct answer - it would be beyond foolish to seek to ban such answers. ", "Of course, a plain \"we don't know\" without saying anything more than those three words would probably make for a bad answer, just like any other unsupported three-word answer. ", "Here are some ideas I once came up with for possible ways to make a \"we don't know\" answer good:\n\nshow your work. ", "Give list of Google queries you used, or resource sites/pages checked, or terms searched in e-books.", "\nlist all the information we do know (\"there's no mention of xyz - the closest is this mention of yxz on page 73\")\ngive some sort of explanation for why it's reasonable that we don't know (\"it wouldn't make sense for them to tell us, because blah blah blah\" or \"people have written fanfic taking xyz in this direction, so it's unlikely to be confirmed as going in that direction anywhere in canon\")\n\nThe basic principle, as with many SE answers, is to back it up if at all possible. ", "Of course it tends to be hard to prove a negative, but any sort of extra knowledge - even just a deep personal experience of the topic - can be helpful. ", "If you say \"I've searched through all the books and also supplementary information on websites X, Y, and Z, and none of them say anything about this\", that's a much more respectable answer than \"dunno, mate\".", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01, 0.002070393374741201, 0, 0, 0 ]

[ "// RUN: llvm-tblgen %s | FileCheck %s\n// XFAIL: vg_leak\n\nclass Base<list<int> v> {\n list<int> values = v;\n}\n\nclass Derived<list<int> v> : Base<!if(!empty(v),[0],v)>;\n\nmulticlass Multi<list<list<list<int>>> v> {\n def ONE : Derived<!if(!empty(v),[]<int>,!if(!empty(!head(v)),[]<int>,v[0][0]))>;\n def TWO : Derived<!if(!empty(v),[]<int>,!if(!empty(!tail(v)),!if(!empty(!head(v)),[]<int>,v[0][0]),v[1][0]))>;\n}\n\ndefm Def : Multi<[[[]],[[1, 2, 3]]]>;\n\n// CHECK: values = [0]\n// CHECK: values = [1, 2, 3]\n" ]

{ "pile_set_name": "Github" }

[ 0.00199203187250996 ]

[ "Please wait...\n\nI have a idea for a mod I would love to see. ", "I would really like a mod that lets you kill the people on virtual voyager and not be sent to the brig. ", "I hope someone can make this mod. ", "Or if you alrready know of one that dose this plz tell me.", "\n\nInteract\n\nAbout\n\nDBolical\n\nGameFront\n\nThe best serving of video game culture, since 1998. ", "Whether you're looking for the biggest collection of PC gaming files on the planet, tools, tips or advice, GameFront has you covered. ", "Browse through over 145,000 mods, maps, tools and more. ", "Game on!" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0.021739130434782608, 0.007462686567164179, 0, 0 ]

[ "Inferring evolutionary rates using serially sampled sequences from several populations.", "\nThe estimation of evolutionary rates from serially sampled sequences has recently been the focus of several studies. ", "In this paper, we extend these analyzes to allow the estimation of a joint rate of substitution, omega, from several evolving populations from which serial samples are drawn. ", "In the case of viruses evolving in different hosts, therapy may halt replication and therefore the accumulation of substitutions in the population. ", "In such cases, it may be that only a proportion, p, of subjects are nonresponders who have viral populations that continue to evolve. ", "We develop two likelihood-based procedures to jointly estimate p and omega, and empirical Bayes' tests of whether an individual should be classified as a responder or nonresponder. ", "An example data set comprising HIV-1 partial envelope sequences from six patients on highly active antiretroviral therapy is analyzed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0, 0, 0, 0.0055248618784530384, 0 ]

[ "Everybody calls Rob Kuntz last, he says. ", "Those who want to know about the history of Dungeons & Dragons start with co-creator Gary Gygax’s kids, one of Gygax’s biographers, or D&D publisher Wizards of the Coast. ", "As they’re wrapping things up, they might get around to dialing up Kuntz, a 63-year-old game designer. ", "And once they call him, he tells them the same thing: Everything they know about the creation of the tabletop role-playing game is, in his opinion, sorely mistaken or flat-out wrong.", "\n\n\n“There’s a myth that’s been propagated in the industry,” Kuntz told Kotaku during an interview in February of this year. “", "If you keep digging into this, you’re going to come up with a story that will enrage people and expose the truth.”", "\n\nA new documentary out last week, Secrets of Blackmoor, attempts to get to the bottom of who really incepted the world of fantasy role-playing. ", "It’s a question that Kotaku has been investigating as well, as part of our ongoing research into the massively popular game, which also resulted in our profile of Gary Gygax’s widow Gail earlier this year and a series of interviews with the first women who worked on D&D.\n\n“Certain questions will open up a shitstorm,” Kuntz said. “", "You’ll peel back the onion to the smelly part.”", "\n\nWhen we first spoke, Kuntz made one thing very clear: He doesn’t buy the story usually told about how Dungeons & Dragons was born, because he was there to witness the reality that was spun into the mythos.", "\n\n\n“We are in a mass delusion that it’s all Gary, that he’s the father of role-playing games,” he said. “", "Humans do not like to admit they’ve been hornswoggled, lied to, cheated, or fooled.”", "\n\nEight million people play Dungeons & Dragons every year. ", "And when they talk about how it all started, the biographers and fanboys and panel speakers and local hobby shop owners and dungeon masters all tell the same tale, the by-the-bootstraps American dream story of Gary Gygax, progenitor of the role-playing tradition, the original dungeon master.", "\n\nRob Kuntz interviewed for Secrets of Blackmoor. ", "Photo : Secrets of Blackmoor\n\nHere’s how the story is usually told: Gygax was an insurance underwriter in Lake Geneva, Wisconsin. ", "As the legend goes, his love for miniature wargames and pulpy Conan The Barbarian novels inspired him to publish a game called Chainmail, a medieval wargame with a fantasy-flavored supplement, in 1971. ", "Soon after, a young Minnesota security guard named Dave Arneson would adopt Chainmail’s ruleset for another fantasy wargame called Blackmoor. ", "The pair would then collaborate to make Dungeons & Dragons, a name Gygax’s daughter Cindy would cutely conjure as she and her siblings ran through D&D’s earliest games. ", "Gygax would whisk up a scrappy little company to sell D&D, and run it until he was unfairly pushed out in 1985 by some suits who didn’t understand his genius. ", "By then, Arneson’s name would have long dropped out of the story, unless the person telling it brought up his lawsuits against Gygax for royalties.", "\n\nGary Gygax died in 2008 at 69. ", "Dave Arneson died a year later, at 61. ", "With both of the celebrated game’s creators gone ten years, it falls to those who were closest to them, like Kuntz, to fill in the gaps around the history—and, in Kuntz’s case, challenge some long-held assumptions about the origin story of D&D. He’d witnessed the great creation first-hand. ", "He was there, and has come to know the power of the Gygax legend better than almost anyone. ", "After all, Gygax had welcomed him into his family in October, 1968, when he was 13.", "\n\n\nKuntz’s mother had suffered a nervous breakdown and was institutionalized. ", "His older brother Terry was already in foster care. ", "At 13, he found himself living alone in Lake Geneva, in what had been their family home. ", "Kuntz’s upstairs neighbors would check in on him during the week. ", "On the weekends, his aunt would drive over from seven miles away to attend to him. ", "Living across from the school he attended, Kuntz’ life followed a pattern: school, home, school, home.", "\n\nOne day, he was flipping through a copy of a neighbor’s Playboy magazine when he saw something that captivated his 13-year-old imagination: an advertisement for board games. ", "Around hi s birthday , his aunt took him to the five-and-dime and bought him Afrika Korps, a wargame from Avalon Hill that reenacted the Nazi German forces entering North Africa in the early 1940s. ", "The genre predecessor to Dungeons & Dragons, wargames involved pushing miniatures around a map, measuring bullet spread with rulers, and crafting historically accurate battlegrounds out of sand or fabricated terrain that resembled battlegrounds like Gettysburg or Stalingrad.", "\n\n“We play these games with a group here in town,” Kuntz recalled the store manager telling him when he picked up Afrika Korps. “", "We’re joined by Gary Gygax.”", "\n\n“He was jealous. ", "Just stone-cold jealous.”", "\n\nGygax, then a 30-year-old man with thick glasses and a mustache, ruled the roost when it came to wargaming in Lake Geneva, Wisconsin in 1968. ", "In his basement at 330 Center St., a white, modestly-sized home, Gygax welcomed all sorts of wargaming devotees from all over the midwest. ", "Kuntz, who it turned out lived just a few blocks from Gygax, devoted himself to learning Afrika Korps’ ruleset, and a week later, he would enter Gygax’s home, where the man himself, having heard of the precocious new wargamer from a neighbor, was setting up Afrika Korps.", "\n\n\n“They taught me how to play by watching them,” says Kuntz. “", "I was Gary’s student, co-author, almost adopted by the family.” ", "Gygax and his then wife Mary Jo would invite him to church or bible study, to family meals. ", "Gygax would read manuscripts to Kuntz while he sat on the guest bed in his study. ", "Kuntz was all admiration and gratefulness. ", "In 1969, Gygax wrote the words “ENTRANCE WARGAMES ROOM” on the cellar door leading to the basement. ", "By 1970, Kuntz was at the Gygaxes’ house every day, often staying overnight on the living room couch.", "\n\n“Role-playing games first began in 1971,” says Dave Arneson, a chubby-cheeked Minnesotan with a wry smile and a grey beard, in footage from 2009 that opens the Secrets of Blackmoor documentary. ", "Speaking in a tone that sounds bored and a little defensive, he sits at the front of a classroom, atop the teacher’s desk, bouncing his legs off the back. “", "Don’t ask me why I know that because I’m the one who did it,” he says. “", "Backed up by court documents. ", "Thank you.”", "\n\n\n\nIn the 1960s, Arneson, a University of Minnesota history major and part-time security guard, was part of a gaming group in the state’s Twin Cities area that operated more like a 2010 tech startup than a hobbyist clique. ", "Just for kicks, they riffed on each other’s hard-headed wargaming rulesets and very seriously playtested the results, sometimes publishing their thoughts in periodicals and hobbyist magazines. ", "If the ideas of “innovation” and “iteration” hadn’t been so co-opted by corporations today, Arneson’s little gaming group may have been more deeply inked into the history of Dungeons & Dragons.", "\n\nFinding like-minded folks through ads in the classified section of wargaming fanzines, Arneson assembled his own gaming group. ", "They’d meet at his parents’ St. Paul home and marvel at his huge number of painted gaming miniatures, which his father had bought for him, his only child, according to Secrets of Blackmoor. ", "Taking bits and pieces of Avalon Hill games and sprinkling them with their own flavors, the Twin Cities gamers were entrenched in the Napoleonic wargaming tradition, but not particularly to its ubiquitous “rules lawyers,” a term Arneson would later use with derision to describe the sorts of people who would passionately litigate games’ rules in lieu of actually playing. ", "Instead, Arneson’s group appointed “referees” for their games to adjudicate anything that happened covered or not covered by the rules.", "\n\nA school photo of Dave Arneson. ", "Image : Secrets of Blackmoor ( Dave Arneson Archive, curated by Paul Stormberg )\n\n\nOne of Arneson’s buddies, a U.S. Army Reserves major named David Wesely, invented a game in 1968 called Braunstein, where two forces met in the Napoleonic town of that name. ", "Braunstein advanced the wargaming format in multiple ways that echo the design of modern D&D by actually requiring a referee. ", "And instead of having them play as an entire faceless army, it asked players to create and take up the roles of individual characters, maybe a town mayor or a protesting student. ", "Once, Arneson and a teammate, in-game allies who did not get along together in real life, told Wesley that they were going to duel. ", "Wesley, surprised and game, came up with dueling mechanics on the fly to accommodate, according to Secrets of Blackmoor.", "\n\n“This was the first kernel of role-playing games,” Paul Stormberg, a role-playing game archivist, told Kotaku. ", "Stormberg, a former archaeologist, now spends his days digging into the work of Arneson, Gygax, and other lesser-known deities of the RPG tradition. ", "He said that the Twin Cities crew became very attached not only to Braunstein, but also to the individual commander that they created for the game. ", "They wanted to evade situations where their beloved avatars faced death, or find ways to express themselves, or other, more heroic selves, while playing. ", "That, of course, led to them going a little off-book.", "\n\n“This guy Dave had a couple ideas, Gary saw what he was doing and was a genius, and figured out how to make it 20 times better. ", "That’s the narrative.”", "\n\nBraunstein got the Twin Cities crew’s fluids going, inspiring them to develop their own games with similar gameplay attributes. ", "One of the players, Duane Jenkins, designed Brown Stone, a riff on Braunstein set in Texas. ", "But it’s the game that Arneson designed after Braunstein that changed everything.", "\n\n“Dave took a left turn when everyone else was turning right,” said Stormberg. “", "Blackmoor.”", "\n\n\n“Arneson start[ed] this process of creating systems to handle what’s happening in the game, no matter what the players want[ed] to try,” Stormberg said. “", "Nowadays, when a dungeon master runs a game and a player says, ‘I try to jump a pit,’ the dungeon master says, ‘You have a 3 in 6 chance. ", "Roll the dice.’ ", "The system doesn’t exist in the game—they made something up. ", "That’s the genius breakthrough of role-playing.” ", "Stormberg defines role-playing as “playing a character that isn’t you and has different abilities from you, facing an ongoing set of circumstances or environments entirely defined by the game master.”", "\n\nThis, says Robert Kuntz, is where the narrative momentum picks up—when the rolling snowball of Gygax’s story begins to grow so large that it has eclipsed the truth.", "\n\nGary Gygax and Dave Arneson met at the second annual Gen Con, short for “Geneva Convention.” ", "Today, the board gaming convention attracts over 60,000 attendees to the Indiana Convention Center in Indianapolis. ", "In 1969, it attracted 187 people to Lake Geneva. ", "Arneson and his gaggle of wargaming fiends drove eight hours to get there. ", "Gygax and Arneson discussed their love for Napoleonic wargames, and their theories around wargaming rulesets. ", "Soon after, Gygax and Kuntz would launch their own society for medieval wargaming, known as the Castle & Crusade society. ", "Arneson would become a “Baron” of the society. ", "Gygax was the “Earl of Walworth,” the Wisconsin county in which sits Lake Geneva. ", "Kuntz, still a young teen, was named king.", "\n\n\n\nGygax had recently lost his job as an insurance underwriter. “", "I am working on a couple of board games for semi-commercial sale and trying to get some work in on miniature rules,” he wrote in a 1971 issue of Wargamer’s Newsletter during what he called his “forced vacation.” ", "Gygax was barely making ends meet living on some combination of unemployment compensation and money from repairing shoes. ", "He had five young children and needed cash, and if at all possible, he wanted to make it in the world of tabletop gaming. ", "He just needed something noteworthy to come along, or to make something noteworthy himself.", "\n\nGygax began to edit other aspiring game developers’ rulesets for the publisher Guidon Games on a part-time basis. ", "In the meantime, he began formulating his own: Chainmail, a wargame set in medieval Europe. ", "Players fought with hand axes, morning stars, flails and two-handed swords, resolving scenarios with dice. ", "To hit an opponent, a player had to roll the dice and modify the result based on any number of conditions or factors. ", "Melee combat and long-range combat had separate mechanics. ", "A unit of 20 men was represented by a single figurine.", "\n\n\nGary Gygax at home. ", "Image : The Dreams in Gary’s Basement trailer\n\nLater, Gygax would expand on Chainmail’s ruleset with a fantasy supplement, which injected trappings from Lord of the Rings and Conan the Barbarian into Chainmail’s world. ", "There were wizards, fireballs, elves. ", "There were magic swords and armor. ", "The dragons came in red, white, blue, black, and green varieties. ", "The dungeons would come later, but at the time, were absent. ", "Gygax would call the supplement an “afterthought.” ", "Notably, one-to-one combat was supported; just not the role-playing caprice.", "\n\nChainmail, or more specifically its fantasy supplement, is widely considered to be the prototype of D&D. This is stated in all the books: in the Gygax biography Empire of the Imagination, in the graphic novel Rise of the Dungeon Master: Gary Gygax and the Creation of D&D, and in Playing at the World. ", "It’s stated in the articles, the forum posts, the oral histories. ", "Despite all of this, Chainmail was decidedly not a role-playing game. ", "It wasn’t structured around campaigns. ", "There were no experience points. ", "Characters weren’t acted out, or represented as being anyone other than the player.", "\n\nIn his Minnesota basement games incubator, Arneson ran a game of Chainmail. ", "He loved the medieval setting and the fantasy trappings in the supplement, and played the game consistently for about a month. ", "One day after the game of Chainmail had wound down, Arneson was at rest, binging five monster movies on Creature Feature weekend, gobbling down fistfuls of popcorn, playing with some graph paper, flipping through a Conan book.", "\n\nChainmail, he thought, could make for a solid combat ruleset for a more expansive sort of game, an ongoing one like Braunstein. ", "That restful day, Arneson idly considered bringing Gygax’s new combat ruleset into the developing game tradition he and his friends were carving out: role-playing.", "\n\n\n“There will be a medieval ‘Braunstein’ April 17, 1971, at the home of Dave Arneson from 1300 hrs to 2400 hrs with refreshments being available on the usual basis,” Arneson advertised in his wargaming group’s small-circulation newsletter, Corner of the Table Top. “", "It will feature mythical creatures and a Poker game under the Troll’s bridge between sunup and sundown.”", "\n\nPlayers took novice characters—“flunkies” in their terms—and implanted them in Blackmoor, a medieval setting of Arneson’s own invention. ", "Arneson’s map of the town perfectly resembles an early Dungeons & Dragons map, with roads and wilderness that eventually give way to a central, barricaded town. ", "Giants roaming the land would send the players scrambling for the safety of the town. ", "Later, there would be evil wizards and castles and gold, dungeon exploration mechanics. ", "Chainmail’s armor class and hit point mechanics, Stormberg says, Arneson expanded on to fit Blackmoor’s gameplay.", "\n\nAccording to Secrets of Blackmoor, on that April day in 1971, Arneson gathered his friends around his ping-pong table, on which he often taped down a layer of brown paper maps. ", "What transpired there, three years before the creation of Dungeons & Dragons, could very well have been the first-ever session of a fantasy tabletop role-playing game. ", "There were no complicated miniature armies, no rulers, no graph paper. ", "It was dice and imagination. ", "Arneson played the “referee,” like the one in the rules of Braunstein, who conjured descriptions of what the players saw. ", "For the most part, the game existed in Arneson’s head.", "\n\nDave Arneson’s friends gaming on his ping pong table. ", "Photo : Secrets of Blackmoor ( Dave Arneson Archive curated by Paul Stormberg )\n\nOne player was the king of Portugal, another a merchant. ", "A third player, Mike Carr, took on the role of “personality coordinator” to manage the game’s burgeoning role-playing elements. ", "Arneson even wrote up a Blackmoor Gazette and Rumormonger one-sheet newspaper to keep players and hangers-on up to date on the latest in-game news.", "\n\n\nSometimes, a player would come upon a magical item, which would remain attached to their character across sessions. ", "Characters’ stats included brains, strength, credibility, courage, sex, health, and looks. ", "Over time, these improved with the characters’ various activities. “", "Further tables and charts were then made to take into account player progress and experience,” Arneson wrote in Wargamer. “", "With these charts each player increased their ability in a given area by engaging in activity in that area. ", "For a fighter that means that by killing opponents (normal types or monsters), their ability to strike an opponent and avoid the latter’s blows was increased.”", "\n\nWith the release of Secrets of Blackmoor last week, documentarian Griffith Morgan is pushing back against the popular narrative that Gary Gygax was the primary figure behind the creation of what we know today as the tabletop role-playing game, “the mythology that Gary Gygax created everything,” as he told Kotaku.", "\n\n“People turn it into a thing,” Morgan said. “", "This guy Dave had a couple ideas, Gary saw what he was doing and was a genius, and figured out how to make it 20 times better. ", "That’s the narrative. ", "Actually, they were working on this role-playing thing for 10 years before Gary was even there. ", "He came in late 1972. ", "He still [didn’t] know how to do it until early 1973.”", "\n\nThe cover of Empire of the Imagination, a biography of Gary Gygax. ", "Image : Michael Witwer, author\n\nRegardless, for years after D&D’s mainstream explosion into popular culture, Gygax would refer to Blackmoor as Arneson’s “amended Chainmail fantasy campaign,” or more simply, “a Chainmail game.”", "\n\n\n“People think that Blackmoor arose from Chainmail, and thus Chainmail gave rise to Dungeons & Dragons. ", "That is not correct,” said Stormberg, the RPG historian. ", "While Chainmail, amongst other things, was an influence on Blackmoor, Arneson’s game was “entirely new,” he said. “", "It’s a game entirely unlike Chainmail. ", "It’s like saying a Rodin uses red and a Picasso uses red so they’re the same style of painting.”", "\n\n“There should have been throngs of worshipers bestrewing his lap with rose petals, or a shaft of light from the Fifth Heaven, or an honor guard of bugbears.”", "\n\nBy this time, Rob Kuntz was busy with the Lake Geneva Tactical Studies Association, which put on weekly games, and the Castle & Crusades society. “", "I was a great dismay to many girlfriends,” Kuntz said. “", "I missed the normal teen episodes with all that had happened to me and that was happening around me.” ", "Arneson submitted an article to the Castle & Crusade Society’s newsletter, offering a top-down view of Blackmoor. ", "He described the game’s underground caves, in which “the Elfs and Dwarves make their homes along with several unclassified inhabitants and denizens of darker places.”", "\n\nDave Arneson’s Basement circa 1971. ", "Dave Arneson’s role-playing group, consisting of Bill Hoyt, Duane Jenkins, Pete Gaylord, David Megarry et al. ", "Photo by Arneson. ", "Photo : Dave Arneson ( Dave Arneson Archive, curated by Paul Stormberg )\n\n“Dave described this fantasy medieval campaign he was running,” Stormberg said. “", "To express it to Gary, he expressed it as a variant to Chainmail, when in fact it was a completely new concept in gaming with some elements of Chainmail laid overtop it. ", "The underlying concept of a role-playing game is what Dave Arneson created.”", "\n\n\n\n\nNot mindful of the language of product sales, of intellectual property, Arneson apparently wanted to share his innovation with a likeminded, and well-connected, new friend. ", "He and Gygax had already collaborated on another game, a Napoleonic naval battle ruleset called Don’t Give Up the Ship, and curious about the campaign and its ruleset, Gygax invited Arneson and one member of his gaming crew, David Megarry, who had designed the adventure board game Dungeon, to his Lake Geneva basement to demonstrate Blackmoor. ", "To get there, they drove through a snowstorm in November of 1972. ", "Megarry and Arneson arrived to find Mary Jo Gygax clearing away the dinner plates while Gary sat at the typewriter, Kuntz recalled. ", "Rob Kuntz was there, too, and joined them as the sixth player in Gygax’s first game of Blackmoor, alongside his brother Terry, Gary Gygax, his son Ernie, Arneson, and Megarry.", "\n\nA dispatch from Blackmoor. ", "Photo : Secrets of Blackmoor ( Dave Arneson )\n\n“Arneson set up his 3-ring binder as a screen between us and him,” wrote Kuntz in an unpublished work called A Tale of Two Daves, Two Gygaxʼs and Two Kuntzʼs, which he shared with Kotaku. “", "He noted that Dave Megarry, a regular in his game, would be our guide for the adventure. ", "Megarry did most of the interfacing and explaining what it was we were about to do with imaginary characters. ", "Arneson noted that we could be either heroes or wizards. ", "Gary chose to be a wizard and the rest of us heroes.”", "\n\nKuntz continued, explaining how players received no rules and no maps. ", "Mostly, it was Arneson rolling the six-sided die behind his binder. “", "Arneson controlled everything behind the scenes with a screen and told us what he saw,” Kuntz said.", "\n\n“Arneson described a typical medieval inn and an affable innkeeper who served us; and he also warned us from starting any trouble in his establishment as its patrons were a quiet and simple folk. ", "We all had drinks and checked out the surroundings. ", "A little into this I informed Arneson that my character (we had no names, so it was Garyʼs character, Robʼs, etc.) ", "was stepping outside to get some air.”", "\n\n\n“Arneson said, ‘Okay. ", "You come back in.’ ", "I was confused while thinking that he had understood that I stepped out and got air and then, later, came back in. ", "I questioned this and he clarified by noting that when I stepped through the entryway that I indeed found myself walking back into the inn. ", "Magic! ", "I had never exited the inn. ", "We all caught onto the problem at once. ", "We were trapped! ", "Megarry and Arneson either smiled or snickered as we realized what ‘Come Back Inn’ really meant.”", "\n\nEventually, the group figured out how to escape the Come Back Inn. ", "Kuntz went on to describe how the adventure continued, with Megarry playing guide, leading them into a castle, an encounter with some humorous magical elves, and then a battle with a troll.", "\n\n“Until Gary Gygax gets a hold of it, it can’t be shared with the masses.", "\n\n“After a brief struggle the five of us overcame it and Megarry started looking for treasure,” Kuntz said. “", "Here was encountered another aspect which we all take for granted today but which was foreign to us then. ", "To vanquish an opponent was not new to us due to our grounding in wargames. ", "But that the opponent could have treasure that we might immediately secure and use, well, this was a novel concept.” ", "The group found a magical sword that could grant wishes. ", "Megarry suggested the group keep the sword for the future.", "\n\nThe foursome played Blackmoor long into the night. ", "Arneson and Megarry crashed on the couch, leaving at 9 a.m. the next morning. ", "At 9:15, Kuntz said, Gygax called him up. “‘", "I want you to come over. ", "We need to discuss what we just experienced with Arneson,’” Kuntz said Gygax told him.", "\n\n\nAs Kuntz tells it, Gygax had taken out some paper and colored pencils. ", "They sat together at his dining room table. “", "I really believe what we experienced the night before can be turned into a game for creating stories,” Kuntz recalls Gygax saying. “", "Be the adjudicator. ", "I’ll be the player.” ", "Gygax and Kuntz ran through two one-hour sessions of Blackmoor, but as Kuntz recalled it, neither game proceeded to their satisfaction. ", "Kuntz believes it is because Arneson had been running Blackmoor for months now and had been able to furnish players with an immersive experience from repetition and recollection. ", "Regardless, Kuntz describes himself as the first “dungeon master.”", "\n\n\n\nKuntz remembers Gygax writing down his own recollections from the Blackmoor game in a frenzy. ", "He remembers when Gygax later asked Arneson to send over his notes for Blackmoor. ", "Arneson didn’t have a concrete ruleset; he was making things up as he went along. ", "But, Kuntz said, he did manage to cobble together 18 pages of handwritten notes, a lot of which were simply stats for Chainmail monsters.", "\n\n\n\nArneson, who referred to himself as a “hunt and peck typist,” wasn’t much for polished rulesets. “", "The game was in Dave’s mind, in practice with his home players. ", "It didn’t exist as a full-blown set of rules,” said Stormberg. “", "It was a eureka moment for Gary.”", "\n\nGygax read through Arneson’s notes. “", "Halfway through the reading,” Kuntz said, “Gary… nonchalantly said, ‘This needs to be rewritten.’ ", "Not one nice thing to say about Dave, the adventure the rules. ", "This is when it all switches.”", "\n\n“He was jealous. ", "Just stone-cold jealous.”", "\n\n\nGygax generated his own 50-page manuscript, expanding on Arneson’s notes and his own recollections of the game while adding in more concrete mechanics from Chainmail. ", "To make a game system, a publishable game system, he knew he’d have to beef it up and commit it to written language. ", "Gygax wrote what was then called The Fantasy Game, later accepting and integrating some notes from Arneson. ", "At the time, the D20 could be purchased from a school supply company in Palo Alto, California; it was suggested for use in the wargame Tractics. ", "According to Stormberg, Gygax thought they’d be useful mathematical models for combat, adding that he wanted an impetus to sell the dice, too. ", "The spell system was inspired by Jack Vance’s book The Dying Earth. ", "The trolls, from Poul Anderson’s book Three Hearts and Three Lions. ", "The character alignment system, from the novels of Michael Moorcock.", "\n\nPaul Stormberg displaying original “character sheets” from the Dungeons & Dragons prototype. ", "Photo : Cecilia D’Anastasio (Kotaku\n\nJust as the mythos of D&D is inexorably bound with the mythos of Gygax, Gygax’s own favored mythoi colored and shaded in the borders of D&D’s fantasy world. “", "Gary wove this ecology of fantasy creatures into this fantasy world, which is integral to Dungeons & Dragons—rust monsters, gelatinous cubes,” said Stormberg. “", "The ecosystem of D&D is by Gary. ", "If Gary had loved Westerns, for example, the whole role-playing game could have been turned into a shoot-em-up Western scenario.” ", "Gygax designed the original castle for Dungeons & Dragons, Castle Greyhawk, furnished with towers and an evil archmage.", "\n\n\n\nPlayers, including Gygax’s young children, scrawled out attributes on note cards. ", "They’d fight kobolds, giant centipedes, and scorpions as persistent fantasy characters in a persistent fantasy world. ", "Kuntz was co-dungeon master of the original Greyhawk game, which involved “constant expansion and reiteration and experimenting with Arneson’s architecture,” he said—“fast and furious, trying to let no stone go unturned.” “", "In the end it was proven that Dave’s concept was infinite,” Kuntz said, meaning that “applied imagination has no boundaries.”", "\n\n“Gary at this point is wanting to desperately latch onto some sort of game to make himself a success,” said Stormberg. “", "He really sees the potential in this and latches onto the idea to make it into something that can be shared. ", "As it is, it’s something that can be enjoyed when Dave runs a game for his friends. ", "But until Gary Gygax gets a hold of it, it can’t be shared with the masses.”", "\n\n\n“It was intuited and put together by the genius Arneson, like a mad alchemist,” said Kuntz. “", "If there’s any good thing you could say about Gary, you could say he knew when to move on a good idea and had the wherewithal to make it happen.”", "\n\nWargaming publishers Guidon Games and Avalon Hill considered Dungeons & Dragons too weird, too open-ended, but Arneson and Gygax knew they had something. ", "In 1973, Gygax and his Lake Geneva friend Don Kaye founded their own company Tactical Studies Rules, or TSR, to publish Dungeons & Dragons. ", "Gygax would become the editor and co-founder. ", "Arneson was creative director. ", "Kuntz, then still a teenager, wanted to be a designer. ", "Instead he was titled a “chairman” of the company, but said that functionally he was the director of shipping.", "\n\nIn 1974, 1,000 copies of the first D&D box set would go on sale for $10 each. ", "It was called Dungeons & Dragons: Rules for Fantastic Medieval Wargames Campaigns Playable with Paper and Pencil and Miniature Figurines. ", "The front cover credited the game to both Gygax and Arneson. ", "Gygax’s deep focus on wargaming had seeped into the role-playing game architecture that Arneson had engineered. ", "TSR would publish David Megarry’s board game Dungeon, too.", "\n\nAn original D&D set in its woodgrain box, sold on Ebay in 2016 for $22,000. ", "Photo : EditorJan_1 ( Ebay\n\n“It was very much a case of me providing various ideas and concepts but not having any say as to how they were used,” Arneson would later write in Different Worlds, a gaming magazine. ", "He says he was not consulted on several aspects of the final, public D&D product. ", "But Arneson subtly credits himself for the mechanic that made D&D not only the start of the role-playing game industry but also the inspiration for video games like Final Fantasy and The Legend of Zelda. ", "He wrote in Different Worlds of D&D’s success in 1979, the same year the game grossed $2 million for TSR: “Why did it catch on so quickly? ", "Because it offered almost pure escapism and the ability, in the game, to do anything and everything you wanted to do! ", "Gads! ", "Who wouldn’t get hooked on game playing nirvana like that after years of charts, tables, painting figures, etc.”", "\n\n\nArneson would work at TSR for just 11 months. ", "If he produced any manuscripts there, their existence, and the reasons they were not published, remains unknown, although in 1975, a 60-page Blackmoor supplement was produced for D&D. During this time, he was credited on an article about naval combat in World War II for a wargaming magazine, the introductory text for the game Valley Forge, and some work on a board game called Lankmhar. ", "In the meantime, Arneson may have served as a content broker between the heady and productive Minnesota crowd and TSR’s Lake Geneva headquarters. ", "At some point during his brief tenure, Arneson was demoted from creative director to research director.", "\n\nRobert Kuntz has written a dense text called Dave Arneson’s True Genius. ", "There, and in interviews, he describes the moment when his relationship with Gygax, who had been his beneficent father figure, who had given him dinners, religious study, a job and a calling, changed forever.", "\n\nIt was an early stockholder’s meeting. ", "Dave Megarry said that, to the best of his memory, this meeting was where he and Arneson suggested moving TSR to Minnesota to capitalize on local talent. ", "Gary was not on board. “", "Gary suggested that we poll the department heads present about whether there was misdirection with the company,” said Kuntz.", "\n\nAfter the vote, toward the end of the meeting, Gygax “bolted from his seat,” said Kuntz, and “screamed at the top of his lungs in my face.” ", "Hearing all the complaints and suggestions from various staffers, it seemed, had pushed him over the edge. ", "Today, Kuntz thinks Gygax feared that Melvin Blume, the father of Gygax’s business partner Brian Blume, would be brought on and potentially overtake the company, while Megarry thinks that “Gary thought Arneson and I were trying to take over the company.”", "\n\nFollowing this meeting, a group of TSR employees including Kuntz, his brother, and the Minnesota gang collected themselves at a nearby restaurant. “", "Arneson said very little,” recalled Kuntz. “", "This is the first time I’d seen a grown man crying.”", "\n\n\nMegarry soon resigned. ", "Kuntz wrote a memo to Gygax with his request to be moved to design. ", "He said he got it back a day later with NO! ", "written on it in red ink. ", "He resigned, too. ", "Then his brother Terry, who was managing TSR’s hobby shop, resigned. ", "Then Arneson, who by then had been moved to the shipping department. “", "Some say Gygax dismissed him while others say Arneson resigned after a humiliating demotion and others say that he left in disgust with the stultifying profit-driven atmosphere,” wrote Jon Peterson in his book Playing At The World.", "\n\n“I talked to people who were very informed and knew Gary or knew Gary and Dave,” said Griffith Morgan, the documentarian behind Secrets of Blackmoor. “", "Some of them will take sides. ", "Some will try to not take sides. ", "It gets really complicated. ", "Then there’s a lot of resentment.”", "\n\nDave Arneson in 1982. ", "Photo : Dave Arneson ( Dave Arneson Archive, curated by Paul Stormberg )\n\n“The biggest problem with the whole Dungeons & Dragons thing is the desire to claim ownership for the invention of D&D created a schism between Arneson and Gygax,” Morgan said. ", "The two even ran their own D&D games differently in 1975, Gygax wrote in an issue of Alarums & Excursions. “", "Dave and I disagree on how to handle any number of things, and both of our campaigns differ from the ‘rules’ found in DandD.”\n\nArneson had designed a way to organize the imagination and foster communal storytelling; Gygax had designed a way to ground it in wargaming traditions, package and sell that. ", "Today, the Chainmail-inspired rules Gygax mixed in with D&D’s prototype are quite altered, while Arneson’s initial role-playing conceit, and the variability of rulesets encouraged by his Minnesota friends, is what defines the genre.", "\n\n\nShortly after D&D secured its cultural foothold in the gaming world, Arneson’s name disappeared from the books. ", "TSR was now titling the game Advanced Dungeons & Dragons, calling it a totally separate work, and thus holding that it did not need to pay Arneson any royalties. ", "Arneson disagreed with this, and sued Gygax and TSR in 1979, then again in 1985. ", "In an interview circa 2003 interview with the now-defunct website Dungeons.it, Arneson was asked why his relationship with TSR deteriorated. “", "That happens when people do not pay you,” said Arneson. ", "Arneson and TSR settled out of court.", "\n\nKuntz would go on to college and fall in love. ", "His proclivity for game design, however, never faded. ", "In 1980, he released Deities & Demigods, a lore book for dungeon masters published by TSR. ", "Kuntz would contribute more to Gygax’s Greyhawk around then, too. ", "In 1986, he founded his own game design company, which would publish several adventures in the decades to follow. ", "He claims partial credit on some of D&D’s most defining books, including the Dungeon Masters Guide and the Monster Manual, although he was sometimes uncredited on these works.", "\n\nGary Gygax getting interviewed. ", "Image : The Dreams in Gary’s Basement trailer\n\nIn Dragon magazine editorials, Gygax began writing Arneson out of the history of D&D—at least as anything other than a guy with some good ideas. “", "The idea of measured progression (experience points) and the addition of games taking place in a dungeon maze struck me as being very desirable,” wrote Gygax of Blackmoor in a 1977 editorial. “", "However, that did not really fit into the framework of Chainmail. ", "I asked Dave to please send me his rules additions, for I thought a whole new system should be developed.”", "\n\n“I don’t think it was his plan as a kid, as a young adult, to become some entrepreneurial game designer,” said Malia Arneson, Dave Arneson’s daughter, of her father in Secrets of Blackmoor.", "\n\n\nArneson started a computer company in 1979 and designed a video game called Basic. ", "He continued playing Blackmoor, but with the slow, underground integration of gaming and the budding world of computer technology, also became enamored of the prototypical computer RPGs known as multi-user dungeons or MUDs. ", "He wasn’t much of a fan of the RPG genre that soon sprung up in video games, though. “", "Early role-playing games really were not much about role-playing. ", "Just fighting with different characters that had different weapons. ", "Lame. ", "Today there is more online play,” Arneson said in a 2001 interview, always advocating for imagination and collaboration as true gaming mechanics.", "\n\n“The mechanics don’t matter,” said Secrets of Blackmoor director Morgan. “", "The reason why I know the mechanics don’t matter when you’re looking at the research in roleplaying games is once D&D was released, you end up with a mass of copy games coming out and they all have different mechanics. ", "But they’re all using the thing D&D does, and that’s role-playing.”", "\n\nTo be sure, there would be no Dungeons & Dragons without Gary Gygax. ", "Chainmail is a clear influence for D&D’s famous combat rules, and Gygax’s particular tastes in literature and voracious reading habit helped populate D&D’s world with monsters, gods, and legendary beasts. ", "Gygax saw the potential in Blackmoor, or the aspects of Chainmail it happened to bring out, and moved quickly and purposefully enough to put the idea into a publishable format. ", "But what gets lost is that neither would there be D&D without Dave Arneson. ", "And indeed, the things that D&D fans love the most about the game—the things that distinguish “role-playing” from “fantasy wargaming”—were Arneson’s vision.", "\n\nIn 2009, Arneson lost his battle with cancer. ", "He was 61. ", "Gygax had died a year earlier. ", "In one obituary, role-playing designer Ken Hite recalled his first meeting with Arneson at Gen Con in 1997. ", "It was just after Wizards of the Coast had acquired TSR. “", "He was sitting alone, near the Wizards booth, wearing a badge but otherwise inconspicuous. ", "Certainly, there should have been throngs of worshipers bestrewing his lap with rose petals, or a shaft of light from the Fifth Heaven, or an honor guard of bugbears, or something.”", "\n\nIf Arneson taught gamers anything, it’s that there is room for more than one story. ", "Both reality and fiction are best developed on the open prairie, which others might only witness from the windows of a railroad car. ", "Personalities and histories bend around genius and around legend. ", "Today’s Dungeons & Dragons credits no one on its front cover.", "\n\n\n“It wasn’t a prototype,” Robert Kuntz said of Blackmoor. “", "It was a fully functioning game. ", "Everything’s a prototype if you’re stealing these things. ", "This is the history.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.024390243902439025, 0.023391812865497075, 0, 0, 0.008, 0, 0.006896551724137931, 0.009036144578313253, 0, 0.00966183574879227, 0.009523809523809525, 0, 0.01694915254237288, 0.003424657534246575, 0.04, 0.007692307692307693, 0.009900990099009901, 0.02112676056338028, 0.023668639053254437, 0.012578616352201259, 0.006802721088435374, 0.06060606060606061, 0.02564102564102564, 0, 0, 0.012048192771084338, 0.01282051282051282, 0.019230769230769232, 0, 0, 0, 0.00980392156862745, 0.005681818181818182, 0.005050505050505051, 0.007272727272727273, 0.007751937984496124, 0.03571428571428571, 0, 0, 0, 0.014388489208633094, 0.01107011070110701, 0.015873015873015872, 0.015625, 0.021739130434782608, 0.012195121951219513, 0.023255813953488372, 0.01, 0.009900990099009901, 0.015306122448979591, 0, 0, 0, 0, 0.013392857142857142, 0, 0.010362694300518135, 0.007751937984496124, 0.005263157894736842, 0.005361930294906166, 0.007407407407407408, 0.029411764705882353, 0.023346303501945526, 0.007936507936507936, 0, 0.015151515151515152, 0.016666666666666666, 0.008849557522123894, 0.020134228187919462, 0.006756756756756757, 0, 0, 0.015384615384615385, 0, 0.007692307692307693, 0.021739130434782608, 0.012345679012345678, 0.024691358024691357, 0, 0.006369426751592357, 0, 0, 0, 0, 0, 0.012048192771084338, 0.031578947368421054, 0.008620689655172414, 0, 0.013333333333333334, 0.02727272727272727, 0.01639344262295082, 0.02127659574468085, 0.012195121951219513, 0, 0.015151515151515152, 0.0047169811320754715, 0.00819672131147541, 0, 0, 0.017241379310344827, 0, 0, 0, 0.01694915254237288, 0, 0.043478260869565216, 0.0091324200913242, 0, 0, 0, 0, 0.0196078431372549, 0, 0.003289473684210526, 0, 0.014285714285714285, 0, 0, 0, 0.01282051282051282, 0, 0.017699115044247787, 0, 0.006134969325153374, 0.00749063670411985, 0.019230769230769232, 0.007194244604316547, 0.012422360248447204, 0.011627906976744186, 0, 0.02654867256637168, 0.0111731843575419, 0.005952380952380952, 0, 0, 0.00819672131147541, 0.018518518518518517, 0.017857142857142856, 0.014492753623188406, 0.0078125, 0.013605442176870748, 0, 0, 0, 0.016260162601626018, 0, 0, 0.012658227848101266, 0.02127659574468085, 0.015748031496062992, 0, 0.010416666666666666, 0, 0, 0.014492753623188406, 0.022123893805309734, 0.02830188679245283, 0.03508771929824561, 0.017391304347826087, 0.02564102564102564, 0.020833333333333332, 0, 0.020134228187919462, 0.017857142857142856, 0, 0.02631578947368421, 0, 0.02631578947368421, 0.045454545454545456, 0.05555555555555555, 0.03225806451612903, 0.01764705882352941, 0.013157894736842105, 0.0056179775280898875, 0.017391304347826087, 0, 0.03787878787878788, 0.03428571428571429, 0, 0.012711864406779662, 0.011235955056179775, 0, 0.017543859649122806, 0.018867924528301886, 0.0136986301369863, 0.014492753623188406, 0.020202020202020204, 0, 0, 0.02608695652173913, 0, 0.04, 0, 0, 0, 0.14285714285714285, 0, 0.025, 0, 0.020618556701030927, 0, 0.005291005291005291, 0.013513513513513514, 0.01834862385321101, 0, 0, 0, 0, 0, 0, 0.02564102564102564, 0.045454545454545456, 0, 0.03488372093023256, 0.02702702702702703, 0, 0.015151515151515152, 0, 0, 0.014705882352941176, 0.01675977653631285, 0.015151515151515152, 0.030612244897959183, 0.036585365853658534, 0.012195121951219513, 0.0072992700729927005, 0.00980392156862745, 0.015625, 0.015625, 0.030303030303030304, 0.02564102564102564, 0.02040816326530612, 0.015873015873015872, 0, 0, 0, 0.011764705882352941, 0, 0.009259259259259259, 0.013793103448275862, 0.006993006993006993, 0.014705882352941176, 0.04411764705882353, 0.014705882352941176, 0.021052631578947368, 0.015384615384615385, 0.01875, 0.06060606060606061, 0.015384615384615385, 0.025210084033613446, 0.011627906976744186, 0, 0.004484304932735426, 0.016, 0.01639344262295082, 0, 0.011904761904761904, 0.013157894736842105, 0.010416666666666666, 0.006896551724137931, 0.03205128205128205, 0.02857142857142857, 0.021739130434782608, 0.03225806451612903, 0, 0, 0.0125, 0.007246376811594203, 0.03278688524590164, 0.017857142857142856, 0.034482758620689655, 0.02564102564102564, 0.014150943396226415, 0.012195121951219513, 0.0196078431372549, 0.014388489208633094, 0, 0, 0, 0.02040816326530612, 0, 0.0136986301369863, 0.009708737864077669, 0.02666666666666667, 0.004807692307692308, 0, 0.012987012987012988, 0.041666666666666664, 0.008064516129032258, 0.014084507042253521, 0, 0.027559055118110236, 0, 0.022727272727272728, 0, 0.038461538461538464, 0.014705882352941176, 0, 0, 0, 0.014492753623188406, 0.014285714285714285, 0.012987012987012988, 0.032679738562091505, 0, 0, 0, 0, 0.041666666666666664, 0.03187250996015936, 0.027777777777777776, 0.013245033112582781, 0.01293103448275862, 0.017391304347826087, 0.012345679012345678, 0.024691358024691357, 0.007042253521126761, 0.017857142857142856, 0.02702702702702703, 0.02040816326530612, 0, 0.01098901098901099, 0.015151515151515152, 0, 0.017142857142857144, 0.029411764705882353, 0.015544041450777202, 0.0051813471502590676, 0, 0.009433962264150943, 0.015706806282722512, 0.011627906976744186, 0.004464285714285714, 0.011627906976744186, 0, 0, 0, 0.006896551724137931, 0.02631578947368421, 0.0045662100456621, 0.014925373134328358, 0.028169014084507043, 0.014634146341463415, 0.005649717514124294, 0.02631578947368421, 0.01282051282051282, 0.020833333333333332, 0, 0.03225806451612903, 0.027777777777777776, 0.017241379310344827, 0.01098901098901099, 0, 0.011627906976744186, 0, 0, 0.01639344262295082, 0.03278688524590164, 0, 0.017241379310344827, 0 ]

[ "// Copyright (c) 2012, the Dart project authors. ", " Please see the AUTHORS file\n// for details. ", "All rights reserved. ", "Use of this source code is governed by a\n// BSD-style license that can be found in the LICENSE file.", "\n//\n// Test creating a large number of socket connections.", "\nlibrary ServerTest;\n\nimport \"package:expect/expect.dart\";\nimport \"package:async_helper/async_helper.dart\";\nimport \"dart:async\";\nimport \"dart:io\";\nimport \"dart:isolate\";\npart \"testing_server.dart\";\n\nconst CONNECTIONS = 200;\n\nclass SocketManyConnectionsTest {\n\n SocketManyConnectionsTest.start()\n : _connections = 0,\n _sockets = new List<Socket>(CONNECTIONS) {\n initialize();\n }\n\n void run() {\n\n void connectHandler() {\n _connections++;\n if (_connections == CONNECTIONS) {\n for (int i = 0; i < CONNECTIONS; i++) {\n _sockets[i].destroy();\n }\n close();\n }\n }\n\n for (int i = 0; i < CONNECTIONS; i++) {\n Socket.connect(TestingServer.", "HOST, _port).then((socket) {\n Expect.isNotNull(socket);\n _sockets[i] = socket;\n connectHandler();\n });\n }\n }\n\n void initialize() {\n var receivePort = new ReceivePort();\n var remote = Isolate.spawn(startTestServer, receivePort.sendPort);\n receivePort.first.then((msg) {\n this._port = msg[0];\n this._closeSendPort = msg[1];\n run();\n });\n }\n\n void close() {\n _closeSendPort.send(null);\n asyncEnd();\n }\n\n int _port;\n SendPort _closeSendPort;\n List<Socket> _sockets;\n int _connections;\n}\n\n\nvoid startTestServer(SendPort replyPort) {\n var server = new TestServer();\n server.init().then((port) {\n replyPort.send([port, server.closeSendPort]);\n });\n}\n\nclass TestServer extends TestingServer {\n\n void onConnection(Socket connection) {\n Socket _client;\n\n void closeHandler() {\n connection.close();\n }\n\n void errorHandler(e, trace) {\n String msg = \"Socket error $e\";\n if (trace !", "= null) msg += \"\\nStackTrace: $trace\";\n print(msg);\n connection.close();\n }\n\n _connections++;\n connection.listen(\n (data) {},\n onDone: closeHandler,\n onError: errorHandler);\n }\n\n int _connections = 0;\n}\n\nmain() {\n asyncStart();\n SocketManyConnectionsTest test = new SocketManyConnectionsTest.start();\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.02040816326530612, 0, 0, 0.01, 0, 0.0070921985815602835, 0.007194244604316547, 0.005763688760806916 ]

[ "Q:\n\nIs Clojure considered Lispy or Schemey?", "\n\nPossible Duplicate:\nIs Clojure closer to Scheme or Common Lisp from a beginner's perspective? ", "\n\nClojure is a Lisp dialect that runs on the JVM.", "\nIs Clojure considered Lispy or Schemey?", "\nI mean is it like Lisp or like Scheme?", "\n\nA:\n\nIf by \"Lispy\" you mean \"like Common Lisp,\" then...\nClojure is \"Lispy\" because it has full (nonhygienic) macros and doesn't guarantee tail-call optimization (except with recur).", "\nClojure is \"Schemey\" because it has a single namespace for both functions and values (it is a Lisp-1).", "\n\nA:\n\nLisp has mainly two meanings:\n\nLisp is a family of programming language, starting with the original Lisp in 1958.", "\n\nIn this sense Scheme, Clojure, Emacs Lisp, Common Lisp, Logo, ... are all somewhat 'Lispy'.", "\n\nLisp is a family of language with one main branch: Lisp, Lisp 1.5, MacLisp, Lisp Machine Lisp, Common Lisp.", "\n\nOne can see that it is possible to run decades old Lisp code with very few changes in Common Lisp.", "\nIn this view, neither Scheme nor Clojure are particular 'Lispy', since they are widely incompatible with the 'main branch' and with the historic Lisp.", "\nClojure is a new Lisp dialect that is mostly incompatible with all other Lisps and also with the historic Lisp. ", "Names of functionality, identifiers, syntax, etc. ", "are all different. ", "In my view it is as far from CL as it is from Scheme.", "\n\nA:\n\nWhen people say \"Schemey\" they tend to mean \"Lisp-1\" vs. \"Lisp-2\", which is historically the distinction. ", "Clojure is schemey in that fashion. ", "\nBut beyond those, Clojure is stylistically more like very modern lisp sensibilities. ", "Probably the most notable predecessor to clojure in this modern style is Arc. ", "If anything, Clojure is arc-ish: it prefers constructs with reduced nesting depth (see clojure and arc let vs. common lisp or scheme let); both are distinct runtimes nested within larger, more generic interpreter runtimes that give a larger library for free; and both value brevity in names as opposed to the insanely long names in the common lisp spec (e.g., multiple-value-bind). ", "\nClojure is arc-ish.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.06976744186046512, 0.020833333333333332, 0.02040816326530612, 0.075, 0, 0.01098901098901099, 0, 0, 0.053763440860215055, 0.01834862385321101, 0.01, 0.013245033112582781, 0.008849557522123894, 0.02, 0, 0.018867924528301886, 0.008928571428571428, 0.027777777777777776, 0.011627906976744186, 0.01282051282051282, 0.002617801047120419, 0, 0 ]

[ "Q:\n\nWhy is this \"Press Enter to Continue\" code in C++ not working?", "\n\nSo, I was making a simple quiz program for kids in C++ (I am really a beginner to programming). ", "What I wanted to do was require the user to press Enter after the first question and only upon pressing enter, the second question is visible. ", "But due to some reasons, C++ doesn't waits for the user to enter an output in the cin statement and automatically prints the next question.", "\nHere's the code:\ncout << \"Q1. ", "Which of these languages is not used to make Computer Software?\" ", "<< endl;\ncout << \"a. Python\" << endl;\ncout << \"b. Java\" << endl;\ncout << \"c. C++\" << endl;\ncout << \"d. HTML\" << endl;\ncout << \"\" << endl;\ncin >> ans;\ncout << \"\" << endl;\ncout << \"Press Enter to Continue\";\ncin.ignore();\n\nA:\n\nYou may have already entered \"enter\" after providing some data for ans. ", "In that case, the cin.ignore() will read the \"enter\" and immediately return. ", "Therefore, you would want another cin.ignore() for wait for another \"enter\".", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0.007194244604316547, 0, 0.015384615384615385, 0, 0, 0, 0 ]

[ "Q:\n\nretrieve stored shared preference value from another page with flutter_settings_screen\n\nim using this plugin flutter_settings_screen but cant figured out how to get a stored value from another page. ", "im supposed to use Settings.getValue<bool>('key_wifi', false) to retrieve the key_wifi from \"AppSettings\" page\nthis is the full simple code i work on:\n\nimport 'package:draft/app_settings.dart';\r\nimport 'package:flutter/material.dart';\r\nimport 'package:flutter_settings_screens/flutter_settings_screens.dart';\r\n\r\nfinal bool isWifiEnabled = Settings.getValue<bool>('key_wifi', false);\r\n\r\nvoid main() {\r\n initSettings();\r\n runApp(MyApp());\r\n}\r\n\r\nvoid initSettings() {\r\n SharePreferenceCache spCache = SharePreferenceCache()\r\n ..init();\r\n Settings.init(cacheProvider: spCache);\r\n}\r\n\r\nclass MyApp extends StatelessWidget {\r\n @override\r\n Widget build(BuildContext context) {\r\n return MyHomePage(title: 'Flutter Demo Home Page');\r\n }\r\n}\r\n\r\nclass MyHomePage extends StatefulWidget {\r\n final String title;\r\n\r\n const MyHomePage({Key key, this.title}) : super(key: key);\r\n\r\n @override\r\n _MyHomePageState createState() => _MyHomePageState();\r\n}\r\n\r\nclass _MyHomePageState extends State<MyHomePage> {\r\n @override\r\n Widget build(BuildContext context) {\r\n return MaterialApp(\r\n title: 'App Settings Demo',\r\n theme: ThemeData.dark(),\r\n home: Scaffold(\r\n appBar: AppBar(\r\n title: Text(widget.title),\r\n ),\r\n body: Center(\r\n child: Column(\r\n children: <Widget>[\r\n isWifiEnabled? ", "Text(\"Wifi is ON\") : Text(\"Wifi is OFF\"),\r\n RaisedButton(\r\n child: Text(\"Open Settings\"),\r\n onPressed: () {\r\n Navigator.push(context, MaterialPageRoute(\r\n builder: (context) => AppSettings()));\r\n },\r\n ),\r\n ],\r\n ),\r\n ),\r\n ),\r\n );\r\n }\r\n}\r\n\r\nclass AppSettings extends StatefulWidget {\r\n @override\r\n _AppSettingsState createState() => _AppSettingsState();\r\n}\r\n\r\nString keywifi = 'keywifi';\r\n\r\nclass _AppSettingsState extends State<AppSettings> {\r\n\r\n final bool isWifiEnabled = Settings.getValue<bool>(keywifi, false);\r\n\r\n @override\r\n Widget build(BuildContext context) {\r\n return Container(\r\n child: SettingsScreen(\r\n title: \"Application Settings\",\r\n children: [\r\n SettingsGroup(\r\n title: 'Single Choice Settings',\r\n children: <Widget>[\r\n SwitchSettingsTile(\r\n settingKey: 'key_wifi',\r\n title: 'Wi-Fi',\r\n enabledLabel: 'Enabled',\r\n disabledLabel: 'Disabled',\r\n leading: Icon(Icons.wifi),\r\n onChange: (value) {\r\n debugPrint('keywifi: $value');\r\n },\r\n ),\r\n ],\r\n ),\r\n ],\r\n ),\r\n );\r\n }\r\n}\n\nA:\n\nYou can copy paste run full code below \nStep 1: You need to await initSettings() \nStep 2: You need to await spCache.init();\nFuture<void> initSettings() async {\n SharePreferenceCache spCache = SharePreferenceCache();\n await spCache.init();\n await Settings.init(cacheProvider: spCache);\n }\n\nStep 3: Use Settings.getValue diretcly\nSettings.getValue<bool>('key_wifi', false)\n ? ", "Text(\"Wifi is ON\")\n : Text(\"Wifi is OFF\"),\n\nStep 4: await Navigator.push and setState\nonPressed: () async {\n await Navigator.push(context,\n MaterialPageRoute(builder: (context) => AppSettings()));\n setState(() {});\n\nStep 5: typo String keywifi = 'keywifi'; change 'keywifi' to 'key_wifi'\nworking demo\n\nfull code\n//import 'package:draft/app_settings.dart';\nimport 'package:flutter/material.dart';\nimport 'package:flutter_settings_screens/flutter_settings_screens.dart';\n\n//final bool isWifiEnabled = Settings.getValue<bool>('key_wifi', false) ?? ", "false;\n\nFuture<void> main() async {\n await initSettings();\n\n runApp(MyApp());\n}\n\nFuture<void> initSettings() async {\n SharePreferenceCache spCache = SharePreferenceCache();\n await spCache.init();\n await Settings.init(cacheProvider: spCache);\n}\n\nclass MyApp extends StatelessWidget {\n @override\n Widget build(BuildContext context) {\n return MaterialApp(\n title: 'App Settings Demo',\n theme: ThemeData.dark(),\n home: MyHomePage(title: 'Flutter Demo Home Page'));\n }\n}\n\nclass MyHomePage extends StatefulWidget {\n final String title;\n\n const MyHomePage({Key key, this.title}) : super(key: key);\n\n @override\n _MyHomePageState createState() => _MyHomePageState();\n}\n\nclass _MyHomePageState extends State<MyHomePage> {\n @override\n Widget build(BuildContext context) {\n return Scaffold(\n appBar: AppBar(\n title: Text(widget.title),\n ),\n body: Center(\n child: Column(\n children: <Widget>[\n Settings.getValue<bool>('key_wifi', false)\n ? ", "Text(\"Wifi is ON\")\n : Text(\"Wifi is OFF\"),\n RaisedButton(\n child: Text(\"Open Settings\"),\n onPressed: () async {\n await Navigator.push(context,\n MaterialPageRoute(builder: (context) => AppSettings()));\n setState(() {});\n },\n ),\n ],\n ),\n ),\n );\n }\n}\n\nclass AppSettings extends StatefulWidget {\n @override\n _AppSettingsState createState() => _AppSettingsState();\n}\n\nString keywifi = 'key_wifi';\n\nclass _AppSettingsState extends State<AppSettings> {\n final bool isWifiEnabled = Settings.getValue<bool>(keywifi, false);\n @override\n Widget build(BuildContext context) {\n return Container(\n child: SettingsScreen(\n title: \"Application Settings\",\n children: [\n SettingsGroup(\n title: 'Single Choice Settings',\n children: <Widget>[\n SwitchSettingsTile(\n settingKey: 'key_wifi',\n title: 'Wi-Fi',\n enabledLabel: 'Enabled',\n disabledLabel: 'Disabled',\n leading: Icon(Icons.wifi),\n onChange: (value) {\n debugPrint('keywifi: $value');\n },\n ),\n ],\n ),\n ],\n ),\n );\n }\n}\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.008830022075055188, 0.005073280721533258, 0.006568144499178982, 0.009689922480620155, 0.007423904974016332 ]

[ "The schedule is out and the discussion can really begin. ", "Time to start breaking down the 49ers 2011 schedule. ", "I'll have my own breakdown in the coming days. ", "For now I just wanted to get the schedule up. ", "The schedule features two true prime time games including Thanksgiving against Baltimore and MNF in December against PIttsburgh. ", "Additionally, the 49ers will face the Seattle Seahawks on Saturday afternoon. ", "That's not technically \"primetime\" but it is sort of a featured game since few games will be played that day.", "\n\nThe 49ers open their second straight season against the Seattle Seahawks, although we certainly hope it goes better than last year. ", "And in terms of divisional games, this is the first time since 2006 that the 49ers and Cardinals weren't a prime time matchup. ", "They have usually played entertaining games, but maybe the NFL just decided it wasn't worth it anymore.", "\n\nFeel free to pick apart the schedule after the jump. ", "All times PACIFIC.", "\n\nWeek 1: vs Seattle Seahawks - Sunday September 11, 1:15pm FOX\n\nWeek 2: vs. Dallas Cowboys - Sunday September 18, 1:05pm FOX\n\nWeek 3: @ Cincinnati Bengals - Sunday September 25, 10:00am FOX\n\nWeek 4: @ Philadelphia Eagles - Sunday October 2, 10:00am FOX\n\nWeek 5: vs. Tampa Bay Buccaneers - Sunday October 9, 1:05pm FOX\n\nWeek 6: @ Detroit Lions - Sunday October 16, 10:00am FOX\n\nWeek 7: BYE\n\nWeek 8: vs. Cleveland Browns - Sunday October 30, 1:15pm CBS\n\nWeek 9: @ Washington Redskins - Sunday November 6, 10:00am FOX\n\nWeek 10: vs. New York Giants - Sunday November 13, 1:15pm FOX\n\nWeek 11: vs. Arizona Cardinals - Sunday November 20, 1:05pm FOX\n\nWeek 12: @ Baltimore Ravens - Thursday November 24, 5:20pm NFLN\n\nWeek 13: vs. St. Louis Rams - Sunday December 4, 1:15pm FOX\n\nWeek 14: @ Arizona Cardinals - Sunday December 11, 1:05pm FOX\n\nWeek 15: vs. Pittsburgh Steelers - Monday December 19, 5:30pm ESPN\n\nWeek 16: @ Seattle Seahawks - Saturday December 24, 1:15pm FOX\n\nWeek 17: @ St. Louis Rams - Sunday January 1, 10:00am FOX" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0.007751937984496124, 0.01282051282051282, 0, 0.007462686567164179, 0.007874015748031496, 0.009708737864077669, 0, 0, 0.021505376344086023 ]

[ "Louis Schwitzer Award\n\nThe Louis Schwitzer Award is presented annually to an engineer, or a team of engineers, for excellence in the design, development and implementation of new, innovative motorsports technology concepts for use in the Indianapolis 500 Mile Race. ", " The focus of this award is on those concepts that improve the performance, safety, or energy efficiency of racing cars, related components and systems, or driver and race track support equipment.", "\n\nAward details\nThe award has been presented annually since 1967 by the Indiana Section SAE International in honor of early racing pioneer and past Indiana Section Chairman Louis Schwitzer, winner of the first race at the Indianapolis Motor Speedway.", "\n\nEach year prior to the running of the Indianapolis 500 Mile Race, a committee of Indiana Section SAE International members meets with technical representatives of the IndyCar Series to identify potential candidates for the award. ", " The committee then interviews those candidates and selects a winner. ", " Award sponsor BorgWarner provides a $10,000 cash prize to the winner, and the winner's name is added to a permanent trophy on display at the Indianapolis Motor Speedway Hall of Fame Museum.", "\n\nAmong the many previous award winners are the developers of the revolutionary safety devices the HANS device and the SAFER barrier.", "\n\nPast recipients\n\nSee also\n\n List of motor vehicle awards\nPACE Award\n\nReferences\n\nCategory:Indianapolis 500\nCategory:Motor vehicle awards\nCategory:BorgWarner" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0037593984962406013, 0, 0.012, 0.004310344827586207, 0, 0.010526315789473684, 0.015037593984962405, 0.006329113924050633 ]

[ "Glenwood Springs on Colorado’s Western Slope last week became the seventh U.S. city — and the second in the state — to be 100 percent powered by renewable energy.", "\n\nEvery home, business and street light in the resort city of almost 10,000 people will be fully powered by energy from wind and hydroelectric resources.", "\n\nOfficials from the Municipal Energy Agency of Nebraska, which has supplied bulk power to Glenwood Springs since 2012, signed a contract with the city on Wednesday afternoon at Glenwood Caverns Adventure Park.", "\n\n“What initiated this was much like if you have a free agent in basketball or football, you want to lock up that free agent before they hit the open market,” Glenwood Springs Mayor Jonathan Godes said. “", "The MEAN contract was up in a couple years.”", "\n\nGlenwood’s renewable energy will primarily be generated by wind power from MEAN’s stations on the Eastern Plains. ", "Western Area Power Administration will supply a shade under 7 percent of the power from hydroelectric power, according to a story by Matthew Bennett in the Glenwood Springs Post Independent.", "\n\nAspen was the first Colorado city to have its electricity be solely from renewables. ", "Its mix is roughly 50 percent wind, 45 percent hydropower and 5 percent from solar and landfill gas, according to information provided by The Sierra Club.", "\n\nThe goal of Glenwood Springs was to use 100 percent renewable energy without raising the rates. ", "In fact, the cost of wholesale energy to the city, Godes said, will be lowered by half a million dollars a year.", "\n\n“Three to four years ago it would not have been (possible) without the city paying a significant premium to achieve that,” the mayor said. “", "Wind turbines and solar panels have advanced greatly (since Aspen went 100 percent renewable in 2015). ", "Because of the ability to negotiate a contract and with the technology, it fell into our lap. ", "We started asking the question, ‘What would it take to get us to 100 percent?’ ", "It was desired by everybody but was surprising with the speed with which it came.”", "\n\nThe site of last week’s contract signing, Glenwood Caverns Adventure Park, is one of the first theme parks in the country to use 100 percent renewable energy to power its 12 rides and a new gondola.", "\n\n“Glenwood Caverns in general has always taken a stance on the environment,” said owner Steve Beckley, who opened the park with his wife, Jeanne, in May 1999 after the couple moved from Denver. “", "We’re on the forefront of sustainability and protecting the environment.”", "\n\nThe caverns aren’t just for tourists. ", "There are organisms that live deep inside the caves that are an essential part of the environment that Beckley is trying to preserve.", "\n\nThe site has airtight doors and is a constant 52 degrees Fahrenheit with 90 percent humidity, said Beckley, who graduated from the Colorado School of Mines with a petroleum engineering degree. ", "Computers monitor those levels every 20 minutes to ensure an environment that houses pseudoscorpions, springtail insects and millipedes is well maintained.", "\n\n“This was such a win for Glenwood,” Godes said. “", "Our economy is driven by tourism. ", "Why not invest in a community that’s on the cutting edge? ", "It’s also a wake-up call for city and staff of what else we could do.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.006172839506172839, 0, 0.009523809523809525, 0.004901960784313725, 0.022727272727272728, 0.008620689655172414, 0.010526315789473684, 0, 0.006493506493506494, 0, 0, 0, 0, 0, 0, 0, 0.005, 0.015306122448979591, 0, 0, 0, 0.010256410256410256, 0, 0.0196078431372549, 0, 0, 0 ]

[ "Q:\n\nWPF Validation not fired\n\nI have a simple textbox and a button on a WPF form. ", "When I click the button an OpenFolderDialog opens and I choose a folder. ", "That SelectedPath is then shown in the textbox. ", "This all works fine.", "\nThen I decided I wanted validation on the textbox to check if the directory exists, because you can just paste some path in the textbox too.", "\nWhen my program starts the textbox shows a red border around it because the validation sees an empty textbox. ", "For now I can live with that.", "\nThere are two problems:\n\n When I select a valid folder through the dialog, the PropertyChnged is fired, but is null and thus the validation never runs and the red border is still shown.", "\n When I just paste a valid directory in it, nothing is fired at all and the red border is still shown.", "\n\nWhat am I doing wrong?", "\nBelow my code. ", "I'm new to WPF so I appreciate every help I can get.", "\n<TextBox Grid.", "ColumnSpan=\"2\" Grid.", "Row=\"1\" x:Name=\"textBoxFolder\" Margin=\"2,4\">\n <TextBox.", "Text>\n <Binding Path=\"this.", "MovieFolder\" UpdateSourceTrigger=\"PropertyChanged\">\n <Binding.", "ValidationRules>\n <!-- ", " Validation rule set to run when binding target is updated. --", ">\n <Rules:MandatoryInputRule ValidatesOnTargetUpdated=\"True\" />\n </Binding.", "ValidationRules>\n </Binding>\n </TextBox.", "Text>\n</TextBox>\n\nAnd here is my c# code:\npublic partial class MainWindow : Window, INotifyPropertyChanged\n{\n private string _movieFolder;\n public string MovieFolder\n {\n get { return _movieFolder; }\n set\n {\n _movieFolder = value;\n OnNotifyPropertyChanged(\"MovieFolder\");\n }\n }\n\n public MainWindow()\n {\n InitializeComponent();\n //textBoxFolder.", "DataContext = MovieFolder;\n\n }\n\n public event PropertyChangedEventHandler PropertyChanged;\n private void OnNotifyPropertyChanged(string propertyName)\n {\n if (PropertyChanged !", "= null)\n {\n PropertyChanged(this, new PropertyChangedEventArgs(propertyName));\n }\n }\n\n private void buttonSearchFolder_Click(object sender, RoutedEventArgs e)\n {\n FolderBrowserDialog folderBrowserDialog = new FolderBrowserDialog();\n folderBrowserDialog.", "ShowDialog();\n\n MovieFolder = folderBrowserDialog.", "SelectedPath;\n textBoxFolder.", "Text = MovieFolder;\n }\n\n private void MenuItemClose_Click(object sender, RoutedEventArgs e)\n {\n this.", "Close();\n }\n\n private void Window_Loaded(object sender, RoutedEventArgs e)\n {\n\n }\n}\n\npublic class MandatoryInputRule : ValidationRule\n{\n public override ValidationResult Validate(object value, CultureInfo cultureInfo)\n {\n if (value !", "= null)\n {\n string input = value as string;\n\n if (Directory.", "Exists(input))\n return new ValidationResult(true, null);\n }\n\n return new ValidationResult(false, \"Not a valid folder.\");", "\n }\n}\n\nA:\n\nYour binding path is just wrong, you can not bind via this (it will look for a property called this). ", "It works as expected if the binding is correct.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.012195121951219513, 0, 0.020833333333333332, 0, 0, 0, 0, 0.005376344086021506, 0, 0, 0, 0, 0, 0.05, 0, 0, 0, 0, 0, 0, 0.022727272727272728, 0.002652519893899204, 0, 0, 0, 0.03125, 0, 0.012396694214876033, 0.0136986301369863, 0, 0, 0, 0 ]

[ " \n# BUTTERCREAM \nONE-TIER WONDERS\n\n## Valeri Valeriano & Christina Ong\n\nwww.stitchcraftcreate.co.uk\n\n# CONTENTS\n\nINTRODUCTION\n\nBUTTERCREAM BASICS\n\nBasic buttercream recipe\n\nColouring\n\nUsing props\n\nStyling your cake board\n\nEquipment\n\nCake recipes\n\nStacking and dowelling\n\nCovering cakes\n\nPiping textures\n\nPiping flowers\n\nUsing wafer paper\n\nMoulds\n\nTHE CAKES\n\nClassic\n\nBroderie Anglaise\n\nCharming Chalkboard\n\nHeavenly Hat Box\n\nArtistic\n\nInspired by Romero Britto\n\nVan Gogh Sunflowers\n\nImpression of Waterlilies\n\nMonochromatic\n\nToile de Jouy\n\nWedgewood Blue\n\nBas Relief\n\nScenic\n\nTotally Tropical\n\nBeach Treasure\n\nCountry Window\n\nRomantic\n\nRibbon Rose Heart\n\nLace Romance\n\nBall of Flowers\n\nRustic\n\nAutumn Wreath\n\nTerrarium\n\nEnchanted Forest Flowers\n\nShabby Chic\n\nVintage Bird Cage\n\nA Pail of Roses\n\nBox of Delights\n\nGeometric\n\nPastel Patchwork\n\nAztec-inspired Chevrons\n\nBlack and White Pinstripe\n\nMetallic\n\nSparkling Sensation\n\nAll Gold\n\nPink Shimmer\n\nEccentric\n\nSteampunk Hat\n\nNicely Sliced\n\nAlice in Wonderland\n\nSuppliers\n\nAbout the authors\n\nThanks\n\n# INTRODUCTION\n\nBack in 2011 when we discovered that butter and icing sugar are not just for spreading on toast and sprinkling on pancakes, we were amazed at the wonders a combination of these two humble ingredients can create. ", "We were instantly obsessed!", "\n\nWe were very certain that we wanted to become cupcake pros and therefore we named ourselves 'Queen of Hearts Specialty Cupcakes, Edible Bouquets and More'. (", "It is the longest company name you could ever imagine, isn't it?). ", "The 'More' referred to the fact that we would make cookies, pies and other small treats, but never really thought of making towering multi-tiered cakes, because we thought anything bigger than a cupcake was just too scary and too stressful.", "\n\nThen one day a friend called us and ordered a birthday cake for herself and, of course, we couldn't say no. ", "We thought that if it didn't turn out right, she would forgive us because we were friends. ", "And so we did it.", "\n\nWe made her an eight-inch square cake (why did we start with square when we could have begun with an easier round cake, right?), ", "with a simple graffiti decoration. ", "She came back to us full of praises... _but_ , with a smiling face, she started to tell us how the celebration went and how, as she was about to blow out the candles, the back part of the cake had fallen off. ", "The frosting CAME OFF! ", "But because she was a friend (thank goodness), she was fine about it and just thought it was funny!", "\n\nThis episode might have confirmed our fear of making any cake bigger than a cupcake, but after hearing her story, instead of being discouraged, we were determined to figure out what went wrong, and make sure it that it didn't happen again. ", "So if you guessed that we did not crumb coat our cake properly, you were right! ", "We didnt even know what crumb coating was! ", "We had just covered the cake with a thick layer of buttercream and decorated straight onto that. ", "Technically, buttercream is heavy and it will not stick to the cake properly unless it's been crumb coated. ", "What happened to us, could happen to you too – but we'd like to help you avoid the mistakes that we made.", "\n\nThat is basically our inspiration for this book. ", "Whenever we look back at our cake-y journey, we can't help but laugh about it. ", "So we thought, we'd make a book that is all about single-tier cakes: starting from the basics, to simple carving and building up to dowelling taller cakes, in addition to giving you over thirty ideas on how to decorate your cake in ten different styles. ", "You may think that it is 'easier' to decorate single-tier cakes but, in fact, there is always a danger of over-decorating, because you wanted to put all your ideas on such a small canvas.", "\n\nIn this book, we don't just help you build up your skills, but we also divide the cake styles into different themes: Shabby Chic, Romantic, Rustic to name just a few. ", "After trying to re-create the projects in the book, please do explore how to mix and match the techniques to come up with your own unique designs. ", "Also try changing the colour palette, for example, if you change the Black & White Pinstripe cake to pastel rainbow stripes or use gradient colours, it could become a soft romantic or a shabby chic-themed cake.", "\n\nThere is more to it than just following our cake projects and so we truly hope that you will want to innovate and develop your own styles too. ", "And when you do, please share them with us because we would love to see them! ", "We hope you enjoy this book.", "\n\nHappy BUTTERCREAM cake decorating!", "\n\n# BUTTERCREAM BASICS\n\n## Basic buttercream recipe\n\nWith this recipe, the one thing you should remember is never over-beat your buttercream. ", "If you do it will become grainy and the edges are likely to 'break' when you pipe your flowers, borders and textures. ", "When you over-beat, you incorporate lots of air in your buttercream, thus, the surface will have holes or 'air-pockets' when you spread it on the cake, making it hard to smooth. ", "This is a 'crusting' buttercream that we developed to suit all climates.", "\n\nA hand-held mixer is not usually as powerful as a stand mixer, so if you are using a hand-held one, make sure you fold your mixture manually first until the ingredients are incorporated. ", "This helps to avoid over-beating as well.", "\n\nWhat is so good about our recipe is that a little less or more of a certain ingredient is fine. ", "So if your buttercream is too stiff, add water or milk. ", "If it is too thin, just add icing (confectioners') sugar. ", "Adjust it as you need to – all in moderation of course. ", "You may use your buttercream straight away to cover and decorate your cakes but if you think it is too soft, we suggest you chill it in the fridge for about an hour, or touch the surface – if it is hard enough, you may take it out of the fridge. ", "DO NOT add more icing sugar just to make it stiff.", "\n\n#### TIP\n\nKeep your buttercream in the refrigerator and store it in an air-tight container or food storage bags. ", "You can freeze it for up to a month, letting it defrost thoroughly at room temperature before use. ", "Do not beat it again in a mixer, just mix it manually. ", "But of course, nothing is better than lovely fresh buttercream!", "\n\n### You will need\n\n * 227g (8oz) butter, room temperature\n * 113g (4oz) medium soft vegetable fat (shortening) (Trex), at room temperature, OR 227g (8oz) of soft spreadable vegetable fat (shortening) (Crisco)\n * 2–3 tsp vanilla essence, or your choice of flavouring\n * 1 tbsp water or milk (omit if you live in a hot country or whenever the temperature is hot)\n * 600g (1lb 5oz) icing (confectioners') sugar, sifted, if you are using medium soft vegetable fat (shortening) OR 750g (1lb 10oz) icing sugar, sifted, if you are using soft spreadable vegetable fat (shortening)\n * Mixer (hand-held or stand mixer)\n * Mixing bowls\n * Spatula\n * Sieve (sifter/strainer)\n * Measuring spoons\n\n**1.** ", "Beat the butter at medium speed until soft and pale (about one to two minutes). ", "Some brands of butter are more yellow in colour, so to make it paler you can increase the beating time to about two to five minutes.", "\n\n**2.** ", "Add the vegetable fat (shortening) and beat for another 20 to 30 seconds or less. ", "Make sure that it is well incorporated and that there are no lumps.", "\n\n**Important note: As soon as you add anything to the butter, you must limit your beating time to 20–30 seconds or even less.**", "\n\n**3.** ", "Add vanilla essence, or your flavour of choice and water, or milk, then beat at medium speed for about 10 to 20 seconds until well incorporated.", "\n\n**4.** ", "Slowly add the sifted icing (confectioners') sugar and beat at medium speed for another 20 to 30 seconds or until everything is combined. ", "You may want to fold the ingredients together manually before beating to avoid puffing clouds of sugar round your kitchen. ", "Make sure you scrape the sides and bottom of your bowl, as well as the blade of your mixer, so you don't miss any lumps of icing sugar.", "\n\n**5.** ", "Lastly, after scraping the bowl, beat again for about 20 to 30 seconds and do not over-mix. ", "This yields a perfect piping consistency of buttercream.", "\n\n#### TIP\n\nYou may add milk but if you do you can only keep your buttercream for two to four days, as milk has a shorter shelf-life. ", "If you use water, you will be able to keep it for longer – about five to ten days. ", "If you find the vegetable shortening does not incorporate well enough to the butter and you see lumps or you think that it is a really hard consistency, in future, beat the vegetable shortening separately first and then proceed as normal.", "\n\n#### Coverage\n\nIf you make the basic buttercream recipe with the amounts given, one batch will yield approximately 1–1.1kg (2lb 71⁄2oz) of buttercream. ", "This will be enough to cover the top, the sides and fill a 20cm (8in) round or square cake depending on the design. ", "This can be your guide to determine how much frosting you need to prepare. ", "If you have any left over, just label it with the date you made it and store it in the fridge.", "\n\n### About vegetable fat, aka shortening\n\nThis is a white solid fat made from vegetable oils, and is usually flavourless or at least bland. ", "You can find it in most supermarkets, next to the butter and margarines. ", "It plays a very important role in our recipe as it helps make our buttercream stable, so you do not need to add too much icing sugar to make a stiff consistency, thus your frosting will have just the right sweetness. ", "It also allows the surface of the decorated cake to 'crust' so it is not too sticky.", "\n\nDifferent brands of vegetable fat (shortening) have different consistencies. ", "If the consistency of your shortening is hard, defrost it in the microwave first to soften and use 113g (4oz). ", "If it is somewhat medium-soft to slightly hard, like Trex, use 113g (4oz) as well. ", "If it is soft and very spreadable, like Crisco, you will have to double the amount to 227g (8oz).", "\n\n## Colouring\n\nColours bring your cake to life, can set a mood, attract attention, or make a statement. ", "Hence, it is important to choose and prepare your tinted buttercream properly. ", "Since this book is all about different themes, it is best to research the perfect colour palette to be able to get the appropriate colours to use per project.", "\n\nWe have highlighted the things you should remember when mixing colours.", "\n\n * Make sure that your buttercream is at room temperature when tinting, so that the colours blend together.", "\n * Add paste colours a little at a time using a clean cocktail stick (toothpick), and never re-use it as it will contaminate the paste. ", "Or tint a small amount of buttercream to create a strong colour, then use that to add to your bigger batch of buttercream so that you can control the strength of colour gradually.", "\n * When tinting buttercream, mix it manually. _", "Do not_ put it into the mixer to blend it even if it is a huge amount because there is a tendency that you will over-beat it.", "\n * Bear in mind that it is normal for buttercream to deepen in colour after a short while, especially with darker colours. ", "Prepare at least two or three hours ahead of time to allow for colour change.", "\n * Prepare more than enough tinted buttercream for big projects. ", "You don't want a part of your cake to be a different colour, do you?", "\n * To lighten the colour add more untinted buttercream, to darken the colour, add more colouring.", "\n * If your buttercream is a little yellowish, you can make it whiter by adding a hint of violet or a whitener, such as Sugarflair Super White. ", "If you are aiming for a light shade, whiten the buttercream first then add the desired colour.", "\n * If the colours that you have made are very bright, you can tone them down by adding a hint of black, brown or violet.", "\n * Food colouring comes as powder, gel or pastes. _", "Do not_ use powder food colour to tint your buttercream directly as it will not dissolve properly. ", "When mixed, it will look as if it is well blended but after a while, the tiny granules will start to dissolve and will show speckles of colours. ", "If this is your only option, we suggest that you dissolve the powder in a very small drop of water, bearing in mind that the more liquid you put in buttercream, the softer it becomes.", "\n * If you are using a liquid food colouring like those in squeeze bottles, it is sometimes hard to control the amount that comes out, especially if you need even less than a drop. ", "You can tint a small amount of buttercream then use that to add colour to your bigger batch, rather than putting colours directly to your buttercream.", "\n * Food colouring pastes and gels come in many different brands and each has a different concentration and yields a different shade. ", "Whatever brand you have locally, you should always try it first in a small batch so as to prevent wasting the buttercream.", "\n\n## Using props\n\nBecause the cakes in this book are single-tier ones they can be quite small, and therefore you do not need to surround them with an elaborate range of props. ", "You can enhance your cake display with the simplest things that you can find at home or even in your garden. ", "For example, you could place a single hibiscus flower beside the cake or scatter a few around it. ", "If you can't find a real one, you could make a paper flower.", "\n\nAlternatively, try wrapping a strip of burlap lace around an empty tin and add your birthday message onto it for a shabby chic theme. ", "Then present the tin together with the cake. ", "We could go on and on about ideas, but what we are simply trying to emphasize here is that adding some props when you set up your cake will show it at its very best.", "\n\n## Styling your cake board\n\nBesides propping, another way to add glamour to your cake is by dressing up your cake boards. ", "This is a blind spot for some, and so often people leave their boards uncovered. ", "Even if your cake is good, if it's poorly presented it may disappoint. ", "Therefore, take it from us, say 'NO' to naked cake boards!", "\n\nYou will see from the projects in this book that we have covered our boards with vinyl sticker paper (a 5m/51⁄2yd roll costs very little and can cover about eight or more 25cm/10in boards), gift wrap, scrapbooking papers, fabrics etc. ", "You can even write a letter or lyrics of your favourite song on a large piece of paper and use that to cover your board. ", "We have also used slate boards, chopping boards and placemats (board and glass types) to replace the usual boards. ", "There are so many inexpensive things that you can use or even create yourself, but balance the cake design with the board and, unless your cake is very plain, don't make everything too elaborate.", "\n\n## Equipment\n\n## Cake recipes\n\n#### Madeira cake\n\nThis recipe makes a nice dense sponge cake that is easy to carve and stack – and it's absolutely delicious! ", "The quantities given below will make a 20cm (8in) round cake.", "\n\n### You will need\n\n * 250g (12oz) unsalted butter\n * 250g (12oz) caster (superfine) sugar\n * 250g (12oz) self-raising (-rising) flour\n * 125g (6oz) plain (all-purpose) flour\n * 5 large eggs\n * 1⁄8tsp salt\n * 2–3tbsp milk\n\n**1.** ", "Pre-heat the oven to 160°C or 325°F. ", "Grease your cake tin, line the base with baking (parchment) paper and grease the paper.", "\n\n**2.** ", "Cream the butter and sugar in a large bowl until light, fluffy and pale. ", "Sift the flours together in a separate bowl.", "\n\n**3.** ", "Beat in the eggs, one at a time, beating the mixture well between each one and adding a tablespoon of flour with the last egg to prevent the mixture curdling.", "\n\n**4.** ", "Gently fold in the flour and salt, with enough milk to give a mixture that falls slowly from the spoon.", "\n\n**5.** ", "Transfer to the lined cake tin and bake for an hour to an hour and a half. ", "When the cake is ready it will be well risen, firm to the touch and a skewer inserted into the centre will come out clean.", "\n\n**6.** ", "Turn it out onto a wire rack to cool completely.", "\n\n#### Chocolate mud cake\n\nThis recipe makes a dense cake that behaves well when you use it for stacking and carving.", "\n\n### You will need\n\n * 250g (9oz) salted butter\n * 250g (9oz) dark or milk chocolate (chopped or broken)\n * 8tsp instant coffee\n * 180ml (61⁄4fl oz) water\n * 150g (51⁄2oz) self-raising (-rising) flour\n * 150g (51⁄2oz) plain (all-purpose) flour\n * 60g (2oz) cocoa powder (unsweetened is best)\n * 1⁄2tsp bicarbonate of soda (baking soda)\n * 500g (17oz) caster (superfine) sugar\n * 5 eggs, lightly beaten\n * 70g (21⁄2oz) vegetable oil\n * 125ml (4fl oz) buttermilk (to make: add one tablespoon lemon juice or white vinegar to one cup of milk and let it sit for 5–10 minutes)\n\n**1.** ", "Preheat your oven to 160°C or 320°F, then grease and line your baking tins.", "\n\n**2.** ", "Combine the butter, water and coffee in a saucepan over heat until they come to a slow boil. ", "Turn off the heat and pour in the chocolate, stirring until it is completely melted. ", "Set aside.", "\n\n**3.** ", "Sift the flours, cocoa powder, sugar and bicarbonate of soda (baking soda) together in a large bowl, and make a well in the centre.", "\n\n**4.** ", "Pour in the eggs, buttermilk, oil and chocolate mixture and stir vigorously with a wooden spoon until there are no lumps.", "\n\n**5.** ", "Pour into your prepared tins and bake for approx 45 minutes for a 15cm (6in) cake or an hour and 15 minutes for a 20cm (8in) cake. ", "Remove the cake from the oven when a skewer inserted in the middle comes out clean.", "\n\n**6.** ", "Allow the cakes to cool completely in the tins before removing them.", "\n\n#### TIP\n\nThese quantities will make a 23 x 7.5cm (9 x 3in) round cake, a 20 x 10cm (8 x 4in) round cake, a 15 x 10cm (6 x 4in) round cake and approx. ", "eight cupcakes, or a 20 x 7.5cm (8 x 3in) square cake.", "\n\n## Stacking and Dowelling\n\nAs your cake becomes taller you must add some structure to support it, to make it sturdy so that it will not collapse. ", "You will need plastic or wooden dowels (or even large plastic straws) inserted properly into the lower layers of the cake, to bear the weight of the cake above and to make sure that each layer does not get squashed and collapse.", "\n\nYou can stack as many as three cake sponges without needing to dowel but as soon as you need to increase the height with more cake sponges, make sure you support the structure with dowels.", "\n\n### You will need\n\n * Four cake sponges of your chosen size\n * Three 1–2mm (1⁄16in) thin cake boards (fairly sturdy but still possible to cut – not cake cards)\n * Cake drum\n * Cake leveller or serrated knife\n * Plastic or wooden dowels\n * Wire cutters or heavy-duty scissors\n * Pencil or pen\n * Glue\n\n#### TIP\n\nTo cut dowels that are exactly the same height as the layer of cake to be dowelled, you can push a dowel right into it from the top until it touches the cake board, then mark the place on the dowel that the top surface of the cake reaches, using a pencil or a pen, then remove the dowel and cut it off at the marked length.", "\n\n**1.** ", "Use a cake leveller or serrated knife to trim the top surface of all the cake sponges to make them level.", "\n\n**2.** ", "Cut the thin boards about 5–10mm (1⁄4– 1⁄2in) bigger than the size of the cake or slightly bigger if you want the buttercream to be thicker. ", "Usually you can use the bottom of the baking tin that you used to bake the cakes as your guide. ", "Glue two thin boards together back to back (with the silver-coating outwards) and insert a dowel through the middle to create a hole. ", "Keep turning the dowel around to make the hole slightly bigger so that it is easier to insert later.", "\n\n**3.** ", "Place the first two cake sponges on the third thin board, filling between them with buttercream. ", "Measure and, using the wire cutters or heavy-duty scissors, cut dowels that are exactly the same height as the cake.", "\n\n**4.** ", "Insert the dowel rods into the bottom layer, evenly spaced about 4cm (11⁄2in) in from the edge of the marked outline. ", "Push the dowel rods straight down until each touches the cake board. ", "The number of dowels to use depends on the size of the cake.", "\n\n**5.** ", "Apply a thin layer of buttercream on the top of the cake, just enough to cover the protruding dowels, then secure and stick the thin board to your cake drum using the glue. ", "Do not just use buttercream or royal icing to stick the thin board to the drum as it could still slide about.", "\n\n**6.** ", "Repeat the process described in steps 3 and 4 to stack the other two cake sponges onto the glued-together thin boards, then position on top of the bottom two cakes.", "\n\n**7.** ", "Measure and cut a long dowel which is the height of the whole cake.", "\n\n**8.** ", "Insert the long dowel centrally right the way to the bottom of the cake.", "\n\n## Covering Cakes\n\nThe first step, before you can add any wonderful decoration, is to know how to cover the cake, making sure that the buttercream sticks to it and provides a clean base. ", "You need to crumb coat, and then create a smooth surface. ", "Further techniques for creating textured surfaces can be found within the cake projects.", "\n\n#### Crumb Coating\n\nCrumb coating means applying a thin layer of buttercream all over your cake to secure the loose crumbs. ", "This is a very important step that you should not miss as this makes your outer layer of buttercream stick to the cake, giving the heavy piped and textured designs something to adhere to.", "\n\n**1.** ", "Use a round nozzle or just snip the end off a piping bag, then, using the same buttercream that will go on the rest of the cake, pipe around the cake with a good firm pressure so the buttercream sticks to the cake.", "\n\n**2.** ", "Use a palette knife to spread the buttercream all over the cake, applying even pressure and making sure to remove any excess buttercream with the edge of the palette knife.", "\n\n**3.** ", "You can use a cake scraper to even the thickness out or leave it as it is.", "\n\n#### TIP\n\nChill the crumb coated cake in the fridge for about 20 to 30 minutes or until the surface is firm. ", "It is better if you can place the cake in the freezer to speed up the process. ", "If you don't chill the cake, it will be much more difficult to apply further decoration, such as a smooth layer of buttercream.", "\n\n#### Smoothing\n\nAfter the cake has been chilled for a while you can apply another layer of buttercream. ", "The thickness of this layer will be a matter of taste. ", "You can also use the thin board as your guide as to how thick your buttercream will be. ", "For this stage you will need non-woven cloth, such as the interfacing used in sewing projects. ", "This can be sourced online or from any reasonably large haberdashery.", "\n\n**1.** ", "Use a cake scraper to even out the thickness of buttercream all the way around the cake. ", "Air-dry the cake at room temperature to allow it to crust for about 10 to 20 minutes.", "\n\n**2.** ", "When the cake is fully crusted (see tip below), place the non-woven cloth on the surface of the cake and rub gently with your fingers to smooth the surface. ", "Repeat the same process all over the cake.", "\n\n**3.** ", "To make it perfectly smooth, place the non-woven cloth on the surface of the cake again and use the scraper, running it up and down over the cloth.", "\n\n**4.** ", "Use a small knife or the cake scraper to remove any excess buttercream on the edge of the cake.", "\n\n#### TIP\n\nDo not put it in the fridge or freezer again as the moist environment inside will prevent the buttercream from crusting. ", "If the cake is dry and not tacky to touch, it means the cake is ready for smoothing.", "\n\n#### Covering a sphere cake\n\nCoating a sphere with buttercream presents its own particular problems. ", "However, follow these steps to make an impressively smooth job of it.", "\n\n**1.** ", "Bake two half dome cakes using suitably shaped cake tins or heat-resistant bowls, such as Pyrex. ", "Then level the cakes using a cake leveller or a serrated knife.", "\n\n**2.** ", "Cut off a small piece of cake at the top of one of the domes so it will sit steady on the board without rolling, then apply buttercream before sticking it to the board.", "\n\n**3.** ", "Fill the middle and place the other half of the cake on top of it to make a sphere. ", "Use a short palette knife to spread out any excess buttercream.", "\n\n**4.** ", "Crumb coat the cake using the same buttercream that you will use for the top layer of cake covering.", "\n\n**5.** ", "Apply the thicker layer of buttercream and even out with a flexible Mylar scraper (or you can use any flexible plastic). ", "Follow the curve of the cake then leave it to crust.", "\n\n**6.** ", "Dowel if the cake is large, then smooth the top coat with non-woven cloth, making sure that you follow the contours of the cake.", "\n\n## Piping textures\n\nSome of the textures you will need to pipe to create the cakes in this book, are described within the projects themselves. ", "However, where the method is a bit more involved or has cropped up several times, we have referred you to this section where we can explain the technique more thoroughly.", "\n\n#### Borders\n\n##### Shell border\n\nPipe a shell border by cutting a small hole at the tip of a piping bag or by using various nozzles. ", "Hold the piping bag at a 30-degree angle with the tip of the nozzle touching the cake surface. ", "Firmly squeeze the piping bag until the buttercream builds up and creates a small blob, then slightly lift the piping bag and pull down as you also gradually relax the pressure on the bag to create a pointed end of the shell. ", "Start your next shell so that the wide end just covers the tail of the preceding shell to form a chain.", "\n\n##### Ruffle borders\n\nUsing a small petal nozzle, such as Wilton 103 or 104, hold your piping bag at an angle with the cake surface, with the wide part of nozzle touching the surface of the cake. ", "Continuously squeeze the piping bag with constant pressure and drag it along your border. ", "Apply slight pressure to ensure that the ruffles stick to the cake. ", "You can also slightly wiggle your piping bag to make wavy ruffles. ", "Repeat the process for any succeeding ruffles making sure that they are close to each other and maintaining the angle. ", "Variations can be 'back to back' (orange), 'upwards' (green), 'downwards' (yellow), wiggly etc.", "\n\n##### Loop border\n\nThe loop border that is used on our Vintage Birdcage and Steampunk Hat cakes is very simple to achieve. ", "Fill a piping bag with your chosen colour and choose a suitable nozzle. ", "Pipe with a tight circular motion, clockwise, making your circles tight so there are no gaps between the loops.", "\n\n##### Bead border\n\nFill a piping bag with buttercream and use scissors to cut a tiny hole at the tip, or you can use a nozzle. ", "Hold the piping bag straight on to the cake and gently squeeze the bag until a small dot appears. ", "Make sure you stop squeezing the bag before you pull it away. ", "Pipe dots in a neat row with each one touching its neighbour to create a border.", "\n\n## Piping flowers\n\nFloral designs are amongst the most popular, and we often feature flowers, or whole bouquets on our cakes. ", "The instructions for piping many flowers will be found within the cake projects, but if a flower appears often, we have referred you to this section to avoid repeating ourselves over and over again.", "\n\n#### Sunflowers, waterlilies and simple leaves\n\nA leaf nozzle will produce a perfect petal for a sunflower, if you follow the instructions below, but this technique can also be used to create waterlilies like those on our Impression of Waterlilies cake, the orange flowers on the Autumn Wreath, and to pipe simple leaves. ", "All you need is to select the right nozzle and colour of buttercream.", "\n\n**1.** ", "Pipe a guide circle, then using a leaf nozzle such as Wilton 67 or 352 held at a 20 to 30 degree angle with one of the points touching your guide, squeeze the piping bag to create a wide base to the leaf. ", "Pull slowly away, reducing the pressure on the bag until you reach the desired length, then stop squeezing and pull away abruptly.", "\n\n**2.** ", "Repeat the same process to pipe a layer of petals around the guide circle.", "\n\n**3.** ", "Pipe another layer of petals with a slightly steeper angle than the first, about 30 to 40 degrees, and make sure that they are close to the first layer of petals to avoid gaps.", "\n\n**4.** ", "Finally, using brown buttercream in a piping bag with a small hole at the tip, pipe little dots to create the centre of the flower.", "\n\n#### Buds\n\nTiny buds can be added in sprays or singly to fill gaps in a design, or to add delicate features. ", "We've used them in the Bas Relief and Country Window cakes.", "\n\nTo pipe a bud, take a small petal nozzle, such as Wilton 104, and hold your piping bag so the nozzle is flat on the cake surface with the wide end of the opening to the left. ", "Gently squeeze the piping bag until it creates a half petal then pull the nozzle slightly to the right and upwards, then fold towards the centre. ", "Pipe another petal over the first to overlap it, but this time work it in the opposite direction, so the wide part of the nozzle points right and you pull the petal left. ", "Repeat until the bud is the size you require (in the case of small buds like those on the Country Window cake, this might only take two petals), then add a calyx using a piping bag with a small hole at the tip.", "\n\n#### Simple petals\n\nWe use a wide variety of piping techniques to create flower petals, but here are two very simple ones. ", "The first is used on the Lace Romance cake and the second for piping the frangipani on the Totally Tropical cake.", "\n\n##### Lace Romance flowers\n\nWith two-tone buttercream (see the Lace Romance cake) in a bag with a Wilton 104 petal nozzle, position the nozzle at a 20 to 30 degree angle with the wide end of the opening touching the cake surface. ", "The narrow end should be pointing outwards and in a 12 o'clock position. ", "Give the piping bag a good squeeze without moving the nozzle at all. ", "Stop when the petal is the right size. ", "Repeat in curved overlapping rows, one below the other, reducing the number of petals in each row until the flower is complete.", "\n\n##### Frangipani\n\nUsing a Wilton 103 petal nozzle and two-tone yellow and white buttercream (see the Lace Romance cake for the two-tone effect) and holding the piping bag at a 20 to 30 degree angle with the yellow buttercream at the bottom, squeeze evenly and move the nozzle to the desired petal length. ", "Make a tight turn to create a rounded tip, but do not make an arch. ", "With the same pressure, pull the nozzle back to the base of the petal (a). ", "Repeat and pipe four more petals all starting at the same central point (b).", "\n\n#### Hibiscus and two-stroke leaves\n\nThe petals of the exotic hibiscus flowers on the Totally Tropical cake share the same piping technique with the leaves on the Sparkling Sensation cake. ", "Use just steps 2 and 3 with green buttercream to achieve two-stroke leaves.", "\n\n**1.** ", "Pipe five guide marks radiating from a central point. ", "Then start piping one side of the first petal by positioning your nozzle facing left, and positioned flat on the surface.", "\n\n**2.** ", "Squeeze the piping bag with constant, even pressure in a jiggling up and down motion until you reach the tip of your petal.", "\n\n**3.** ", "Turn the piping bag straight after piping the first side of the petal and continue piping the other side of the petal.", "\n\n**4.** ", "Repeat to pipe the other four petals.", "\n\n**5.** ", "For the flower centre, fill a piping bag with orange buttercream and cut a medium hole at the tip. ", "Squeeze firmly and gradually pull upwards to create the central cone. ", "Pipe yellow dots on the flower centre using a piping bag with a small hole cut at the tip.", "\n\n#### Ruffle Flowers\n\nThese floral flourishes are perfect in so many designs – we find that we use them a lot! ", "You can achieve a variety of effects with different nozzles but the basic technique is very simple. ", "Here are some examples that you can try; we've shown them on a flower nail for clarity, but actually ruffle flowers should normally be piped directly onto the cake.", "\n\n##### Ruffle one, Wilton 150\n\n##### Ruffle five, Wilton 103\n\nStart from the outer edge for both ruffles one and two, hold the piping bag at a 20 to 30 degree angle and squeeze with even pressure, moving your hand up and down in a tight jiggling motion, while gradually moving clockwise (or counter-clockwise for left-handers). ", "Repeat the same process for the succeeding layers.", "\n\n##### Ruffle three, Wilton 2D\n\nHold the piping bag with the nozzle flat to the surface of the cake. ", "Squeeze with good pressure while slightly rotating left and right as you gradually pull the bag away.", "\n\n##### Ruffle four, Wilton 104\n\n##### Ruffle two, Wilton 103\n\nFor both these ruffles, starting from the outer edge, hold a piping bag at a 20 to 30 degree angle and squeeze a simple petal (see Piping Flowers). ", "Repeat to pipe petals in a circle until you finish the first layer. ", "Pipe two or three more layers of petals. ", "This ruffle makes the basic shape for a camellia.", "\n\n##### Ruffle six, 97L\n\nHold the piping bag with the nozzle in an upright position. ", "Squeeze the bag as you drag the nozzle downwards and slightly wiggle it to create a wavy petal. ", "Repeat to pipe more rows of petals.", "\n\n#### Succulents\n\nFor the rose-like succulents for the Terrarium cake, pipe a blob of buttercream onto a flower nail to create a central mound. ", "Onto this, pipe 'petals' like a rose (see Roses) starting at the centre and using a Wilton nozzle 150. ", "Turn the flower nail and build up the layers until the succulent is the desired size. ", "For the spikey succulent, pipe a cluster of fat spikes onto a flower nail with a Wilton open star nozzle 68. ", "Pipe with even pressure then stop squeezing and pull the bag away. ", "The succulents should be placed in the freezer until firm, usually about 10 to 20 minutes.", "\n\n#### Roses\n\nSurely the most popular of flowers, especially for enhancing a cake design, roses are easiest to create when piped onto a flower nail. ", "We've used them extensively in this book, particularly on the Pail of Roses and Ball of Flowers cakes.", "\n\n**1.** ", "Position the Wilton 104 petal nozzle flat against the flower nail and squeeze the piping bag as you turn the nail to create a base.", "\n\n**2.** ", "Hold the nozzle vertically with the wide end touching the surface and slightly tilted inward, so that your central bud will have only a small opening. ", "Squeeze the piping bag as you turn the nail until you make both ends meet.", "\n\n**3.** ", "While the nozzle is still slightly tilted inwards, turn the nail and pipe a curved petal in an arch-shape around the bud, slightly pushing the petal against the bud so there are no gaps. ", "Each subsequent petal should begin slightly past the middle of the previous one and overlap it. ", "Pipe about two to four short petals.", "\n\n**4.** ", "After creating the bud with few petals around it, hold the nozzle vertically and pipe four to five slightly longer and higher arched upright petals.", "\n\n**5.** ", "When piping the last few petals, tilt the nozzle slightly outwards and make the arches longer instead of higher. ", "Pipe four to five outer petals.", "\n\n**6.** ", "Use scissors to lift the rose up from the flower nail. ", "Gently slide the rose onto a board, ready to go into the freezer for 10 to 20 minutes.", "\n\n#### Using wafer paper\n\nVersatile wafer paper is perfect for creating large appliqués for decoration. ", "It is stiff and very light, so it makes wonderful feathers, leaves and flowers that don't need to be supported by anything. ", "And it can be painted so that you can give it any colour or pattern you desire.", "\n\n### You will need\n\n * Wafer paper\n * Florist wire, gauge 18–20, or any thin and bendable wire\n * Scissors\n * Clear alcohol such as vodka, or lemon extract\n * Paint brush\n * Paint palette\n * Chosen food colouring pastes\n * Small bowl with water\n * Piping gel\n\n**1.** ", "Cut strips of wafer paper of the same width. ", "The width will depend on your pattern. ", "The feathers for the Steampunk Hat are about 4–5cm (11⁄2–2in) wide. ", "On one side of the wafer paper, apply a thin layer of piping gel then position the florist wire in the centre and stick another piece of wafer paper on top of it.", "\n\n**2.** ", "Ideally, leave to dry for several hours or overnight. ", "Sketch your leaf or feather pattern, cut it out and transfer it to the wafer paper by tracing or drawing round it. ", "Next cut around the pattern shape. ", "Paint as desired. ", "Make sure not to oversaturate the paint with lots of alcohol as it may cause the wafer paper to wrinkle.", "\n\n#### Moulds\n\nYou can make a huge range of beautifully detailed shapes to add to your cakes using silicone moulds, which can be purchased in most specialist stores and online. ", "We've made good use of them in our Eccentric cakes, the Steampunk Hat, Alice in Wonderland and Nicely Sliced cakes. ", "To use the moulds press your chosen colour of buttercream in firmly with a palette knife to avoid any air bubbles. ", "Freeze the mould for 10 to 20 minutes, then ease the shape out, touching it as little as possible with warm fingers, and apply it to your cake.", "\n\n#### TIP\n\nDo not freeze buttercream flowers or moulded shapes for too long, definitely not overnight, as condensation will form on the buttercream. ", "This can make colours run and ruin your hard work. ", "Freezing for 20 to 30 minutes, or until firm to the touch is enough.", "\n\n# THE CAKES\n\n# Classic\n\n# BRODERIE ANGLAISE\n\nThe soft colours and delicate decoration of this cake evoke its lacy fabric inspiration. ", "The eyelet design is created with small perforations shaped into simple flowers. ", "These eyelet flowers perfectly compliment the ruffles and ribbons to produce a simple yet exquisite look.", "\n\n### You will need\n\n * 20 x 20cm (8 x 8in) square cake, 13cm (5in) high\n * 500g (1lb 2oz) white buttercream (Sugarflair Super White powder)\n * 1–1.1kg (2lb 4oz–2lb 8oz) peach buttercream (Sugarflair Peach)\n * 100–200g (31⁄2–7oz) light peach buttercream (Sugarflair Peach)\n * 100–200g (31⁄2–7oz) grey buttercream (Sugarflair Liquorice)\n * Baking (parchment) paper\n * Scissors\n * Ruler\n * Pencil\n * Cocktail stick (toothpick)\n * Short angled palette knife\n * Scraper\n * Small piece of cardboard or plastic sheet\n * Wilton ruffle nozzle 86\n * Wilton writing nozzle no.1\n * Wilton basketweave nozzle 47\n * Wilton petal nozzle 150\n * Piping bags\n * Coupler\n * Large pearl dragees (sugar balls)\n * Tweezers\n * Flower nail\n\n**1.** ", "Stack and crumb coat your cake (see Buttercream Basics). ", "Cut a piece of baking (parchment) paper measuring 5cm (2in) less than the height of the cake, and make the corners rounded as shown. ", "Make four of these paper pieces and stick them on all sides of the cake, each 2.5cm (1in) from the top.", "\n\n**2.** ", "Apply peach buttercream all around the cake without covering the parchment paper. ", "Then smooth the surface of the cake (see Buttercream Basics).", "\n\n#### TIP\n\nWhen covering the cake with two different colours, you will find it very helpful to cover one part with baking paper to prevent the colours mixing and to get precision in the shape of the design.", "\n\n**3.** ", "Use a cocktail stick (toothpick) to help you lift each piece of baking paper, then completely pull them off.", "\n\n**4.** ", "Use white buttercream to fill in the rounded panel on all sides. ", "Make sure that it is the same thickness as the peach buttercream. ", "Use a short angled palette knife to spread it carefully.", "\n\n**5.** ", "Use a small piece of cardboard or plastic sheet as a scraper to even out the buttercream, then smooth with a non-woven cloth after.", "\n\n**6.** ", "Use ruffle nozzle 86 and pipe a ruffle border around all the edges of the white central panel. ", "Continuously squeeze the piping bag with the round part of the nozzle touching the edge of the central panel, and drag the piping bag following the shape.", "\n\n**7.** ", "Using peach buttercream and the writing nozzle no.1, pipe a small five-petal flower with a tiny circle as the centre. ", "Pipe staggered rows of the flowers all over the peach-coloured surfaces of the cake.", "\n\n**8.** ", "Around the edge of the white panel, pipe alternating three-petal flowers and small circles using white buttercream.", "\n\n**9.** ", "Wait about 30 minutes to an hour, until the buttercream surface is crusted well. ", "Next cut off one end of the cocktail stick using scissors and use the blunt end to poke the floral details to exaggerate the holes.", "\n\n**10.** ", "Use the smooth side of the basketweave nozzle 47 to pipe short straight lines across the centre of the white panel using grey buttercream. ", "Make sure you leave spaces in between these lines.", "\n\n**11.** ", "With writing nozzle no.1, pipe little 'brackets' on the ends of each of the grey 'ribbons' using white buttercream. ", "Pipe a large ribbon bow in grey on each side of the cake. ", "Finally add a few ribbon roses at the base (see the Ribbon Rose Heart cake for this technique) in light peach buttercream using the petal nozzle 150.", "\n\n# CHARMING CHALKBOARD\n\nYou can write any message you like on this distressed vintage chalkboard. ", "It can easily be incorporated into the perfect theme to match your celebration, just by changing the floral accents and the words written on its invitingly smooth dark surface.", "\n\n### You will need\n\n * 20cm (8in) round cake, 20cm (8in) high\n * 1.2kg (2lb 10oz) black buttercream (Sugarflair Liquorice)\n * 400–500g (14oz–1lb 2oz) white buttercream (Sugarflair Super White powder)\n * 30–50g (11⁄4–13⁄4oz) light pink buttercream (Sugarflair Claret)\n * 300–400g (101⁄2–14oz) dusky pink buttercream (Sugarflair Dusky Pink)\n * 300–400g (101⁄2–14oz) violet buttercream (Sugarflair Grape Violet)\n * 300–400g (101⁄2–14oz) green buttercream (Sugarflair Gooseberry)\n * 50–100g (13⁄4–31⁄2oz) yellow buttercream (Sugarflair Autumn Leaf)\n * Scraper\n * Piping bags\n * Palette knife\n * Non-woven cloth\n * Baking (parchment) paper\n * Ruler\n * Pencil\n * Scissors\n * Cocktail stick (toothpick)\n * Wilton star nozzle 16\n * Wilton chrysanthemum nozzle 81\n * Wilton flower nozzle 14\n * Wilton leaf nozzle 352\n * Wilton petal nozzle 102\n\n**1.** ", "Stack and crumb coat your cake (see Buttercream Basics). ", "Then make the chalkboard colour: blend the white buttercream by adding it gradually to a bowl containing the black buttercream. ", "Start with 100g (31⁄2oz) and add only as much as you need until the black becomes deep grey. ", "Then apply it to the crumbcoated cake. ", "You do not have to smooth it yet, just even it out with a scraper.", "\n\n**2.** ", "Use the remaining white buttercream to pipe small blobs randomly all over the cake. ", "Make sure you leave spaces in between and do not overdo it. ", "Use the tip of your palette knife to spread the buttercream using small round or back and forth movements.", "\n\n**3.** ", "Use the non-woven cloth and lightly smooth the surface of the cake (see Buttercream Basics).", "\n\n**4.** ", "Draw an arch on a piece of baking (parchment) paper as a guide for where the top floral feature will go, and cut it out. ", "Ours measured 20cm (8in) wide. ", "Position it on the cake and use a cocktail stick (toothpick) to draw a guide mark, then remove. ", "Repeat to create a guide for the lower floral feature, using the same paper guide flipped over.", "\n\n**5.** ", "Use white buttercream in a piping bag with a small hole at the tip, or use a Wilton writing nozzle no.1 or 2, to write anything you wish. ", "For this cake we used the word 'Love'. ", "Make sure that it is positioned centrally between your arched guide marks.", "\n\n**6.** ", "Add some white scribbles, scrolls, hearts, dots, or leaves, to decorate your cake, but don't go above the top arched guide mark or below the bottom one.", "\n\n**7.** ", "Using the dusky pink and star nozzle 16, pipe a very small swirl on the guide mark. ", "Pipe more along the mark, leaving gaps for other flowers. ", "Do this on both the arches.", "\n\n#### TIP\n\nIf you accidentally made a mistake, just use the palette knife and blend the white buttercream into the black background. ", "If you make a lot of mistakes and the background becomes too light, just add a thin layer of black buttercream on top and repeat the process. ", "Since the background is black, once you have covered the cake, leave it to crust for three to four hours so that the black doesn't bleed into the white writing and decoration.", "\n\n**8.** ", "Pipe small chrysanthemum flowers using chrysanthemum nozzle 81 and violet buttercream. ", "Position the nozzle straight on to the cake with the curved part pointing away from the flower centre then gently squeeze the piping bag as you lift up and away slightly, releasing the pressure as you do so for each short petal. ", "Pipe some short spikes in the centre using yellow.", "\n\n**9.** ", "Using light pink buttercream and flower nozzle 14, pipe the drop flowers by holding the piping bag at a 90-degree angle straight on to the cake, with the tip just touching the surface. ", "Squeeze the piping bag as you gently turn it clockwise (counter-clockwise for left-handers) until it creates a flower then stop squeezing and pull the piping bag away. ", "Add flower centres and simple petal strokes (see Piping Flowers) using yellow buttercream.", "\n\n**10.** ", "Add some dots and small leaves in between the flowers using light green buttercream. ", "Use a piping bag with a small hole at the tip for the dots, and leaf nozzle 352 for the leaves.", "\n\n# HEAVENLY HAT BOX\n\nA hat box may be just a simple container for carrying millinery to some people, but we've elevated ours with the addition of soft pink and yellow roses to give the impression of luxury. ", "We've highlighted its classic look by choosing a pale colour combination for the flowers that perfectly compliments the pastel green of the box.", "\n\n### You will need\n\n * 20cm (8in) round cake, 15cm (6in) high\n * 15cm (6in) round cake, 5cm (2in) high\n * 20cm (8in) round dummy cake, 2.5–4cm (1–11⁄2in) high\n * 20cm (8in) round thin cake board\n * 700–800g (1lb 9oz–1lb 12oz) light green buttercream, to cover the cake (Sugarflair Spruce Green)\n * 200–300g (7–101⁄2oz) light pink buttercream (Sugarflair Dusky Pink)\n * 200–300g (7–101⁄2oz) pink buttercream (Sugarflair Dusky Pink)\n * 200–300g (7–101⁄2oz) yellow buttercream (Sugarflair Melon plus a hint of Autumn Leaf)\n * 200–300g (7–101⁄2oz) light green buttercream (Sugarflair Gooseberry)\n * 200–300g (7–101⁄2oz) light yellow buttercream (Sugarflair Caramel)\n * Glue\n * Scraper\n * Serrated knife\n * Dowel\n * Sharpener\n * Ruler\n * Scissors\n * Wilton petal nozzle 103\n * Wilton petal nozzle 104\n * Wilton leaf nozzle 352\n * Piping bags\n * Tweezers\n * Pearl dragees (sugar balls)\n\n**1.** ", "Pre-pipe and freeze about 15 to 18 roses using the Wilton petal nozzle 104 and light pink, pink and yellow buttercream in a variety of sizes (see Piping Flowers).", "\n\n**2.** ", "Prepare the thin cake board and dummy cake that will become the box lid. ", "Poke a hole in the centre of the board for a dowel to go through, before sticking the dummy cake to the non-laminated side of the board.", "\n\n#### TIP\n\nIn this project we used a dummy cake for the lid to make it easier to assemble. ", "However, you may use a real cake if you prefer.", "\n\n**3.** ", "Stack your 20cm (8in) cakes (see Buttercream Basics), then add the 15cm (6in) cake centrally to the top of the stack. ", "Then carve the top cake diagonally. ", "The highest point should allow enough space for the height of the roses that you will add here shortly. ", "We found this to be about 5cm (2in) for our cake.", "\n\n**4.** ", "Insert a dowel down through the whole cake, measure and mark a point level with the highest point of the cake. ", "Cut the dowel at your guide mark, pull it out and sharpen one end.", "\n\n**5.** ", "Place the dummy lid on the top of the cake to determine that it is the height you desire, then remove it. ", "Crumb coat the cake and cover the lid and the cake sides with a smooth coat of light green buttercream (see Buttercream Basics).", "\n\n**6.** ", "Use a ruler or scraper to mark four straight equally spaced lines vertically around the cake.", "\n\n**7.** ", "Using light cream buttercream and the Wilton petal nozzle 103 with the wide end touching the guide mark, pipe two back to back ruffles (see Piping Textures), side by side without a gap in between, following your vertical guides.", "\n\n**8.** ", "Pipe blobs of buttercream to attach the roses to, and to increase the angle of their position if necessary. ", "Make sure that the roses will not exceed the height of the centre cake so they do not get squashed when the lid goes on.", "\n\n**9.** ", "Pipe a very thin layer of buttercream on the top of the cake, insert the dowel with the pointed end upwards then put the lid on. ", "Press it carefully but firmly so the dowel skewers the dummy cake and it will not come off.", "\n\n**10.** ", "Pipe a beads border (see Piping Textures) on the bottom edges of the cake lid and the top edge of the hat box in light green buttercream, using a piping bag with a small hole at the tip.", "\n\n**11.** ", "Pipe some leaves in light green between roses to cover the gaps using the Wilton leaf nozzle 352.", "\n\n**12.** ", "Continue the light cream ruffled lines up over the lid and then pipe a small ruffle flower (see Piping Flowers) where the ruffles intersect. ", "Put some pearl dragees in the centre using tweezers to position them.", "\n\n# Artistic\n\n# INSPIRED BY ROMERO BRITTO\n\nHailing from the bright and brilliant Brazilian neo-pop movement, Romero Britto is an artist, painter and sculptor whose work is a visual feast. ", "We love his extraordinary skill at combining vibrant colours while infusing each piece with history, playful themes and pop art. ", "He makes art that emanates love, cheerfulness and enthusiasm, so of course we were inspired!", "\n\n### You will need\n\n * 20 x 15cm (8 x 6in) square cake, 15cm (6in) high\n * 700g untinted buttercream\n * 250g (9oz) black buttercream (Sugarflair Liquorice)\n * 250g (9oz) yellow buttercream (Sugarflair Melon)\n * 250g (9oz) dark yellow buttercream (Sugarflair Melon plus Autumn Leaf)\n * 250g (9oz) orange buttercream (Sugarflair Tangerine)\n * 250g (9oz) light pink buttercream (Sugarflair Claret)\n * 250g (9oz) dusky pink buttercream (Sugarflair Tangerine)\n * 250g (9oz) red buttercream (Sugarflair Christmas Red plus Ruby)\n * 250g (9oz) light green buttercream (Sugarflair Gooseberry)\n * 250g (9oz) medium dark green buttercream (Sugarflair Spruce Green)\n * 250g (9oz) violet buttercream (Sugarflair Grape Violet)\n * 250g (9oz) blue buttercream (Sugarflair Baby Blue)\n * Wilton writing nozzle no.5\n * Wilton round nozzle no.12\n * Piping bags\n * Cookie cutters (various sized hearts and small flowers)\n * Cake scraper\n * Cardboard templates for small circles and random shapes\n * Cocktail sticks (toothpicks)\n\n**1.** ", "Prepare your tinted buttercream, bagging each colour in a separate piping bag with the tip cut off to create a small hole. ", "For the black, you may use a Wilton writing nozzle no.5, or just cut the tip off a bag to make a slightly bigger hole.", "\n\n**2.** ", "Stack and crumb coat your cake (see Buttercream Basics). ", "Then start by marking the position of the largest hearts first as they will be the main decorations. ", "Use a cookie cutter to mark one on the top and two or three more on the sides.", "\n\n#### TIP\n\nTo stop the black tinted buttercream bleeding into the other colours, you can pipe it first then let it crust for between 30 minutes and an hour before piping the rest of the pattern. ", "The best way to mark your patterns is with various cutters, as you can change the design by smoothing them over until you are happy with the overall layout.", "\n\n**3.** ", "Using a cocktail stick (toothpick), start to mark the outline of some half circles on the bottom edge of all four sides of the cake.", "\n\n**4.** ", "Draw long lines that will create a visually pleasing division all around the cake. ", "To achieve the right effect these lines should connect with each other. ", "Make sure that the spaces in between lines will be large enough to fit in more decorative shapes.", "\n\n**5.** ", "Using the smallest heart cookie cutter, mark some hearts randomly along the lines.", "\n\n**6.** ", "Using your black tinted buttercream, with continuous pressure, pipe on top of your long lines, then the big hearts and finally the smaller hearts.", "\n\n**7.** ", "Using your Wilton round nozzle no.12, a flower cookie cutter, cake scraper and small cardboard templates, create patterns and stripes in between the long lines over the rest of the cake.", "\n\n**8.** ", "With repetitive back and forth movements and continuous and consistent pressure, fill in the smaller patterns (circles, hearts and flowers) in various colours. ", "The motion will be like making embroidery stitches that vary in length and direction.", "\n\n**9.** ", "Now fill in the bigger spaces with stripes, making sure that you use all the different colours.", "\n\n**10.** ", "Finally cover the rest of the white space over the entire cake filling in all the shapes with stripes and solid colours, ensuring the direction of your 'stitches' vary from shape to shape.", "\n\n# VAN GOGH SUNFLOWERS\n\nVan Gogh's sunflower paintings are surely the most globally recognisable examples of his art. ", "The vibrancy of colour seems to have such a deep impact on the viewer. ", "For us, Van Gogh's masterpiece is a symbol of optimism and hope.", "\n\n### You will need\n\n * 20cm (8in) square cake, 10cm (4in) high\n * 200–300g (7–101⁄2oz) dark yellow buttercream (Sugarflair Autumn Leaf)\n * 200–300g (7–101⁄2oz) bright yellow buttercream (Sugarflair Melon plus Autumn Leaf)\n * 200–300g (7–101⁄2oz) medium yellow buttercream (Sugarflair Autumn Leaf plus a hint of Melon)\n * 200–300g (7–101⁄2oz) light blue buttercream (Sugarflair Baby Blue)\n * 50–100g (13⁄4–31⁄2oz) dark blue buttercream (Sugarflair Baby Blue)\n * 100–200g (31⁄2–7oz) dark green buttercream (Sugarflair Spruce Green)\n * 100–200g (31⁄2–7oz) light green buttercream (Sugarflair Spruce Green plus Gooseberry)\n * 400–500g (14oz–1lb 2oz) dark brown buttercream (Sugarflair Dark Brown)\n * 100–200g (31⁄2–7oz) light brown buttercream (Sugarflair Dark Brown)\n * Palette knife\n * Small tip palette knife\n * Baking (parchment) paper\n * Pencil\n * Scissors\n * Piping bags\n * Wilton small star nozzle 16\n * Wilton leaf nozzle 67\n * Wilton leaf nozzle 352\n\n**1.** ", "Apply dark yellow buttercream across the bottom part of the cake, creating the impression of a sloping 'landscape' to appear behind the flowers. ", "Add some bright yellow buttercream, even it out with the larger palette knife and apply short horizontal strokes using the small tip palette knife.", "\n\n**2.** ", "Repeat the same process to cover the remaining surface of the cake using two shades of blue buttercream.", "\n\n#### TIP\n\nThere is a wide variety of leaf nozzles available so experiment to find the perfect effect for your cake.", "\n\n**3.** ", "Cut a piece of baking (parchment) paper that is exactly the same height and width as the side of the cake. ", "Fold the paper in half twice horizontally then mark the sides of the cake with a piece of card where the folds are.", "\n\n**4** Use the star nozzle 16 and dark brown buttercream to pipe tightly packed diagonal lines between your guide marks. ", "Each subsequent row leans in the opposite direction. ", "Make sure that there are no gaps in between.", "\n\n**5.** ", "Use the same star nozzle and pipe a scallop-like border all around the top edge of the cake.", "\n\n**6.** ", "Pipe the flower stems with dark green buttercream using a piping bag with a medium hole at the tip.", "\n\n**7.** ", "Position and mark all the sunflower heads by piping guide circles.", "\n\n**8.** ", "Pipe the sunflowers using leaf nozzle 67 (see Piping Flowers). ", "Refer to the photograph of the finished cake as a guide, and pipe all the flowers that seem to be underneath or the lowest first, including the one on the side of the cake, before piping the rest.", "\n\n**9.** ", "Build up the sunflowers and swap between the two darker shades of yellow buttercream as you do so, to create variety.", "\n\n**10.** ", "Complete the rest of the sunflower heads using leaf nozzle 352 and the bright yellow. ", "When piping the petals here make them more narrow and flatter than the others. ", "Pipe the centre of the flowers using dark and light brown buttercream dots.", "\n\n# IMPRESSION OF WATERLILIES\n\nUsing a simple piping technique it's remarkable how easy it is to achieve an impressionist masterpiece! ", "Claude Monet's famous waterlily painting series was our inspiration, and buttercream our medium. ", "Even without much detail, it is still perfectly clear that the subject is delicate pink water lilies on a tranquil pond.", "\n\n### You will need\n\n * 20cm (8in) round cake, 15cm (6in) high\n * 300–400g (101⁄2–14oz) light blue buttercream (Sugarflair Navy Blue)\n * 300–400g (101⁄2–14oz) medium blue buttercream (Sugarflair Baby Blue plus Navy Blue)\n * 300–400g (101⁄2–14oz) dark blue buttercream (Sugarflair Navy Blue)\n * 300–400g (101⁄2–14oz) very light green buttercream (Sugarflair Gooseberry)\n * 300–400g (101⁄2–14oz) light green buttercream (Sugarflair Spruce Green)\n * 300–400g (101⁄2–14oz) medium green buttercream (Sugarflair Spruce Green plus Party Green)\n * 300–400g (101⁄2–14oz) dark green buttercream (Sugarflair Holly Green)\n * 300–400g (101⁄2–14oz) light pink buttercream (Sugarflair Claret)\n * 50–100g (13⁄4–31⁄2oz) dark pink buttercream (Sugarflair Claret)\n * 50–100g (13⁄4–31⁄2oz) dark purple buttercream (Sugarflair Grape Violet plus Claret)\n * 50–100g (13⁄4–31⁄2oz) yellow buttercream (Sugarflair Autumn Leaf)\n * Wilton petal nozzle 125\n * Wilton grass nozzle 233\n * Wilton leaf nozzle 352\n * Piping bags\n * Coupler\n\n**1.** ", "When piping the basic 'impressionist dots' with the grass nozzle 233, hold the piping bag straight on to the surface of the cake at a 90-degree angle before squeezing the piping bag.", "\n\n**2.** ", "Squeeze the piping bag gently until the buttercream builds up slightly, then stop squeezing the bag before pulling away.", "\n\n#### TIP\n\nIf you accidentally squeeze the piping bag too much and the small dots became too fat and look like they are merging, just scrape them off with a palette knife or scraper, then pipe again.", "\n\n**3.** ", "Stack the cakes, carve the curved top edge (see Wedgewood Blue cake, steps 1–4), then crumb coat (see Buttercream Basics). ", "Use any of the shades of blue buttercream in a piping bag with a small hole at the tip and mark the position for all the different blues.", "\n\n**4.** ", "Pipe all the shades of blue buttercream using the grass nozzle 233. ", "When piping the details, make sure they are in clusters and not dotted about, so the colours will not get blended together.", "\n\n**5.** ", "Continue to pipe guide lines to mark out areas for the shades of green.", "\n\n**6.** ", "Repeat the process as for the blues, and add all the different shades of green except for the darkest shade.", "\n\n**7.** ", "Using a piping bag with a small hole at the tip, add some dark green accents by piping wavy rows of dots that are close to each other.", "\n\n**8.** ", "Repeat the same process using plain buttercream, light and dark pink, and dark purple to give the impression of some water lilies.", "\n\n**9.** ", "Add a few white dots randomly, again using a piping bag with a small hole at the tip, in order to create highlights.", "\n\n**10.** ", "Pipe some lily pads on top of the cake using petal nozzle 125. ", "Hold the piping bag at a flattish angle with the surface of the cake, with the wide end at the centre. ", "Continuously squeeze the piping bag as you turn your bag clockwise.", "\n\n**11.** ", "Pipe the lilies in the centre of the lily pads using light pink buttercream as if you were piping a sunflower (see Piping Flowers), making sure that the petals start with a steep angle of 30 to 40 degrees, increasing the angle as you pipe towards the centre of the flower.", "\n\n**12.** ", "Add centre spikes using yellow buttercream and a piping bag with a small hole at the tip. ", "Pipe more pads and lilies at the base of the cake.", "\n\n# Monochromatic\n\n# TOILE DE JOUY\n\nToile de jouy is a classic decoration originally used on textiles, and was popular in the mid-18th century. ", "Small floral or pastoral scenes are repeated over and over in a single colour. ", "You can choose to depict whatever you like, either by tracing onto baking (parchment) paper or by using die-cut paper designs, doilies and paper appliqués. ", "As you can see, with simple repeated images you can achieve a really sophisticated look.", "\n\n### You will need\n\n * 20 x 20cm (8 x 8in) square cake, 4in (10cm) high\n * 1.5kg (3lb 5oz) white buttercream (Sugarflair Super White powder)\n * Pink food colouring paste (Sugarflair Dusky Pink)\n * Baking (parchment) paper\n * Pen or pencil\n * Scissors\n * Small piece of cardboard or stiff paper\n * Ruler\n * Scraper\n * Serrated knife\n * Dinky Doodle Pearl airbrush paint\n * Paint palette or dish\n * Paint brush, any size\n * Small bowl of water\n * Clean sponge\n * Clean tissue\n * Cocktail stick (toothpick)\n * Piping bags\n * Wilton nozzle 199\n\n**1.** ", "Trace your chosen image onto baking (parchment) paper, or find a nice royalty-free image on the internet and resize it until it fits your design. ", "Cut out the shapes.", "\n\n**2.** ", "Stack your cake (see Buttercream basics). ", "Cut a right-angle triangle from cardboard or paper with the two short sides measuring 5cm (2in). ", "Make four of these triangles. ", "Position each one at the corners of the cake as a guide.", "\n\n#### TIP\n\nThe only limitation on the designs you choose is your own imagination! ", "You can draw your own or search the internet for royalty-free images, or even seek out the kind of cut-outs used for scrapbooking.", "\n\n**3.** ", "Using a scraper or a ruler, mark the sides of the cake from the tips of the triangles, down to the base using any colour of buttercream in a piping bag with the tip cut off.", "\n\n**4.** ", "Cut the corners of the cake straight down with the serrated knife, then crumb coat the cake and cover with a smooth coat of white buttercream (see Buttercream Basics).", "\n\n**5.** ", "Position your paper design pieces onto the cake straight away after covering it, so that they adhere to the slightly sticky buttercream. ", "If the surface has crusted too much and the design does not stick to the cake, dab a thin layer of vegetable shortening to the paper.", "\n\n**6.** ", "Put a little pink food colouring paste onto a paint palette or dish and add few drops of water to dilute it. ", "Use a brush to make sure you dissolve the paste properly.", "\n\n**7.** ", "Cut a small piece of sponge, dip it into the colour and remove any excess. ", "Dab it onto a clean tissue to remove the excess water and to check the strength of colour.", "\n\n**8.** ", "Dab the surface of the cake gently. ", "Add more colour around the pattern to give a shadow effect and add depth.", "\n\n**9.** ", "Mix a paler shade for the background and continue dabbing it onto the cake.", "\n\n**10.** ", "Use a cocktail stick (toothpick) to lift and gently remove the design stencils from the cake.", "\n\n**11.** ", "Pipe loops as border around the bottom of the cake using Wilton nozzle 199.", "\n\n#### TIP\n\nWhen applying the colour, make sure you don't dab too heavily so you don't leave dents on the cake.", "\n\n# WEDGEWOOD BLUE\n\nThe iconic colour of Wedgewood jasperware pottery is famous around the world. ", "The soft background blue is decorated with often floral decoration of great delicacy. ", "You can create a charming little historical piece by adding your own monochromatic 'Wedgewood' design to a cake. ", "Your design can be any pattern that you fancy – choose something suitable and your cake will simply exude sophistication.", "\n\n### You will need\n\n * 20cm (8in) round cake, 15cm (6in) high\n * 1kg (2lb 4oz) light blue buttercream to cover the cake (Sugarflair Navy Blue plus a hint of Baby Blue)\n * 100–200g (31⁄2–7oz) light blue buttercream (Sugarflair Navy Blue plus a hint of Baby Blue)\n * 100–200g (31⁄2–7oz) medium blue buttercream (Sugarflair Navy Blue)\n * 100–200g (31⁄2–7oz) of dark blue buttercream (Sugarflair Navy Blue)\n * Baking (parchment) paper\n * Scissors\n * Pen or pencil\n * Ruler\n * Serrated knife\n * Small piece of paper or cardboard\n * Scraper\n * Piping bags\n * Wilton writing nozzles no.2 or 3 (optional)\n * Paint brushes, flat and rounded tip\n * Small bowl of water\n * Cocktail stick (toothpick)\n\n**1.** ", "Stack your cake (see Buttercream Basics), then make a circle of baking (parchment) paper 2.5cm (1in) smaller all round than the top of the cake.", "\n\n**2.** ", "Depending on how curved you want the edges to be, measure about 2.5–5cm (1–2in) down from the top edge of the cake and mark a guide line in buttercream all the way around.", "\n\n#### TIP\n\nSome types of Wedgewood pottery have blue details on a white background, which would make a lovely variation. ", "Or you could use just one shade of blue for your piping, or even more shades than we have.", "\n\n**3.** ", "Start carving the edge of the cake carefully into a nice curve following the paper and the mark.", "\n\n**4.** ", "On a piece of cardboard, draw the desired curve shape and use this as a guide to check the preciseness and consistency of your curved edge. ", "Trim more cake if necessary to adjust the curve.", "\n\n**5.** ", "After you have achieved the curved edge, crumb coat and cover the cake with a smooth coat of light blue buttercream (see Buttercream basics).", "\n\n**6.** ", "Prepare three shades of blue buttercream, light, medium and dark, in separate piping bags with the tips cut off, or with Wilton writing nozzles no.2 or 3. ", "Starting at the outer edge of your first petal, pipe an uneven line of medium blue as an outline.", "\n\n**7.** ", "Using a damp flat or rounded tip paint brush, sweep the buttercream down from the outline towards the centre or base of the flower. ", "Repeat the process for a couple more outer petals.", "\n\n**8.** ", "Repeat the same process, piping and brushing layers of petals until you complete the whole flower. ", "Pipe the outline again to make it slightly thicker if you have brushed it too much.", "\n\n**9.** ", "Outline where you want the leaves and stems to go using a cocktail stick (toothpick).", "\n\n**10.** ", "Use light blue buttercream to fill the leaves. ", "Pipe zigzag motion like embroidery stitching (see the Inspired by Romero Britto cake, step 8).", "\n\n**11.** ", "Use dark blue buttercream and the same piping motion to outline the leaves and to pipe the stems.", "\n\n**12.** ", "Add more flowers all around the cake, in a variety of sizes, then finish with a dark blue piped shell or beads border (see Piping Textures) around the bottom.", "\n\n# BAS RELIEF\n\nInspired by a form of sculpture in which shapes are carved from a flat surface so that they stand up from the backround, this is our buttercream take on bas relief. ", "Our detailed design is piped onto the background, rather than being carved out of it, and you could choose a light or dark surface colour to show the details off. ", "Ornate yet sophisticated, this cake is is perfect for life's big celebrations.", "\n\n### You will need\n\n * 15 x 15cm (6 x 6in) square cake, 20cm (8in) high\n * 1kg (2lb 4oz) light cream buttercream (Sugarflair Caramel)\n * 800g (1lb 12oz) medium cream buttercream (Sugarflair Caramel)\n * Dowels\n * Scraper\n * Piping bags\n * Scissors\n * Coupler\n * Wilton petal nozzle 103\n * Wilton small star nozzle 16\n * Wilton writing nozzle no.1 (optional)\n * Airbrush machine\n * Pearl airbrush colour\n\n**1.** ", "Stack and dowel the cake to stabilize it, then crumb coat and cover with a smooth coat of medium cream buttercream (see Buttercream Basics).", "\n\n**2.** ", "Using medium cream buttercream and the Wilton petal nozzle 103, pipe the buds, roses and ruffle flowers (see Piping Flowers) on all the corners of the cake.", "\n\n#### TIP\n\nBesides the piped details that give you the elegant bas relief effect, you can also use a variety of moulds to make features to stick to the cake with a thin layer of buttercream (see Moulds). ", "If the moulded designs are heavy you will find that piping gel or edible glue may not be strong enough to keep them from falling off the cake.", "\n\n**3.** ", "When the flowers have crusted, gently pat down the rough parts where your piping strokes ended.", "\n\n**4.** ", "Using medium cream buttercream in a piping bag with a small hole at the tip, pipe a calyx on each of the buds and roses and dots on the base of the ruffle flowers.", "\n\n**5.** ", "Using the Wilton small star nozzle 16, fill the gaps around the roses and buds with stars, with some extending on both sides to look like long flowers. ", "Make sure you cover all gaps in between the flowers with small stars.", "\n\n**6.** ", "Add small buds at the tip of the long star flowers. ", "Pipe some small buds in layers using just a piping bag with a small hole at the tip, or Wilton writing nozzle no.1.", "\n\n**7.** ", "Pipe some scrolls randomly around the corners of the cake to add pretty detail.", "\n\n**8.** ", "Airbrush some details using pearl colour to highlight some flowers. ", "Don't overdo it – you just want to add a little sparkle, not to make the cake look too metallic.", "\n\n#### TIP\n\nWhen airbrushing colour onto small details, make sure you bring the spray gun closer to allow the spray to reach the finer details, but be careful not to get so close that the colour pools on the surface and drips.", "\n\n# Scenic\n\n# TOTALLY TROPICAL\n\nRelax into the island-style vibe of this tropically inspired cake. ", "Bamboo and hibiscus combine to create a fresh, serene design that's perfect for an outdoor summer celebration, the cascade of exotic flowers adding some hot colour against the calm green background.", "\n\n### You will need\n\n * 15cm (6in) square cake, 10cm (4in) high\n * 600–700g (1lb 5oz–1lb 9oz) green buttercream (Sugarflair Gooseberry)\n * 50–100g (13⁄4–31⁄2oz) caramel buttercream (Sugarflair Caramel)\n * 100–200g (31⁄2–7oz) yellow buttercream (Sugarflair Autumn Leaf)\n * 150–200g (51⁄2–7oz) white buttercream (Sugarflair Super White powder)\n * 100–200g (31⁄2–7oz) light pink (Sugarflair Claret)\n * 100–200g (31⁄2–7oz) orange buttercream (Sugarflair Apricot)\n * 100–200g (31⁄2–7oz) blue buttercream (Sugarflair Baby Blue plus Navy Blue)\n * Wilton writing nozzle no.10\n * Wilton petal nozzle 104\n * Wafer paper leaves\n * Piping bags\n\n**1.** ", "When piping the bamboo, hold the piping bag to the side, in the direction you are piping, to achieve the rounded shape of each bamboo segment (top). ", "Do not hold it at 90 degrees to the cake's surface as the bamboo will look flat (bottom).", "\n\n**2.** ", "Stack and crumb coat your cake (see Buttercream Basics). ", "Then starting at any top corner on any side of the cake, pipe bamboo segments in green buttercream using the writing nozzle no.10, and vary them from 2.5cm (1in) to 4cm (11⁄2in) in length.", "\n\n#### TIP\n\nThis cake is a rectangular block on its side. ", "Because the cake is small, we did not use any dowels for support but if you want to make yours taller, you should of course add dowels to stabilize the layers.", "\n\n**3.** ", "Use caramel buttercream in a piping bag with a small hole at the tip, and pipe a short but thick line after each bamboo segment.", "\n\n**4.** ", "Repeat the same process to pipe the bamboo all around the edges of the cake, and then work inwards until you have covered each surface of the cake.", "\n\n**5.** ", "Make sure that the lines of bamboo are tightly packed so that they do not have gaps in between them.", "\n\n**6.** ", "Pipe the frangipani flowers directly on to the cake in white and yellow buttercream using the Two-tone Effect described in the Lace Romance cake, and the petal nozzle 104 (see Piping Flowers). ", "Some of them can overlap so the effect is more natural.", "\n\n**7.** ", "Make the wafer paper leaves (see Using Wafer Paper in the techniques section). ", "Pipe a blob of buttercream where you want the leaves to be positioned.", "\n\n**8.** ", "Position and insert the wafer paper leaves and arrange them according to how you want them.", "\n\n**9.** ", "Pipe the orange hibiscus flowers directly on to the cake using nozzle 104, and add the centre dots in yellow (see Piping Flowers). ", "Make sure you use a little pressure when piping so that the flowers adhere to the cake properly.", "\n\n**10.** ", "Add some pink hibiscus for extra colour and to complete the cake.", "\n\n# BEACH TREASURE\n\nThe sight of the ocean never fails to impress, and the shoreline has a special power to draw us to it. ", "So what could be more appealing than a beach-inspired cake? ", "Especially one with the hint of buried pirate treasure! ", "We have included edible sea shells, biscuit crumb sand and blue ruffle waves, and even piped a length of discarded rope and a compass – a treat for beachcombers, sailors and all beach lovers.", "\n\n### You will need\n\n * 20cm (8in) round cake, 15cm (6in) high\n * 1kg (2lb 4oz) light cream buttercream (Sugarflair Caramel)\n * 400–500g (14oz–1lb 2oz) medium blue buttercream (Sugarflair Baby Blue plus Navy Blue)\n * 400–500g (14oz–1lb 2oz) light blue buttercream (Sugarflair Navy Blue)\n * 300–400g (101⁄2–14oz) white buttercream (Sugarflair Super White powder)\n * 100–200g (31⁄2–7oz) dark yellow buttercream (Sugarflair Autumn Leaf)\n * 50–100g (13⁄4–31⁄2oz) black buttercream (Sugarflair Liquorice)\n * 50–100g (13⁄4–31⁄2oz) brown buttercream (Sugarflair Dark Brown)\n * 30–50g (11⁄4–13⁄4oz) red buttercream (Sugarflair Ruby Red)\n * Scraper\n * Palette knife\n * Piping bags\n * Scissors\n * Non-woven cloth\n * 2–3 tbsps cocoa powder\n * Small bowl of water\n * 3–4 tbsps melted cocoa butter or vegetable shortening\n * Paint palette or small saucer\n * Round-tip paint brush\n * Rounded square-tip paint brush\n * Cocktail stick (toothpick)\n * Wilton petal nozzle 104\n * Crushed digestive biscuits (graham crackers)\n\n**1.** ", "Stack and crumb coat your cake (see Buttercream Basics), place it on the cake board then cover the cake with light cream buttercream, evening it out with a scraper. ", "Using a piping bag with a hole at the tip, apply random small blobs of dark yellow buttercream then spread with a palette knife in a circular motion. ", "Repeat with brown.", "\n\n**2.** ", "Scrape the side and top to give a marbled effect on the surface. ", "Clean the scraper from time to time so the colours do not blend too much.", "\n\n**3.** ", "When the surface is even, use the non-woven cloth to smooth the surface of the cake very lightly. ", "You should leave some rough areas around the cake.", "\n\n**4.** ", "Prepare your cocoa paint by dissolving the cocoa powder in the melted vegetable shortening or cocoa butter. ", "Regulate the amount of cocoa powder you use depending on how dark you want the shade of brown to be.", "\n\n**5.** ", "Use the round-tip paint brush to paint some patches of brown and then smudge the colour randomly to create an old and distressed look.", "\n\n**6.** ", "Use a cocktail stick (toothpick) to mark where you will pipe the waves.", "\n\n**7.** ", "Pipe the waves using petal nozzle 104 with white and medium blue buttercream, (see Two-tone Effect in the Lace Romance cake) with the wide end of the nozzle touching the cake and the narrow end pointing up and at a 20-degree angle.", "\n\n**8.** ", "Squeeze with even pressure as you move your hand slightly up and down and drag the wave down following your guide. ", "Then dampen the tip of the rounded square-tip paint brush with water and sweep the blue buttercream downwards.", "\n\n**9.** ", "Repeat the same process switching between the two shades of blue to pipe waves all over the lower part of the cake and onto the cake board, following your guide mark.", "\n\n**10.** ", "Sprinkle the crushed biscuits all around the board and in between the waves. ", "You can use the tip of the palette knife to sprinkle biscuit crumbs into narrow spaces.", "\n\n**11.** ", "Add the ropes in light brown by piping short overlapping 'S' shapes to create a twisted rope pattern using a piping bag with a small hole at the tip. ", "Pipe the map markings using a piping bag with a small hole at the tip and brown buttercream. ", "Make the 'X' mark in red and the compass details in black.", "\n\n**12.** ", "Pipe 15 to 20 seashells using a piping bag with a medium hole at the tip (see Tip). ", "Squeeze the piping bag with even pressure starting with the tip touching the surface, then move your hand in a round motion as the shell gets bigger.", "\n\n#### TIP\n\nWhen piping the seashells, you can also use a Wilton writing nozzle no.2 or 3, or even small star nozzles like Wilton 14 or 16. ", "Alternatively, you can even go bigger than that depending on the size you want. ", "You can also freeze the shells first before applying them, because it can be challenging to pipe them directly onto the crumbled biscuits.", "\n\n# COUNTRY WINDOW\n\nImagine yourself in a country house surrounded by a beautiful garden, with stunning views of meadows and greenery beyond. ", "Even the experience of making this cake, and certainly seeing the finished results, will fill you with a sense of tranquility.", "\n\n### You will need\n\n * 20cm (8in) square cake, 10cm (4in) high\n * 100–150g (31⁄2–51⁄2oz) white buttercream (Sugarflair Super White powder)\n * 700–800g (1lb 9oz–1lb 12oz) medium caramel buttercream (Sugarflair Caramel)\n * 300–400g (101⁄2–14oz) light caramel buttercream (Sugarflair Caramel)\n * 100–200g (31⁄2–7oz) dark yellow buttercream (Sugarflair Autumn Leaf)\n * 100–150g (31⁄2–51⁄2oz) blue buttercream (Sugarflair Baby Blue plus Navy Blue)\n * 100–150g (31⁄2–51⁄2oz) light green tinted buttercream (Sugarflair Gooseberry)\n * 100–150g (31⁄2–51⁄2oz) medium green buttercream (Sugarflair Spruce Green)\n * 100–150g (31⁄2–51⁄2oz) dark green buttercream (Sugarflair Holly Green)\n * 100–150g (31⁄2–51⁄2oz) light pink buttercream (Sugarflair Claret)\n * 100–150g (31⁄2–51⁄2oz) dark pink buttercream (Sugarflair Claret)\n * 100–150g (31⁄2–51⁄2oz) grey buttercream (Sugarflair Liquorice)\n * 100–150g (31⁄2–51⁄2oz) black buttercream (Sugarflair Liquorice)\n * 100–150g (31⁄2–51⁄2oz) light brown buttercream (Sugarflair Dark Brown)\n * 100–150g (31⁄2–51⁄2oz) dark brown buttercream (Sugarflair Dark Brown)\n * Pen or pencil\n * Baking (parchment) paper\n * Scissors\n * Serrated knife\n * Piping bags\n * Palette knife\n * Scraper\n * Non-woven cloth\n * Brick embosser\n * Rounded square-tip paint brush\n * Sugarflair Autumn Leaf food colouring paste\n * Paint palette\n * Small bowl of water\n * Cocktail stick (toothpick)\n * Wilton small star nozzle 14\n * Wilton petal nozzle 103\n * Wilton basketweave nozzle 47\n\n**1.** ", "Cut a window template out of baking (parchment) paper that is 15cm (6in) wide and 25cm (10in) long, making the top part rounded like an arch. ", "Place it on top of your cake and cut around it using a serrated knife. ", "Attach the excess cake at the bottom to make the window length longer. ", "Level the surface of the cake by trimming it, if necessary (we found we could just cover the whole cake as is).", "\n\n**2.** ", "Crumb coat the cake (see Buttercream Basics), then cover the top with white and the sides with medium caramel buttercream. ", "Apply random blobs of dark yellow on the side of the cake and blend with a palette knife in a circular motion.", "\n\n**3.** ", "After blending, use the scraper to blend the colours even more. ", "Scrape the cake in both directions (right to left, and left to right).", "\n\n**4.** ", "Pipe random small blobs of blue buttercream at the arched end, and blend them into the background in a circular motion. ", "This will create the 'clouds' effect for the sky. ", "Next, gently scrape using the scraper, in both directions. ", "Then lightly smooth the surface of the whole cake with a non-woven cloth (see Buttercream Basics).", "\n\n**5.** ", "Press the brick embosser firmly onto the sides of the cake. ", "To give an old and weathered look, dilute Autumn Leaf food colouring paste with water and lightly brush the surface of the embosser before pressing. ", "Do not brush with too much water.", "\n\n**6.** ", "Using the basketweave nozzle 47 and light caramel buttercream, pipe an outline all around the top edge of the cake, with the smooth side of the nozzle pointing upwards. ", "Pipe three layers altogether, one on top of the other, to make the window frame.", "\n\n**7.** ", "Even out the 'join' of the two colours on the side of the cake with a small palette knife.", "\n\n**8.** ", "Pipe an inner frame of 2.5cm (1in) long strips all round the window, using the same nozzle and the light caramel buttercream. ", "Pipe two more rows of strips across the bottom of the window, on top of the frame and on the outer edge, where the frame meets the brick pattern.", "\n\n**9.** ", "Pipe half the horizon and the path using light caramel buttercream, then use a damp paint brush and gently make a tapping motion to create texture.", "\n\n**10.** ", "Use the different shades of green buttercream, and pipe them onto the cake to create the meadows effect. ", "Do not pipe the buttercream too thickly. ", "Repeat the tapping motion to blend the colours together.", "\n\n**11.** ", "Add the impression of some water in the landscape using blue buttercream, and add some shadows with dark green. ", "You can also add mountains and trees, and blend them with a brush or just leave them piped.", "\n\n**12.** ", "Pipe blobs of grey buttercream at the bottom of the scene to create the impression of rocks, and pipe streaks of black buttercream on their surface as shadows, lightly blending them with a brush.", "\n\n**13.** ", "Pipe some stems and vines using different shades of green, and also the tree and branches using light and dark brown buttercream.", "\n\n**14.** ", "Pipe the buds using light pink (see Piping Flowers), and small dots using light and dark pink. ", "Pipe foliage using the small star nozzle 14 in medium green. ", "For the smaller leaves, cut a slightly bigger hole at the tip of the piping bag and pipe spikes and wavy spikes with two shades of green.", "\n\n# Romantic\n\n# RIBBON ROSE HEART\n\nAs their name suggests, these roses are formed from a piped ribbon of buttercream and are so easy to create yet very effective. ", "Start with a plain white background as a simple canvas, and with a delicate touch you can elevate your cake to a different level where it radiates elegance and style. ", "You can arrange the roses into any shape you wish, in this case we went for a classic romantic statement by forming a heart.", "\n\n### You will need\n\n * 15cm (6in) round cake, 10cm (4in) high\n * 600–750g (1lb 5oz–1lb 10oz) white buttercream (Sugarflair Super White powder)\n * 200–300g (7–101⁄2oz) pink buttercream (Sugarflair Claret)\n * 200–300g (7–101⁄2oz) red buttercream (Sugarflair Claret, Orange and Ruby Red)\n * Baking (parchment) paper\n * Scissors\n * Flower nail\n * Wilton petal nozzle 103\n * Piping bags\n * Cocktail stick (toothpick)\n * Scraper\n * Cake board or tray\n * Tweezers\n * Pearl dragees (sugar balls)\n\n**1.** ", "Cut small baking (parchment) paper squares. ", "Pipe a blob of buttercream on to the flower nail and stick on one parchment paper square.", "\n\n**2.** ", "Using the Wilton petal nozzle 103 with red buttercream, pipe a ribbon rose by holding the nozzle upright with the wide end touching the flower nail. ", "Squeeze continuously as you turn your flower nail.", "\n\n#### TIP\n\nThe ribbon roses are small and made of only a little buttercream so they melt easily, especially when you are applying them to the cake and they are in contact with your fingers. ", "When they start to soften, just put them back in the freezer. ", "Make sure you pipe fresh buttercream on the cake surface so the roses adhere better, and use a cocktail stick (toothpick) to help you press them on firmly.", "\n\n**3.** ", "Use scissors and lift the piped ribbon roses onto a tray or board then put them in the freezer for few minutes to harden. ", "Repeat to make about 40 to 50 roses in red and pink buttercream.", "\n\n**4.** ", "Stack, crumb coat and cover the cake with a smooth coat using 500–600g (1lb 2oz–1lb 5oz) of the white buttercream (see Buttercream Basics). ", "Reserve the rest for steps 5 and 9. ", "Mark the outline shape for your design onto the cake surface using a cocktail stick (toothpick).", "\n\n**5.** ", "Apply white buttercream on the surface area that you want to attach the ribbon roses to.", "\n\n**6.** ", "Take the frozen ribbon roses from the freezer and quickly position and stick them to the surface of the cake. ", "To do this without touching them – so they don't melt so easily – use cocktail sticks, poking on both sides and wiggling them as you press down.", "\n\n**7.** ", "Start at any side of your design and work towards the centre. ", "Alternate the pink and red roses for variety.", "\n\n**8.** ", "Repeat the same process and apply the roses on the top surface of the cake following your outline.", "\n\n**9.** ", "Put white buttercream in a piping bag with a small hole cut at the tip and apply into the gaps between and around the ribbon roses.", "\n\n**10.** ", "Use tweezers to add the small pearl dragees and fill the gaps.", "\n\n# LACE ROMANCE\n\nBy piping delicate lace patterning onto a white background, it's possible to achieve an elegant and romantic cake design. ", "You could choose to make your lace more dense or sparser depending on the look you want to achieve. ", "In fact, creating variations in the density of the lace will actually make the whole design even more effective, creating dark and light areas of the surface. ", "Add a few flowers and you'll have a cake with real impact.", "\n\n### You will need\n\n * 15cm (6in) square cake, 20cm (8in) high\n * 1kg (2lb 4oz) white buttercream (Sugarflair Super White powder)\n * 300–400g (101⁄2–14oz) black buttercream (Sugarflair Liquorice)\n * 200–300g (7–101⁄2oz) green buttercream (Sugarflair Gooseberry)\n * 200–300g (7–101⁄2oz) orange buttercream (Sugarflair Tangerine plus a hint of Liquorice)\n * 200–300g (7–101⁄2oz) purple buttercream (Sugarflair Grape Violet plus a hint of Liquorice)\n * 200–300g (7–101⁄2oz) yellow buttercream (Sugarflair Melon plus a hint of Autumn Leaf and a hint of Liquorice)\n * Scraper\n * Wilton writing nozzle no.1\n * Wilton leaf nozzle 352\n * Wilton petal nozzle 104\n * Piping bags\n * Scissors\n\n**1.** ", "Stack and crumb coat the cake, then cover with a smooth coat of white buttercream (see Buttercream Basics). ", "Using black buttercream with the Wilton writing nozzle no.1, pipe random short and slightly wavy lines.", "\n\n**2.** ", "Add more lines and make sure that they are all connected from one point to another. ", "Repeat the same process until the cake is fully decorated with black lace piping effect.", "\n\n#### TIP\n\nMake sure that the tip of your nozzle is always touching the surface of the cake, and never pull it away from the cake as the line might either break or curl up. ", "If this accidentally happens, first try to mend it by joining the broken line to another point. ", "If that's not possible because the line of buttercream has curled up, pipe shorter lines around it so that it is not very obvious.", "\n\n**3.** ", "Pipe shorter wavy lines randomly, but still connected to your lace web, to add more eye-catching texture.", "\n\n**4.** ", "Decide where you want to position your flowers. ", "Using green buttercream, pipe long and wavy leaves for the flowers using the Wilton leaf nozzle 352.", "\n\n**5.** ", "Next pipe the flowers using two-tone buttercream (see 'To make the two-tone effect').", "\n\n**6.** ", "Start creating the flowers by piping four or five simple petals (see Piping Flowers) in a half circle positioned at the base of the leaves you piped earlier.", "\n\n**7.** ", "Pipe two or three layers of petals below the first, making sure that the number of petals decreases as you pipe towards the base of the flower. ", "Repeat to create more flowers using the other buttercream colours.", "\n\n**8.** ", "Pipe the calyx and the stem for each of the flowers using green buttercream in a piping bag with a small hole at the tip. ", "The stem is created by piping repeating small teardrop 'v' shapes.", "\n\n### To make the two-tone effect\n\nFill two piping bags with your two chosen colours, one colour in each bag. ", "Attach the Wilton petal nozzle 104 to a third empty piping bag. ", "Cut the tips off the two filled piping bags, but make the hole for the 'stripe' colour smaller than the main colour.", "\n\nPipe a line of the stripe colour of buttercream inside the empty piping bag, aligning it with the narrow end of the nozzle.", "\n\nThe other colour will need a bigger hole in its piping bag. ", "Pipe this colour on top of the stripe colour to fill the bag.", "\n\nSqueeze the piping bag until you get the desired two-tone effect. ", "Turn the nozzle if you want the stripe thicker or thinner.", "\n\n# BALL OF FLOWERS\n\nFlowers can be words in the language of love, and roses are without doubt the most traditional way to express affection. ", "How would you arrange a basket of blooms to best convey your message? ", "Just imagine presenting this delicate ball of flowers cake with a handwritten note – such a heart-warming gift.", "\n\n### You will need\n\n * Two 15cm (6in) half dome cakes\n * 500–600g (1lb 2oz–1lb 5oz) plain buttercream (for blobs and roses)\n * 200–300g (7–101⁄2oz) caramel buttercream (Sugarflair Caramel)\n * 100–200g (31⁄2–7oz) light brown buttercream (Sugarflair Dark Brown)\n * 100–200g (31⁄2–7oz) dark brown buttercream (Sugarflair Dark Brown)\n * 300–400g (101⁄2–14oz) red-violet buttercream (Sugarflair Grape Violet plus Claret)\n * 300–400g (101⁄2–14oz) dark red-violet buttercream (Sugarflair Grape Violet)\n * 300–400g (101⁄2–14oz) dusky pink buttercream (Sugarflair Dusky Pink)\n * 300–400g (101⁄2–14oz) pink buttercream (Sugarflair Claret)\n * 100–200g (31⁄2–7oz) green buttercream (Sugarflair Gooseberry)\n * 15cm (6in) round, 5cm (2in) thick styrofoam board\n * 20cm (8in) round, 2.5cm (1in) thick styrofoam board\n * Flower nail\n * Baking (parchment) paper\n * Wilton petal nozzle 104\n * Wilton petal nozzle 103\n * Piping bags\n * Printout, gift wrapper or scrapbook paper\n * Contact paper or clear sticky backed plastic\n * Scissors\n * Glue\n * Dowel\n * Matching ribbons\n * Cocktail stick (toothpick)\n\n**1.** ", "Pipe and freeze the small roses and ruffle flowers ahead of time (see Piping Flowers) using red-violet, dark red-violet, pink, dusky pink and plain buttercream, and the petal nozzle 104 for the roses, and 103 for the ruffle flowers. ", "Some of the roses use the Two-tone Effect, which can be found in the instructions for the Lace Romance cake.", "\n\n**2.** ", "Prepare the styrofoam boards by cutting out a suitable design from a printout, gift wraping or scrapbook paper, then glue it to both of the styrofoam boards and cover with contact paper or clear sticky backed plastic. ", "Cover the sides of the boards with matching ribbon then stick them together.", "\n\n**3.** ", "Before filling and crumb coating the cake, cut a piece off the rounded top of one of the cake domes so it will sit flat on a board. ", "Apply a thin layer of buttercream on the cake so it sticks to the board.", "\n\n**4.** ", "Sandwich the two domes together with a buttercream filling between them, then crumb coat the resulting ball of cake (see Buttercream Basics). ", "Place the ball centrally on top of the styrofoam board stack and insert a long dowel all the way through to the bottom styrofoam board to secure the cake.", "\n\n**5.** ", "Pipe the basketweave using brown, light brown and caramel buttercream. ", "Use a piping bag with a medium hole at the tip and pipe two short strokes to create slightly overlapping and off-set 'V' shapes in rows around the cake. ", "Cover more than half the cake and make sure there are no gaps in between the weaves.", "\n\n**6.** ", "When putting the roses and ruffle flowers onto the cake, make sure you pipe a blob of fresh buttercream onto the surface and press the flower firmly to the cake. ", "This is to make sure that they adhere to the cake properly, especially as they are on the curved sides and will be inclined to slip off.", "\n\n**7.** ", "Insert a cocktail stick (toothpick) into both sides of the pre-piped frozen flowers in order to push them down onto the buttercream blobs securely, to make sure that they stick properly.", "\n\n#### TIP\n\nRoses and other similar flowers are created with quite a lot of buttercream and therefore they can be a little heavy. ", "Due to the weight, these flowers ideally need to be positioned where there are supporting corners or edges. ", "Since this is a sphere cake with no corners at all, it's best to stick the roses and ruffle flowers just above the 'equator' of your sphere so they will not slide down.", "\n\n**8.** ", "Pipe guide marks to determine the size of the rest of the flowers. ", "Because the cake is small you want to plan the layout, positioning the flowers well, without gaps between. ", "The dahlias are piped directly onto the cake. ", "Alternate the two shades of violet and use petal nozzle 104 to pipe short spike-like petals in concentric circles.", "\n\n**9.** ", "Position the rest of the flowers, completing one layer after the other until you reach the top of the cake.", "\n\n**10.** ", "Using a piping bag with a small hole at the tip, pipe clusters of green buttercream blobs, like big dots, to represent buds. ", "Next, with a piping bag with a smaller hole, insert the tip of the bag inside each green blob and fill with white buttercream until it shows on the surface.", "\n\n**11.** ", "Pipe clusters of small dots randomly using white buttercream to create the effect of delicate sprays of Baby's-breath (Gypsophila).", "\n\n# Rustic\n\n# AUTUMN WREATH\n\nThis autumnal wreath has a certain rough-hewn charm that makes it very appealing. ", "The rugged twigs that intertwine each other highlight the natural beauty of the other elements: the scattering of yellow, orange and red flowers, which together with a few pine cones, berries, foliage and other natural adornments combine to make such a rich display. ", "It is perfect for welcoming the season!", "\n\n### You will need\n\n * 25cm (10in) round cake, 10cm (4in) high\n * 1kg (2lb 4oz) light brown buttercream (Sugarflair Dark Brown)\n * 300g (101⁄2oz) medium brown buttercream (Wilton Brown)\n * 500g (1lb 2oz) dark brown buttercream (Sugarflair Dark Brown)\n * 100–200g (31⁄2–7oz) green buttercream (Sugarflair Gooseberry)\n * 100–200g (31⁄2–7oz) red buttercream (Sugarflair Christmas Red plus Ruby)\n * 250g (9oz) cream buttercream (Sugarflair Cream)\n * 250g (9oz) dark yellow buttercream (Sugarflair Autumn Leaf plus Melon)\n * 250g (9oz) dark orange buttercream (Sugarflair Tangerine plus Ruby)\n * 250g (9oz) orange buttercream (Sugarflair Tangerine)\n * Wilton petal nozzle 102\n * Wilton petal nozzle 104\n * Wilton petal nozzle 352\n * Wilton leaf nozzle 74\n * Wilton writing nozzle no.5\n * Piping bags\n * Baking (parchment) paper\n * Scissors\n * Pen or pencil\n * Serrated knife\n * Bread sticks or thick straight pretzels\n * Cocktail stick (toothpick)\n\n**1.** ", "Draw a circle 2.5–5cm (1–2in) smaller than the actual size of your cake on baking (parchment) paper to use as a guide for cutting.", "\n\n**2.** ", "Using a serrated knife, held vertically downwards, cut the cake following your guide. ", "Slide your fingers underneath and carefully push the centre up and pull it away.", "\n\n#### TIP\n\nFor the excess/cutout part of the cake, you can decorate it like a small cake to match your wreath or make it into cakepops. ", "For the pinecones, if you find it hard to pipe on a breadstick, you may prefer to pipe them as you would the roses and freeze, before arranging them on the cake.", "\n\n**3.** ", "Carve the edges of the cake to make it more rounded, then crumb coat (see Buttercream Basics) using light brown buttercream.", "\n\n**4.** ", "Prepare three shades of brown buttercream in separate piping bags, with the tip cut off to create a medium-size hole or with a Wilton writing nozzle no.5.", "\n\n**5.** ", "Start piping from the inner part of the wreath, working over the top edge then cover the outer side as you go round. ", "Use more of the lightest brown and occasionally swap to the other two colours. ", "Pipe the twigs in sections rather than just going all round the cake in one colour.", "\n\n**6.** ", "Pipe the pine cones onto a bread stick in dark brown buttercream with the Wilton petal nozzle 102, using the Rose piping technique (see Piping Flowers) but keeping all the 'petals' short. ", "If you find this challenging, you can freeze the pinecones instead, as you would a rose.", "\n\n**7.** ", "Build up the pinecone with more layers of 'petals' until it looks rounded.", "\n\n**8.** ", "Position each pinecone and stick the breadstick into the cake to hold it in place. ", "You can use a cocktail stick (toothpick) to help the breadstick into the cake.", "\n\n**9.** ", "Use plain buttercream to pipe some blobs to determine the position of the flowers and to give them something to sit on to get them at the right angle.", "\n\n**10.** ", "Pipe the flowers as follows: the camellias in cream using Wilton petal nozzle 104 (see Ruffle Flowers four and five) with yellow and green centre spikes; then the orange and dark orange flowers using the Wilton leaf nozzle 74, and sunflowers in dark yellow and dark brown using the Wilton petal nozzle 352 (see Piping Flowers for both).", "\n\n**11.** ", "Pipe some leaves in green using the Wilton petal nozzle 352 and make sure that there are no big gaps left between the flowers.", "\n\n**12.** ", "Pipe the branches for the berries in dark brown buttercream, using a piping bag with a medium-size hole at the tip, then pipe the berries using the Wilton writing nozzle no.5 with red buttercream. ", "If there are any unsightly peaks, wait until the buttercream is crusted and just press them down with a finger.", "\n\n# TERRARIUM\n\nHere we have used a terrarium, not to hold small plants, but to contain an absolute treat of a chocolate cake – biscuits, pistachios and luscious buttercream carefully arranged all together inside the glass. ", "Not only is this idea a truly unusual approach, but it is also delightfully delicious.", "\n\n### You will need\n\n * 20cm (8in) round or square chocolate cake, 10cm (4in) high\n * 400–500g (14oz–1lb 2oz) chocolate buttercream\n * 100–200g (31⁄2–7oz) light green buttercream (Sugarflair Gooseberry)\n * 100–200g (31⁄2–7oz) medium green buttercream (Sugarflair Gooseberry)\n * Wilton nozzle 150\n * Wilton open star nozzle 6B\n * Piping bags\n * Flower nail\n * Baking (parchment) paper\n * Scissors\n * Digestive biscuits (graham crackers)\n * Moss and leaf green edible dust powders\n * Re-sealable plastic bag\n * Pistachio nuts\n * Terrarium glass\n * Tray or cake board\n * Spoon\n\n**1.** ", "Pre-pipe and freeze five or six succulent plants in light and medium green buttercream, some 'rose-like' and some 'spiky' (see Piping Flowers).", "\n\n**2.** ", "Crumble the biscuits to fine crumbs. ", "Place in a re-sealable bag and add moss and leaf green edible dust powder then shake until you get an even colour.", "\n\n#### TIP\n\nYou can use a clear glass cake stand with a dome cover as an alternative if you cannot find a terrarium glass ball. ", "Then use a big spoon, fork, tongs or even a small sweet-shop scoop with a pretty ribbon tied around it to serve.", "\n\n**3.** ", "Crush some pistachio nuts to make small bits.", "\n\n**4.** ", "Cut about a quarter of the cake and break it into pieces, rubbing them together to crumble them into a bowl.", "\n\n**5.** ", "Cut the remaining cake into small bite-size squares.", "\n\n**6.** ", "Pipe a thin layer of chocolate buttercream on two sides, or all sides, of a cake square, then dip it into the crushed biscuits. ", "Repeat with all the other cake squares.", "\n\n**7.** ", "Lay them out on a board, cover with cling film then set them aside. ", "You can cover all the sides of the cake squares with frosting and biscuit if you prefer.", "\n\n**8.** ", "Scoop the crumbled cake and biscuit into the terrarium and gently mix together with a spoon.", "\n\n**9.** ", "Put the crumbled cake and cake squares into the terrarium, arranging them randomly.", "\n\n**10.** ", "Sprinkle in the crushed pistachio nuts. ", "You can also add other types of nuts if you wish. ", "We chose pistachios as they match the moss colour of the crushed biscuits. ", "You can also use small chocolate chips to look like stones or rocks.", "\n\n**11.** ", "Finally, put your frozen succulents inside. ", "Arrange them as you wish.", "\n\n# ENCHANTED FOREST FLOWERS\n\nThis is our contemporary take on a rustic log cake. ", "It's a million miles from the traditional chocolate Swiss roll! ", "We have created a log with a realistic bark texture, topped with a display of pale and elegant flowers. ", "We think the contrast both enhances and highlights the two elements.", "\n\n### You will need\n\n * 20cm (8in) square cake, 10cm (4in) high\n * 400–500g (14oz–1lb 2oz) brown buttercream (Wilton Brown)\n * 100–200g (31⁄2–7oz) dark brown buttercream (Sugarflair Dark Brown)\n * 100–200g (31⁄2–7oz) white buttercream (Sugarflair Super White powder)\n * 100–200g (31⁄2–7oz) dark yellow buttercream (Sugarflair Autumn Leaf)\n * 100–200g (31⁄2–7oz) light yellow buttercream (Sugarflair Melon)\n * 100–200g (31⁄2–7oz) light purple buttercream (Sugarflair Grape Violet)\n * 100–200g (31⁄2–7oz) pale green buttercream (Sugarflair Gooseberry)\n * 100–200g (31⁄2–7oz) dark green buttercream (Sugarflair Spruce Green)\n * Baking (parchment) paper\n * Pencil\n * Scissors\n * Serrated knife\n * Piping bags\n * Palette knife\n * Small tip palette knife\n * Wilton petal nozzle 104\n * Wilton leaf nozzle 352\n * Wilton chrysanthemum nozzle 81\n * Round cookie cutter (optional)\n\n**1.** ", "Pre-pipe and freeze three white and four light yellow roses using the petal nozzle 104 (see Piping Flowers). ", "Then cut the cake equally in half, and fill and stack the two halves one on top of the other.", "\n\n**2.** ", "Cut a circle of baking (parchment) paper with a diameter the same as the width of the cake. ", "Make another identical circle and stick them to both ends of the cake. ", "Then trim off the top with a serrated knife, to make it level with the top of your guide circles.", "\n\n#### TIP\n\nYou can use the cake trimmings to make cakepops mix by adding a small amount of buttercream to the crumbled cake and mashing it together. ", "This mixture comes in handy to raise up the position of the flowers on the log.", "\n\n**3.** ", "Carve the cake into a log shape by following the guide circles. ", "Leave the baking paper on both ends of the cake.", "\n\n**4.** ", "Apply the brown buttercream all over the cake except the ends. ", "Use the palette knife to even out the buttercream with short horizontal strokes.", "\n\n**5.** ", "Apply blobs of dark brown buttercream and blend with the palette knife using a circular motion. ", "Repeat the same process with a few blobs of dark yellow buttercream.", "\n\n**6.** ", "Repeat the short horizontal strokes using the small tip palette knife to create a realistic bark effect.", "\n\n**7.** ", "Add small blobs of white buttercream and repeat the same short strokes.", "\n\n**8.** ", "Peel off the baking paper circles on the ends of the cake. ", "Apply dark yellow buttercream on both ends, then blend with small blobs of dark brown buttercream using the same palette knife technique.", "\n\n**9.** ", "Apply blobs of buttercream on top of the log and position the frozen roses.", "\n\n**10.** ", "Pipe the chrysanthemums using the Wilton nozzle 81 in light purple and white with pale geen centres directly onto the cake (see the Charming Chalkboard cake, step 8) to fill in the gaps between the roses.", "\n\n**11.** ", "Pipe the leaves between the flowers with the leaf nozzle 352 using dark green buttercream.", "\n\n#### TIP\n\nTo create the slice of log, use a round cookie cutter or a knife to cut a circle from the excess cake and cover it using the same techniques as described for the log.", "\n\n# Shabby Chic\n\n# VINTAGE BIRD CAGE\n\nMuch sought after, vintage bird cages are a favourite amongst collectors of unusual antique items. ", "The shape lends itself perfectly to a domed, single-tier cake, and there are endless possibilities for adding decorative scrolls, flowers or even a bird to create an amazing piece of cake art. ", "Choose elements that compliment the texture and colour of the bird cage to achieve a real masterpiece.", "\n\n### You will need\n\n * 15cm (6in) round cake, 13cm (5in) high\n * One 15cm (6in) dome-shaped cake\n * Two 15cm (6in) round cake boards\n * 20cm (8in) round cake board\n * 800–900g (1lb 12oz–2lb) plain buttercream\n * 500–600g (1lb 2oz–1lb 5oz) cream buttercream (Sugarflair Cream)\n * 200–300g (7–101⁄2oz) chestnut buttercream (Sugarflair Chestnut)\n * 200–300g (7–101⁄2oz) lilac buttercream (Sugarflair Lilac)\n * 200–300g (7–101⁄2oz) purple buttercream (Sugarflair Grape Violet)\n * 200–300g (7–101⁄2oz) peach buttercream (Sugarflair Peach)\n * 200–300g (7–101⁄2oz) light green buttercream (Sugarflair Gooseberry)\n * Dowels\n * Sharpener\n * Baking (parchment) paper\n * Scissors\n * Scraper\n * String or thread\n * Piping bags\n * Wilton small star nozzle 16\n * Wilton petal nozzle 103\n * Wilton petal nozzle 104\n * Wilton leaf nozzle 352\n * Pen or pencil\n * Glue\n * Flower nail\n\n**1.** ", "Assemble the cake with cake boards in between the second and third layers and one central dowel (see Buttercream Basics). ", "You will need to glue the cake boards together and make a hole in the centre of them before you assemble the stack of cakes so that you can push the central dowel through easily.", "\n\n**2.** ", "Crumb coat and cover the cake with a smooth coat of cream buttercream (see Buttercream Basics), then cut a strip of baking (parchment) paper and wrap it around to measure the circumference of the cake.", "\n\n**3.** ", "Fold the strip in half again and again until you have as many folds as you want cage bars, and the spaces between look about right, or measure the strip and divide it up. ", "Next cut along two adjacent folds to create a paper guide for the spacing of the cage bars.", "\n\n**4.** ", "Use a ruler or scraper to mark a vertical line the full height of the straight side of the cake, then use the paper guide to measure and mark the positions of the bars, around the top and bottom, with a cocktail stick (toothpick). ", "Connect the marks with a ruler or scraper.", "\n\n**5.** ", "Cut a strip of parchment paper 2.5cm (1in) in height. ", "Use it to measure and mark the height for the scroll design.", "\n\n**6.** ", "To mark the position of the bars on the curved part of the cage, use a piece of string or thread. ", "Align the string to a vertical mark on the side of the cake, then carefully press down the string all the way to the centre of the top. ", "Repeat with all the bars.", "\n\n**7.** ", "Use the opening of a large nozzle or a small round cookie cutter or plunger to mark the curve for the scroll design. ", "Make sure you mark only the upper half of the circle.", "\n\n**8.** ", "Use chestnut buttercream in a piping bag with a small hole at the tip to pipe a small shell border (see Piping Textures) for all the bars following your guide marks.", "\n\n**9.** ", "Use the Wilton small star nozzle 16 and chestnut buttercream to pipe the scroll design at the top of the cake sides (a) and loops all around the bottom of the cake (b).", "\n\n**10.** ", "Add a conical swirl of chestnut buttercream using the Wilton small star nozzle 16 at the top of the bird cage.", "\n\n**11.** ", "Pipe and freeze roses (see Piping Flowers) in assorted sizes using lilac and lavender buttercream. ", "Pipe a blob of cream buttercream and stick the roses on the top and at the base of the cake, then pipe ruffle flowers (see Piping Flowers) using peach buttercream and a Wilton petal nozzle 103, with chestnut centres.", "\n\n**12.** ", "Using a piping bag with a small hole at the tip, pipe short wavy green vines down from under the roses. ", "Pipe short spikes alternating on both sides of the vines. ", "Pipe some leaves using the Wilton leaf nozzle 352 in between the flowers.", "\n\n#### TIP\n\nWhen covering a curved surface with buttercream, it's very helpful to have some sort of bendy plastic material handy to help you smooth the surface because you can bend it to match the shape of your desired curve. ", "It could be a thick plastic folder, a mylar or stencil sheet, a plastic placemat, or something similar.", "\n\n# A PAIL OF ROSES\n\nA vintage enamel bucket in the most charming shades of blue, brimming with pastel roses, is so evocative of summer in the garden. ", "This is a simple shape to make with just a little cake carving and allows you to show off your rose piping skills for a special gardening friend's birthday or anniversary.", "\n\n### You will need\n\n * 15 x 10cm (6 x 4in) square cake, 30cm (12in) high\n * 10 x 10cm (4 x 4in) round cake or 15cm (6in) dome shaped cake\n * 1kg (2lb 4oz) light blue buttercream (Sugarflair Navy Blue)\n * 300g (101⁄2oz) dark grey buttercream (Sugarflair Liquorice)\n * 100–200g (31⁄2–7oz) light grey buttercream (Sugarflair Liquorice)\n * 300g (101⁄2oz) light peach buttercream (Sugarflair Peach)\n * 300g (101⁄2oz) medium peach buttercream (Sugarflair Peach)\n * 300g (101⁄2oz) light green buttercream (Sugarflair Gooseberry)\n * 300g (101⁄2oz) green buttercream (Sugarflair Spruce Green)\n * Cake board\n * Serrated knife\n * Wilton nozzle no.81\n * Wilton petal nozzle 104\n * Wilton leaf nozzle 352\n * Piping bags\n * Palette knife\n * Cake scraper\n * Non-woven cloth\n * Baking (parchment) paper\n * Scissors\n * Pen or pencil\n * Bread sticks or thick straight pretzels\n\n**1.** ", "Before you begin shaping the cake, pipe and freeze 24 roses (you may end up with a few spares) using light and medium peach and light green buttercream (see Piping Flowers). ", "Stack and dowel the cake (see Buttercream Basics) and place it on a cake board but not the final one you will display the cake on. ", "Draw a circle 2.5–5cm (1–2in) smaller than the actual size of your cake on baking (parchment) paper to use as a guide for cutting.", "\n\n**2.** ", "Measure 5cm (2in) up from the bottom of the cake, and mark a line all around the cake.", "\n\n#### TIP\n\nBecause the bottom of the bucket is smaller than the top it is best to start measuring and carving from the smaller end first then just turn the cake upside down.", "\n\n**3.** ", "Holding your paper guide circle firmly on the top of the cake, start carving diagonally from the edge of the circle down to the guide line near the bottom.", "\n\n**4.** ", "You can also level off around the bottom part of the cake until you get the right 'inverted bucket' shape.", "\n\n**5.** ", "Add a thin layer of buttercream on the uppermost surface before putting your final board on top. ", "Insert your hand underneath the lower board, hold both boards firmly, then quickly turn the cake upside down.", "\n\n**6.** ", "The wider surface should then be at the top. ", "Place the 10cm (4in) round cake (carved into a small half dome) or a dome-shaped cake on top.", "\n\n**7.** ", "Crumb coat the dome cake with untinted buttercream and the rest of the cake in light blue (see Buttercream Basics). ", "Chill in the fridge for about 15–20 minutes or until firm. ", "Add another layer of blue buttercream to the bucket part, then use a scraper to even out the buttercream.", "\n\n**8.** ", "Using dark grey buttercream in a piping bag with a small hole cut at the tip, pipe random blobs around the cake. ", "Ensure they are roughly evenly spaced. ", "Then using your palette knife, smear the dark grey buttercream to the blue background using small circular motions.", "\n\n**9.** ", "Use your cake scraper to even out the surface and to blend the colour better. ", "Scrape in both directions (to the left and to the right) then lightly smooth it with the non-woven cloth (see Buttercream Basics).", "\n\n**10.** ", "Add the bucket details using the Wilton nozzle no.81 with the curved part of the nozzle uppermost, and with the nozzle touching the surface. ", "Start at one end and continuously squeeze the piping bag with an even pressure as you move your hand in a tight back and forth movement to give an even texture. ", "Do this at the top edge and the 5cm (2in) mark all the way around the cake.", "\n\n**11.** ", "Use a cocktail stick (toothpick) to mark where the handle of the bucket should go, then using your light grey buttercream, pipe a loop border following your guide. ", "You can either use the Wilton nozzle no.81 or make a medium-size hole at the tip of your piping bag.", "\n\n**12.** ", "Pipe blobs of buttercream at the top to allow you to position the frozen roses at the right angle. ", "Alternate the colours then pipe leaves in between the gaps.", "\n\n#### TIP\n\nTo make the stem of the roses, cut the breadsticks to your desired length then cover them with Wilton Green Chocolate Candy Melts. ", "Place on baking paper to become firm. (", "See Autumn Wreath pinecones for instructions on how to pipe roses on breadsticks.)", "\n\n# BOX OF DELIGHTS\n\nHere we have taken what appears to be a shabby package, wrapped in old newspaper, and created a stunning couture ruffles box of deliciously muted colours. ", "Like finding a vintage sewing box or a forgotten parcel of ribbon brooches we hope that the frills, buttons and pearls of this little treasure trove will appeal to you as much as it does to us.", "\n\n### You will need\n\n * 30cm (12in) square cake, 7.5cm (3in) high\n * 200–300g (7–101⁄2oz) dusky pink buttercream (Sugarflair Dusky Pink)\n * 200–300g (7–101⁄2oz) peach buttercream (Sugarflair Peach)\n * 200–300g (7–101⁄2oz) cream buttercream (Sugarflair Caramel)\n * 200–300g (7–101⁄2oz) light chestnut buttercream (Sugarflair Chestnut)\n * 200–300g (7–101⁄2oz) dark chestnut buttercream (Sugarflair Chestnut)\n * 200–300g (7–101⁄2oz) green buttercream (Sugarflair Spruce Green)\n * 200–300g (7–101⁄2oz) grey buttercream (Sugarflair Liquorice)\n * 200–300g (7–101⁄2oz) light brown buttercream (Sugarflair Dark Brown)\n * Printed wafer paper\n * Piping gel\n * Small bowl\n * Paint brush\n * Piping bags\n * Baking (parchment) paper\n * Scissors\n * Wilton petal nozzle 104\n * Wilton petal nozzle 103\n * Wilton nozzle 150\n * Wilton nozzle 97L\n * Wilton star nozzle 2D\n\n**1.** ", "Cut the cake in half and stack the two halves one on top of the other. ", "Next crumb coat the cake (see Buttercream Basics).", "\n\n**2.** ", "Tear the printed wafer paper sheet into irregular pieces, then position and stick them to the cake. ", "Use piping gel and lightly brush the back of the wafer paper before sticking each piece to the cake.", "\n\n**3.** ", "Pipe about 21 guide circles to indicate the position of the ruffles on the top of your cake.", "\n\n**4.** ", "Pipe the ruffles onto the cake (see Piping Flowers) with a blob of buttercream beneath, use the photo as a guide.", "\n\n# Geometric\n\n# PASTEL PATCHWORK\n\nSimple squares can create a very contemporary look, particularly when you restrict them to a delicate pastel palette. ", "Keep your squares perfectly square and be accurate with your piping otherwise the effect won't be as good. ", "We've used a different colour combination or texture for each square, mixing the simple and the more intricate. ", "The pale shades enhance the perfection of each square.", "\n\n### You will need\n\n * 20 x 20cm (8 x 8in) square cake, 10cm (4in) high\n * 200–300g (7–101⁄2oz) light blue buttercream (Sugarflair Navy Blue)\n * 200–300g (7–101⁄2oz) light pink buttercream (Sugarflair Claret)\n * 200–300g (7–101⁄2oz) light purple buttercream (Sugarflair Grape Violet)\n * 200–300g (7–101⁄2oz) light green buttercream (Sugarflair Gooseberry)\n * 200–300g (7–101⁄2oz) light blue-green buttercream (Sugarflair Spruce Green)\n * 200–300g (7–101⁄2oz) light peach buttercream (Sugarflair Honey Gold)\n * Baking (parchment) paper\n * Scissors\n * Scraper\n * Short angled palette knife\n * Small piece of cardboard\n * Non-woven cloth\n * Wilton chrysanthemum nozzle 81\n * Wilton small star nozzle 14\n * Wilton plain round nozzle 5\n * Wilton basketweave nozzle 47\n * Piping bags\n * Coupler\n\n**1.** ", "Stack and crumb coat your cake (see Buttercream Basics). ", "Cut a square of baking (parchment) paper the same size as the top of the cake. ", "Fold it to divide the paper into nine small equal squares.", "\n\n**2.** ", "Cut one column of the guide paper and position it on the top of the cake. ", "Use a scraper or ruler to mark out three columns.", "\n\n#### TIP\n\nYou can use all sorts of other piping techniques to fill the designs for each patch – scrolls, criss-crosses, dots, small piped flowers or anything else you can think of.", "\n\n**3.** ", "Repeat the process to mark the rows. ", "Do the same on the sides of the cake as well.", "\n\n**4.** ", "Divide some squares into two, either into rectangles or triangles, using either a scraper or a small piece of cardboard. ", "Apply any choice of tinted buttercream and even it out with the palette knife or the cardboard.", "\n\n**5.** ", "Smooth the triangles and rectangles with a non-woven cloth and scraper (see Buttercream Basics).", "\n\n**6.** ", "Trim the sides of the shapes in order to make them really straight. ", "Use a scraper, press down and pull it away from the patch. ", "With the edges straight you can repeat steps 4–6 to fill in the other halves of the patches with another colour.", "\n\n**7.** ", "If the patch is on the corner edge of the cake, use a scraper and cut downwards. ", "Fill the remaining patches with a variety of colours and textures by swapping the nozzles between different colours of buttercream.", "\n\n**8.** ", "When piping the shell design, start from the outer edge using the Wilton plain round nozzle 5. ", "Hold the piping bag at about an 80-degree angle with the opening of the nozzle touching the surface, squeeze until the buttercream builds up then pull the nozzle down.", "\n\n**9.** ", "When using the chrysanthemum nozzle, make sure the curved part is facing upwards while the two points face down and touch the surface. ", "Start at one end and continuously squeeze the piping bag with an even pressure as you move your hand in a tight back and forth movement to give an even texture.", "\n\n**10.** ", "To fill a patch with small stars, start at one end then hold the piping bag at a 90-degree angle with the opening of the nozzle touching the surface, and gently give the bag a good squeeze until it creates a small star. ", "Repeat the same process and make sure you pipe the stars very close together (but not actually overlapping) so that there are no gaps in between.", "\n\n**11.** ", "To fill a patch using the basketweave nozzle, start at one end choosing either of the sides of the nozzle. ", "Squeeze the piping bag with constant pressure and slowly pull the piping bag down or away. ", "Flip the bag over to pipe alternate stripes of the jagged side of the nozzle and the smooth side.", "\n\n#### TIP\n\nThis design is very flexible and can be used to create a cake for both men and women. ", "Explore the use of other nozzles and colour combinations to suit your occasion – imagine using gradient colours of pink or blue, it would look amazing! ", "You can also be playful with the shapes. ", "You don't always have to have square patches.", "\n\n# AZTEC-INSPIRED CHEVRONS\n\nThe intricate look of this cake has less to to with the technique of creating it, which is actually really simple, but is based instead on the final effect of the interlocking shapes. ", "We have used a simple small loops piping texture that looks like crochet to make 'V' and inverted 'V' shapes, or chevrons. ", "The result is an impressively distinguished looking pattern.", "\n\n### You will need\n\n * 20cm (8in) round cake, 10cm (4in) high\n * 500–600g (1lb 2oz–1lb 5oz) light chestnut buttercream (Sugarflair Chestnut)\n * 100–200g (31⁄2–7oz) brown buttercream (Sugarflair Dark Brown)\n * 100–200g (31⁄2–7oz) chestnut buttercream (Sugarflair Chestnut)\n * 100–200g (31⁄2–7oz) cream buttercream (Sugarflair Cream)\n * 100–200g (31⁄2–7oz) blue buttercream (Sugarflair Aztec Blue)\n * Baking (parchment) paper\n * Ruler\n * Pencil\n * Scissors\n * Small piece of cardboard\n * Piping bags\n * Scraper or piece of cardboard\n * Wafer paper feathers\n\n**1.** ", "Stack, crumb coat and cover the cake in a smooth coat of light chestnut buttercream (see Buttercream Basics). ", "Then cut a strip of baking (parchment) paper that is the exact height and circumference of the covered cake.", "\n\n**2.** ", "Keep folding the parchment paper in half until you get sections between the folds of about 1.5cm (5⁄8in) width.", "\n\n#### TIP\n\nThis cake design can easily be changed to a different colour scheme to suit your recipient, whether male or female. ", "You can also change the wafer paper appliqué to anything that would suit the design.", "\n\n**3.** ", "Measure 2.5cm (1in) in from one long side and draw a guide line in pencil.", "\n\n**4.** ", "Create the chevron shape as shown in the photograph using the folds and the pencil line to guide you.", "\n\n**5.** ", "Cut out the chevron pattern then place it on the side of the cake with the single point upwards. ", "Use a cocktail stick (toothpick) to mark the outline. ", "Repeat the process to mark chevrons all round the cake side, with each one touching the ones on either side.", "\n\n**6.** ", "Use a small piece of cardboard to mark the centre line and a line across the bottom section of each pattern, then divide the inside of the top part into five strips on each side of the central line. ", "Do this to the bottom part of the chevron as well.", "\n\n**7.** ", "Pipe the crochet loops (see 'To pipe the crochet texture') starting from the outermost edge of the pattern. ", "Use brown buttercream for the first rows.", "\n\n**8.** ", "Repeat the same process and pipe the crochet texture on the top half of all the chevron patterns using the rest of the colours in the order: chestnut, cream and blue.", "\n\n**9.** ", "Repeat the same process to complete the bottom of the chevrons. ", "Make sure you match the rows with the same colour that you used on the top part of the pattern.", "\n\n**10.** ", "Fill in the small triangles left at the base of the chevrons using the same process to pipe the crochet texture. ", "Start the colours again with dark brown, then chestnut and so on.", "\n\n**11.** ", "Make the wafer paper feathers by following the instructions in the techniques section. ", "Attach them by applying a small blob of buttercream where you want them to be positioned.", "\n\n**12.** ", "Firmly hold the feathers in place for a few seconds to make sure they adhere, before letting go.", "\n\n### To pipe the crochet texture\n\nPipe two rows of small loops for each colour in the chevron shapes. ", "To pipe the loops, take a piping bag with a small hole at the tip and hold it straight on to the cake with the tip always touching the surface. ", "The first row of loops needs to be counter-clockwise, then the second row is clockwise and slightly overlaps the first row. ", "You can use a Wilton writing nozzle no.1 if you prefer.", "\n\n# BLACK AND WHITE PINSTRIPE\n\nWho wouldn't be drawn to the elegance of a black and white cake? ", "Its simplicity makes it even more dramatic. ", "The vertical pinstripe effect on the sides of the cake has the effect of making it seem taller. ", "To balance this, and at the same time provide a burst of colour, we've added a cascade of button-like flat ruffles, sparkling with lovely edible pearls.", "\n\n### You will need\n\n * 15cm (6in) round cake, 15cm (6in) high\n * 1kg (2lb 4oz) white buttercream (Sugarflair Super White powder)\n * 100–150g (31⁄2–51⁄2oz) light yellow buttercream (Sugarflair Melon)\n * 100–150g (31⁄2–51⁄2oz) medium yellow buttercream (Sugarflair Melon)\n * 100–150g (31⁄2–51⁄2oz) grey buttercream (Sugarflair Liquorice)\n * 200–300g (7–101⁄2oz) black buttercream (Sugarflair Liquorice)\n * Baking (parchment) paper\n * Ruler\n * Pen or pencil\n * Scissors\n * Serrated knife\n * Short angled palette knife\n * Flower nail\n * Piping bags\n * Scraper\n * Wilton nozzle 150\n * Wilton basketweave nozzle 47\n * Wilton small round nozzle 5\n * Large pearl dragees (sugar balls)\n * Tweezers\n\n**1.** ", "Stack and dowel the cake (see Buttercream Basics), then cut a piece of baking (parchment) paper measuring the exact height and circumference of the cake.", "\n\n**2.** ", "Fold the paper in half along the side that is the circumference of the cake. ", "On the edge opposite the fold, make a pen mark 2.5cm (1in) from the top, then draw a line from your mark diagonally to the top corner of the folded edge. ", "Trim along the line with scissors.", "\n\n#### TIP\n\nWhen you pipe the stripes it is best that you start from the bottom and pipe upwards. ", "You can use a scraper or ruler to mark straight lines as your guide and just squeeze the piping bag evenly as you quickly pull the bag up to avoid frills.", "\n\n**3.** ", "Wrap the baking paper back around the cake and cut with a serrated knife, following your paper guide, to create a sloping top for the cake.", "\n\n**4.** ", "Cut small baking paper squares and draw a circle as a size guide. ", "Stick the squares to a flower nail with a blob of buttercream. ", "Hold the Wilton nozzle 150 flat on the surface with the outer edge of the nozzle touching your guide circle. ", "Continuously squeeze the bag as you move your hand in a tight back and forth motion, turning the flower nail and following the guide circle. ", "Repeat to create at least three light yellow, medium yellow and grey ruffles, then freeze them.", "\n\n**5.** ", "Crumb coat the cake (see Buttercream Basics). ", "Start piping the stripes on the side of the cake using the Wilton basketweave nozzle 47. ", "Use the jagged edge for white and the smooth side for black. ", "Pipe from the bottom to the top edge of the cake.", "\n\n#### TIP\n\nPipe a couple of spare ruffles so you have some back-ups in case they break when you peel them off the baking paper. ", "They are very delicate as they are made with just a thin layer of buttercream. ", "You also need to work rather quickly when applying them, so that they don't melt before you get the chance to position them. ", "Only press the ruffles in the centre when applying them to the cake so they do not become completely flattened to the surface. ", "They should look three-dimensional.", "\n\n**6.** ", "Use the Wilton round nozzle no.5 with white buttercream to cover the top of the cake with a spiral starting from the outer edge and going in. ", "Make sure that there are no gaps in the spiral, and don't lift your piping bag otherwise the buttercream will curl up.", "\n\n**7.** ", "Determine where you wish to apply the flat ruffles and then pipe a small blob of buttercream on the cake surface for the first ruffle.", "\n\n**8.** ", "Quickly peel off a frozen flat ruffle and position on the cake. ", "Press gently so it adheres properly. ", "Repeat to attach all the ruffles to the cake.", "\n\n**9.** ", "Pipe a small blob of buttercream in the centre of each of the flat ruffles and quickly apply a pearl dragee (sugar ball) using tweezers. ", "Press it gently with your finger.", "\n\n# Metallic\n\n# SPARKLING SENSATION\n\nA real show stopper that features edible silver and gold leaf, this cake is proof that even if you feel you lack artistic flair you can still achieve a real work of art with a few palette knife strokes and some sparkle. ", "Use a light hand when blending the colours with your knife and tweezer the metallic leaf into position. ", "You probably won't need anything to make the leaf adhere to the moist surface – buttercream loves gold and silver!", "\n\n### You will need\n\n * 15cm (6in) round cake, 15cm (6in) high\n * 500–600g (1lb 2oz–1lb 5oz) white buttercream cake (Sugarflair Super White powder)\n * 100–200g (31⁄2–7oz) light blue buttercream (Sugarflair Navy Blue and a hint of Baby Blue)\n * 100–200g (31⁄2–7oz) medium blue buttercream (Sugarflair Navy Blue)\n * 100–200g (31⁄2–7oz) grey buttercream (Sugarflair Liquorice)\n * 100–200g (31⁄2–7oz) green buttercream (Sugarflair Spruce Green)\n * 100–200g (31⁄2–7oz) peach buttercream (Sugarflair Peach)\n * 50–100g (13⁄4–31⁄2oz) yellow buttercream (Sugarflair Autumn Leaf)\n * Piping bags\n * Scissors\n * Scraper\n * Short angled palette knife\n * Small bowl of water\n * Tweezers\n * Edible gold and silver leaves\n * Wilton petal nozzle 104\n * Wilton petal nozzle 103\n\n**1.** ", "Stack and crumb coat your cake, then apply a coat of white buttercream (see Buttercream Basics). ", "Even out the buttercream on the sides with a scraper after applying it. ", "The surface doesn't need to be perfectly smooth.", "\n\n**2.** ", "For the top of the cake, after applying the buttercream, even it out with a scraper and use the tip of your palette knife to make a spiral texture starting from the edge of the cake and moving towards the centre.", "\n\n**3.** ", "Use a cocktail stick (toothpick) to make a guide mark as to where you will apply your gold and silver leaves.", "\n\n**4.** ", "Pipe small blobs of light blue buttercream all around the bottom part of the cake. ", "Make the blobs random but roughly evenly spaced. ", "Keep below the line you have marked by about 5cm (2in).", "\n\n**5.** ", "Spread the buttercream with the tip of your palette knife using upward strokes. ", "Avoid going back and forth too much.", "\n\n**6.** ", "Repeat the same process with medium blue and grey buttercream, but use less grey than the blues.", "\n\n**7.** ", "Add just a few hints of both blues and the grey above the line. ", "Do not overdo it. ", "If the buttercream is starting to crust and it becomes hard to spread the colours, dip the tip of your palette knife into a little water. ", "Make sure that you do not put too much water on your cake though.", "\n\n**8.** ", "Using your tweezers, peel a small piece of gold leaf and apply it to the cake following your guide mark.", "\n\n**9.** ", "Repeat the process to build up the gold and silver leaves to cover your guide mark. ", "Use more gold leaves than silver. ", "You can also apply some metallic flecks randomly on the sides of the cake.", "\n\n**10.** ", "Pipe three leaves in green, radiating out from the point where a flower will be, using the Wilton petal nozzle 104 and a two-stroke piping technique (see Piping Flowers). ", "Pipe three more leaves for the second flower.", "\n\n**11.** ", "Pipe a blob of buttercream in the centre of each cluster of leaves to give the flower a nice volume. ", "Pipe a ruffle flower (see Piping Flowers) on top of each blob using the Wilton petal nozzle 103 with peach buttercream. ", "Add yellow dots to the flowers' centres using a piping bag with a small hole at the tip.", "\n\n#### TIP\n\nWhen applying the gold and silver leaves, make sure you use tweezers. ", "The metallic leaf is very delicate and will easily rip in your fingers. ", "Since fresh buttercream already has a sticky surface, the leaf easily adheres to it. ", "If the buttercream has crusted too much though, you can brush the surface with water or a very thin application of piping gel.", "\n\n# ALL GOLD\n\nAn opulent glow created with just the right combination of bronze and gold, makes this cake a gorgeous gift for someone who appreciates the finer things in life. ", "It is simplicity itself to create but makes a sublime statement, almost appearing to shine on its own.", "\n\n### You will need\n\n * 20cm (8in) square cake, 10cm (4in)\n * 700–800g (1lb 9oz–1lb 12oz) untinted buttercream\n * 200–300g (7–101⁄2in) dark yellow buttercream (Sugarflair Autumn Leaf)\n * Baking (parchment) paper\n * Small piece of cardboard or stiff paper\n * Ruler\n * Pen or pencil\n * Serrated knife\n * Scissors\n * Scraper\n * Palette knife\n * Piping bags\n * Cocktail stick (toothpick)\n * Airbrush machine\n * Dinky Doodle gold airbrush paint\n * Edible gold leaves\n * Piping gel\n * Paint brush\n * Small bowls\n * Rainbow Dust gold and bronze edible paint\n * Gold sugar sprinkles (nonpareils)\n * Wafer paper\n\n**1.** ", "In advance, pre-pipe around 30 to 35 small roses (see Piping Flowers) using untinted buttercream, and freeze them. ", "If you want the roses to look lighter, you can tint the buttercream white using Sugarflair Super White powder.", "\n\n**2.** ", "Carve your cake referring to the Toile de Jouy cake for instructions on how to prepare the octagonal shape. ", "Crumb coat, then cover the cake with a smooth coat of plain buttercream (see Buttercream Basics). ", "Use the cocktail stick (toothpick) to divide the cake into sections, making the lines slightly wavy rather than straight.", "\n\n**3.** ", "Choose the sections where you want the textured airbrushing to go. ", "Begin with these by applying a thin layer of dark yellow buttercream. ", "Use the tip of a narrow round-tip palette knife and sweep in a round motion in both clockwise and counter-clockwise directions.", "\n\n**4.** ", "Use edible gold airbrush paint and spray over the textured section until it is evenly coated. ", "Do not bring the spray gun too close to the surface or the colours may pool or drip.", "\n\n**5.** ", "Choose the sections you want to cover with edible gold leaf. ", "If the surface of the cake is still fresh, the gold leaf will easily adhere to the surface. ", "If not, brush the surface with a thin layer of piping gel. ", "Cut the gold leaf according to each section's shape then pull back one side of the backing paper and stick the gold leaf to the surface.", "\n\n**6.** ", "As the gold leaf sticks to the surface, gently slide your hand away and pull the rest of the backing paper out. ", "You can use the backing paper to rub the gold leaf gently to help it to stick more, instead of using your fingers as it will easily stick to them.", "\n\n**7.** ", "Choose the sections you want to paint with metallic colours. ", "Use the edible bronze paint to apply the first layer of colour. ", "Let it dry slightly for about 10 to 15 minutes then paint over with edible gold paint and lightly blend the two colours together.", "\n\n**8.** ", "The remaining sections will be filled with gold sugar sprinkles (non-pareils). ", "Apply a thin layer of piping gel on the surface using a paint brush.", "\n\n**9.** ", "Use your fingers to sprinkle the gold sugar sprinkles on the sections you need to fill. ", "You can also use a cocktail stick or a dry paint brush to spread out the tiny balls.", "\n\n**10** Prepare the gold wafer paper leaves by painting both sides with bronze paint first then smear it with gold (see the techniques section for information on using wafer paper). ", "Let it dry completely.", "\n\n**11.** ", "Cut small leaf shapes from the dried gold wafer paper using a pair of scissors.", "\n\n**12.** ", "Place the frozen roses all around the bottom of the cake. ", "Pipe small blobs of buttercream behind each one so it sticks and is slightly angled.", "\n\n**13.** ", "Insert the cut-out wafer paper leaves in between the roses.", "\n\n# PINK SHIMMER\n\nThere will always be something glamorous about shimmering metallic cakes. ", "The cascade of sparkling sugar crystals on this eye-catching creation brings a touch of sophistication, offering something decadent and yet remaining simple and modern.", "\n\n### You will need\n\n * 20cm (8in) round cake, 15cm (6in) high\n * 1kg (2lb 4oz) white buttercream (Sugarflair Super White powder)\n * 100–200g (31⁄2–101⁄2oz) black buttercream (Sugarflair Liquorice)\n * Airbrush machine\n * Dinky Doodle pearl and silver airbrush paint (oil-based)\n * 450–500g (1lb–1lb 2oz) jam making/preserving sugar (very big granules), or use granulated if you can't find preserving sugar.", "\n * Rainbow Dust pink and silver edible metallic paint\n * Re-sealable bags\n * Baking (parchment) paper\n * Palette knife\n * Tray or pizza pan\n * Paint brush\n * Piping gel\n * Scraper or piece of cardboard\n * Wafer paper\n * Sugarflair Liquorice food colouring paste\n * Florist wire gauge 27 (or anything thin)\n * Piping bags\n * Scissors\n * Small bowls\n\n**1.** ", "Refer to the techniques section for instructions on how to assemble the wafer paper flower. ", "Airbrush the tip of each of the petals with silver airbrush paint. ", "You can make this flower ahead of time (see Tip).", "\n\n**2.** ", "Stack and crumb coat, then cover the cake with a smooth coat of white buttercream (see Buttercream Basics). ", "When it is crusted enough, airbrush with pearl airbrush paint.", "\n\n#### TIP\n\nPrepare the wafer paper petals for the black flower individually in small, medium and large sizes, then put them together to create the flower. ", "You can airbrush the petals with pearl paint to match the cake if you wish.", "\n\n**3.** ", "Prepare the coloured sugar sprinkles by putting 150g (51⁄2oz) of preserving sugar in a re-sealable bag and then adding drops of pink edible metallic paint to it.", "\n\n**4.** ", "Shake the bag until the colour is evenly distributed. ", "You can add more colour to make it darker but be careful not to use too much as it can start to dissolve the sugar. ", "Repeat the same process to create a total of three different shades of pink.", "\n\n**5.** ", "Spread the sugar out on a piece of baking (parchment) paper to allow it to dry, using a palette knife. ", "Leave it to air dry overnight, or bake at 180°C or 350°F for ten minutes.", "\n\n**6.** ", "When dried, the colour will be lighter and it will look like chunks of sugar crystals. ", "You can put the sugar into a re-sealable bag once more and gently crush it to separate the crystals.", "\n\n**7.** ", "Place the cake on to a tray or a pizza pan then brush the bottom part of the cake with piping gel. ", "Brush it all around the cake covering the area where you want the darker sugar crystals to be. ", "Note that you will be flipping the cake over later, so the bottom will become the top.", "\n\n**8.** ", "Sprinkle the darkest pink sugar crystals all around the base and lightly press them on the cake, covering everywhere that the piping gel was brushed.", "\n\n**9.** ", "Repeat the same process creating layers above with the remaining two shades of pink. ", "When applying the sugar crystals to the cake, it is easier to use a piece of cardboard or scraper to apply these upper layers.", "\n\n**10.** ", "Give the last layer of sugar crystals a ragged uneven edge, to add drama to the design.", "\n\n**11.** ", "Pipe a thin layer of buttercream on top of the cake then place a cake board over it. ", "Hold the tray (or pizza pan) and the cake board firmly then quickly but carefully flip the cake over.", "\n\n**12.** ", "Apply a thin layer of black buttercream on top, let it crust, then smooth it.", "\n\n**13.** ", "Sprinkle the darkest shade of sugar crystals (the first one you used on the cake side) all around the top edge of the cake, then lightly press the crystals so they adhere to the cake properly.", "\n\n**14.** ", "Lightly airbrush with edible pearl paint all around the cake to give it even more sparkle and to cover up some of the gaps between the sugar crystals. ", "Finish by adding the wafer paper flower.", "\n\n# Eccentric\n\n# STEAMPUNK HAT\n\nSteampunk is all about mixing the style of the Victorian age with modern technological accessories. ", "It commonly features lots of brass, bronze or copper, and is very often accessorized with fashion features including corsetry, feathers and brooches. ", "Applying this theme to a cake means infusing all the details with quirky style and elegance.", "\n\n### You will need\n\n * 15cm (6in) round cake, 15cm (6in) high\n * 20cm (8in) round x 2.5cm (1in) thick styrofoam cake dummy\n * 800–900g (1lb 12oz–2lb) black buttercream (Sugarflair Liquorice)\n * 400–500g (14oz–1lb 2oz) brown buttercream (Sugarflair Dark Brown)\n * 30–50g (11⁄4–13⁄4oz) light brown buttercream (Wilton Brown)\n * 300–400g (101⁄2–14oz) dark violet buttercream (Sugarflair Grape Violet)\n * 300–400g (101⁄2–14oz) violet buttercream (Sugarflair Grape Violet plus Claret)\n * 50–100g (13⁄4–31⁄2oz) yellow buttercream (Sugarflair Autumn Leaf)\n * Dowels\n * Scissors\n * Baking (parchment) paper\n * Ruler\n * Pencil\n * Piping bags\n * Scraper\n * Impression mat\n * Airbrush machine\n * Non-woven cloth\n * Dinky Doodle gold airbrush paint\n * Wilton petal nozzle 103\n * Wilton petal nozzle 104\n * Brooch moulds\n * Small piece of card for marking\n * Gold dragees (sugar balls)\n * Tweezers\n * Wafer paper feather\n\n**1.** ", "Stack then carve the cake (see Buttercream Basics). ", "For guidance on how to achieve the correct shape refer to the Pail of Roses cake. ", "When you are happy with the shape, flip the cake over and crumb coat it (see Buttercream Basics).", "\n\n**2.** ", "Cut a strip of baking (parchment) paper about 2.5cm (1in) wide and the exact circumference of the cake, then position it 2.5cm (1in) down from the top edge of the cake. ", "From a square of baking paper 2.5cm (1in) shorter than the height of your cake, cut a big 'V' shape of whatever size you want the laced part of the design to be. ", "Cut it in two halves vertically and stick it to the freshly crumbcoated cake, then trim the baking paper strip to open up the top of the V, as shown. ", "Cover the cake top and inside of the V, as well as the styrofoam cake dummy, with black buttercream.", "\n\n**3.** ", "Let the black buttercream areas dry and crust at room temperature for a good 45 minutes to an hour, or until they are not sticky to the touch. ", "Then lightly press all the black buttercream with your impression mat. ", "Cover the cake dummy for the hat brim in the same way.", "\n\n**4.** ", "Lightly airbrush with gold, making sure that the spray gun is not too close to the cake so the colour does not pool on the surface or form drips. ", "Do the same on the styrofoam cake dummy.", "\n\n**5.** ", "Gently peel the baking paper off. ", "You can use a cocktail stick (toothpick) to help you carefully lift the paper up.", "\n\n**6.** ", "Cover the sides of the cake with brown buttercream. ", "Even it up with a scraper or palette knife then smooth with a non-woven cloth (see Buttercream Basics).", "\n\n**7.** ", "Pipe some random scrolls on all the sides using the same brown buttercream in a piping bag with a small hole at the tip. ", "Alternatively, you could use a Wilton writing nozzle no.1 if you prefer.", "\n\n**8.** ", "Next assemble the parts. ", "Place the covered styrofoam cake dummy onto your cake board then stack the cake on top of it, centrally. ", "Cut a piece of dowel that is the total height of the cake then insert it in the centre (see Buttercream Basics).", "\n\n**9.** ", "Use the petal nozzle 103 and dark violet buttercream to pipe the ruffles border (see Piping Textures) all around the top of the brown area, and along the edge of the V shape. ", "Always make sure that the wider part of the nozzle is at the bottom. ", "If you wish you can pipe two or three layers of ruffles – we stopped at one.", "\n\n**10.** ", "Pipe two or three layers of non-wavy ruffles in dark violet where the hat crown meets the brim.", "\n\n**11.** ", "Pipe some ruffle flowers (see Piping Flowers) in a variety of sizes and position your frozen rose or roses (see tip). ", "Then add the gold-airbrushed frozen brooch moulds in the centre of each ruffle flower.", "\n\n**12.** ", "Make criss-cross marks on the black V-shaped area using a small piece of card, then pipe over the marks using the loop border technique (see Piping Textures) using light brown buttercream. ", "Place edible gold balls on the point where the 'laces' meet the edging ruffles.", "\n\n#### TIP\n\nPre-pipe one or two roses using violet buttercream, and fill brooch moulds with yellow buttercream then freeze them in advance (see Piping Flowers). ", "Airbrush the brooches with gold when done.", "\n\n**13.** ", "Add the wafer paper feather to finish (see the techniques section for instructions on using wafer paper). ", "If you prefer, you can position this before you add the rose and ruffles.", "\n\n# NICELY SLICED\n\nWhy stick with one motif for a whole cake? ", "Here you can experiment with half a dozen complementary designs! ", "However you slice it, this cake creates a visual feast. ", "Even if you go for the simplest of patterns, this is still a show-stopping way to present a cake and is bound to impress.", "\n\n### You will need\n\n * 200–250g (7–9oz) of each of the following colours of buttercream: deep pink (Sugarflair Claret), blue (Sugarflair Baby Blue plus a hint of Navy), purple (Sugarflair Grape Violet), yellow (Sugarflair Melon with a hint of Autumn Leaf), orange (Sugarflair Orange), green (Sugarflair Spruce Green)\n * 100–150g (31⁄2–51⁄2oz) white buttercream (Sugarflair Super White powder)\n * 50g (13⁄4oz) red buttercream (Sugarflair Ruby Red)\n * 20cm (8in) round cake, 10cm (4in) high\n * Scraper\n * Non-woven cloth\n * Wilton nozzle 102\n * Wilton petal nozzle 103\n * Wilton leaf nozzle 352\n * Wilton star nozzle 14\n * Wilton ruffle nozzle 86\n * Piping bags\n * Baking (parchment) paper\n * Pencil or pen\n * Scissors\n * Serrated knife\n * Button moulds\n * Pearl dragees (sugar balls)\n\n**1.** ", "Cut out a circle of baking (parchment) paper that is the same size at the top of your cake.", "\n\n**2.** ", "Fold the paper in half, then fold twice more to make three equally sized triangles.", "\n\n#### TIP\n\nWe chose fun and bright colours for our theme, but why not see what effect you can achieve with pastel shades or maybe a monochromatic scheme? ", "Imagination is the only limitation!", "\n\n**3.** ", "Use a serrated knife to remove the top of the cake to create a flat surface. ", "Unfold the pattern to a half circle then place it over the cake, and follow the pattern to slice the cake.", "\n\n**4.** ", "Fold to a triangle again then repeat the same process. ", "Crumb coat and cover the slices with a smooth coat of your chosen colour of buttercream (see Buttercream Basics). ", "Then decorate as you wish, or by following one of our designs.", "\n\n##### Blue flowery slice\n\nMark a guide halfway up the sides of the slice and pipe ruffles all around using Wilton nozzle 86 (see Piping Textures). ", "Use white buttercream and Wilton nozzle 14 to pipe small flowers all over the upper part of the cake. ", "Top them with pink dragees (sugar balls). ", "Pipe a small ruffle flower on top (see Piping Flowers) and put a moulded buttercream button (see Moulds) in the centre, and finish off with some small leaves. ", "Pipe the top border using Wilton nozzle 14 in a tight zigzag motion.", "\n\n##### Pink slice\n\nPipe downward ruffles (see Piping Textures) starting from the top edge of the cake using Wilton petal nozzle 103 in two-tone pink (see Lace Romance cake). ", "Use Wilton leaf nozzle 352 to pipe long leaves. ", "Pipe small five- or six-petalled flowers on top using Wilton petal nozzle 102 and finish off with pearl dragees on the centres.", "\n\n##### Purple slice\n\nPipe a wavy border around the sides of the cake using Wilton basketweave nozzle 47 with the smooth side up, then pipe a shell border (see Piping Textures) all around the top edge of the cake. ", "You can add blue dragees on each corner for a little variation. ", "Pipe some scrolls on the top surface and a simple petal flower (see Piping Flowers) using Wilton petal nozzle 102 and finish off with a moulded buttercream button (see Moulds).", "\n\n##### Blue ribboned slice\n\nPipe some scrolls on the sides of the cake using just a piping bag with a small hole at the tip, or writing nozzle no.2. ", "Pipe some small random ruffle flowers (see Piping Flowers) directly on the side of the cake adding pearl dragees to the centres. ", "The top and bottom edges of the slice are decorated with a shell border (see Piping Textures). ", "On the top surface, use Wilton petal nozzle 102 and pipe a ruffled ribbon and finish with some pink dragees in the centre.", "\n\n##### Orange slice\n\nPipe back to back ruffles (see Piping Textures) on the side of the cake with a shell border where the ruffles meet, as well as along the top edge of the cake. ", "Pipe a single layer of ruffle using Wilton petal nozzle 102 at the top of the cake following the shape of the curve and finish off with colourful moulded buttercream buttons (see Moulds). ", "Pipe a bead border at the bottom edge.", "\n\n##### Yellow slice\n\nPipe some random swirls on the side of the cake using yellow buttercream. ", "Add back to back ruffles (see Piping Textures) topped with pearl dragees in a curve to echo the shape of the slice. ", "Use pink and red buttercream in a piping bag with a small hole at the tip and pipe two 'C's facing each other to create the small flower effect, and add short wavy lines for the leaves. ", "Pipe a contrasting shell border at the base and finish with dragees at the corners.", "\n\n# ALICE IN WONDERLAND\n\nThis is a really eccentric cake – it reflects our very active imaginations! ", "We wanted to create a fun design that plays with colours in an appealing and cheerful way. ", "The result is a cake fantasy that is actually produced using some pretty simple techniques. ", "And what could be more whimsical than a Mad Hatter's tea party theme?", "\n\n### You will need\n\n * Two 15cm (6in) half dome cakes\n * 30cm (12in) round cake board\n * 400–500g (14oz–1lb 2oz) plain buttercream\n * 500–600g (1lb 2oz–1lb 5oz) light pink buttercream (Sugarflair Claret)\n * 200–300g (7–101⁄2oz) dark yellow buttercream (Sugarflair Autumn Leaf)\n * 100–200g (31⁄2–7oz) light yellow buttercream (Sugarflair Honey Gold)\n * 100–200g (31⁄2–7oz) blue buttercream (Sugarflair Baby Blue plus Navy Blue)\n * 300–400g (101⁄2–14oz) yellow buttercream (Sugarflair Melon)\n * 300–400g (101⁄2–14oz) violet buttercream (Sugarflair Grape Violet)\n * 300–400g (101⁄2–14oz) red buttercream (Sugarflair Red Extra)\n * 300–400g (101⁄2–14oz) dark green buttercream (Sugarflair Spruce Green)\n * 100–200g (31⁄2–7oz) light green buttercream (Sugarflair Gooseberry)\n * 100–150g (31⁄2–51⁄2oz) dark pink buttercream (Sugarflair Scarlet)\n * Flower nail\n * Baking (parchment) paper\n * Scissors\n * Serrated knife\n * 15cm (6in) round, 2.5cm (1in) thick styrofoam board\n * Small palette knife\n * Piping bags\n * Wilton round nozzle no.10\n * Wilton writing nozzle no.5\n * Wilton petal nozzle 103\n * Wilton leaf nozzle 352\n * Wilton open star nozzle 1M\n * Wilton Candy Melts, pink\n * Small bowl for melting\n * Cocktail stick (toothpick)\n * Chocolate-covered pretzel\n * Pink chocolate button\n\n**1.** ", "Pre-pipe and freeze around 20 roses in red, violet and yellow buttercream (see Piping Flowers). ", "Join the two half dome cakes to make a sphere. ", "Using the serrated knife, trim off the rounded top, then make a downward cut from the top centre about 2.5cm (1in) deep, and another horizontal cut from the side to take out a segment as shown.", "\n\n**2.** ", "Flip the cake over and sit it on the clock as shown, with the part with the missing segment resting on the clock.", "\n\n**3.** ", "Trim off the rounded top of the cake to make it flat, then crumb coat (see Buttercream Basics). ", "Cover the cake with a smooth coat of light pink buttercream. ", "Using a large cake board (about 30cm/12in diameter) secure the cake firmly with a good amount of buttercream, or you may use a dowel (see Buttercream Basics) that goes through the cake board for added support.", "\n\n**4.** ", "Pipe ruffles all around the flat top part of the teapot using light yellow buttercream and petal nozzle 103. ", "Fill the centre as you pipe each layer of ruffles to make it into a slight dome.", "\n\n**5.** ", "Stack three or four pink buttons, created and frozen using a mould (see Moulds) on top of the ruffles in the centre, to look like the knob of the teapot lid.", "\n\n**6.** ", "Pipe some scrolls for stems onto the side of the teapot using light green buttercream in a piping bag with a small hole at the tip.", "\n\n### To make the clock\n\nFor the clock you can use a real cake, but we used a 15cm (6in) round, 2.5cm (1in) thick styrofoam board. ", "Just trim the top edge of the board to make it slightly rounded. ", "Cover the top with plain buttercream and blend in some dark yellow buttercream with a palette knife then smooth the surface (see the sky instructions in the Country Window cake). ", "Next, cover the side with dark yellow buttercream then pipe a simple border around the top with the round nozzle no.10, then a narrower one inside that with the writing nozzle no. ", "5. ", "Finally, pipe the hands and Roman numerals on the clockface using black buttercream in a piping bag with a small hole at the tip.", "\n\n**7.** ", "Pipe small buds in blue buttercream using the petal nozzle 103 (see Piping Flowers) and even smaller buds with just a piping bag with a small hole at the tip. ", "Pipe some spikes with fat bases and tapering points on the side of the stems for leaves using light green buttercream and a piping bag with a medium hole at the tip.", "\n\n**8.** ", "Position the roses around the cake, as shown, using cocktail sticks (toothpicks) to manoeuvre them if necessary. ", "Secure them with blobs of buttercream.", "\n\n**9.** ", "Pipe the leaves in between the flowers using dark green buttercream and the leaf nozzle 352.", "\n\n**10.** ", "Use the open star nozzle 1M and dark pink buttercream to pipe the base where you will attach the handle of the teapot. ", "Hold the nozzle straight on to the cake and firmly squeeze the piping bag to build up a big star.", "\n\n**11.** ", "Melt the pink Candy Melts and cover a couple of pretzels. ", "Allow them to cool, then attach them on the star you piped for the handle. ", "Or you can create a handle using wafer paper (see Using Wafer Paper in the techniques section).", "\n\n**12.** ", "Pipe the spout by positioning the nozzle a little below the midline of the cake then squeezing the piping bag with slow steady pressure until you reach the desired length of the spout. ", "Slowly pull away as you continue to squeeze. ", "Stick a pink moulded button at the tip.", "\n\n# Suppliers\n\n##### UK SUPPLIERS\n\n**Queen of Hearts Couture Cakes**\n\n23 Jersey Road, Hanwell, London, W7 2JF\n\n+44 (0)1634 235407 / 075813 95801\n\nwww.queenofheartscouturecakes.com\n\nSupplier of food colouring pastes and cake decorating materials\n\n**Wilton UK**\n\nMerlin Park, Wood Lane, Erdington\n\nBirmingham B24 9Ql\n\n0121 386 3200\n\nwww.wilton.co.uk\n\nBig selection of nozzles and cake decorating supplies\n\n**DinkyDoodle Designs**\n\n2b Triumph Road, Nottingham, NG7 2GA\n\n+44 (0)115 969 9803\n\nwww.dinkydoodle.co.uk\n\nSupplier of airbrush machines and colours\n\n##### US SUPPLIER\n\n**The Wilton Store**\n\n7511 Lemont Road\n\nDarien, IL 60561\n\n+1 (630) 985 6000\n\nwww.wilton.com\n\nBig selection of nozzles and cake decorating supplies\n\n# About the authors\n\nQueen of Hearts Couture Cakes is a multi-award winning cake company based in London, UK. ", "This company, which has gone from strength to strength since its beginning in 2011, is owned and run by best friends, Valeri Valeriano and Christina Ong. ", "They have authored two best-selling books, _The Contemporary Buttercream Bible_ and _100 Buttercream Flowers_ which were released 2014 and 2015 respectively. ", "Valeri and Christina have discovered that they can create stunning edible works of art using nothing else but buttercream and since then, they have never looked back.", "\n\nThese self-taught ladies offer the most intensive and extensive number of buttercream techniques through classes in Europe, USA, Asia, Middle East and Australia. ", "They have been featured in well known magazines, local and international news and have appeared in various TV shows. ", "They have been highlighted as international cake stars in different renowned cake shows internationally as they showcase their masterpieces.", "\n\nQueen of Hearts Couture Cakes creations always deliver originality, sophistication, elegance and perfection.", "\n\n# Thanks\n\n_\"Choose a job you love, and you will never have to work a day in your life.\"_ ", "Confucius\n\nOur cake journey has been the best years of our lives so far. ", "We have always believed that there must be one great purpose for why things turn out as they do. ", "To those who believed in us, supported us, inspired us and were inspired by us, thank you for being a part of our journey.", "\n\nTo our F+W Media family: Ame Verso, Lorraine Inglis and Anna Wade, thank you for always trusting us, so that together we could make a little bit of cake decorating history. ", "To Sam Vallance for helping us spread buttercream love in different languages.", "\n\nTo our fairy cake editor, Jane Trollope, we can't thank you enough. ", "Jason Jenkins, your passion for making sure that we got the best photos is amazing, thank you for always going for that 'last shot' (even when we'd asked for it ten times already).", "\n\nTo Justine Hyde of Hyde+Seek, Exeter for letting us borrow some of her gorgeous stock for our photoshoot.", "\n\nTo our Cake International family, Clare Fisher, Ben Fidler, Troy Bennett, Melanie Underwood, Adam Elkins, Vicky Vinton, David Bennett, Simon Burns and to everyone else, thank you for always believing in us. ", "We will be forever grateful and proud to be a part of your family and your shows every year.", "\n\nTo our new friends at Wilton, thank you for welcoming us and supporting us always in all ways.", "\n\nTo our increasing number of loyal friends around the world, thank you for being buttercream believers, you are all superstars.", "\n\nTo our families back in the Philippines, we love you. ", "Our success story is your story. ", "Thank you for being proud of us. ", "This is for you.", "\n\n**Go #TEAMBUTTERCREAM!**", "\nA DAVID & CHARLES BOOK\n\n© F&W Media International, Ltd 2016\n\nDavid & Charles is an imprint of F&W Media International, Ltd\n\nBrunel House, Forde Close, Newton Abbot, TQ12 4PU, UK\n\nF&W Media International, Ltd is a subsidiary of F+W Media, Inc\n\n10151 Carver Road, Suite #200, Blue Ash, OH 45242, USA\n\nText and Designs © Valeri Valeriano and Christina Ong 2015\n\nLayout and Photography © F&W Media International, Ltd 2016\n\nFirst published in the UK and USA in 2016\n\nValeri Valeriano and Christina Ong have asserted their right to be identified as author of this work in accordance with the Copyright, Designs and Patents Act, 1988.", "\n\nAll rights reserved. ", "No part of this publication may be reproduced in any form or by any means, electronic or mechanical, by photocopying, recording or otherwise, without prior permission in writing from the publisher.", "\n\nReaders are permitted to reproduce any of the patterns or designs in this book for their personal use and without the prior permission of the publisher. ", "However, the designs in this book are copyright and must not be reproduced for resale.", "\n\nThe author and publisher have made every effort to ensure that all the instructions in the book are accurate and safe, and therefore cannot accept liability for any resulting injury, damage or loss to persons or property, however it may arise.", "\n\nNames of manufacturers and product ranges are provided for the information of readers, with no intention to infringe copyright or trademarks.", "\n\nA catalogue record for this book is available from the British Library.", "\n\nISBN-13: 978-1-4463-0621-5 paperback\n\nISBN-10: 1-4463-0621-6 paperback\n\nISBN-13: 978-1-4463-7340-8 PDF\n\nISBN-10: 1-4463-7340-1 PDF\n\nISBN-13: 978-1-4463-7339-2 EPUB\n\nISBN-10: 1-4463-7339-8 EPUB\n\nF&W Media International, Ltd\n\nBrunel House, Forde Close, Newton Abbot, TQ12 4PU, UK\n\nAcquisitions Editor: Ame Verso\n\nDesk Editor: Michelle Patten\n\nProject Editor: Jane Trollope\n\nDesigner / Stylist: Lorraine Inglis\n\nArt Editor: Anna Wade\n\nPhotographer: Jason Jenkins\n\nProduction Controller: Bev Richardson\n\nF+W Media publishes high quality books on a wide range of subjects.", "\n\nFor more great book ideas visit: www.stitchcraftcreate.co.uk\n\nLayout of the digital edition of this book may vary depending on reader hardware and display settings.", "\n\n# Contents\n\n 1. ", "Cover\n 2. ", "Title Page\n 3. ", "Table of Contents\n 4. ", "Introduction\n 5. ", "Buttercream Basics\n 1. ", "Basic buttercream recipe\n 2. ", "Colouring\n 3. ", "Using props\n 4. ", "Styling your cake board\n 5. ", "Equipment\n 6. ", "Cake recipes\n 7. ", "Stacking and dowelling\n 8. ", "Covering cakes\n 9. ", "Piping textures\n 10. ", "Piping flowers\n 11. ", "Using wafer paper\n 12. ", "Moulds\n 6. ", "The Cakes\n 1. ", "Classic\n 1. ", "Broderie Anglaise\n 2. ", "Charming Chalkboard\n 3. ", "Heavenly Hat Box\n 2. ", "Artistic\n 1. ", "Inspired by Romero Britto\n 2. ", "Van Gogh Sunflowers\n 3. ", "Impression of Waterlilies\n 3. ", "Monochromatic\n 1. ", "Toile de Jouy\n 2. ", "Wedgewood Blue\n 3. ", "Bas Relief\n 4. ", "Scenic\n 1. ", "Totally Tropical\n 2. ", "Beach Treasure\n 3. ", "Country Window\n 5. ", "Romantic\n 1. ", "Ribbon Rose Heart\n 2. ", "Lace Romance\n 3. ", "Ball of Flowers\n 6. ", "Rustic\n 1. ", "Autumn Wreath\n 2. ", "Terrarium\n 3. ", "Enchanted Forest Flowers\n 7. ", "Shabby Chic\n 1. ", "Vintage Bird Cage\n 2. ", "A Pail of Roses\n 3. ", "Box of Delights\n 8. ", "Geometric\n 1. ", "Pastel Patchwork\n 2. ", "Aztec-inspired Chevrons\n 3. ", "Black and White Pinstripe\n 9. ", "Metallic\n 1. ", "Sparkling Sensation\n 2. ", "All Gold\n 3. ", "Pink Shimmer\n 10. ", "Eccentric\n 1. ", "Steampunk Hat\n 2. ", "Nicely Sliced\n 3. ", "Alice in Wonderland\n 7. ", "Suppliers\n 8. ", "About the authors\n 9. ", "Thanks\n 10. ", "Copyright\n\n# Guide\n\n 1. ", "Cover\n 2. ", "Table of Contents\n 3. ", "Start of Content\n\n" ]

{ "pile_set_name": "Books3" }

[ 0.00548159749412686, 0, 0.006289308176100629, 0, 0, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011834319526627219, 0, 0.004761904761904762, 0, 0, 0, 0.027777777777777776, 0.007042253521126761, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008695652173913044, 0, 0, 0, 0.001422475106685633, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007462686567164179, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010309278350515464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006896551724137931, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006535947712418301, 0, 0, 0, 0, 0.0015527950310559005, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007936507936507936, 0, 0, 0, 0, 0, 0, 0, 0.009009009009009009, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008264462809917356, 0, 0, 0.0078125, 0, 0, 0.014705882352941176, 0, 0, 0, 0.005050505050505051, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006172839506172839, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005649717514124294, 0, 0, 0, 0, 0.008849557522123894, 0, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0, 0.010471204188481676, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0, 0, 0.00303951367781155, 0, 0.00980392156862745, 0, 0.004739336492890996, 0, 0, 0, 0, 0, 0, 0, 0.019417475728155338, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008620689655172414, 0, 0, 0, 0, 0, 0, 0, 0, 0.00535475234270415, 0.017543859649122806, 0, 0, 0, 0, 0.01639344262295082, 0.004830917874396135, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007633587786259542, 0, 0, 0, 0, 0, 0, 0, 0.010101010101010102, 0, 0.005773672055427252, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010869565217391304, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007462686567164179, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0, 0, 0.009868421052631578, 0.012345679012345678, 0, 0, 0.007352941176470588, 0.010869565217391304, 0, 0, 0.00847457627118644, 0, 0, 0, 0, 0, 0, 0, 0, 0.0078125, 0, 0, 0, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0, 0.005376344086021506, 0, 0, 0, 0.0070921985815602835, 0, 0.010638297872340425, 0, 0, 0.009652509652509652, 0, 0, 0, 0.017543859649122806, 0, 0, 0.00510204081632653, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.005376344086021506, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015625, 0.009155645981688708, 0, 0, 0, 0, 0.008547008547008548, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015873015873015872, 0, 0, 0, 0, 0, 0, 0, 0.007407407407407408, 0.010309278350515464, 0, 0.01065891472868217, 0, 0, 0, 0.005, 0, 0.016260162601626018, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.003676470588235294, 0, 0, 0, 0.013888888888888888, 0, 0, 0, 0.00528169014084507, 0, 0, 0, 0.023809523809523808, 0, 0, 0, 0.012048192771084338, 0, 0, 0, 0, 0.005988023952095809, 0, 0, 0, 0, 0, 0, 0, 0, 0.011111111111111112, 0, 0.027777777777777776, 0, 0, 0, 0, 0, 0, 0.013333333333333334, 0.009009009009009009, 0.01020408163265306, 0, 0.008849557522123894, 0, 0.005594405594405594, 0.006944444444444444, 0, 0, 0.01639344262295082, 0, 0, 0, 0, 0, 0, 0, 0.0070921985815602835, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011764705882352941, 0, 0, 0.010638297872340425, 0, 0, 0, 0.006329113924050633, 0.0055248618784530384, 0, 0.01282051282051282, 0.0047169811320754715, 0.007142857142857143, 0, 0.01282051282051282, 0.004878048780487805, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.014705882352941176, 0, 0.004424778761061947, 0.010101010101010102, 0, 0.009202453987730062, 0, 0, 0, 0.017543859649122806, 0, 0.017241379310344827, 0, 0, 0, 0, 0, 0, 0, 0, 0.0051813471502590676, 0, 0, 0.012658227848101266, 0, 0, 0, 0, 0.007633587786259542, 0, 0, 0, 0, 0, 0, 0, 0.006750241080038573, 0.006060606060606061, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007142857142857143, 0, 0, 0.007042253521126761, 0, 0.008502289077828646, 0, 0, 0, 0, 0, 0.008130081300813009, 0, 0, 0, 0, 0, 0, 0, 0, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0.009784735812133072, 0, 0, 0, 0, 0, 0.005235602094240838, 0, 0, 0, 0, 0, 0, 0.007142857142857143, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01422475106685633, 0.009259259259259259, 0.009708737864077669, 0, 0, 0, 0.005747126436781609, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006369426751592357, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0071492403932082215, 0.004291845493562232, 0.009259259259259259, 0, 0, 0, 0, 0, 0, 0, 0.007042253521126761, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007633587786259542, 0.009009009009009009, 0, 0, 0.007186858316221766, 0, 0, 0, 0, 0.0072992700729927005, 0, 0, 0.008064516129032258, 0, 0, 0, 0, 0, 0, 0, 0.010638297872340425, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011904761904761904, 0, 0.007936507936507936, 0, 0.005076142131979695, 0, 0, 0, 0.00333889816360601, 0.006993006993006993, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010869565217391304, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0077951002227171495, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.00980392156862745, 0, 0, 0.0056179775280898875, 0.0072992700729927005, 0, 0, 0.012222222222222223, 0.00819672131147541, 0, 0, 0.004975124378109453, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006060606060606061, 0, 0, 0, 0.00909090909090909, 0, 0.010101010101010102, 0.009259259259259259, 0, 0, 0, 0, 0.004424778761061947, 0, 0, 0, 0.007865168539325843, 0, 0.007633587786259542, 0, 0, 0, 0.005747126436781609, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008620689655172414, 0, 0, 0, 0, 0, 0, 0, 0, 0.007692307692307693, 0, 0.0070921985815602835, 0, 0, 0, 0, 0.01, 0, 0, 0, 0.013986013986013986, 0, 0, 0, 0, 0.0170261066969353, 0, 0.02, 0, 0, 0, 0, 0, 0, 0.008849557522123894, 0.006535947712418301, 0, 0, 0, 0.01346389228886169, 0.017543859649122806, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0.006920415224913495, 0.00909090909090909, 0, 0, 0, 0.0078125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008356545961002786, 0.006535947712418301, 0, 0, 0, 0, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.021739130434782608, 0, 0, 0, 0.007751937984496124, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.015625, 0, 0, 0, 0, 0, 0, 0, 0, 0.008917197452229299, 0.010309278350515464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011695906432748537, 0, 0, 0, 0.016666666666666666, 0, 0.012195121951219513, 0, 0, 0, 0, 0, 0.001579778830963665, 0.008695652173913044, 0.00909090909090909, 0, 0.009259259259259259, 0.01020408163265306, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007281553398058253, 0.0026954177897574125, 0, 0.014925373134328358, 0, 0, 0.009259259259259259, 0, 0.00641025641025641, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.010526315789473684, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006362672322375398, 0.019230769230769232, 0, 0.010309278350515464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009708737864077669, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0, 0.005714285714285714, 0, 0.013157894736842105, 0, 0, 0, 0.00847457627118644, 0, 0, 0.005291005291005291, 0, 0.006211180124223602, 0.023809523809523808, 0, 0, 0, 0.016129032258064516, 0, 0, 0, 0.011111111111111112, 0, 0, 0, 0.0064516129032258064, 0, 0, 0, 0, 0, 0, 0.008771929824561403, 0, 0.013422818791946308, 0.00980392156862745, 0, 0.012578616352201259, 0.014705882352941176, 0.017142857142857144, 0.020833333333333332, 0.007874015748031496, 0.009345794392523364, 0, 0.017045454545454544, 0, 0.007751937984496124, 0.010526315789473684, 0, 0.0055248618784530384, 0.010638297872340425, 0, 0, 0.008620689655172414, 0, 0, 0, 0, 0, 0, 0.008314436885865457, 0, 0, 0, 0, 0, 0, 0.010416666666666666, 0, 0.004784688995215311, 0, 0, 0, 0, 0.006369426751592357, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006289308176100629, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.034482758620689655, 0, 0.010526315789473684, 0, 0, 0, 0, 0.013237063778580024, 0.006493506493506494, 0.006329113924050633, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.022857142857142857, 0.01282051282051282, 0.014285714285714285, 0.005555555555555556, 0.009345794392523364, 0.03827751196172249, 0, 0.010416666666666666, 0, 0, 0, 0, 0, 0, 0.020700636942675158, 0, 0, 0, 0, 0, 0, 0, 0.019332161687170474, 0.006024096385542169, 0, 0.09090909090909091, 0.0625, 0, 0, 0.038461538461538464, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.08333333333333333, 0, 0, 0.037037037037037035, 0.034482758620689655, 0, 0, 0.02857142857142857, 0, 0.030303030303030304, 0.043478260869565216, 0.043478260869565216, 0.041666666666666664, 0, 0, 0.038461538461538464, 0, 0, 0, 0.037037037037037035, 0.045454545454545456, 0, 0, 0.043478260869565216, 0, 0, 0.047619047619047616, 0, 0, 0, 0, 0.038461538461538464, 0, 0.030303030303030304, 0, 0, 0, 0, 0, 0, 0.043478260869565216, 0, 0, 0, 0, 0, 0.09090909090909091, 0, 0.05555555555555555 ]

[ "Have you ever wondered how the football kits of Animated Movies could look like? ", "Mexican-website Juan Futbol has created eight unique soccer jerseys, inspired by famous Animated Movies like Minions, Shrek and Monsters.", "\n\nAnimated Movies Soccer Jerseys\n\nHere's the unique collection of Animated Movies Jerseys.", "\n\nDragon FC, Nightmare FC, Minions FC, Monsters FC\n\nParaNorman FC, Shrek FC, Star Command, Inside Out\n\nHow to Train Your Dragon, Huevocartoon, The Nightmare Before Christmas, Minions, Monsters, ParaNorman, Shrek, Star Command or Inside Out? ", "What's your favorite Animated Movies Soccer Kit? ", "Let us know in the comments below, and also check out the Social Media Inspired Kits by Juan Futbol." ]

{ "pile_set_name": "Pile-CC" }

[ 0.012345679012345678, 0.014598540145985401, 0.011111111111111112, 0.04149377593360996, 0, 0.01 ]

[ "package com.junjunguo.pocketmaps.activities;\n\nimport java.io.", "File;\nimport java.io.", "FileInputStream;\nimport java.io.", "FileOutputStream;\nimport java.io.", "IOException;\nimport java.util.", "ArrayList;\nimport java.util.", "List;\nimport java.util.", "Locale;\nimport java.util.", "Map.", "Entry;\nimport java.util.", "Properties;\n\nimport org.oscim.core.", "GeoPoint;\n\nimport com.junjunguo.pocketmaps.", "R;\nimport com.junjunguo.pocketmaps.fragments.", "MessageDialog;\nimport com.junjunguo.pocketmaps.fragments.", "MyAddressAdapter;\nimport com.junjunguo.pocketmaps.geocoding.", "AddressLoc;\nimport com.junjunguo.pocketmaps.geocoding.", "GeocoderGlobal;\nimport com.junjunguo.pocketmaps.geocoding.", "GeocoderLocal;\nimport com.junjunguo.pocketmaps.model.listeners.", "OnClickAddressListener;\nimport com.junjunguo.pocketmaps.model.listeners.", "OnProgressListener;\nimport com.junjunguo.pocketmaps.util.", "Variable;\nimport com.junjunguo.pocketmaps.util.", "Variable.", "VarType;\n\nimport android.content.", "Context;\nimport android.content.", "Intent;\nimport android.graphics.", "Color;\nimport android.location.", "Address;\nimport android.net.", "Uri;\nimport android.os.", "AsyncTask;\nimport android.os.", "Bundle;\nimport com.google.android.material.floatingactionbutton.", "FloatingActionButton;\nimport androidx.appcompat.app.", "AppCompatActivity;\nimport androidx.recyclerview.widget.", "DefaultItemAnimator;\nimport androidx.recyclerview.widget.", "LinearLayoutManager;\nimport androidx.recyclerview.widget.", "RecyclerView;\nimport android.util.", "Log;\nimport android.view.", "View;\nimport android.view.", "View.", "OnClickListener;\nimport android.widget.", "AdapterView;\nimport android.widget.", "AdapterView.", "OnItemClickListener;\nimport android.widget.", "AdapterView.", "OnItemSelectedListener;\nimport android.widget.", "ArrayAdapter;\nimport android.widget.", "AutoCompleteTextView;\nimport android.widget.", "Button;\nimport android.widget.", "CheckBox;\nimport android.widget.", "EditText;\nimport android.widget.", "ImageView;\nimport android.widget.", "LinearLayout;\nimport android.widget.", "Spinner;\nimport android.widget.", "TextView;\nimport android.widget.", "Toast;\nimport androidx.annotation.", "UiThread;\n\n/** Shows the Favourites-List, AddressDetailsView, and SearchEngine. **/", "\npublic class GeocodeActivity extends AppCompatActivity implements OnClickListener\n{\n private static final String FAV_PROP_FILE = \"Favourites.properties\";\n private static final String SEL_FROM = \"Location from\";\n private static final String SEL_TO = \"Location to\";\n private static final String SEL_CUR = \"Current location\";\n public static final String ENGINE_OSM = \"OpenStreetMap\";\n public static final String ENGINE_GOOGLE = \"Google Maps\";\n public static final String ENGINE_OFFLINE = \"Offline\";\n private enum EditType {ViewOnly, ViewEdit, EditOnly};\n private static OnClickAddressListener callbackListener;\n /** The locations \"from\" \"to\" and \"current\" used to set in Favourites. **/", "\n private static GeoPoint[] locations;\n private static String[] locNames;\n private static Properties favourites;\n Spinner geoSpinner;\n Spinner locSpinner;\n AutoCompleteTextView txtLocation;\n Button okButton;\n CheckBox cb_multi_match_only;\n CheckBox cb_explicit_search_text;\n CheckBox cb_city_nodes;\n CheckBox cb_street_nodes;\n View cb_lineA;\n View cb_lineB;\n boolean statusLoading = false;\n static boolean backToListViewOnly = false;\n static List<Address> backToListData = null;\n static boolean autoEdit = false;\n \n /** Set pre-settings.", "\n * @param newCallbackListener The Callback listener, called on selected Address.", "\n * @param newLocations The [0]=start [1]=end and [2]=cur location used on Favourites, or null.", "\n * @param autoEdit Directly show AddressDetails of index 2=cur. **/", "\n public static void setPre(OnClickAddressListener newCallbackListener, GeoPoint[] newLocations, String[] newLocNames, boolean bAutoEdit)\n {\n callbackListener = newCallbackListener;\n locations = newLocations;\n locNames = newLocNames;\n autoEdit = bAutoEdit;\n }\n \n @Override protected void onCreate(Bundle savedInstanceState)\n {\n super.onCreate(savedInstanceState);\n if (!", "isFavouritesView())\n {\n if (backToListData == null)\n {\n showSearchEngine();\n }\n else\n { // Continue with last search results.", "\n showAddresses(backToListData, backToListViewOnly);\n backToListData = null;\n }\n }\n else // Favourites-AddressList\n {\n backToListData = null;\n RecyclerView recView = showAddresses(new ArrayList<Address>(), false);\n startFavAsync((MyAddressAdapter)recView.getAdapter());\n }\n }\n \n private void addDeleteItemHandler(RecyclerView recView)\n {\n final MyAddressAdapter recAdapter = (MyAddressAdapter)recView.getAdapter();\n OnItemClickListener delL = new OnItemClickListener()\n {\n @Override\n public void onItemClick(AdapterView<?", "> parent, View view, int position, long id)\n {\n Address curAddr = recAdapter.remove(position);\n favourites.remove(curAddr.getAddressLine(0));\n \n String mapDir = Variable.getVariable().getMapsFolder().getParent();\n String propFile = new File(mapDir,FAV_PROP_FILE).getPath();\n try(FileOutputStream fos = new FileOutputStream(propFile))\n {\n favourites.store(fos, \"List of favourites\");\n }\n catch (IOException e)\n {\n logUser(\"Unable to store favourites\");\n }\n }\n };\n MainActivity.addDeleteItemHandler(this, recView, delL);\n }\n\n private void showSearchEngine()\n {\n setContentView(R.layout.activity_geocode);\n ArrayAdapter<String> adapter = new ArrayAdapter<String>(this, android.", "R.layout.simple_dropdown_item_1line);\n adapter.add(ENGINE_OSM);\n adapter.add(ENGINE_GOOGLE);\n adapter.add(ENGINE_OFFLINE);\n geoSpinner = (Spinner) findViewById(R.id.geoSpinner);\n geoSpinner.setAdapter(adapter);\n geoSpinner.setSelection(Variable.getVariable().getGeocodeSearchEngine());\n geoSpinner.setOnItemSelectedListener(createOnSearchEngineChanged());\n okButton = (Button) findViewById(R.id.geoOk);\n txtLocation = (AutoCompleteTextView) findViewById(R.id.geoLocation);\n cb_multi_match_only = (CheckBox) findViewById(R.id.checkbox_multi_match_only);\n cb_explicit_search_text = (CheckBox) findViewById(R.id.checkbox_explicit_search_text);\n cb_city_nodes = (CheckBox) findViewById(R.id.checkbox_city_nodes);\n cb_street_nodes = (CheckBox) findViewById(R.id.checkbox_street_nodes);\n cb_lineA = findViewById(R.id.lineA);\n cb_lineB = findViewById(R.id.lineB);\n if ((Variable.getVariable().getOfflineSearchBits() & GeocoderLocal.", "BIT_MULT) > 0)\n {\n cb_multi_match_only.setChecked(true);\n onCheckboxClicked(cb_multi_match_only);\n }\n if ((Variable.getVariable().getOfflineSearchBits() & GeocoderLocal.", "BIT_EXPL) > 0)\n {\n cb_explicit_search_text.setChecked(true);\n }\n if ((Variable.getVariable().getOfflineSearchBits() & GeocoderLocal.", "BIT_CITY) > 0)\n {\n cb_city_nodes.setChecked(true);\n }\n if ((Variable.getVariable().getOfflineSearchBits() & GeocoderLocal.", "BIT_STREET) > 0)\n {\n cb_street_nodes.setChecked(true);\n }\n String preText = ShowLocationActivity.locationSearchString;\n if (preText !", "= null)\n {\n txtLocation.setText(preText);\n ShowLocationActivity.locationSearchString = null;\n }\n ArrayAdapter<String> autoAdapter = new ArrayAdapter<String>(this,\n android.", "R.layout.simple_list_item_1,\n Variable.getVariable().getGeocodeSearchTextList());\n txtLocation.setAdapter(autoAdapter);\n\n okButton.setOnClickListener(this);\n }\n \n private OnItemSelectedListener createOnSearchEngineChanged()\n {\n return new OnItemSelectedListener()\n {\n @Override\n public void onItemSelected(AdapterView<?", "> arg0, View arg1, int arg2, long arg3)\n {\n if (geoSpinner.getSelectedItem().toString().equals(ENGINE_OFFLINE))\n {\n cb_multi_match_only.setVisibility(View.", "VISIBLE);\n cb_explicit_search_text.setVisibility(View.", "VISIBLE);\n cb_city_nodes.setVisibility(View.", "VISIBLE);\n cb_street_nodes.setVisibility(View.", "VISIBLE);\n cb_lineA.setVisibility(View.", "VISIBLE);\n cb_lineB.setVisibility(View.", "VISIBLE);\n }\n else\n {\n cb_multi_match_only.setVisibility(View.", "INVISIBLE);\n cb_explicit_search_text.setVisibility(View.", "INVISIBLE);\n cb_city_nodes.setVisibility(View.", "INVISIBLE);\n cb_street_nodes.setVisibility(View.", "INVISIBLE);\n cb_lineA.setVisibility(View.", "INVISIBLE);\n cb_lineB.setVisibility(View.", "INVISIBLE);\n }\n }\n\n @Override\n public void onNothingSelected(AdapterView<?", "> arg0) {}\n };\n }\n\n /** Callback of activity_geocode **/\n public void onCheckboxClicked(View view)\n {\n boolean checked = ((CheckBox) view).isChecked();\n if (view.getId() == R.id.checkbox_multi_match_only)\n {\n cb_explicit_search_text.setEnabled(!checked);\n cb_explicit_search_text.setChecked(false);\n cb_city_nodes.setEnabled(!checked);\n cb_city_nodes.setChecked(true);\n cb_street_nodes.setEnabled(!checked);\n cb_street_nodes.setChecked(true);\n }\n else if (view.getId() == R.id.checkbox_city_nodes)\n {\n if (!", "checked && !", "cb_street_nodes.isChecked())\n {\n cb_city_nodes.setChecked(true);\n }\n }\n else if (view.getId() == R.id.checkbox_street_nodes)\n {\n if (!", "checked && !", "cb_city_nodes.isChecked())\n {\n cb_street_nodes.setChecked(true);\n }\n }\n }\n\n \n /** Plus button pressed, or SettingsWheel. ", "When not editOnly then preAddress is needed. **/", "\n private void showAddressDetails(EditType type, Address preAddress)\n {\n if (type == EditType.", "EditOnly &&\n locations[0] == null &&\n locations[1] == null &&\n locations[2] == null)\n {\n logUser(\"Select a location first!\");", "\n return;\n }\n setContentView(R.layout.activity_address_add);\n Button okButton = (Button) findViewById(R.id.addrOk);\n TextView tv = (TextView) findViewById(R.id.addrText);\n ImageView iv = (ImageView) findViewById(R.id.addrShare);\n EditText addr[] = new EditText[5];\n addr[0] = (EditText) findViewById(R.id.addrLine1);\n addr[1] = (EditText) findViewById(R.id.addrLine2);\n addr[2] = (EditText) findViewById(R.id.addrLine3);\n addr[3] = (EditText) findViewById(R.id.addrLine4);\n addr[4] = (EditText) findViewById(R.id.addrLine5);\n TextView addrV[] = new TextView[5];\n addrV[0] = (TextView) findViewById(R.id.addrLineV1);\n addrV[1] = (TextView) findViewById(R.id.addrLineV2);\n addrV[2] = (TextView) findViewById(R.id.addrLineV3);\n addrV[3] = (TextView) findViewById(R.id.addrLineV4);\n addrV[4] = (TextView) findViewById(R.id.addrLineV5);\n locSpinner = (Spinner) findViewById(R.id.addrSpinner);\n\n GeoPoint loc;\n String oldLocName = null;\n if (type == EditType.", "ViewOnly)\n {\n okButton.setVisibility(View.", "INVISIBLE);\n locSpinner.setVisibility(View.", "INVISIBLE);\n fillText(addr, null, View.", "GONE);\n fillText(addrV, preAddress, View.", "VISIBLE);\n loc = new GeoPoint(preAddress.getLatitude(), preAddress.getLongitude());\n oldLocName = preAddress.getAddressLine(0);\n tv.setText(oldLocName);\n iv.setOnClickListener(createShareListener(loc));\n }\n else if (type == EditType.", "ViewEdit)\n {\n okButton.setText(R.string.edit);\n okButton.setTextColor(Color.", "BLUE);\n locSpinner.setVisibility(View.", "INVISIBLE);\n fillText(addr, preAddress, View.", "GONE);\n fillText(addrV, preAddress, View.", "VISIBLE);\n loc = new GeoPoint(preAddress.getLatitude(), preAddress.getLongitude());\n oldLocName = preAddress.getAddressLine(0);\n tv.setText(oldLocName);\n iv.setOnClickListener(createShareListener(loc));\n }\n else // EditOnly\n {\n ArrayAdapter<String> adapter = new ArrayAdapter<String>(this, android.", "R.layout.simple_dropdown_item_1line);\n if (locations[0] !", "= null) { adapter.add(SEL_FROM); }\n if (locations[1] !", "= null) { adapter.add(SEL_TO); }\n if (locations[2] !", "= null) { adapter.add(SEL_CUR); }\n locSpinner.setAdapter(adapter);\n locSpinner.setOnItemSelectedListener(createSpinnerListener(addrV[1], addr[1], addrV[2], addr[2]));\n loc = getLocFromSpinner(locSpinner);\n iv.setVisibility(View.", "GONE);\n }\n okButton.setOnClickListener(createAddAddrClickListener(loc, type, addr, addrV, okButton, oldLocName));\n }\n \n /** Share button. **/", "\n private OnClickListener createShareListener(final GeoPoint loc)\n {\n OnClickListener c = new OnClickListener()\n {\n @Override\n public void onClick(View v)\n {\n String latLon = loc.getLatitude() + \",\" + loc.getLongitude();\n String latAndLon = \"lat=\" + loc.getLatitude() + \"&lon=\" + loc.getLongitude();\n String geoUri = \"geo:\" + latLon;\n String gooUri = \"https://maps.google.com/maps?q=loc:\" + latLon + \"&z=15\";\n String osmUri = \"http://www.openstreetmap.org/?\" ", "+ latAndLon + \"&zoom=17&layers=M\";\n Intent shareI = new Intent(android.content.", "Intent.", "ACTION_SEND);\n shareI.setType(\"text/plain\");\n shareI.putExtra(Intent.", "EXTRA_TITLE, \"PocketMaps location\");\n shareI.putExtra(Intent.", "EXTRA_TEXT, \"Location Geolink:\\n\" + geoUri + \"\\n\\n\" +\n \"Location OSM:\\n\" + osmUri + \"\\n\\n\" +\n \"Location GoogleStreetMap:\\n\" + gooUri);\n v.getContext().startActivity(Intent.createChooser(shareI, \"Share via\"));\n }\n };\n return c;\n }\n\n private OnItemSelectedListener createSpinnerListener(final TextView editText1, final TextView editText2,\n final TextView editText3, final TextView editText4)\n {\n OnItemSelectedListener l = new OnItemSelectedListener(){\n\n @Override\n public void onItemSelected(AdapterView<?", "> parent, View view, int position, long id)\n {\n String txt = getTxtFromSpinner(locSpinner);\n log(\"Spinner location-TXT: \" + txt);\n editText1.setText(txt);\n editText2.setText(txt);\n editText3.setText(Variable.getVariable().getCountry());\n editText4.setText(Variable.getVariable().getCountry());\n }\n\n @Override\n public void onNothingSelected(AdapterView<?", "> parent) {}\n };\n return l;\n }\n\n private GeoPoint getLocFromSpinner(Spinner sp)\n {\n if (sp.getSelectedItem().toString().equals(SEL_FROM)) { return locations[0]; }\n else if (sp.getSelectedItem().toString().equals(SEL_TO)) { return locations[1]; }\n else { return locations[2]; }\n }\n \n private String getTxtFromSpinner(Spinner sp)\n {\n if (sp.getSelectedItem().toString().equals(SEL_FROM)) { return locNames[0]; }\n else if (sp.getSelectedItem().toString().equals(SEL_TO)) { return locNames[1]; }\n else { return \"GPS\"; }\n }\n \n /** Fill the text of preAddress, and set visibility.", "\n * @param preAddress The address to fill out, may be null. **/", "\n private void fillText(TextView[] addr, Address preAddress, int visibility)\n {\n if (preAddress !", "= null)\n {\n ArrayList<String> lines = AddressLoc.getLines(preAddress);\n for (int i=0; i<lines.size(); i++)\n {\n int arrIndex = i;\n if (arrIndex >= addr.length)\n { // Switch to multiLine\n arrIndex = addr.length-1;\n }\n TextView v = addr[arrIndex];\n String line = lines.get(i);\n if (line !", "= null)\n {\n if (line.contains(\"\\n\"))\n { // Use MultiLine TextEdit\n v = addr[addr.length-1];\n }\n boolean isMultiLine = (v == addr[addr.length-1]);\n if (isMultiLine && !", "v.getText().toString().isEmpty())\n {\n v.setText(v.getText() + \"\\n\");\n }\n v.setText(v.getText() + line);\n }\n }\n }\n for (TextView v : addr)\n {\n v.setVisibility(visibility);\n }\n }\n\n private OnClickListener createAddAddrClickListener(final GeoPoint loc, final EditType type,\n final EditText eaddr[], final TextView eaddrV[],\n final Button okButton, final String oldLocName)\n {\n OnClickListener l = new OnClickListener()\n {\n @Override\n public void onClick(View v)\n {\n if (okButton.getCurrentTextColor() == Color.", "BLUE)\n { // ViewEdit --> Switch to edit!", "\n okButton.setTextColor(Color.", "BLACK);\n okButton.setText(R.string.ok);\n fillText(eaddr, null, View.", "VISIBLE);\n fillText(eaddrV, null, View.", "GONE);\n return;\n }\n new AsyncTask<Void, Void, Void>()\n {\n @Override\n protected Void doInBackground(Void... params)\n {\n Address addr = new Address(Locale.getDefault());\n for (int i=0; i<eaddr.length; i++)\n {\n String line = eaddr[i].getText().toString();\n if (i == (eaddr.length-1) &&\n (!", "line.isEmpty()) &&\n (!", "line.contains(\"\\n\")))\n { // Force MultiLine!", "\n line = line + \"\\n\";\n }\n addr.setAddressLine(i, line);\n }\n GeoPoint newLoc = loc;\n if (type == EditType.", "EditOnly)\n {\n newLoc = getLocFromSpinner(locSpinner);\n }\n addr.setLatitude(newLoc.getLatitude());\n addr.setLongitude(newLoc.getLongitude());\n AddressLoc.addToProp(favourites, addr, oldLocName);\n String mapDir = Variable.getVariable().getMapsFolder().getParent();\n String propFile = new File(mapDir,FAV_PROP_FILE).getPath();\n try(FileOutputStream fos = new FileOutputStream(propFile))\n {\n favourites.store(fos, \"List of favourites\");\n }\n catch (IOException e)\n {\n logUser(\"Unable to store favourites\");\n }\n return null;\n }\n }.execute();\n GeocodeActivity.this.finish();\n }\n };\n return l;\n }\n\n @Override protected void onResume()\n {\n super.onResume();\n if (isFavouritesView() && favourites!=null && !", "favourites.isEmpty())\n {\n MessageDialog.showMsg(this, \"addressDeleteMsg\", R.string.swipe_out, true);\n }\n }\n \n @Override protected void onDestroy()\n {\n super.onDestroy();\n GeocoderGlobal.stopRunningActions();\n if (isFavouritesView())\n {\n backToListData = null;\n }\n }\n \n @Override\n public void onClick(View v)\n {\n if (v.getId()==R.id.geoOk)\n {\n log(\"Selected: Search location\");\n startSearchAsync();\n }\n }\n \n private boolean isFavouritesView()\n {\n return locations !", "= null;\n }\n \n private boolean isSearchEngineShowing()\n {\n return (findViewById(R.id.geoSpinner) !", "= null);\n }\n \n @Override\n public void onBackPressed()\n {\n if (backToListData == null)\n {\n if (!", "isFavouritesView() && !", "isSearchEngineShowing())\n {\n showSearchEngine();\n }\n else\n {\n super.onBackPressed();\n }\n }\n else\n {\n showAddresses(backToListData, backToListViewOnly);\n backToListData = null;\n }\n }\n\n private void startSearchAsync()\n {\n if (statusLoading)\n {\n logUser(okButton.getText().toString());\n return;\n }\n statusLoading = true;\n okButton.setText(R.string.loading_dotdotdot);\n final String engine = geoSpinner.getSelectedItem().toString();\n final String geoLocation = txtLocation.getText().toString();\n storeGeocodeSettings(geoLocation);\n if (geoLocation.isEmpty())\n {\n logUser(\"Empty textfield!\");", "\n return;\n }\n new AsyncTask<Void, Integer, List<Address>>()\n {\n @Override\n protected List<Address> doInBackground(Void... params)\n {\n Locale locale = Locale.getDefault();\n GeocoderGlobal geoc = new GeocoderGlobal(locale);\n Context appContext = GeocodeActivity.this.getApplicationContext();\n if (engine.equals(ENGINE_OSM)) { return geoc.find_osm(appContext, geoLocation); }\n if (engine.equals(ENGINE_GOOGLE)) { return geoc.find_google(appContext, geoLocation); }\n if (engine.equals(ENGINE_OFFLINE)) { return geoc.find_local(appContext, geoLocation, makeListener()); }\n return null;\n }\n \n private OnProgressListener makeListener()\n {\n return new OnProgressListener()\n {\n @Override\n public void onProgress(int progress)\n {\n publishProgress(progress);\n }\n };\n }\n\n @Override\n protected void onProgressUpdate(Integer... progress)\n {\n okButton.setText(R.string.loading_dotdotdot);\n okButton.setText(progress[0] + \"% \" + okButton.getText());\n }\n \n @Override\n protected void onPostExecute(List<Address> resp)\n {\n if (resp==null)\n {\n logUser(engine + \" search is not present!\");", "\n okButton.setText(R.string.search_location);\n statusLoading = false;\n }\n else\n {\n if (resp.size()==0)\n {\n logUser(\"No addresses found\");\n okButton.setText(R.string.search_location);\n statusLoading = false;\n }\n else\n {\n showAddresses(resp, true);\n statusLoading = false;\n }\n }\n }\n }.execute();\n }\n \n private void storeGeocodeSettings(String searchText)\n {\n boolean bSetEn = Variable.getVariable().setGeocodeSearchEngine(geoSpinner.getSelectedItemPosition());\n boolean bSetTx = Variable.getVariable().addGeocodeSearchText(searchText);\n \n int newBitSet = 0;\n int oldBitSet = Variable.getVariable().getOfflineSearchBits();\n if (cb_multi_match_only.isChecked()) { newBitSet += GeocoderLocal.", "BIT_MULT; }\n if (cb_explicit_search_text.isChecked()) { newBitSet += GeocoderLocal.", "BIT_EXPL; }\n if (cb_city_nodes.isChecked()) { newBitSet += GeocoderLocal.", "BIT_CITY; }\n if (cb_street_nodes.isChecked()) { newBitSet += GeocoderLocal.", "BIT_STREET; }\n Variable.getVariable().setOfflineSearchBits(newBitSet);\n boolean bSetBit = (oldBitSet !", "= newBitSet);\n \n if (bSetEn || bSetTx || bSetBit) { Variable.getVariable().saveVariables(VarType.", "Geocode); }\n }\n \n @UiThread\n public static void resetFavourites() { favourites = null; }\n\n private void startFavAsync(final MyAddressAdapter adapter)\n {\n String mapDir = Variable.getVariable().getMapsFolder().getParent();\n final String propFile = new File(mapDir,\"Favourites.properties\").getPath();\n boolean loadProp = false;\n if (!", "new File(propFile).exists())\n {\n favourites = new Properties();\n }\n else if (favourites == null)\n {\n favourites = new Properties();\n loadProp = true;\n }\n final boolean loadPropFinal = loadProp;\n final Properties favouritesFinal = favourites;\n new AsyncTask<Void, Void, List<Address>>()\n {\n String errMsg;\n @Override\n protected List<Address> doInBackground(Void... params)\n {\n ArrayList<Address> result = new ArrayList<Address>();\n if (loadPropFinal)\n {\n try (FileInputStream fis = new FileInputStream(propFile))\n {\n favouritesFinal.load(fis);\n }\n catch (IOException e)\n {\n errMsg = \"Error while loadiong favourites (file)\";\n return null;\n }\n }\n boolean hasError = false;\n for (Entry<Object, Object> entry : favouritesFinal.entrySet())\n {\n Address addr = AddressLoc.readFromPropEntry(entry);\n if (addr == null) { hasError = true; }\n else { result.add(addr); }\n }\n if (hasError) { errMsg =\"Error while loading favourites (properties)\"; }\n return result;\n }\n @Override\n protected void onPostExecute(List<Address> resp)\n {\n if (errMsg!=null) { logUser(errMsg); }\n if (resp !", "= null)\n {\n adapter.addAll(resp);\n }\n if (autoEdit && isFavouritesView() && locations[2]!=null && locNames[2]!=null)\n {\n autoEdit = false;\n Address address = new Address(Locale.getDefault());\n address.setAddressLine(0, locNames[2]);\n address.setLatitude(locations[2].getLatitude());\n address.setLatitude(locations[2].getLatitude());\n showAddressDetails(EditType.", "EditOnly, address);\n }\n }\n }.execute();\n }\n\n private RecyclerView showAddresses(final List<Address> list, final boolean viewOnly)\n {\n setContentView(R.layout.activity_addresses);\n OnClickAddressListener l = new OnClickAddressListener()\n {\n @Override\n public void onClick(Address addr)\n {\n log(\"Address selected: \" + addr);\n if (viewOnly)\n {\n GeocodeActivity.backToListViewOnly = true;\n GeocodeActivity.backToListData = list;\n }\n GeocodeActivity.this.finish();\n if (callbackListener!=null)\n {\n callbackListener.onClick(addr);\n }\n }\n };\n OnClickAddressListener detL = new OnClickAddressListener()\n {\n @Override\n public void onClick(Address addr)\n {\n log(\"Address details selected: \" + addr);\n backToListData = list;\n backToListViewOnly = viewOnly;\n if (viewOnly)\n {\n GeocodeActivity.this.showAddressDetails(EditType.", "ViewOnly, addr);\n }\n else\n {\n GeocodeActivity.this.showAddressDetails(EditType.", "ViewEdit, addr);\n }\n }\n };\n MyAddressAdapter adapter = new MyAddressAdapter(list, l, detL);\n RecyclerView listView = (RecyclerView) findViewById(R.id.my_addr_recycler_view);\n listView.setHasFixedSize(true);\n\n // use a linear layout manager\n LinearLayoutManager layoutManager = new LinearLayoutManager(this.getApplicationContext());\n layoutManager.setOrientation(RecyclerView.", "VERTICAL);\n listView.setLayoutManager(layoutManager);\n listView.setItemAnimator(new DefaultItemAnimator());\n listView.setAdapter(adapter);\n\n FloatingActionButton fab = (FloatingActionButton) findViewById(R.id.my_addr_add_fab);\n if (!", "isFavouritesView())\n {\n fab.setVisibility(View.", "INVISIBLE);\n }\n else\n {\n fab.setOnClickListener(new View.", "OnClickListener()\n {\n public void onClick(View v)\n {\n log(\"Plus selected!\");", "\n showAddressDetails(EditType.", "EditOnly, null);\n }\n });\n }\n if (!", "viewOnly) { addDeleteItemHandler(listView); };\n return listView;\n }\n \n private void log(String str)\n {\n Log.i(GeocodeActivity.class.getName(), str);\n }\n \n private void logUser(String str)\n {\n Log.i(GeocodeActivity.class.getName(), str);\n try\n {\n Toast.makeText(this.getBaseContext(), str, Toast.", "LENGTH_SHORT).show();\n }\n catch (Exception e) { e.printStackTrace(); }\n }\n}\n\n" ]

{ "pile_set_name": "Github" }

[ 0.01639344262295082, 0, 0, 0, 0.03333333333333333, 0.03571428571428571, 0, 0, 0, 0, 0, 0.023255813953488372, 0.022222222222222223, 0.03508771929824561, 0, 0.018518518518518517, 0.017241379310344827, 0.015873015873015872, 0, 0, 0, 0, 0.030303030303030304, 0, 0, 0.03225806451612903, 0.03571428571428571, 0, 0.034482758620689655, 0, 0.019230769230769232, 0, 0, 0, 0.029411764705882353, 0, 0, 0, 0, 0.02857142857142857, 0.08333333333333333, 0, 0.08333333333333333, 0, 0.027777777777777776, 0, 0, 0.03125, 0.03125, 0.030303030303030304, 0.027777777777777776, 0, 0.03125, 0.029411764705882353, 0.024096385542168676, 0.0028776978417266188, 0.014388489208633094, 0.03571428571428571, 0.01020408163265306, 0.014084507042253521, 0.015228426395939087, 0, 0.00847457627118644, 0.003778337531486146, 0.006166495375128468, 0, 0, 0, 0, 0.010101010101010102, 0.002840909090909091, 0, 0.015873015873015872, 0.018867924528301886, 0.01818181818181818, 0.020833333333333332, 0.020833333333333332, 0.010869565217391304, 0, 0, 0, 0, 0, 0.010416666666666666, 0.003527336860670194, 0.08333333333333333, 0.006060606060606061, 0.08333333333333333, 0.006944444444444444, 0, 0.020202020202020204, 0.016853932584269662, 0.010773751224289911, 0.02, 0, 0, 0.043478260869565216, 0.011583011583011582, 0.011235955056179775, 0, 0.04, 0.043478260869565216, 0.012048192771084338, 0, 0, 0, 0, 0.006666666666666667, 0.007736943907156673, 0, 0, 0.012048192771084338, 0, 0.0029585798816568047, 0.0024096385542168677, 0.003289473684210526, 0.015151515151515152, 0.00980392156862745, 0.002770083102493075, 0, 0.005788712011577424, 0, 0, 0.011627906976744186, 0.020833333333333332, 0.02122641509433962, 0, 0.017543859649122806, 0.0111731843575419, 0.0021436227224008574, 0.005660377358490566, 0, 0.009009009009009009, 0.043478260869565216, 0, 0.009878419452887538, 0.0011467889908256881, 0.011627906976744186, 0.013157894736842105, 0.01282051282051282, 0, 0.009708737864077669, 0.002857142857142857, 0.008148148148148147, 0, 0.0029644268774703555, 0.01834862385321101, 0.0024509803921568627, 0.012096774193548387, 0, 0, 0, 0, 0, 0.003076923076923077, 0.011904761904761904 ]

[ "Most popular 637 posts about sport activities in Canada & USA :\n\nTheme 37: Bet predictions daily\n\ntel Aviv If this bet will not be a winner we will not lose the money invested! ", "Today I chose these two events for the best bet: Leeds Utd bet predictions daily 3-0 Rotherham Utd B. Jerusalem 1-0 M.it wouldn't shock me if. ", "A huge playmaker, because Bryant bet predictions daily was suspended last season, but this kid has scored 15 touchdowns in his first 21 NFL contests. ", "Martavis Bryant finishes with double-digit touchdowns: People might forget,\n\ntheme images by nfl picks and predictions for week 4 national football league espn piskunov. ", "Simple theme. ", "Qtscore All Rights reserved.but on m we release our top 4-5 football spread picks in College and pro football to read more check out some info on nfl and college handicapping. ", "We are here to help you so if bet predictions daily you have any questions about our 2013 College football spread picks or NFL winners feel free to email us anytime. ", "We personally bet many games throughout the season on our own,\n\nWIN WITH US AND MAKOOD PROFIT WITH OUR MATCHES HAZARD TEAM YOU RECEIVE BEST INFORMATION FROM OUR TEAM! ", "FOLLOW US! ", "DONT MISS THIS OFFER! ", "FOLLOW EXPERIENCE HAZARD TEAM! ", "FOR EVERY ONE WHO LIKE VIP TICKET WITH LITTLE ODDS KINDLY CONTACT US ALWAYS THERE FOR OUR.", "\n\nThe Saints need to beat Tampa Bay to clinch the NFC South, so there will be chances for Brees to have a big game. ", "He threw for 263 yards in a win over the Bucs earlier this season. ", "881: Difference in total yards from scrimmage.", "\n\nFrom the last round of games, Lawro got six correct results, including two perfect scores, from 10 matches, for a total of 120 points. ", "He beat actor Will Ferrell, who got three correct results, including one perfect score, giving him 60 points. ", "Total scores after.", "\n\nBet predictions daily in USA and Canada!", "\n\nthereby gaining home-field advantage throughout the playoffs. ", "Which means the Patriots will enter as strong favorites to reach bet predictions daily the Super Bowl and defend their championship. ", "New England will complete a 13-win season by beating the New York Jets this Sunday,sheva 1 3.25 1:0 Win Everton Atalanta 2 2.35 1:5 bet predictions daily Win Sutjeska Budunost P.\n\nthe man behind 'Fire in the football transfers now Booth' has racked up more than 51 million views and 20 million streams, and his single 'Man's Not Hot' is in in the top 10 of the charts.while others dont quite live up to their reputation. ", "They all share an important characteristic, however, some of which are good, as a result bet predictions daily of this there are multitudes of soccer tipping services appearing on the internet,\n\n30 Cricket bet predictions daily Deposit Bonus! ", "Org. ", "T Cs apply, yet there is still plenty for week 4 college football predictions ats the American soccer fan to get excited about when. ", "Photo report: 2018 World Cup predictions:. ", "You have come to the right place!or any other week. ", "Note bet predictions daily when betting on NFL, so sign up for Football LOCKS.com's NFL week 2 predictions today. ", "It's often paramount to use risk adverse money management whether you're gambling on week 2 football picks,all of those you will see showcased throughout our website are fully licensed and regulated and as such they all come highly recommended. ", "By visiting any of those betting sites websites you simply need to click onto the bet predictions daily register as a new player links,\n\nas always, if it's not week two but pro football is in bet predictions daily season, please visit the main picks page. ", "To find out which NFL week 2 games. ", "Surf over here to. ", "Football LOCKS.com has top rated NFL betting picks available for sale in,for that matter) chatter. ", "Hes hearing all of nfl picks week 6 sb nation the Darnold and Rosen (and Wyomings Josh Allen,) passing TDs Rushing Yards Rushing TDs Charlotte. ", "Marshall NC State Virginia Boston College Jackson is as competitive as they come.", "\n\nBetting tips and fixed!", "\n\ngolfer A has odds of 900, golfer A becomes a good choice. ", "Which means that you bet predictions daily will get 9.00 for every 1.00 you wager. ", "Even though hes the underdog in this bet, suddenly, this line shows value.take on Lawro and other fans, lawro is going for a 2-1 Liverpool win bet predictions daily - do you agree? ", "You can make your own predictions now,free fixed match, verifid seller football fixed matches, sure bet predictions daily fixed predictions, 100 sure predictions, 100 sure fixed matches, best fixed matches, hT/FT sure match fixed, fIXED MATCHES 100 SURE - Match prediction 100 sure, odds 30 fixed match, real fixed matches,dan Fouts (CBS Sports)) : Before Romo's arrival, many bet predictions daily thought CBS's No. ", "1 team of Phil Simms and Jim Nantz. ", "6. ", "2 announce team of Fouts and Ian Eagle were actually better than the former No. ", "Louis Riddick (ESPN )) : Rising star at ESPN. ", "5.zinedine Zidane, but board members are backing the 21-year-old ex-Real Mallorca star, wanted Hazard, a long-term admirer of the Chelsea forward, spain Eden Hazard bet predictions daily is no longer a Real Madrid transfer target with the La Liga champions putting their trust in Marco Asensio.", "\n\nsoccer predictions bet predictions daily : : soccer-picks. ", "Paid Soccer tips, football predictions - M betting tips, tipster competition, professional predictions soccer-picks. ", "Free picks and tips, betting predictions, odd tips, org. ", "Free betting tips, org Best Soccer picks, english football tips, bet free picks,we sell bet predictions daily football predictions from professional cappers (similar as tipster)).jameis Winston looked every bit like a former No.1 draft pick in the season opener, but its important not to overreact bet predictions daily to one game, and the Cardinals lost at home to a quarterback making his first career start.", "\n\nSee Bet predictions daily\n\nNCAAF Football - Computer Picks Score Predictions Odds Shark\n\n(GMT13:00)) Nuku'alofa bet tips sure wins Longtitude: atitude: isclaimer: bet predictions daily No guarantee is given that the program necessarily works as intended,\n\n20-16 (Getty Images)) Previous Next bet predictions daily If the Titans end up sitting at home for the playoffs, they will curse their loss to the 49ers most, prediction: Washington, also uncertain: everything about the Broncos quarterback situation, now and later.best betting efficacy over 10 to 20 tips. - ", "1st place 100 bet predictions daily Bet-at-home - 100 Roy Richie - 2nd place 50 Bet-at-home - 50 Roy Richie - 3rd place 25 Bet-at-home - 25 Roy Richie.get Best FREE Cricket Betting Tips and Match Predictions for bet predictions daily Free of IPL,\n\nincluding the Associated sports analytics predictions Press, college Football Playoff, bet predictions daily get NCAA FBS College Football rankings," ]

{ "pile_set_name": "Pile-CC" }

[ 0.005649717514124294, 0, 0.006666666666666667, 0.011764705882352941, 0, 0, 0.006024096385542169, 0, 0, 0, 0, 0, 0.017241379310344827, 0.014925373134328358, 0, 0, 0.00909090909090909, 0, 0, 0, 0.007518796992481203, 0.004750593824228029, 0, 0, 0, 0, 0, 0.017543859649122806, 0, 0, 0.027777777777777776, 0, 0.010101010101010102, 0.013888888888888888, 0.037037037037037035, 0, 0, 0, 0.0055248618784530384, 0.011990407673860911, 0.05555555555555555, 0, 0.025, 0.06521739130434782, 0.017006802721088437, 0, 0.008547008547008548, 0, 0.004866180048661801, 0.003527336860670194, 0.012626262626262626 ]

[ "Fergestad ME, Stamsås GA, Morales Angeles D, Salehian Z, Wasteson Y, Kjos M. Penicillin‐binding protein PBP2a provides variable levels of protection toward different β‐lactams in *Staphylococcus aureus* RN4220. ", "MicrobiologyOpen. ", "2020;9:e1057 10.1002/mbo3.1057\n\nMarte Ekeland Fergestad and Gro Anita Stamsås contributed equally to this work and are listed with increasing seniority.", "\n\n1. ", "INTRODUCTION {#mbo31057-sec-0001}\n===============\n\n*Staphylococcus aureus* is a major pathogen responsible for a range of different infections in both animals and humans, including skin and wound infections, mastitis, and bacteremia. ", "Besides, both animals and humans can be asymptomatic carriers of these bacteria. ", "Traditionally, β‐lactams alone or in combination with other substances have been used successfully to treat staphylococcal infections, due to their low toxicity, good pharmacodynamics, and bactericidal action (Foster, [2019](#mbo31057-bib-0014){ref-type=\"ref\"}; Llarrull, Fisher, & Mobashery, [2009](#mbo31057-bib-0029){ref-type=\"ref\"}). ", "However, the spread of β‐lactam resistant staphylococcal strains has emerged as a global concern (Grundmann, Aires‐de‐Sousa, Boyce, & Tiemersma, [2006](#mbo31057-bib-0020){ref-type=\"ref\"}), making it increasingly difficult to combat these infections.", "\n\nβ‐lactam antibiotics function by inhibiting the transpeptidase activity of penicillin‐binding proteins (PBPs). ", "PBPs are essential for the last steps of the synthesis of peptidoglycan in the bacterial cell wall. ", "Peptidoglycan consists of glycan chains with alternating N‐acetylglucosamine (NAG) and N‐acetylmuramic acid (NAM) units, which are cross‐linked by peptide bridges between the stem peptides of the NAMs units (Egan, Cleverley, Peters, Lewis, & Vollmer, [2017](#mbo31057-bib-0012){ref-type=\"ref\"}; Typas, Banzhaf, Gross, & Vollmer, [2011](#mbo31057-bib-0050){ref-type=\"ref\"}). ", "Synthesis of peptidoglycan requires two enzymatic reactions: NAGs and NAMs are added to the growing peptidoglycan chain by transglycosylases, and the cross‐links are formed by transpeptidases (Lovering, Safadi, & Strynadka, [2012](#mbo31057-bib-0031){ref-type=\"ref\"}; Typas et al.,", " [2011](#mbo31057-bib-0050){ref-type=\"ref\"}). ", "β‐lactams mimic the D‐ala‐D‐ala residues on the NAM side chain and form a covalent bond to a serine residue in the transpeptidase active site to inhibit PBP activity (Peacock & Paterson, [2015](#mbo31057-bib-0038){ref-type=\"ref\"}).", "\n\n*Staphylococcus aureus* encodes four different PBPs, named PBP1‐4 (Pinho, Kjos, & Veening, [2013](#mbo31057-bib-0041){ref-type=\"ref\"}) which can be targeted by β‐lactams. ", "Two of these, PBP1 and PBP3, are monofunctional transpeptidases, meaning that they only catalyze the formation of peptide crossbridges. ", "PBP1 and PBP3 interact with proteins of the SEDS ([s]{.ul}hape, [e]{.ul}longation, [d]{.ul}ivision, and [s]{.ul}porulation) family (FtsW and RodA, respectively) to form active transpeptidase/transglycosylase pairs (Meeske et al.,", " [2016](#mbo31057-bib-0033){ref-type=\"ref\"}; Reichmann et al.,", " [2019](#mbo31057-bib-0043){ref-type=\"ref\"}). ", "In contrast to PBP1 and PBP3, the PBP2 is a bifunctional protein with both transpeptidase and transglycosylase activities in the same protein. ", "The last PBP, PBP4 is a nonessential low‐molecular‐weight PBP with transpeptidase activity, whose function is still to a large extent undefined (da Costa, de Oliveira, Chambers, & Chatterjee, [2018](#mbo31057-bib-0009){ref-type=\"ref\"}).", "\n\nMethicillin‐resistant *S. aureus* (MRSA) strains encode, in addition to PBP1‐4, a fifth PBP protein, known as PBP2a, which is responsible for the resistant phenotype. ", "Even though methicillin is no longer in use, the term methicillin resistance persists and represents resistance to practically all β‐lactams, except 5th generation cephalosporins (Peacock & Paterson, [2015](#mbo31057-bib-0038){ref-type=\"ref\"}). ", "PBP2a is encoded by the *mecA* gene located on a genomic island known as staphylococcal cassette chromosome mec (SCCmec) (Katayama, Ito, & Hiramatsu, [2000](#mbo31057-bib-0023){ref-type=\"ref\"}). ", "PBP2a is a transpeptidase with a reduced affinity for transpeptidase‐inhibiting β‐lactams. ", "This low affinity allows MRSA strains to continue cell wall synthesis and multiplication in the presence of β‐lactams, as the transpeptidase activity of PBP2a is still functional when the activities of the other PBPs are inhibited.", "\n\nPBP2a activity in MRSA is regulated on many levels. ", "For example, PBP2a is under allosteric control (Fuda et al.,", " [2005](#mbo31057-bib-0015){ref-type=\"ref\"}; Otero et al.,", " [2013](#mbo31057-bib-0037){ref-type=\"ref\"}). ", "Correct folding and activity of PBP2a are also known to be dependent on extracellular chaperones (Jousselin et al.,", " [2015](#mbo31057-bib-0022){ref-type=\"ref\"}; Roch et al.,", " [2019](#mbo31057-bib-0044){ref-type=\"ref\"}), while *mecA* transcription is influenced by several factors (Hao, Dai, Wang, Huang, & Yuan, [2012](#mbo31057-bib-0021){ref-type=\"ref\"}; Peacock & Paterson, [2015](#mbo31057-bib-0038){ref-type=\"ref\"}). ", "Importantly, the stringent stress response pathway, specifically mediated by changes in the guanine metabolism, is associated with high‐level β‐lactam resistance in MRSA strains (Kim et al.,", " [2013](#mbo31057-bib-0025){ref-type=\"ref\"}; Mwangi et al.,", " [2013](#mbo31057-bib-0036){ref-type=\"ref\"}; Tomasz, Nachman, & Leaf, [1991](#mbo31057-bib-0049){ref-type=\"ref\"}). ", "Many MRSA strains also display so‐called heterogeneous resistance where only a fraction of the cells in a population are resistant (de Lencastre & Tomasz, [1994](#mbo31057-bib-0011){ref-type=\"ref\"}; Tomasz et al.,", " [1991](#mbo31057-bib-0049){ref-type=\"ref\"}). ", "Induction of the stringent stress response can change this heterogeneous resistant phenotype to a homogeneous, high‐level β‐lactam resistant phenotype (Aedo & Tomasz, [2016](#mbo31057-bib-0001){ref-type=\"ref\"}).", "\n\nDifferent β‐lactam subclasses, such as penicillins, cephalosporins, carbapenems, and monobactams, all have the β‐lactam ring as the functional core. ", "Apart from that, they contain chemical features which give different properties, such as different sensitivities toward β‐lactamases (Bush, [2018](#mbo31057-bib-0005){ref-type=\"ref\"}) and selective affinities for different PBPs (Chambers, Sachdeva, & Kennedy, [1990](#mbo31057-bib-0007){ref-type=\"ref\"}; Georgopapadakou, Smith, & Bonner, [1982](#mbo31057-bib-0017){ref-type=\"ref\"}; Kocaoglu, Tsui, Winkler, & Carlson, [2015](#mbo31057-bib-0026){ref-type=\"ref\"}). ", "Such detailed knowledge about the characteristics of these antibiotics and their interplay with bacteria could be utilized and explored in the design of individually tailored treatment schemes of difficult‐to‐treat infections. ", "Due to the increasing spread and treatment challenges of MRSA, it is necessary to gain further insight into the β‐lactam resistance of *S. aureus*. ", "In this work, we investigated how PBP2a protected against different β‐lactams in when expressed in the MSSA‐strain*S. aureus* RN4220.", "\n\n2. ", "RESULTS AND DISCUSSION {#mbo31057-sec-0002}\n=========================\n\n2.1. ", "Heterologous expression of *mecA* in *S. aureus* RN4220 results in dose‐dependent cefoxitin resistance {#mbo31057-sec-0003}\n-----------------------------------------------------------------------------------------------------------\n\nHeterologous expression of *mecA* has previously been shown to confer resistance to β‐lactams in *S. aureus* MSSA strains (Ballhausen, Kriegeskorte, Schleimer, Peters, & Becker, [2014](#mbo31057-bib-0003){ref-type=\"ref\"}; Matthews, Reed, & Stewart, [1987](#mbo31057-bib-0032){ref-type=\"ref\"}; Murakami & Tomasz, [1989](#mbo31057-bib-0035){ref-type=\"ref\"}). ", "We introduced the PBP2a‐encoding gene *mecA* downstream of the P*~spac~* promoter on a plasmid in the MSSA laboratory strain RN4220 (pLOW‐*mecA*, strain MF7). ", "This strain allows controlled *mecA* expression from the well‐established pLOW plasmid (Liew et al.,", " [2011](#mbo31057-bib-0028){ref-type=\"ref\"}) by the addition of increasing concentrations of IPTG. ", "Expression of *mecA* did not influence the growth of the resulting strain; no growth defect was observed in MF7 (P*~spac~*‐*mecA*) compared to the control strain (vector control strain IM55 carrying pLOW without *mecA*) for any of the inducer concentrations (Figure [1a](#mbo31057-fig-0001){ref-type=\"fig\"}). ", "Ender, McCallum, Adhikari, and Berger‐Bächi ([2004](#mbo31057-bib-0013){ref-type=\"ref\"}) found that transformation of a type I SCCmec element into a naïve susceptible strain resulted in a slower growth rate compared to the parental strain. ", "However, with our experimental conditions, there was no apparent fitness cost related to heterologous expression of the *mecA* gene in an MSSA.", "\n\n{#mbo31057-fig-0001}\n\nTo first establish that *mecA* expression could confer resistance in RN4220 under our experimental conditions, we exposed the cells to cefoxitin, a cephalosporin commonly used to detect MRSA strains (Skov et al.,", " [2006](#mbo31057-bib-0047){ref-type=\"ref\"}, [2014](#mbo31057-bib-0046){ref-type=\"ref\"}). ", "As expected, *mecA* induction protected *S. aureus* against cefoxitin (Figure [1b--f](#mbo31057-fig-0001){ref-type=\"fig\"}). ", "The MF7 strain (P*~spac~*‐*mecA*) grown with a range of inducer concentrations (0--1,000 µM IPTG) was exposed to twofold dilution series of cefoxitin to determine the minimum inhibitory concentrations (MIC). ", "The MIC of the uninduced strain was 1 µg/ml (Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}), and 50 µM IPTG was needed to increase the MIC to cefoxitin twofold (Figure [1b,c](#mbo31057-fig-0001){ref-type=\"fig\"}). ", "By further increasing the inducer concentration, a maximum of eightfold increase in MIC was obtained compared to the noninduced MF7 strain (Figure [1d,e](#mbo31057-fig-0001){ref-type=\"fig\"}, Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "The MIC of the noninduced MF7‐strain was similar to that of the vector control strain (IM55) and the wild‐type RN4220, verifying that leakiness of the P*~spac~* promoter did not influence the level of resistance (Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}). ", "We also performed a population analysis profile (Tomasz et al.,", " [1991](#mbo31057-bib-0049){ref-type=\"ref\"}) of the MF7‐strain and control strain toward cefoxitin, by plating the strain onto different concentrations of cefoxitin. ", "The population analysis profile shows a heterogeneous resistant pattern for MF7 (Figure [1g](#mbo31057-fig-0001){ref-type=\"fig\"}). ", "This result thus suggests that the majority of cells in the population are sensitive to cefoxitin despite expressing *mecA*. ", "This is in line with what has been reported for the heterologous expression of *mecA* before (Katayama, Zhang, Hong, & Chambers, [2003](#mbo31057-bib-0024){ref-type=\"ref\"}).", "\n\n###### \n\nLevel of protection by *mecA* expression in *Staphylococcus aureus* MF7 for different β‐lactams[^a^](#mbo31057-note-0002){ref-type=\"fn\"}\n\n β‐lactam[^b^](#mbo31057-note-0003){ref-type=\"fn\"} Class MIC RN4220 MIC MF7 (µg/ml) Fold protection[^c^](#mbo31057-note-0004){ref-type=\"fn\"} \n --------------------------------------------------- ----------------------------------------------- ------------ ----------------- ---------------------------------------------------------- ----\n Ampicillin 3rd generation penicillin (extended spectrum) 0.78 0.78 12.5 16\n Cefaclor 2nd generation cephalosporin 0.5 0.5 16 32\n Cefotaxime 3rd generation cephalosporin 0.5 0.5 4 8\n Cefoxitin 2nd generation cephalosporin 1 1 8 8\n Cephalexin 1st generation cephalosporin 2 2 64 32\n Imipenem Carbapenem 0.03 0.03 0.13 4\n Oxacillin 2nd generation penicillin (narrow spectrum) 0.39 0.39 6.25 16\n Penicillin G 1st generation penicillin (narrow spectrum) 0.10 0.10 0.78 8\n Piperacillin 4th generation penicillin (extended spectrum) 1.56 1.56 12.5 8\n\nThe experiments were repeated at least three times with similar results.", "\n\nAmong the β‐lactams tested here, four have been reported to have a specific affinity for certain PBPs in *S. aureus*. ", "These are cefaclor (specific to PBP3), cefotaxime (PBP2), cefoxitin (PBP4), and cephalexin (PBP3).", "\n\nFold protection by *mecA* induction was determined as the ratio between MIC with induction and the MIC of uninduced cells.", "\n\nJohn Wiley & Sons, Ltd\n\n###### \n\nMIC values and level of protection against antibiotics with PBP selectivity with a gradual increase in *mecA* expression in *Staphylococcus aureus* MF7[^a^](#mbo31057-note-0005){ref-type=\"fn\"}\n\n ABX Strain Genotype Concentration IPTG (µM) Fold protection[^b^](#mbo31057-note-0006){ref-type=\"fn\"} \n ------------ -------------------------- ---------- ------------------------- ---------------------------------------------------------- ----- ----- ---\n Cefoxitin IM55 Control 1 1 1 1 1\n MF7 P*~spac~*‐*mecA* 1 2 4 8 8 \n MF21 P*~spac~*‐*mecA* (S403A) 1 1 1 1 1 \n MF23 P*~spac~*‐*mecA* (K188A) 1 2 8 8 8 \n Cefotaxime IM55 Control 0.5 0.5 0.5 0.5 1\n MF7 P*~spac~*‐*mecA* 0.5 2 4 4 8 \n MF21 P*~spac~*‐*mecA* (S403A) 0.5 0.5 0.5 0.5 1 \n MF23 P*~spac~*‐*mecA* (K188A) 0.5 1 4 4 8 \n Cefaclor IM55 Control 0.5 0.5 0.5 0.5 1\n MF7 P*~spac~*‐*mecA* 0.5 4 16 16 32 \n MF21 P*~spac~*‐*mecA* (S403A) 0.5 0.5 0.5 0.5 1 \n MF23 P*~spac~*‐*mecA* (K188A) 1 4 16 16 32 \n Cephalexin IM55 Control 2 2 2 2 1\n MF7 P*~spac~*‐*mecA* 2 8 64 64 32 \n MF21 P*~spac~*‐*mecA* (S403A) 2 2 2 2 1 \n MF23 P*~spac~*‐*mecA* (K188A) 2 16 32 64 32 \n\nThe experiments were repeated at least three times with similar results.", "\n\nFold protection by *mecA* induction was determined as the ratio between MIC with 1,000 µM induction and the MIC of uninduced cells.", "\n\nJohn Wiley & Sons, Ltd\n\nTo verify that the enzymatic activity of PBP2a is needed for the observed protection, we created a *mecA* mutant construct, in which the active site serine was changed to alanine (S403A). ", "This mutation has previously been shown to abolish the enzymatic activity of PBP2a (Sun, Bauer, & Lu, [1998](#mbo31057-bib-0048){ref-type=\"ref\"}). ", "As expected, the *mecA*(S403A) mutation (strain MF21) fully abolished the protection by PBP2a in our experiments (Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}). ", "Thus, heterologous expression of PBP2a confers protection toward cefoxitin in *S. aureus* RN4220.", "\n\nPBP2a has also been shown to be under allosteric control (Fuda et al.,", " [2005](#mbo31057-bib-0015){ref-type=\"ref\"}; Otero et al.,", " [2013](#mbo31057-bib-0037){ref-type=\"ref\"}), however, it has not been studied whether the allostery of PBP2a plays any role during heterologous expression in an MSSA strain. ", "To see if allosteric regulation played a role under our experimental conditions, we therefore created another mutant, *mecA*(K188A) (strain MF23), where one of the key residues for allosteric regulation was mutated (Otero et al.,", " [2013](#mbo31057-bib-0037){ref-type=\"ref\"}). ", "However, this mutation did not have any effect on the activity of PBP2a and the mutant was as efficient as the wild‐type PBP2a protein in protecting against the different β‐lactams (Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}). ", "Thus, based on the results of this mutant, allosteric regulation does not seem to play any role in our experimental setup.", "\n\n2.2. ", "Variable levels of protection toward different β‐lactams by PBP2a in *S. aureus* RN4220 {#mbo31057-sec-0004}\n--------------------------------------------------------------------------------------------\n\nThe results above establish that the P*~spac~*‐*mecA* construct in *S. aureus* RN4220 can protect the cells against cefoxitin up to eightfold compared to the controls. ", "Previously, studies have indicated that expression of *mecA* in an MSSA background may confer variable levels of protection against different β‐lactams (Ballhausen et al.,", " [2014](#mbo31057-bib-0003){ref-type=\"ref\"}; Ubukata, Nonoguchi, Matsuhashi, & Konno, [1989](#mbo31057-bib-0051){ref-type=\"ref\"}). ", "To study this variation more systematically, we tested the resistance levels of strain MF7 toward a panel of 10 different β‐lactams. ", "These represent ten different β‐lactam subclasses, including penicillins (1st--4th generation), carbapenems, and cephalosporins (1st--3rd generation) (Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "Furthermore, it has long been known that different β‐lactams have variable affinities for the four native staphylococcal PBPs (Chambers & Sachdeva, [1990](#mbo31057-bib-0006){ref-type=\"ref\"}; Chambers et al.,", " [1990](#mbo31057-bib-0007){ref-type=\"ref\"}; Georgopapadakou, Dix, & Mauriz, [1986](#mbo31057-bib-0016){ref-type=\"ref\"}; Georgopapadakou, Smith, Cimarusti, & Sykes, [1983](#mbo31057-bib-0018){ref-type=\"ref\"}), and we included β‐lactams with variable affinity characteristics: Cefoxitin has the highest affinity for PBP4, cefotaxime has the highest affinity for PBP2 and cephalexin and cefaclor has the highest affinity for PBP3 (Chambers et al.,", " [1990](#mbo31057-bib-0007){ref-type=\"ref\"}; Georgopapadakou et al.,", " [1982](#mbo31057-bib-0017){ref-type=\"ref\"}, [1986](#mbo31057-bib-0016){ref-type=\"ref\"}). ", "The other β‐lactams tested also have variable but less defined affinities for PBP1‐PBP4 (Chambers & Sachdeva, [1990](#mbo31057-bib-0006){ref-type=\"ref\"}; Georgopapadakou et al.,", " [1982](#mbo31057-bib-0017){ref-type=\"ref\"}, [1983](#mbo31057-bib-0018){ref-type=\"ref\"}, [1986](#mbo31057-bib-0016){ref-type=\"ref\"}).", "\n\nMICs were determined in strain MF7 with or without induction of *mecA* by IPTG (Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "Notably, the level of protection for the different β‐lactams ranged from fourfold to a 32‐fold increase in MIC from induced to uninduced. ", "Cefaclor and cephalexin showed the highest increase in MIC (32‐fold), followed by ampicillin and oxacillin (16‐fold). ", "The lowest MIC increase was found for imipenem (fourfold) followed by cefotaxime, cefoxitin, penicillin G, and piperacillin (all eightfold). ", "These results strengthen and underline previous indications (Ballhausen et al.,", " [2014](#mbo31057-bib-0003){ref-type=\"ref\"}; Ubukata et al.,", " [1989](#mbo31057-bib-0051){ref-type=\"ref\"}) that there is a great variation in the level of β‐lactam protection conferred by *mecA* upon expression in an*S. aureus* MSSA strain. ", "The observed variations do not seem to correlate with β‐lactam subclasses (i.e., penicillins vs cephalosporins, Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "The highest level (32‐fold) of protection was found against cefaclor and cephalexin. ", "Notably, these are β‐lactams that are characterized by having high specific affinity toward PBP3 (Chambers & Sachdeva, [1990](#mbo31057-bib-0006){ref-type=\"ref\"}; Georgopapadakou et al.,", " [1982](#mbo31057-bib-0017){ref-type=\"ref\"}). ", "On the other hand, the two other selective β‐lactams tested, cefotaxime and cefoxitin, which have the highest affinity toward PBP2 and PBP4, respectively (Chambers & Sachdeva, [1990](#mbo31057-bib-0006){ref-type=\"ref\"}), showed clearly lower resistance levels (both eightfold resistance).", "\n\nTo further study the notable observation that the highest level of protection was conferred against PBP3‐selective β‐lactams in our experiments, we made an IPTG titration with concentrations from 0 to 1,000 µM and again determined the MICs for these PBP‐selective β‐lactams (Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}). ", "This further demonstrated that PBP2a is more effective in protecting against cefaclor and cephalexin than against cefoxitin and cefotaxime (Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}) at different PBP2a expression levels. ", "In all cases, the MIC value of the uninduced MF7 was similar to the wild type and control strain, verifying the leaky expression of *mecA* did not play any significant role (Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}, Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}). ", "In line with what was found for cefoxitin, the active site mutant did not confer resistance to any of the β‐lactams and we found no indication that allosteric regulation plays a role in these assays since the *mecA*(K188A) mutant provided a similar degree of protection as the original *mecA* allele.", "\n\nPBP3 is a monofunctional, nonessential transpeptidase that is thought to be important for the slight cell elongation observed during the staphylococcal cell cycle (Reichmann et al.,", " [2019](#mbo31057-bib-0043){ref-type=\"ref\"}). ", "PBP2a, which is also a transpeptidase, replaces the transpeptidase activity of PBP2 in MRSA strains, but cannot complement the transpeptidase activity of PBP1 (Pereira, Henriques, Pinho, de Lencastre, & Tomasz, [2007](#mbo31057-bib-0039){ref-type=\"ref\"}; Pinho, de Lencastre, & Tomasz, [2001](#mbo31057-bib-0040){ref-type=\"ref\"}). ", "It is possible that PBP2a functionally complements the β‐lactam‐inhibited PBP3 activity and that this somehow contributes to the observation that PBP2a expression confers the highest level of resistance toward PBP3‐selective β‐lactams. ", "This trend has not been reported before. ", "In contrast, Antignac and Tomasz ([2009](#mbo31057-bib-0002){ref-type=\"ref\"}) compared the MICs of the homogeneously resistant MRSA strain COL with an isogenic strain in which *mecA* was deleted (COL‐S) and found that the drop in resistance levels was more pronounced for PBP2‐ and PBP4‐specific β‐lactams as compared to a PBP3‐specific β‐lactam (Antignac & Tomasz, [2009](#mbo31057-bib-0002){ref-type=\"ref\"}; Georgopapadakou et al.,", " [1982](#mbo31057-bib-0017){ref-type=\"ref\"}). ", "It can be speculated that these differences may be due to strain‐specific host factors important for optimal resistance (Berger‐Bächi & Rohrer, [2002](#mbo31057-bib-0004){ref-type=\"ref\"}; Roemer, Schneider, & Pinho, [2013](#mbo31057-bib-0045){ref-type=\"ref\"}), for example, proteins affecting the cell wall synthesis machinery. ", "However, to shed further light on the mechanisms underlying the observed variation in PBP2a‐mediated protection against different β‐lactams in *S. aureus* RN4220 observed here, future studies should systematically compare *mecA* expression in *S. aureus* MSSA strains with different genetic backgrounds.", "\n\n2.3. ", "Heterologous *mecA* expression confers a low level of protection against β‐lactams {#mbo31057-sec-0005}\n---------------------------------------------------------------------------------------\n\nIn addition to the β‐lactam‐dependent variation, the results presented in Table [1](#mbo31057-tbl-0001){ref-type=\"table\"} also show that the level of protection conferred by *mecA* expression in *S. aureus* RN4220 is relatively low. ", "Upon full induction of *mecA,* the MICs for cefoxitin and cephalexin were 8 and 64 µg/ml, respectively. ", "Both these MICs are significantly lower than those for MRSA strains carrying the full SCCmec. ", "We determined the MICs for cefoxitin and cephalexin for the homogeneous resistant MRSA strain *S. aureus* COL and found these to be 188 and 125 µg/ml, respectively. ", "The relatively low MICs in RN4220 upon heterologous *mecA* expression is in line with a study by Ballhausen et al.", " ([2014](#mbo31057-bib-0003){ref-type=\"ref\"}) where *mecC* and *mecA* expression in RN4220 resulted in cefoxitin resistance levels in the same range as observed here. ", "These differences between MRSA strains and heterologous expression of *mecA* in MSSA strains may be explained by the variable transcription level of PBP2a between strains. ", "Alternatively, unknown strain‐dependent factors may play an important role. ", "For example, the functionality of PBP2a is likely to be better adapted and optimized in their natural MRSA hosts compared to non‐native expression in MSSA hosts such as RN4220 (Katayama et al.,", " [2003](#mbo31057-bib-0024){ref-type=\"ref\"}). ", "This notion may also be one of several reasons for the limited horizontal gene transfer events observed for *mecA* in *S. aureus* (Peacock & Paterson, [2015](#mbo31057-bib-0038){ref-type=\"ref\"}) since the competitive advantage of strains with newly acquired *mecA* is relatively low upon exposure to high doses of β‐lactams.", "\n\n2.4. ", "Single‐cell analysis of heterologous *mecA* expression {#mbo31057-sec-0006}\n-----------------------------------------------------------\n\nTo further observe how heterologous *mecA* expression protects the RN4220 cells toward β‐lactams on a single‐cell level, we performed microfluidics fluorescence time‐lapse microscopy. ", "To allow cocultivation experiments, we created a GFP‐positive RN4220 strain by integrating a *gfp* gene on the RN4220 chromosome, following a previously published approach (de Jong, van der Horst, van Strijp, & Nijland, [2017](#mbo31057-bib-0010){ref-type=\"ref\"}). ", "The P*~spac~*‐*mecA*(S403A) construct, expressing the nonactive PBP2A, was transformed into the GFP‐positive strain to create strain MF27. ", "As expected, the MICs of strain MF27 were shown to be identical to those of MF21 and wild‐type RN4220 (data not shown). ", "The single‐cell growth of the two strains MF7 (P*~spac~*‐*mecA*) and MF27 (P*~spac~*‐*mecA*(S403A), GFP^+^) was then studied in culture medium without cefoxitin and in the presence of 2 and 20 µg/ml cefoxitin. ", "These concentrations correspond to twofold and 20‐fold higher than the MIC for *S. aureus* RN4220 (Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "Expression from the P*~spac~* promoter was induced throughout the experiment. ", "In the absence of cefoxitin (Figure [2a](#mbo31057-fig-0002){ref-type=\"fig\"}), the two strains were both actively multiplying. ", "At the lower cefoxitin concentration (Figure [2](#mbo31057-fig-0002){ref-type=\"fig\"}b, 2 µg/ml), MF7 was growing normally, while the MF27 strain stopped dividing. ", "In the presence of 20 µg/ml, which is more than 20× MIC of MF27 and more than 2× MIC of MF7, neither of the strains were multiplying (Figure [2c](#mbo31057-fig-0002){ref-type=\"fig\"}). ", "Thus, these single‐cell data are fully in line with the growth curves.", "\n\n{#mbo31057-fig-0002}\n\nIt was interesting to note, however, that only a fraction of the *mecA*‐negative cells (MF27) lysed, as observed by loss of GFP‐signal upon exposure to cefoxitin. ", "During the 6 hr timeframe of the experiments, exposure to 2× MIC (2 µg/ml cefoxitin) resulted in lysis of 17.3% (*N* = 243) of the cells. ", "The fraction increased somewhat upon exposure to 20× MIC of cefoxitin (28.1% of cell lost GFP‐signal, *N* = 238). ", "Still, the majority of cells even at this concentration (20× MIC of MF27) did not lyse. ", "Our observations thus show that there are cell‐to‐cell variations with regard to cell lysis upon cefoxitin exposure.", "\n\nTo see whether this was a cefoxitin‐specific phenotype, the same type of experiments was then performed with cefotaxime, a 3rd generation cephalosporin. ", "The MIC of the control strain for cefotaxime is 0.5 µg/ml, and similar to cefoxitin, induction of *mecA* expression resulted in an eightfold increase in MIC (Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "During the time‐lapse microscopy, cells were exposed to 2 µg/ml (4× MIC of control) and 20 µg/ml (40× MIC of control) for four hours. ", "In these experiments, we changed to cefotaxime‐free medium after four hours to study the potential recovery and regrowth of cells after antibiotic exposure. ", "As for cefoxitin, only a small fraction of the control cell (MF27) lysed during four hours (Figure [3](#mbo31057-fig-0003){ref-type=\"fig\"}, 8.1% and 7.6%, respectively). ", "However, upon changing to normal growth medium after four hours of cefotaxime exposure, the MF27 cells did not regrow. ", "This shows, as expected, that all the cells were killed by the bactericidal β‐lactam although only a fraction of the cells lysed. ", "It is well established that β‐lactams inhibit the PBP transpeptidase activity, however, the exact mechanism leading to cell killing by β‐lactams is still not fully understood (Peacock & Paterson, [2015](#mbo31057-bib-0038){ref-type=\"ref\"}). ", "Cell wall degrading enzymes seem to have variable importance in different strains and for different β‐lactams (Peacock & Paterson, [2015](#mbo31057-bib-0038){ref-type=\"ref\"}). ", "The cell‐to‐cell variation observed here with regard to lysis thus suggests that several mechanisms resulting in cell killing at play in the same population.", "\n\n{#mbo31057-fig-0003}\n\nThe growth of *mecA*‐positive MF7‐cells was, as expected, fully inhibited at the highest cefotaxime concentration (20 µg/ml) (Figure [2b](#mbo31057-fig-0002){ref-type=\"fig\"}). ", "This concentration is fivefold higher than cefotaxime MIC after *mecA* induction (Table [2](#mbo31057-tbl-0002){ref-type=\"table\"}). ", "Noteworthy, however, upon changing to normal growth medium after four hours of cefotaxime exposure, some of these cells (13%, *N* = 170) were able to regrow after the antibiotic exposure was released (Figure [3](#mbo31057-fig-0003){ref-type=\"fig\"}, yellow arrowheads). ", "The presence of PBP2a in these cells thus protected the cells from β‐lactam‐mediated killing even with four hours exposure with concentration much higher than the MIC value. ", "The reason for the cell‐to‐cell variation is not known. ", "As shown in Figure [1g](#mbo31057-fig-0001){ref-type=\"fig\"}, the MF7 strain has a heterogeneous resistant phenotype and this result underlines the importance of prolonged drug treatment to kill all cells in a population.", "\n\n3. ", "CONCLUSIONS {#mbo31057-sec-0007}\n==============\n\nThe results presented here show (a) that the level of resistance conferred by *mecA* expression in *S. aureus* RN4220 is low compared to MRSA strains, and that (b) the level of resistance varies considerably between different β‐lactams. ", "Surprisingly, and in contrast to what has been reported for MRSA strains, the highest level of resistance is observed for PBP3‐targeting β‐lactams. ", "The reason for this is unknown and should be subjected to further studies. ", "It is not known whether these variable MICs observed here would be valid in clinical isolates of MRSA. ", "However, it underlines the importance of determining the MIC for the specific antibiotic toward the individual pathogenic strain when preparing for the treatment of an MRSA infection, as well as considering the achievable drug concentration at the site of infection.", "\n\nOur experiments were done in a laboratory strain with heterologous expression of *mecA*. ", "If the observations reported here also are representative for wild‐type populations of *S. aureus*, this will pose critical problems for diagnostics and treatment of such infections. ", "For example for cefoxitin, the MIC of resistant isolates based on the Clinical and Laboratory Standards Institute (CLSI) guidelines is \\>8 µg/ml (CLSI, [2020](#mbo31057-bib-0008){ref-type=\"ref\"}), and wild‐type MRSA strains often show MICs more than 10‐fold higher (e.g., 188 µg/ml for *S. aureus* COL). ", "Due to the relatively low MIC values after *mecA* induction (e.g., 8 µg/ml for cefoxitin), such a strain could be interpreted as intermediate or even negative for methicillin resistance. ", "Besides, the single‐cell data suggest that some cells can survive at concentrations fivefold higher than the MIC and thus also regrow when no longer exposed to antibiotics. ", "This is a critical aspect in the treatment of infections and further highlights the importance of achievable drug concentrations and duration of drug exposure, to prevent such survivor cells to regrow and avoid re‐emergence of infections.", "\n\n4. ", "MATERIALS AND METHODS {#mbo31057-sec-0008}\n========================\n\n4.1. ", "Bacterial strains and growth conditions {#mbo31057-sec-0009}\n--------------------------------------------\n\nAll strains used in this study are listed in Table [3](#mbo31057-tbl-0003){ref-type=\"table\"}. *", "Escherichia coli* was grown in LB medium at 37°C with shaking or on LB plates at 37°C. ", "100 µg/ml ampicillin was added to the growth medium for selection. ", "The transformation of *E. coli* was performed using standard heat‐shock protocols.", "\n\n###### \n\nStrains and plasmids used in this study\n\n Strain or plasmid Description Reference\n ------------------------- ------------------------------------------------------------------------------------------------------------------------------------------- ----------------------------------------------------------------\n *Escherichia coli* \n IM08B Monk et al.", " ([2015](#mbo31057-bib-0034){ref-type=\"ref\"})\n *Staphylococcus aureus* \n RN4220 Kreiswirth et al.", " ([1983](#mbo31057-bib-0027){ref-type=\"ref\"})\n COL Gill et al.", " ([2005](#mbo31057-bib-0019){ref-type=\"ref\"})\n MK1483 RN4220, chromosomal integration of SarA_P1‐*sfgfp* in the locus between genes SAOUHSC_00038 and SAOUHSC_00039 This study\n MF7 RN4220, pLOW‐*mecA* This study\n MF21 RN4220, pLOW‐*mecA*(S403A) This study\n MF23 RN4220, pLOW‐*mecA*(K188A) This study\n MF27 MK1483, pLOW‐*mecA*(S403A) This study\n IM55 RN4220, pLOW‐*lacA‐gfp* Lab collection\n *Plasmids* \n pLOW‐GFP Plasmid containing a gfp gene downstream of a P*~spac~* promoter (P*~spac~*‐MCS‐*gfp*) Liew et al.", " ([2011](#mbo31057-bib-0028){ref-type=\"ref\"})\n pLOW‐mecA Expressing *mecA* from an IPTG‐inducible promoter (P~spac~ *‐mecA*), *ery^R^*, *amp^R^* This study\n pLOW‐mecA(S403A) Expressing *mecA* with mutation S403A to inactivate the active site P*~spac~‐mecA(S403A)*, *ery^R^*, *amp^R^* This study\n pLOW‐mecA(K188A) Expressing *mecA* with mutation K188A to inactivate the allosteric site P*~spac~‐mecA(K188A)*, *ery^R^*, *amp^R^* This study\n pTH100 Vector for the integration of SarA_P1‐sGFP in the locus between genes SAOUHSC_00038 and SAOUHSC_00039 pJB38‐NWMN29‐30 + SarA_P1‐sGFP‐Term de Jong et al.", " ([2017](#mbo31057-bib-0010){ref-type=\"ref\"})\n\nJohn Wiley & Sons, Ltd\n\n*Staphylococcus aureus* was grown in brain‐heart‐infusion (BHI) medium with shaking at 37°C or on BHI agar at 37°C. ", "When appropriate, 5 µg/ml erythromycin was added to the growth medium for selection. ", "Expression from the P*~spac~* promoter was induced by the addition of IPTG to the growth medium. ", "Transformation of *S. aureus* was performed by electroporation, as described before (Lofblom, Kronqvist, Uhlen, Stahl, & Wernerus, [2007](#mbo31057-bib-0030){ref-type=\"ref\"}), with plasmids isolated from *E. coli* IM08B (Monk, Tree, Howden, Stinear, & Foster, [2015](#mbo31057-bib-0034){ref-type=\"ref\"}).", "\n\n4.2. ", "Plasmid and strain construction {#mbo31057-sec-0010}\n------------------------------------\n\nAll primers and plasmids used in this study are listed in Table [4](#mbo31057-tbl-0004){ref-type=\"table\"}.", "\n\n###### \n\nOligos used in this study\n\n Name Sequence (5′--3′)\n ------------------------- ------------------------------------\n mf3_mecA_f\\_SalI ACTGGTCGACGTAATATACTACAAATGTAGTCTT\n mf2_mecA_r\\_EcoRI GATCGAATTCTCGTTACGGATTGCTTCACTG\n im110_seq‐pLOW_up ermC TTGGTTGATAATGAACTGTGCT\n im134_pLOW_down_check_R TGTGCTGCAAGGCGATTAAG\n mecA_K188A_f AGCAATCGCTgcAGAACTAAGTATTTC\n mecA_K188A_r GAAATACTTAGTTCTgcAGCGATTGCT\n mecA_S403A_f ACTTCACCAGGTgCAACTCAAAAAATAT\n mecA_S403A_r ATATTTTTTGAGTTGcACCTGGTGAAGT\n\nJohn Wiley & Sons, Ltd\n\n### 4.2.1. ", "pLOW‐*mecA* {#mbo31057-sec-0011}\n\nThe *mecA* gene was amplified from *S. aureus* COL (Gill et al.,", " [2005](#mbo31057-bib-0019){ref-type=\"ref\"}) using primers mf3 and mf2. ", "The PCR product was digested with restriction enzymes SalI and EcoRI and ligated into the multiple cloning site of pLOW, to produce the plasmid pLOW‐*mecA*, a plasmid with the inducible promoter P*~spac~* that allows controlled expression of *mecA*. ", "The ligation reaction was transformed into *E. coli* IM08B, and correct constructs were verified by colony PCR and sequencing with primers IM110 and IM134.", "\n\n### 4.2.2. ", "pLOW‐*mecA*(S403A) {#mbo31057-sec-0012}\n\nThe *mecA*(S403A) allele was made by introducing a point mutation using a two‐step overlap extension PCR. ", "The first fragment was amplified with primers mf3 and mecA_S403A_r, and the second fragment was amplified with primers mecA_S403A_f and mf2. ", "pLOW‐*mecA* was used as template DNA. ", "The mutation was introduced by the overlapping inner primers, and the two fragments were fused in a second PCR using the two outer primers which contain the SalI and EcoRI restriction sites. ", "The final fragment was digested with SalI and EcoRI and ligated into the multiple cloning site of pLOW. ", "The resulting plasmid was verified by PCR and sequencing as described above.", "\n\n### 4.2.3. ", "pLOW‐*mecA*(K188A) {#mbo31057-sec-0013}\n\nThe *mecA*(K188A) allele was made by the introduction of a point mutation using a two‐step overlap extension PCR. ", "The first fragment was amplified with primers mf3 and mecA_K188A_r, and the second fragment was amplified with primers mecA_K188A_f and mf2. ", "pLOW‐*mecA* was used as template DNA. ", "The plasmid was then made and verified as described above.", "\n\n### 4.2.4. *", "Staphylococcus aureus* MK1483 {#mbo31057-sec-0014}\n\nTo make a constitutive GFP‐positive strain (SarA_P1‐*sfgfp* in RN4220), we used the plasmid pTH100, which allows markerless integration of a superfolder gfp expressing construct in an intergenic region between genes SAOUHSC_00038 and SAOUHSC_00039 (de Jong et al.,", " [2017](#mbo31057-bib-0010){ref-type=\"ref\"}). ", "The temperature‐sensitive pTH100 plasmid was transformed into *S. aureus* RN4220 at 30°C using chloramphenicol as a selection marker, and the double crossover was generated as described (de Jong et al.,", " [2017](#mbo31057-bib-0010){ref-type=\"ref\"}). ", "GFP‐positive colonies were finally verified for correct integration by PCR.", "\n\n4.3. ", "Growth assays and determination of β‐lactam susceptibility {#mbo31057-sec-0015}\n---------------------------------------------------------------\n\nThe MICs for different antibiotics were determined by twofold dilution assays in microtiter plates. ", "Overnight cultures of *S. aureus* strains grown in BHI with 5 µg/ml erythromycin were diluted 100‐fold in medium (with various IPTG concentrations) and exposed to a twofold dilution series of the antibiotics (listed in Table [1](#mbo31057-tbl-0001){ref-type=\"table\"}). ", "Growth at 37°C was monitored by measuring OD~600~ every 10th minute for 15 hr in a Synergy (BioTek) or Hidex microtiter plate reader (BioTek) with shaking for 5 s before each measurement. ", "MIC (MIC~50~) was defined as the minimal concentration to inhibit the growth of at least 50%. ", "The fold protection was determined as the ratio between the MIC value for full *mecA* induction (1,000 µM IPTG) and the MIC value for the uninduced condition. ", "All MIC assays were performed at least three times.", "\n\n4.4. ", "Population analysis profile (PAP) {#mbo31057-sec-0016}\n--------------------------------------\n\nPAPs were performed as described by Reichmann and Pinho ([2017](#mbo31057-bib-0042){ref-type=\"ref\"}) with some modifications. ", "Briefly, overnight cultures of strains MF7 and MF12 with 250 µM IPTG and without IPTG were diluted to 10^--1^ to 10^--7^. Ten µl of each dilution was plated on BHI plates containing cefoxitin (0, 1, 2, 4, 6, and 16 µg/ml), erythromycin 5 µg/ml and 250 mM IPTG when necessary. ", "Plates were incubated at 37°C, and colonies were counted after 24 hr.", "\n\n4.5. ", "Time‐lapse microfluidics microscopy {#mbo31057-sec-0017}\n----------------------------------------\n\nA CellASIC^®^ ONIX2 Microfluidic System (Millipore) connected to a Zeiss fluorescence microscope was used to monitor the growth and survival of *S. aureus* during exposure to cefoxitin and cefotaxime. ", "Strains MF7 and MF27 were grown overnight in BHI with 5 µg/ml erythromycin. ", "The cultures were rediluted in the same medium with 250 µM IPTG for induction and grown for 3 hr until the cultures reached the exponential phase (OD~600~ = 0.4). ", "CellASIC^®^ ONIX B04A‐03 Microfluidic Bacteria Plates (Millipore) were primed with medium (BHI with 5 µg/ml erythromycin and 250 µM IPTG), and cells were loaded onto the plates according to the manufacturer\\'s protocol. ", "Images were acquired with a Zeiss Axio Observer with an Orca‐Flash4.0 V2 Digital complementary metal‐oxide‐semiconductor (CMOS) camera (Hamamatsu Photonics) through a 100× PC objective. ", "HPX 120 Illuminator was used as a fluorescent light source. ", "Cells were imaged (phase contrast and GFP fluorescence) every 15th minute for 6 hr during normal growth or exposure to cefoxitin or cefotaxime.", "\n\nCONFLICT OF INTEREST {#mbo31057-sec-0020}\n====================\n\nNone declared.", "\n\nAUTHOR CONTRIBUTION {#mbo31057-sec-0021}\n===================\n\n**Marte Ekeland Fergestad:** Conceptualization (supporting); investigation (lead); methodology (equal); writing -- original draft (supporting); writing -- review & editing (lead). **", "Gro Anita Stamsås:** Conceptualization (supporting); investigation (equal); methodology (equal); writing -- review & editing (equal). **", "Danae Morales Angeles:** Investigation (equal); methodology (equal); writing -- review & editing (equal). **", "Zhian Salehian:** Investigation (equal); methodology (equal); writing -- review & editing (equal). **", "Yngvild Wasteson:** Conceptualization (supporting); funding acquisition (equal); supervision (supporting); writing -- original draft (equal); writing -- review & editing (equal). **", "Morten Kjos:** Conceptualization (lead); funding acquisition (equal); investigation (supporting); methodology (equal); supervision (lead); writing -- original draft (lead); writing -- review & editing (lead).", "\n\nETHICS STATEMENT {#mbo31057-sec-0018}\n================\n\nNone required.", "\n\nWe would like to thank Ine Myrbråten, NMBU, for help with strain construction. ", "This work has been funded by the ANIHWA ERA‐Net project MRSA_BACTERIOPHAGE project (project number 258877), by a FRIMEDBIO grant (project number 250976) and a JPIAMR grant (project number 296906) from the Research Council of Norway.", "\n\nDATA AVAILABILITY STATEMENT {#mbo31057-sec-0023}\n===========================\n\nData generated in this study are available from the corresponding author upon request. ", "Movies S1--S5 are available at figshare: <https://doi.org/10.6084/m9.figshare.12168351.v1>.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.023696682464454975, 0, 0.013157894736842105, 0, 0, 0, 0.008875739644970414, 0.008, 0, 0, 0.016042780748663103, 0, 0, 0.012987012987012988, 0.011560693641618497, 0, 0.008733624454148471, 0.016129032258064516, 0, 0, 0.01694915254237288, 0, 0.004081632653061225, 0.010256410256410256, 0, 0, 0, 0, 0.017241379310344827, 0, 0, 0, 0.020242914979757085, 0.005263157894736842, 0.01694915254237288, 0.008695652173913044, 0, 0, 0.004739336492890996, 0, 0.01511879049676026, 0, 0, 0.007518796992481203, 0, 0, 0.00847457627118644, 0.006289308176100629, 0.01, 0.010101010101010102, 0, 0.008333333333333333, 0, 0, 0, 0, 0.0045871559633027525, 0, 0, 0, 0, 0, 0.0058823529411764705, 0, 0, 0.004807692307692308, 0.004651162790697674, 0.004149377593360996, 0.0038022813688212928, 0, 0, 0, 0, 0, 0.0004233700254022015, 0, 0, 0.008064516129032258, 0.0009910802775024777, 0.007518796992481203, 0, 0.02040816326530612, 0.006097560975609756, 0, 0, 0.017241379310344827, 0, 0.008733624454148471, 0, 0, 0, 0, 0, 0.011695906432748537, 0.015267175572519083, 0, 0, 0.009615384615384616, 0.01348314606741573, 0.014705882352941176, 0, 0.01694915254237288, 0, 0.007575757575757576, 0.007246376811594203, 0.00847457627118644, 0.014184397163120567, 0.012658227848101266, 0.016666666666666666, 0, 0, 0, 0.010752688172043012, 0, 0.006944444444444444, 0, 0, 0.003663003663003663, 0, 0.00546448087431694, 0, 0.006042296072507553, 0.00423728813559322, 0, 0.009237875288683603, 0, 0.006097560975609756, 0, 0, 0, 0, 0, 0.006060606060606061, 0.008771929824561403, 0, 0.005813953488372093, 0, 0.0051813471502590676, 0, 0.0030864197530864196, 0, 0, 0.011320754716981131, 0, 0, 0.004761904761904762, 0, 0, 0, 0, 0, 0, 0, 0, 0.009302325581395349, 0.005917159763313609, 0, 0, 0.007168458781362007, 0.007246376811594203, 0, 0, 0, 0, 0.004807692307692308, 0, 0, 0, 0, 0, 0.004149377593360996, 0.005681818181818182, 0.006369426751592357, 0, 0, 0.004629629629629629, 0.007692307692307693, 0, 0, 0, 0, 0.00684931506849315, 0.007575757575757576, 0, 0.005747126436781609, 0.017857142857142856, 0, 0, 0.0034965034965034965, 0, 0, 0, 0, 0, 0, 0.013157894736842105, 0.0053475935828877, 0.005780346820809248, 0, 0, 0, 0, 0.034482758620689655, 0, 0, 0, 0, 0, 0.0006793478260869565, 0.00130718954248366, 0.0106951871657754, 0, 0.010309278350515464, 0.009868421052631578, 0, 0, 0.0031545741324921135, 0.02040816326530612, 0, 0.004, 0.0064516129032258064, 0, 0.013605442176870748, 0, 0, 0, 0, 0.013157894736842105, 0, 0.0064516129032258064, 0, 0, 0, 0, 0.0031645569620253164, 0, 0.0049504950495049506, 0, 0.013333333333333334, 0, 0, 0.0037174721189591076, 0.005319148936170213, 0.010638297872340425, 0.012578616352201259, 0, 0, 0.004524886877828055, 0.0036231884057971015, 0, 0, 0.006666666666666667, 0.013157894736842105, 0, 0.013636363636363636, 0.016129032258064516, 0.016666666666666666, 0, 0, 0.0040650406504065045, 0.007352941176470588, 0.009259259259259259, 0.009900990099009901, 0.0055248618784530384, 0.004807692307692308, 0, 0.024691358024691357, 0.017241379310344827, 0, 0.01098901098901099, 0 ]

[ "Check out our new site Makeup Addiction\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nadd your own caption\n\nScumbag Obama Plans to kill Americans on US soil without trial starts filibuster to protect constitution" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0036101083032490976 ]

[ "So I decided to take a break from civilization and urban environment and hit the desert with friends.", "\n\nI’ll be going to AlSalmi Desert in Friday 23rd. ", "So if you’re interested in coming along, read along!", "\n\nWhat you’d need to bring?", "\n\nFood and drinks\n\nMats and chairs\n\nJackets and warm clothes; it’ll drop below 10c\n\nFlashlights. ", "But don’t abuse it, we’re there to stargaze\n\nIf you’re bringing a camera: CHARGE YOUR BATTERY! ", "Trust me, I tend to forget to charge it 16GB minimum. ", "AND DON’T FORGET IT! ", "I tend to do so Tripod Remote control (Or cable release)\n\n\n\nHow to contact me?", "\n\nYou can reach me in Twitter (@8GEEK)\n\nYou can email me or use the contact form in this website or post a reply\n\nYou can call me if you already know my phone number\n\nInstructions and how and when and banana?", "\n\nPark in Saleh AlShehab school parking lot next to Mishref CO-OP\n\nI’ll be personally sitting in Starbucks reading a book or coding something, I’m not sure.", "\n\nWe leave by 5pm to reach there by 6:30pm ~ 7:15pm\n\nWe’ll be taking the 6th ring road to almost reaching the Kuwaiti-Saudi border\n\nWhat not to do?", "\n\nDO NOT CALL ME AN HOUR OR TWO BEFORE THE DEPARTURE. ", "You’ll only cause confusion and delay. ", "If you’re going to be late, I’ll send you a Glymps to keep on track\n\nNO LITTER NOR TRASH! ", "In all honesty, I had no problem with previous sessions at all. ", "Just saying it to be careful.", "\n\nDrop me a message if you’re interested 😀\n\nShare this: Email\n\nReddit\n\nTwitter\n\nTumblr\n\nFacebook\n\nPinterest\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.02, 0, 0, 0, 0, 0, 0, 0.01282051282051282, 0.009615384615384616, 0.01282051282051282, 0, 0, 0, 0.011111111111111112, 0.015625, 0, 0.009174311926605505 ]

[ "When I travel I make sure I fly looking fashionable. ", "I believe after discovering this little gem, clearly the bar has been raised. ", "This is the way I want my trip to start off. ", "Footloose n fanciful. ", "From car to plane to when I land, this is what I want a stylish groovy wrinkle free flight!", "\n\nFlights of Fanciful Red! ", "It was the red that caught my eye but when I started to watch it ........\n\nI was already in my dream world letting myself be carried away! ", "I can't help smile slyly plotting" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "President Trump Donald John TrumpSteele Dossier sub-source was subject of FBI counterintelligence probe Pelosi slams Trump executive order on pre-existing conditions: It 'isn't worth the paper it's signed on' Trump 'no longer angry' at Romney because of Supreme Court stance MORE on Wednesday officially designated Brazil as a major non-NATO ally, making it easier for the South American country to purchase U.S. weapons and defense equipment.", "\n\nThe president sent a memo to Secretary of State Mike Pompeo Michael (Mike) Richard PompeoPutin nominated for Nobel Peace Prize The Hill's Morning Report - Sponsored by Facebook - Trump previews SCOTUS nominee as 'totally brilliant' Pompeo accused of stumping for Trump ahead of election MORE late Wednesday notifying him of the change, which he had hinted at earlier this year.", "\n\nSixteen other countries have major non-NATO ally status, including South Korea, Australia, Argentina and Kuwait. ", "Colombia is the only other Latin American nation affiliated with NATO as a \"global partner,\" meaning it would not necessarily have to engage in military action.", "\n\nADVERTISEMENT\n\nTrump said during a visit in March from Brazilian President Jair Bolsonaro that he intended to make the country a major non-NATO ally. ", "He suggested the country could be considered to be added to NATO, but the alliance would have to invite Brazil to join.", "\n\nThe president has offered frequent praise for Bolsonaro, who earned the nickname \"Trump of the Tropics\" last year when he ran a populist right-wing campaign that railed against the government establishment. ", "He also drew backlash for inflammatory comments about minorities and women.", "\n\n\"He's a great gentleman,\" Trump said of Bolsonaro on Tuesday. \"", "In fact, they say the 'Trump of Brazil.' ", "I like that. ", "That’s a compliment.\"" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.013544018058690745, 0.0158311345646438, 0.008695652173913044, 0.00625, 0.013157894736842105, 0.008403361344537815, 0.004784688995215311, 0, 0.03076923076923077, 0, 0, 0 ]

[ "Tere ishq Nachaya\n\nTere Ishq Nachaya (, translation: Your love made me dance) is a Punjabi Sufi song composed by 18th-century mystic-poet Baba Bulle Shah. ", "It is a popular song performed by Sufi and qawwali singers, including Abida Parveen and also featured in Sufi music album, Sufi –Ishq Bada Bedardi (RPG Sa Re Ga Ma) .", "\n\nIt has also been performed by Punjabi folk singer Jasbir Jassi and pop rock band, Jal, who also performed it on the episode 1 of Coke Studio in 2011.", "\n\nIn the early 2000s, Shoaib Mansoor directed a very popular variant of this song called \"Supreme Ishq\" which was sung by Riaz Ali Qadri.", "\n\nReferences\n\nExternal links\nPunjabi Songs\n\nCategory:Qawwali songs\nCategory:Pakistani songs\nCategory:Punjabi-language songs\nCategory:18th-century songs" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.01935483870967742, 0.018072289156626505, 0.02631578947368421, 0.0072992700729927005, 0.006622516556291391 ]

[ "Mandatory pooling as a supplement to risk-adjusted capitation payments in a competitive health insurance market.", "\nRisk-adjusted capitation payments (RACPs) to competing health insurers are an essential element of market-oriented health care reforms in many countries. ", "RACPs based on demographic variables only are insufficient, because they leave ample room for cream skimming. ", "However, the implementation of improved RACPs does not appear to be straightforward. ", "A solution might be to supplement imperfect RACPs with a form of mandatory pooling that reduces the incentives for cream skimming. ", "In a previous paper it was concluded that high-risk pooling (HRP), is a promising supplement to RACPs. ", "The purpose of this paper is to compare HRP with two other main variants of mandatory pooling. ", "These variants are called excess-of-loss (EOL) and proportional pooling (PP). ", "Each variant includes ex post compensations to insurers for some members which depend to various degrees on actually incurred costs. ", "Therefore, these pooling variants reduce the incentives for cream skimming which are inherent in imperfect RACPs, but they also reduce the incentives for efficiency and cost containment. ", "As a rough measure of the latter incentives we use the percentage of total costs for which an insurer is at risk. ", "This paper analyzes which of the three main pooling variants yields the greatest reduction of incentives for cream skimming given such a percentage. ", "The results show that HRP is the most effective of the three pooling variants." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0, 0, 0.00909090909090909, 0, 0, 0, 0, 0.01282051282051282, 0, 0, 0.008771929824561403, 0, 0 ]

[ "Q:\n\nFinding a modified image - image forensics\n\nI have a couple of standard ways of detecting a modified image such as \n\nLuminance gradient\nCopy move detection\nMetadata Extraction\nHistogram analysis\nELA(Error level analysis)\nQuantization matrix analysis\nThumbnail analysis\n\nare there any other standard ways of detecting a modified image? ", "\nTried out\n\nFinding the EXIF of the image to check the created and modified date and check for modification. ", "I also had some rules for EXIF camera make and make note validation along with checking for the software used such as photoshop, Shotwell, etc.", "\nWas able to segment the image and use SLIC(simple linear iterative clustering) to find out the similar cluster regions in an image\nFind the largest contour with less pixel inconsistency with luminance gradient to mark that as a potential modified region\nLargest contour with ELA as a potential modified region\nCheck for inconsistencies in histogram graph and mark it as a potential editted image.", "\n\nHere are my questions\n\nAre there any standard logics to verify the image with metadata such as using the created and modified dates, the camera make or maker note, etc. ", "As these details are not consistent for any given image.", "\nFinding out the least pixel inconsistency contour in the Luminance gradient would always give me an image that is modified?", "\nIf the histogram graph has a regular interval fluctuation could it be considered a modified image?", "\nHow could I use Quantization matrices to find out image anomalies \nwhat is the best way to compare the thumbnail image to the original image to check for inconsistencies?", "\n\nA:\n\nThe answer to this question needs more detailed so, I will give some references to the subject itself and I will share with you the code of every part of your question :\nYou need to use exif to verify the image with metadata\nFor Anomaly Detection in Images see here\nTo compare the thumbnail image to the original image read this. ", "where it showed you how to compare two images using Python.", "\nReferences :\n\nccse.kfupm.edu.sa\ngithub.com/redaelli\ngithub.com/Ghirensics\nwww.amazon.com/Learning\nbooks.google.com.tw\nhal.inria.fr/\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.013986013986013986, 0, 0, 0, 0.008064516129032258, 0, 0, 0.002976190476190476, 0.01694915254237288, 0.007462686567164179 ]

[ "1. ", "Introduction {#s0005}\n===============\n\nSmoking is one of the leading risk factors for premature death and disability ([@bb0105]). ", "The mortality and morbidity associated with cigarette smoking arises primarily from the inhalation of toxins other than nicotine contained within the smoke. ", "By providing a heated vapour containing nicotine without tobacco combustion, electronic cigarettes (e-cigarettes) appear to reduce the cravings and withdrawal symptoms associated with abstinence in smokers ([@bb0020; @bb0035; @bb0125]) whilst being much safer than ordinary cigarettes ([@bb0085]). ", "Moreover, e-cigarettes may be more effective in helping with smoking reduction or cessation than traditional forms of nicotine replacement therapy (NRT) by more closely mimicking the sensory experience and/or nicotine delivery of cigarettes. ", "Two recent randomised controlled trials have suggested that e-cigarettes may aid smoking cessation ([@bb0015; @bb0025]).", "\n\nE-cigarettes provide nicotine via a vapour that is drawn into the mouth and upper airways as with cigarettes ([@bb0020]). ", "These devices use a battery-powered heating element to heat a nicotine solution and transform it into vapour. ", "The nicotine is suspended in a mixture of glycerin, propylene glycol or other humectant with water and provided in a cartridge or tank that in some cases are replaceable or refillable ([@bb0085]). ", "The process of transforming the solution to vapour is usually activated by the act of inhaling through, or 'vaping', the device ([@bb0040]). ", "The concentration of nicotine delivered to the bloodstream appears to depend upon the experience of users and the brand of e-cigarette ([@bb0070; @bb0130]). ", "The reason for the latter is likely that different e-cigarette brands and models vary considerably in the efficacy and consistency with which they vaporise nicotine ([@bb0080; @bb0090]).", "\n\nEvidence to date suggests that e-cigarettes are increasing rapidly in popularity ([@bb0035; @bb0045; @bb0115]). ", "An international study ([@bb0005]), which included the United Kingdom (UK), carried out in 2010/11, found high awareness of e-cigarettes, but low levels overall of trial and usage (3% overall, 4% in the UK). ", "However, a population survey of a British sample found that current use more than doubled between the beginning of 2010 and the beginning of 2012 from approximately 3% to 7% ([@bb0045]). ", "As a result of the speed with which e-cigarette prevalence is evidently increasing, it is important to continue monitoring the situation; the current study provides up-to-date figures on the latest prevalence.", "\n\nWhilst assessments of the overall popularity of e-cigarettes are valuable, the variability in nicotine vaporisation between e-cigarettes ([@bb0090; @bb0080]) means that it is also useful to assess which e-cigarette brands are most prevalent. ", "Such data could inform future real-world assessments of the public health impact of e-cigarettes. ", "Inferences can be drawn on the leading e-cigarette brands by using sales figures from convenience stores, which appear to suggest that in the United States (US) the leading brands are 'NJOY', 'bluCigs'and 'Logic' ([@bb0065]) and in the UK it is E-Lites and Nicolites ([@bb0060]). ", "However, industry wide sales numbers are scarce ([@bb0065]), and with e-cigarettes often purchased online, it is important to assess the popularity of different brands by asking users directly.", "\n\nData are limited on usage patterns and characteristics among representative samples of smokers. ", "One population survey of a US sample in 2010 indicated that approximately 11% of current smokers and 2% of former smokers had ever used e-cigarettes and were more likely to be from higher socio-economic groups ([@bb0115]). ", "The international study, referred to above, found that well educated smokers were more likely to be e-cigarette users and their use was also associated with two extremes of smoking frequency --- nondaily smokers and heavier smokers (more than 20 cigarettes a day; [@bb0005]).", "\n\nIn view of the growing popularity of e-cigarettes, there is a need for an up-to-date assessment in Great Britain among current and recent ex-smokers of i) beliefs about, awareness and prevalence of e-cigarette use, including different brands, ii) usage patterns of e-cigarettes, and iii) the socio-demographic and smoking characteristics associated with their use.", "\n\n2. ", "Methods {#s0010}\n==========\n\n2.1. ", "Study design {#s0015}\n-----------------\n\nThis was a cross-sectional online survey of a sample of the general population of smokers in Great Britain. ", "The study sample was recruited from an online panel managed by Ipsos MORI. ", "The panel consists of contact details for members of the public who have expressed an interest in taking part in research surveys in exchange for vouchers or entering prize draws. ", "Members of the panel who had smoked in the past-year were invited to complete the full online survey. ", "Approval was granted by the University College London ethics committee.", "\n\n2.2. ", "Participants {#s0020}\n-----------------\n\nDuring November and December 2012, a total of 23,785 respondents were asked a screening question about their current smoking status of whom 25.9% (n = 6165) had smoked in the past year. ", "This prevalence of past-year smoking was similar to that identified by a face-to-face survey of representative samples of the population in England during 2012 ([@bb0135]). ", "Of these 6165 smokers, 4117 provided complete data on all survey items and were included in the current study.", "\n\n2.3. ", "Measures {#s0025}\n-------------\n\nSmoking status was assessed by asking: 'Which of the following best applies to you?': (", "a) 'I smoke cigarettes (including hand-rolled) every day'; (b) 'I smoke cigarettes (including hand-rolled) but not every day'; (c) 'I do not smoke cigarettes at all but I do smoke tobacco of some kind (e.g. pipe or cigar)'; and (d) I have stopped smoking completely in the last year'. ", "Those responding 'Yes' to either (a), (b), or (c) were classified as current smokers and those responding 'Yes' to (d) were classified as recent ex-smokers.", "\n\nCurrent and recent ex-smokers were subsequently asked questions that assessed gender, age and socio-economic status by the occupationally-based National Statistics Socio-Economic Classification (NS-SEC) self-coding method ([@bb0110]). ", "The 8-point NS-SEC classification was dichotomised into 'high' (managerial, professional & intermediate occupations) and 'low' (routine & manual occupations) socio-economic status. ", "Cigarettes per day, previous attempts to quit smoking, and e-cigarette awareness, beliefs and usage were also assessed (see [Appendix A](#s0105){ref-type=\"sec\"} for the questions).", "\n\n2.4. ", "Procedure {#s0030}\n--------------\n\nAs members of an online panel maintained by Ipsos MORI, respondents were invited by email to participate in an online survey about smoking. ", "Respondents were told that by completing the survey they would earn points which could be redeemed against high street vouchers or used to enter a prize draw.", "\n\n2.5. ", "Analysis {#s0035}\n-------------\n\nThe analysis plan was agreed a priori and data were analysed using SPSS 21.0.0.0. ", "Differences between current and recent ex-smokers in socio-demographic and smoking characteristics and in awareness, beliefs and usage relating to e-cigarettes were examined with χ^2^ tests and one-way ANOVAs for categorical and continuous variables respectively. ", "Significant omnibus results were investigated further by post-hoc Sidak-adjusted chi-squared tests and t-tests. ", "To assess smoking and socio-demographic characteristics associated with current use of e-cigarettes, we conducted a series of simple and multiple logistic regressions.", "\n\n3. ", "Results {#s0040}\n==========\n\nOf the 4117 past-year smokers included in the current study, 3538 were current smokers and 579 were ex-smokers who had stopped in the past year. [", "Table 1](#t0005){ref-type=\"table\"} presents the socio-demographic and smoking characteristics of the sample by smoking status.", "\n\n[Table 2](#t0010){ref-type=\"table\"} presents e-cigarette awareness, usage and beliefs by smoking status. ", "In both current and recent ex-smokers, there was an almost universal awareness of e-cigarettes. ", "Approximately a third had ever used e-cigarettes and a fifth currently used them regardless of smoking status. ", "There were no differences between current and recent ex-smokers in their beliefs about the harm of e-cigarettes: in both groups, approximately two thirds believed them to be less harmful than cigarettes whilst almost a quarter were unsure.", "\n\nAmong those who were aware of e-cigarettes but had never used them, approximately half of current smokers were interested in future use, which was significantly more than recent ex-smokers. ", "A substantial minority -- just under a fifth -- of recent ex-smokers were interested in using them in the future. ", "Among current users of e-cigarettes, there was a difference in the frequency of use by smoking status; recent ex-smokers were more likely to use e-cigarettes daily than current smokers with almost half of recent ex-smokers reporting daily use. ", "The most frequent reasons provided for using e-cigarettes were to improve health, to cut down and to quit smoking; all were endorsed by approximately 80% of current users regardless of smoking status. ", "Recent ex-smokers as compared with current smokers were more likely to report using e-cigarettes for taste but were less likely to use them in order to help with temporary abstinence from smoking conventional cigarettes. ", "For both current and recent ex-smokers, the most popular brand was 'E-lites' and almost a fifth 'did not know' their current brand.", "\n\n[Table 3](#t0015){ref-type=\"table\"} presents the characteristics associated with current use of e-cigarettes in both current and recent ex-smokers. ", "Among current smokers, e-cigarette users were more likely to have higher socio-economic status than non-users. ", "They were also more likely to have made a quit attempt in the past year and to smoke more cigarettes than non-users. ", "Among recent ex-smokers, e-cigarette users reported having previously smoked more cigarettes per day than non-users.", "\n\n4. ", "Discussion {#s0045}\n=============\n\nThere was a near universal awareness of e-cigarettes among current and recent ex-smokers. ", "Moreover, approximately a fifth of both current and recent ex-smokers were currently using e-cigarettes, whilst just over a third had ever used them. ", "The majority of smokers believed e-cigarettes to be less harmful than cigarettes; however, almost a quarter remained unsure. ", "Among current smokers who were aware of but had never used e-cigarettes, approximately half were interested in using it in the future. ", "Among both current and recent ex-smokers, the most popular reasons for using an e-cigarette were health, cutting down and quitting and the most popular brand was 'E-lites'. ", "Current e-cigarette users were more likely than non-users to have higher socio-economic status, smoked more cigarettes and attempted to quit in the past year.", "\n\nThe 21% prevalence of current and recent ex-smokers who were using an e-cigarette is considerably higher than the estimates of 3--4% for British and UK samples from 2010 to 2011 ([@bb0005; @bb0045]), and the 7% estimate obtained in a British sample approximately 10 months earlier than the current study ([@bb0045]). ", "In line with this apparent increase in current use, the prevalence of ever use appears to have increased over those 10 months from 15% to 37%, and awareness from approximately 79% to 93% ([@bb0045]). ", "The ratio of current to ever use also appeared to have increased across this period, which may suggest that an increasing proportion of smokers who use e-cigarettes are finding that they are sufficiently satisfying or helpful to warrant further use. ", "E-cigarette use is now commonplace in Great Britain and similar to that of licenced NRT ([@bb0010; @bb0100]). ", "This popularity of e-cigarettes combined with their *potential* to be more effective than traditional forms of NRT -- as a result of more closely mimicking the sensory experience and/or nicotine delivery of cigarettes -- leads to the conclusion that the e-cigarette may have a major public health impact. ", "There is a need for more high quality efficacy studies ([@bb0015]), as well as research to examine the longer-term health impact of use.", "\n\nThere also seems to be scope for the number of people using e-cigarettes to increase: a quarter of all smokers were unsure as to whether e-cigarettes are less harmful than cigarettes and almost half of those who have never used an e-cigarette but were aware of them were interested in using one in the future. ", "However, in the former case, this proportion of people not believing that e-cigarettes are harmful was similar to the estimate obtained at the beginning of 2012 when their use appeared to be considerably lower ([@bb0045]). ", "The implication is that there may not necessarily be a straightforward decline in the proportion of those believing that e-cigarettes are less harmful as more people begin using them and relative risks of these products probably need to be communicated more widely to smokers.", "\n\nThe relative popularity of quitting, cutting down and temporary abstinence as reasons for using e-cigarettes is consistent with previous research ([@bb0005; @bb0045]). ", "Recent ex-smokers were significantly more likely than current smokers to cite taste as a reason for using an e-cigarette. ", "It is plausible that taste would partly mediate the use of e-cigarettes given the role that olfactory and taste cues play in the behaviourally reinforcing effects of cigarettes ([@bb0120]). ", "The finding that recent ex-smokers were significantly more likely to use e-cigarettes daily than current smokers may be a reflection of ex-smokers escalating their use following cessation in the belief that the e-cigarette is an effective nicotine replacement device. ", "To provide an indication of the 'real-world' effectiveness of e-cigarettes, future studies should examine the association between smoking status and the reported use of different treatments as aids to cessation among those who made a recent attempt to quit.", "\n\nThe popularity of E-lites identified in the current study may have arisen in part from this being the first brand to have been advertised nationally in Great Britain. ", "From one point of view, the result is nonetheless surprising; data from convenience stores\\' sales figures suggest that E-lites, rather than being a clear market leader, are second to Nicolites ([@bb0055]). ", "The current finding, therefore, illustrates the importance of asking smokers directly about their usage and may reflect the significance of online sales for e-cigarettes. ", "E-lites have a visible online presence, including a range of social media pages, and are widely and easily available to purchase from online stores ([@bb0085]). ", "In terms of price, E-lites 'starter kits' (2 × disposable tips, 1 rechargeable battery and 1 charger) are available at approximately £25 but all leading e-cigarette brands are made more accessible by a range of obtainable discounts and incentives ([@bb0095]). ", "Of greater significance than price is that the nicotine delivery of E-lites is low compared with many other e-cigarette brands readily available online ([@bb0090; @bb0080]). ", "Thus, the prominence of E-lites in Great Britain -- as an e-cigarette brand that delivers a relatively small dose of nicotine -- should be incorporated within future evaluations of the real-world effectiveness of e-cigarettes.", "\n\nThe association of usage with socio-economic status in the current study was similar to a British study at the start of 2012, which reported non-significant associations in the same direction ([@bb0045]), and international research which has reported that well educated individuals are more likely to use e-cigarettes ([@bb0005; @bb0115]). ", "Other research suggests that as new expensive technologies emerge they are typically disproportionately adopted in the early phase by those with greater resources ([@bb0030]). ", "However, if e-cigarettes prove effective and are not to widen the health inequalities caused by smoking then communications concerning relative risks and the benefits of e-cigarettes over traditional smoking may need to be specifically targeted at more deprived groups in society.", "\n\nA potential limitation of the current study is that the recruitment method is likely to have led to selection bias. ", "The study recruited from a panel that consisted of individuals who were interested in participating in research surveys in exchange for vouchers or entering prize draws and may not be representative of the wider population. ", "Additionally, participants were invited to take part in the study by email and completed the questionnaire online. ", "As a result certain socio-demographic groups are likely to have been under-represented, for example both older individuals and those with lower incomes typically have fewer online skills and more limited internet access ([@bb0050]). ", "However, the overall sample characteristics remained broadly similar to those of representative samples obtained through a household survey ([@bb0075]). ", "Also the cross-sectional nature of the study does not permit inferences to be drawn about the causal nature of the associations found. ", "A third limitation is that this is a snapshot in time of a phenomenon that appears to be changing rapidly. ", "It will be important to continue to track this phenomenon over time.", "\n\n5. ", "Conclusions {#s0050}\n==============\n\nIn conclusion, there is now a near universal awareness of e-cigarettes and their use appears to be common among smokers in Great Britain although a quarter of all smokers are unsure as to whether e-cigarettes are less harmful than cigarettes. ", "The brand E-lites, which delivers a relatively low dose of nicotine, is the most popular. ", "E-cigarette users appear to have higher socio-economic status and to be heavier smokers who were more likely to have attempted to quit in the past year than non-users. ", "Insofar that e-cigarettes prove to be effective in aiding smoking cessation, it appears that there will be a need to communicate the relative risks of e-cigarettes compared with traditional smoking, particularly targeted at more deprived smokers.", "\n\nRole of funding sources {#s0090}\n=======================\n\nThe work was undertaken by the UK Centre for Tobacco and Alcohol Studies, a UKCRC Public Health Research Centre of Excellence. ", "Funding from the Medical Research Council, British Heart Foundation, Cancer Research UK, Economic and Social Research Council and the National Institute for Health Research under the auspices of the UK Clinical Research Collaboration, is gratefully acknowledged (MR/K023195/1).", "\n\nContributors {#s0095}\n============\n\nAM & RW conceived of the project with input on the design from JB. ", "JB conducted the statistical analysis. ", "JB wrote the first draft of the manuscript and RW, SM & AM all provided significant input in re-drafting. ", "All authors contributed to and have approved the final manuscript.", "\n\nConflict of interest {#s0100}\n====================\n\nJB has received an unrestricted research grant from Pfizer. ", "RW undertakes research and consultancy and receives fees for speaking from companies that develop and manufacture smoking cessation medications (Pfizer, J&J, McNeil, GSK, Nabi, Novartis, and Sanofi-Aventis). ", "He also has a share of a patent for a novel nicotine delivery device (not an e-cigarette). ", "There are no other financial relationships with any organisations that might have an interest in the submitted work, particularly electronic cigarette companies.", "\n\nAppendix A. Questionnaire assessing e-cigarette awareness, beliefs and usage {#s0105}\n============================================================================\n\nJB\\'s post is funded by a fellowship from the UK Society for the Study of Addiction. ", "JB, AM & RW are part of the UK Centre for Tobacco & Alcohol Studies, a UK Clinical Research Collaboration Public Health Research: Centre of Excellence. ", "We are grateful to the International Tobacco Control Policy Evaluation Project for the use of some of their questions on e-cigarettes.", "\n\n###### \n\nSocio-demographic and smoking characteristics of the sample.", "\n\n ---------------------------------------------------------------------------------------------------------------------\n Current smokers\\ Recent ex-smokers\\ *P*\n (n = 3538) (n = 579) \n -------------------------------------------------------------------- ------------------ -------------------- --------\n Mean (SD) age 43.4 (14.8) 43.7 (15.2) NS\n\n \\% (N) women 50.0 (414) 52.0 (301) NS\n\n \\% (N) high socio-economic status[a](#tf0005){ref-type=\"table-fn\"} 45.8 (1621) 54.0 (313) \\*\\*\\*\n\n Mean (SD) cigarettes per day 12.9 (8.8) 14.7 (10.6) \\*\\*\\*\n\n \\% quit attempt in past year 46.3 (1639) -- --\n ---------------------------------------------------------------------------------------------------------------------\n\nNote: NS=non-significant, \\*\\*\\* p \\< 0.001.", "\n\n'High' socio-economic status includes individuals classified into managerial, professional and intermediate occupational groups by the NS-SEC.", "\n\n###### \n\nE-cigarettes: Awareness, use and beliefs by smoking status.", "\n\n Current smokers Recent ex-smokers *P*\n ------------------------------------------------- ------------------------ ----------------------- --------\n **Full sample** (**n** **=** **3538**) (**n** **=** **579**) \n \\% (N) awareness 93.4 (3303) 92.9 (538) NS\n \\% (N) ever use 36.5 (1291) 37.3 (216) NS\n \\% (N) current use 21.9 (775) 18.8 (109) NS\n \\% (N) beliefs on harm compared with cigarettes NS\n  More harmful 1.5 (52) 1.6 (9) \n  Equally 7.0 (249) 9.5 (55) \n  Less harmful 67.6 (2392) 63.2 (366) \n  Don\\'t know 23.9 (845) 25.7 (149) \n \n **Aware never users** **(n = 2012)** **(n = 322)** \n \\% (N) interest in future use 51.7 (1040) 18.3 (59) \\*\\*\\*\n \n **Current users** **(n = 775)** **(n = 109)** \n \\% (N) frequency of current use \\*\\*\\*\n  Daily 22.7 (176) 45.9 (50) \\*\\*\\*\n  Daily but ≥ once a week 36.4 (282) 19.3 (21) \\*\\*\n  Once a week but ≥ once a month 15.9 (123) 15.6 (17) NS\n  Once a month 25.0 (194) 19.3 (21) NS\n \\% (N) reason for starting current use \n  Health 82.6 (640) 83.5 (91) NS\n  Taste 24.4 (189) 39.4 (43) \\*\\*\n  Cutting down 83.0 (643) 78.9 (86) NS\n  Temporary abstinence 70.2 (544) 47.7 (52) \\*\\*\\*\n  Quitting 82.8 (642) 84.4 (92) NS\n \\% (N) brand for current use \\*\n  10 motives 1.5 (12) 0.9 (1) NS\n  Apollo 1.4 (11) 0.0 (0) NS\n  ClearSmoke 2.1 (16) 1.8 (2) NS\n  E-cigs 1.3 (10) 0.9 (1) NS\n  E-Lites 39.6 (307) 27.5 (30) NS\n  Gamucci 2.2 (17) 1.8 (2) NS\n  Green Smoke 3.0 (23) 2.8 (3) NS\n  Halo 3.0 (23) 3.7 (4) NS\n  Intellicig 2.1 (16) 2.8 (3) NS\n  Liberro 1.3 (10) 0.0 (0) NS\n  Nicolites 1.2 (9) 2.8 (3) NS\n  Sky 7.4 (57) 3.7 (4) NS\n  Vapestick 2.3 (18) 2.8 (3) NS\n  Vapouriz 1.7 (13) 2.8 (3) NS\n  VIP 2.3 (18) 5.5 (6) NS\n  Other brand[a](#tf0010){ref-type=\"table-fn\"} 8.4 (65) 19.3 (21) \\*\\*\n  Don\\'t know/can\\'t remember 19.4 (150) 21.1 (23) NS\n\nNS = non-significant, \\* p \\< .05, \\*\\*p \\< .01, \\*\\*\\* p \\< 0.001.", "\n\nOther brands include all brands identified by less than 1% of the total sample.", "\n\n###### \n\nCharacteristics of e-cigarette users.", "\n\n ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Current smokers Recent ex-smokers \n -------------------------------------------------------------------- ----------------- ------------- -------------------------- ------------------- ------------- ------------------------\n Mean (SD) age 42.9 (14.9) 43.5 (14.8) 1.00 (0.99--1.00)\\ 45.0 (14.8) 43.4 (15.3) 1.01 (0.99--1.02)\\\n 1.00 (0.99--1.01) 1.00 (0.99--1.02)\n\n \\% (N) women 48.1 (373) 49.7 (1373) 0.94 (0.80--1.10)\\ 48.6 (53) 52.8 (248) 0.85 (0.56--1.29)\\\n 0.96 (0.81--1.13) 0.95 (0.61--1.46)\n\n \\% (N) high socio-economic status[a](#tf0015){ref-type=\"table-fn\"} 52.9 (410) 43.8 (1211) 1.44 (1.23--1.69)\\*\\*\\*\\ 52.3 (57) 54.5 (256) 0.92 (0.60--1.39)\\\n 1.48 (1.25--1.75)\\*\\*\\* 0.99 (0.64--1.54)\n\n Mean (SD) cigarettes per day 13.9 (8.9) 12.6 (8.7) 1.02 (1.01--1.02)\\*\\*\\ 17.5 (10.9) 14.0 (10.5) 1.03 (1.01--1.05)\\*\\*\\\n 1.02 (1.01--1.03)\\*\\*\\* 1.03 (1.01--1.05)\\*\\*\n\n \\% quit attempt in past year 31.7 (246) 21.8 (601) 2.81 (2.38--3.32)\\*\\*\\*\\ -- -- --\n 2.82 (2.38--3.34)\\*\\*\\* \n ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\nNote: The adjusted models include all the other socio-demographic and smoking variables presented in [Table 3](#t0015){ref-type=\"table\"}. ", "\\*\\*p \\< .01, \\*\\*\\* p \\< 0.001.", "\n\n'High' socio-economic status includes individuals classified into managerial, professional and intermediate occupational groups by the NS-SEC.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0.007692307692307693, 0, 0.013422818791946308, 0.004132231404958678, 0.016666666666666666, 0.008064516129032258, 0, 0.005076142131979695, 0.0070921985815602835, 0.012738853503184714, 0.010752688172043012, 0.02631578947368421, 0.004807692307692308, 0.0053475935828877, 0, 0.00819672131147541, 0, 0.007142857142857143, 0.0051813471502590676, 0, 0.004484304932735426, 0.0036363636363636364, 0, 0, 0, 0, 0.013333333333333334, 0, 0, 0.014084507042253521, 0, 0, 0.005780346820809248, 0, 0, 0, 0, 0, 0.008438818565400843, 0.0055248618784530384, 0, 0, 0.005714285714285714, 0, 0, 0.008695652173913044, 0, 0, 0, 0, 0, 0, 0.009345794392523364, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009404388714733543, 0.005, 0, 0.02727272727272727, 0.003278688524590164, 0.007352941176470588, 0, 0.004484304932735426, 0, 0.011764705882352941, 0, 0.005263157894736842, 0, 0, 0, 0.004830917874396135, 0, 0.006211180124223602, 0.0038461538461538464, 0.011494252873563218, 0, 0.008771929824561403, 0.005681818181818182, 0, 0, 0, 0, 0.004291845493562232, 0.006535947712418301, 0, 0, 0, 0, 0, 0, 0, 0, 0.0106951871657754, 0.02888086642599278, 0, 0, 0, 0, 0.008771929824561403, 0.03365384615384615, 0, 0, 0.00796812749003984, 0.019736842105263157, 0.007462686567164179, 0, 0.001644736842105263, 0.006944444444444444, 0, 0.0027316663164530363, 0, 0, 0, 0, 0.006944444444444444, 0 ]

[ "Natasha Parry\n\nNatasha Parry (2 December 1930 – 22 July 2015) was an English actress. ", "The daughter of film director Gordon Parry, she was married to theatre director Peter Brook from 1951 until her death, and is the mother of filmmakers Irina and Simon.", "\n\nEarly life\nBorn in London, Parry was the daughter of the Anglo-Greek film director Gordon Parry and his Russian wife. (", "Some sources say Gordon Parry was her stepfather.)", "\n\nStage\nParry made her stage debut at age 12 in The Wingless Victory. ", "At 14, she was in A Midsummer Night's Dream, and later she played in Big Ben and Bless the Bride. ", "On Broadway she appeared in The Fighting Cock (1959–1960). ", "Toward the end of her career, she was in The Tragedy of Hamlet at the Young Vic in London.", "\n\nFilm\nParry made her screen debut in Dance Hall (1950). ", "She appeared in many of her husband's productions including a live American television version of King Lear (1953) opposite Orson Welles, in Anouilh's The Fighting Cock with Rex Harrison,<ref. ", "The Dark Man. ", "1951 name=\"HelferLoney2012\"></ref> Meetings with Remarkable Men, The Cherry Orchard, and Happy Days.", "\n\nPersonal life\nParry was out of performing for a year after contracting tuberculosis in 1952.", "\n\nMarriage\nIn 1951, she married director Peter Brook; at the Russian Orthodox Cathedral of the Dormition of the Mother of God and All Saints, Ennismore Gardens, London. ", "The couple had two children, Irina and Simon.", "\n\nDeath\nParry died on 22 July 2015 (Some sources say 23 July 2015) while on holiday in La Baule, Brittany, France, at the age of 84 after a stroke.", "\n\nFilmography\n\nSelected television\n The Count of Monte Cristo (1964) as Mercédès\n\nSelected theatre\n King Lear (1953)\n Tchin-Tchin (1984, Théâtre des Bouffes du Nord, Paris)\n\nReferences\n\nExternal links\n \n \n\nCategory:1930 births\nCategory:2015 deaths\nCategory:Actresses from London\nCategory:English film actresses\nCategory:English television actresses\nCategory:English people of Greek descent\nCategory:Place of birth missing\nCategory:Place of death missing\nCategory:Brook family" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.011627906976744186, 0.017964071856287425, 0.008264462809917356, 0.02, 0, 0.01020408163265306, 0.01694915254237288, 0, 0.017543859649122806, 0.010362694300518135, 0, 0.009900990099009901, 0, 0.005917159763313609, 0.022222222222222223, 0, 0.008421052631578947 ]

[ "The 66-year-old businessman is Oprah's biggest fan, and even before the couple made it to the award show, he was giving the Wrinkle In Time star a big hug before she headed out for rehearsals. ", "Seriously, every girl needs a Stedman in their life. ", "Of course, Oprah made sure to shout out her partner in her speech, calling him \"my rock.\" ", "However, despite their three-decade-long romance (they have been together since 1986), they remain unmarried — and for good reason.", "\n\n“Nobody believes it, but it’s true. ", "The only time I brought it up was when I said to Stedman, ‘What would have happened if we had actually gotten married?’” ", "she told Vogue magazine last year. “", "And the answer is: ‘We wouldn’t be together.’ ", "We would not have stayed together because marriage requires a different way of being in this world.”", "\n\nShe continued, “His interpretation of what it means to be a husband and what it would mean for me to be a wife would have been pretty traditional, and I would not have been able to fit into that.” ", "They might not have exchanged rings but they continue to prove their love on and off the screen and Twitter was loving it. \"", "Stedman is a true gentleman and Oprah’s hair is magnificent. ", "Goodnight,\" one viewer wrote on the social media platform about the couple before another added, \"Looking for my Stedman.\" ", "Same girl, same.", "\n\nNow, the question remains. ", "When Oprah becomes president, will Stedman be the First Boyfriend or First Partner?" ]

{ "pile_set_name": "Pile-CC" }

[ 0.010362694300518135, 0, 0.011111111111111112, 0, 0, 0.008264462809917356, 0.027777777777777776, 0, 0, 0, 0, 0.03278688524590164, 0.016260162601626018, 0, 0, 0.03614457831325301 ]

[ "Several methods relating to the education of women in Renaissance changed the world. ", "However, these methods of Humanists and the queries of religious reformers had no impact on the lives of early modern European Women. ", "Education, changing drastically between the 15th and 17th centuries was certainly kept from women although the rich and powerful were able to receive some education: it was not always used. ", "Opportunities arose for the daughters of the rich and wealthy. ", "However, the eventuality of all their efforts in education narrowed down to the typical role of a woman: a housewife. ", "They still faced choices and challenges unique to their gender. ", "While some women did receive this education alongside men, the options of what to do with that education were cut severely. ", "It is evident from the study that women did not have a Renaissance because of lack of education and accompanying stereotypes of the time.", "\n\nWomen did not have a Renaissance\n\nHumanists led discussions about various ways to educate with the use of the best strategies. ", "Besides talking about it, they put the ideations into actions. ", "In the Renaissance period, various academies and schools were opened up for men with a wide range of subjects. ", "The principle of exclusively male attendees triggered scholars to experts to debate women did have a Renaissance. ", "Because of absence of education, women lacked a true experience of the Renaissance as their male counterparts did (Bell 181). ", "Men flocked various schools while women remained at homes as they had been barred from the corridors of education. ", "Only upper class and wealthy women accessed higher form of education as they could afford private tutors. ", "During this time, most humanists carried debates as to whether women should be given access to the emergence of increasing education. ", "As a result, most of them determined no. ", "Women were held inappropriate to participate in public activities like education programs in action and eloquence. ", "Even viewed as secondary to men and uneducated, women privileged to access higher education became role models for their fellow women at the period (Bell 206-207).", "\n\nHowever, in the context of art, most talented and famous artists shared a common background: daughters of painters and wealthy families. ", "Female artists were restricted to their education also. ", "All art academies were created for men and women who could afford a private tutor were deterred from studying the male nude. ", "It was deemed inappropriate for women to study this, but the male nude study was a pivotal lesson in painting male historical portraits. ", "Education of women was viewed not important during the Renaissance period (Bell 187). ", "This reflected the attitude towards the female sex in the era of the middle Ages. ", "The absence of education directed at women in Renaissance is enough evidence that women did not have a Renaissance because they were restricted from contributing their opinions and learning new ideas (Rice and Anthony 108).", "\n\nWhile men of the middle and upper class experienced the re-emergence of innovative thoughts and classical ideas, the same opportunities were taken from women because of conforming stereotypes and lack of education. ", "Additionally, women never had a Renaissance as they suffered limitations arising from stereotypes of this period. ", "Many artists used the metaphor of the turtle and nail to depict woman's virtues as been never leaving the house and remaining silent. ", "Castiglione, in his \"The Courtier,\" describes the virtuous that composed a gentleman or a court lady. ", "They both required talent in dancing and music, education, and appropriate manners. ", "However, women were granted duties demanding modesty and beauty; other characteristics deemed not necessary for a court gentleman. ", "Women were stereotyped to be modest and look pleasing; women's favorable traits while but not a prerequisite for men. ", "Power relationships were also stereotypical, with the women subordinate and male dominant, illustrating males were superior. ", "Dominant women in a relationship were ridiculed because the male counterparts were seen as weaklings (Rice and Anthony 81).", "\n\nMachiavelli also looked at the stereotype. ", "In his work \"The Prince,\" he states that an effeminate leader was the worst leader. ", "His sentiments denounced women's characteristics like compassion and love, deeming them as weak (Rice and Anthony 77). ", "Such stereotypes incentivized men to be cautious in the way they portrayed themselves. ", "They constantly became careful to sustain their masculine status.…[continue]\n\nOther Documents Pertaining To This Topic\n\nWomen During the Renaissance Period\nThe Renaissance (14th to 16th centuries) in European history is widely considered to have been a period of \"re-birth\" and a turning point for the Western Civilization. ", "It is believed to be the transitory period between the Middle Ages and the Modern Age when the social, cultural, and artistic conservatism of the Middle Age was replaced by the dynamic philosophy of humanism, which emphasized individualism and\n\nWoman: An Epistemological Programme of Mastery\nThe philosophical discussion of the nature of the female mind and specifically the epistemology of women has been universally debated for as long as there has been recorded words. ", "What is the nature of God? ", "And then: What is the nature of Man? ", "followed shortly there after by: What is the nature of Woman?", "\nIt is not a secret that most of the first recorded\n\nFeminists, like Christine Pizan, who stressed the importance of female education and some of her male feminist contemporaries would mainly remain on the fringes as the classical form of education was reaffirmed as the standard.", "\nIn the 1970s, much of the challenge to female education was answered as the tradition of educating all people was accepted early in the development of the U.S. educations system, though it was not an\n\nPerhaps, the woman did give birth to a healthy child and then died, then this portrait would be in the nature of memorializing the wife of the man in this picture and the mother of his heir preserving for the child a likeness of the child's mother since the mother was no longer living and present in the lives of the family.", "\nThis is the only double portrait of its\n\nWomen in History\nAlthough women have largely suffered from political and economic subordination throughout most of the course of human history, women's roles changed somewhat throughout the bulk of the past millennium. ", "Female roles, occupations, and social status vary from culture to culture and place to place. ", "In general, however, women's roles in society have reflected their inferior political and economic status. ", "Even when women work alongside their male counterparts, the\n\nWomen\nStatus of women 40 Years Ago In the early sixties feminism was still an unthinkable, but its ghost was gradually arousing from the dead. (", "Sims, 1980). ", "Women have been mainly underprivileged of a means of planned interface. ", "Women were connecting more to men than to each other, and were kept remote in their individual homes. ", "Though natural structures had begun to develop, they were still largely lacking. ", "These occurrences led\n\nThe compositional structure here is actually quite daring. ", "Even though a viewer tends to \"read\" a painting left-to-right, as with a book, here the left side of the canvas seems to fade away into nothingness. ", "It is not just the empty seascape on the left as compared with the dark richness of the forest on the right. ", "The left half of the painting contains the subject of the painting after" ]

{ "pile_set_name": "Pile-CC" }

[ 0.011764705882352941, 0.007462686567164179, 0, 0, 0, 0, 0, 0.0072992700729927005, 0.007751937984496124, 0, 0.009009009009009009, 0.008771929824561403, 0.007936507936507936, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.011627906976744186, 0, 0.017937219730941704, 0, 0.008771929824561403, 0, 0, 0, 0, 0, 0, 0.016260162601626018, 0, 0, 0.01680672268907563, 0, 0.0030864197530864196, 0, 0, 0, 0.01639344262295082, 0.0035714285714285713, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "# Noise\n\nThe [noise package](https://github.com/keys-pub/keys/blob/master/noise) helps setup a Noise handshake using X25519 keys.", "\n\nThe default cipher suite used is:\nCurve25519 ECDH, ChaCha20-Poly1305 AEAD, BLAKE2b hash.", "\n\nThe handshake uses the KK pattern:\n\n- K = Static key for initiator Known to responder\n- K = Static key for responder Known to initiator\n\nOne of the Noise participants should be the initiator.", "\n\nThe order of the handshake writes/reads should be:\n\n- (1) Initiator: Write\n- (2) Responder: Read\n- (3) Initiator: Read\n- (4) Responder: Write\n\nWhen the handshake is complete, use the Cipher to Encrypt/Decrypt.", "\n\nSee [noiseprotocol.org](http://www.noiseprotocol.org) for more info.", "\n\n## Examples\n\n- [Handshake + Encrypt/Decrypt](https://github.com/keys-pub/keys/blob/master/noise/example_test.go)\n" ]

{ "pile_set_name": "Github" }

[ 0.023255813953488372, 0.022222222222222223, 0.015544041450777202, 0, 0.014285714285714285, 0.008695652173913044 ]

[ "Dave Chappelle. ", "Photo: Valerie Macon/AFP/Getty Images\n\nDave Chappelle is getting a big, fancy award for his decades of work in comedy. ", "The Kennedy Center announced today that Chappelle will receive this year’s 22nd annual Mark Twain Prize for American Humor, which will be officially handed out on Sunday, October 27, and later broadcast on PBS January 6, 2020.", "\n\n“Dave is the embodiment of Mark Twain’s observation that ‘against the assault of humor, nothing can stand.’ ", "For three decades, Dave has challenged us to see hot-button issues from his entirely original yet relatable perspective,” Kennedy Center president Deborah F. Rutter said on the news. “", "Dave is a hometown hero here in Washington, D.C., where he grew up. ", "We’re so looking forward to welcoming him back home.”", "\n\nOther recent Mark Twain Prize winners include Carol Burnett, Eddie Murphy, Bill Murray, David Letterman, and most recently Julia Louis-Dreyfus, who took home the award late last year." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0625, 0.025210084033613446, 0.01327433628318584, 0.01818181818181818, 0.016304347826086956, 0.014705882352941176, 0, 0.032432432432432434 ]

[ "\n\nStreak (YC S11) launches Google Drive Integration - alooPotato\nhttp://blog.streak.com/2013/04/adding-files-to-your-boxes-using-google.html\n\n======\nandrewljohnson\nA few thoughts on Streak...\n\nWe quickly adopted Streak to do customer support right when it came out,\nbecause we were stoked by the GMail integration.", "\n\nIn the end, we found the canned responses to be no better than GMail canned\nresponses though, and also Streak never seemed to \"stick\" as part of the\nsupport workflow. ", "The support team ended up basically just sending emails, and\nthe dev team didn't end up getting better visibility into issues.", "\n\nRecently, we switched to using UserVoice to handle support, and it works\nreally well. ", "We were using them for their IdeaForum, but also replaced our\nwiki/manual with their knowledgebase, and replaced Streak with their helpdesk.", "\nUserVoice ends up giving us a lot of data about support, and integrates\nsearch/knowledgebase nicely with support. ", "I also like that the UserVoice iOS\nSDK is open source, and I was able to fix a display issue I noticed, and get a\npull request accepted immediately.", "\n\nI also tried to use Streak to do PR - that might have not worked out because\nthe intern wasn't very into doing PR, but I also felt a little clumsy trying\nto collaborate with her via Streak.", "\n\n~~~\nalooPotato\nCo-founder at Streak here. ", "Would love to know how we can do better in the\nsupport use case. ", "We've gotten much better since first launching but,\nadmittedly, we aren't that great at that specific use case. ", "Feel free to send\nto me directly at aleem at streak.", "\n\n~~~\nsebastianavina\nIt's common for me to make a quote for each box. ", "I've to go to Google Docs,\ngenerate a Document, sometimes a Spreadsheet for a Bill of Materials,\nRedactate the quotation, Download the file as PDF, upload it to Gmail, attach\nit and send it.", "\n\nIt would be awesome if every block could have some \"special files\", not the\nones the customer send you (request for proposals, work orders, purchase\norders), but the one you generate and send. ", "I would like to have a button to\njust simply attach a Google Docs Word File as PDF on a mail, and send it.", "\n\n------\nshloime\nI heavily rely on Streak in my day to day and honestly can't imagine how I got\nby without it. ", "I'm excited to try out this new feature. ", "Seems pretty useful to\nbe able to box files.", "\n\n------\nrcoh\nWhy not just use Filepicker?", "\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.006369426751592357, 0.005917159763313609, 0, 0.011363636363636364, 0, 0, 0.006756756756756757, 0, 0, 0, 0, 0.019230769230769232, 0, 0.021052631578947368, 0, 0.009433962264150943, 0, 0, 0, 0.023809523809523808, 0 ]

[ "The only thing that stops the dust is the rain. ", "It’s a sweet reprieve, but there is no middle ground. ", "The land is either as dry as the Betty Ford clinic, or as wet as the ocean floor. ", "Everything can be seen from the ridge overlooking Armadillo as John Marston gently bounces along atop...\n\nShowdown: Scorpion Screenshots\n\nAbout ScorpionAfter several major economical and political crises the world as we know it ceased to exist. ", "Only few major states survived 2020s, while the lesser authorities have collapsed, leaving behind anarchy and pollution. ", "The power vacuum was filled by key international companies who acquired control over derelict territories, forming Free Commerce Areas (FCAs).", "\n\nIn early 2030s ruins of unknown origin were discovered in Sudan. ", "Several artifacts possibly of alien nature were quickly revealed and soon major dig has started. ", "But few months of work as well as bulk of dig team were lost to underground explosion followed by contamination of the region. ", "To prevent disease from spreading series of nuclear strikes were made, completely annihilating the site. ", "These events have caused major resonance and soon the treaty limiting the usage of dangerous technologies and weapon systems was signed between FCAs and UN. ", "As a result the International Committee of Technology and Warfare Supervision (ICTS) with its own military and intelligence units, was created.", "\n\nAt the same time few survivors of Sudan Incident emerged as founders of newly formed Zenith Corporation. ", "This institution with HQ in Zagreb FCA quickly established itself as a notorious player on weapon, pharmaceutics and IT markets. ", "But in 2028 several instances of Zenith weapon systems together with samples of unidentified biological weapons were discovered during the liquidation of the extremists’ Albanian group in Kosovo.", "\n\nICTS immediately started investigation. ", "It was planned to infiltrate Zenith as a customer with clear ties to one of the terrorists’ organization and get a proof of its illegal activity. ", "One of the best ICTS field agents, codename Scorpion, has been assigned to this mission…\n\nGame Key Features\n\n- Intense action in cyber-punk styled Earth 2028- Futuristic storyline supported by multiple cut-scenes- Combination of first-person combat and stealth action elements provides unique gaming experience- Impressive arsenal of upgradable weapons- Character can gain access to several paranormal psychic powers including ability to subdue the will his enemies for short period of time- Advanced squad-oriented combat AI creates strong challenging opposition- Elite opponents who possess similar to player character supernatural powers- Cutting-edge game engine produces detailed realistic picture\n\nContent on this page comes directly from press releases and fact sheets provided by publishers and developers and was not written by the Game Revolution staff." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.012195121951219513, 0.004081632653061225, 0, 0, 0, 0, 0, 0, 0.006369426751592357, 0.006993006993006993, 0.018691588785046728, 0, 0.005128205128205128, 0, 0.00684931506849315, 0.004634994206257242 ]

[ "Evaluation of the Serotonin Transporter Ligand 123I-ADAM for SPECT Studies on Humans.", "\nImaging serotonin transporters in the living human brain is important in several fields, such as normal psychophysiology, mood disorders, eating disorders, and neurodegenerative disorders. ", "The aim of this study was to compare different kinetic and semiquantitative methods for assessing serotonin transporters using (123)I-labeled 2-((2-((dimethylamino)methyl)phenyl)thio)-5-iodophenylamine (ADAM) in humans: an arterial plasma input model, simplified and Logan reference tissue models, and standardized uptake value ratios. ", "Nine subjects were scanned with dynamic (123)I-ADAM SPECT (mean age, 31 y; range, 24-43 y), and metabolite-corrected arterial input was measured. ", "Tissue reference models (simplified reference tissue model, Logan reference tissue model, and ratio method) were validated against the outcome of a 1-tissue-compartment model, and performance with decreasing scan length was evaluated. ", "The specificity of (123)I-ADAM binding was investigated in a blocking experiment. ", "Binding estimates from the simplified reference tissue and Logan reference tissue models correlated tightly with full kinetic modeling when based on a 240- or 360-min dynamic acquisition (r = 0.99); however, there were slight underestimations (3%-5%), especially in high-binding regions. ", "Application of the ratio method to data from 200 to 240 min overestimated specific binding (on average, by 10% +/- 28%) and correlated only moderately with estimates from the 1-tissue-compartment model (r = 0.94). ", "With an acquisition time of 0-120 min, the Logan model still yielded an acceptable outcome when a fixed clearance rate constant (k2') from the cerebellum was applied. ", "Intravenously injected citalopram was not associated with a decrease in cerebellar binding. ", "A lipophilic metabolite that did not seem to bind specifically to serotonin transporter was seen in 2 of 7 subjects. ", "Serotonin transporter binding with (123)I-ADAM SPECT can be assessed with the Logan model based on a 120-min acquisition when a constant k2' is applied. ", "This model, because it allows for more accurate and less biased binding estimates and thus reduces the required sample size, is advantageous over the ratio method used in clinical studies so far. ", "A single blocking experiment supported the use of the cerebellum as a reference region." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.023529411764705882, 0, 0.005952380952380952, 0, 0.00425531914893617, 0, 0.003472222222222222, 0, 0.011976047904191617, 0, 0, 0.013071895424836602, 0, 0 ]

[ "Friday, July 01, 2005\n\nTwo Wax projects for Summer of Code\n\nThe PSF put up a list of projects accepted for Google's Summer of Code. ", "Not one, but two projects deal with improving Hans Nowak's Wax toolkit. ", "Very cool: hopefully by the time I have to write another desktop-bound application, Wax will be mature and well-documented. ", "Tkinter is too underpowered, and wx is too clunky." ]

{ "pile_set_name": "Pile-CC" }

[ 0.015151515151515152, 0.013888888888888888, 0.008064516129032258, 0 ]

[ "It's the day Connor has been waiting for his whole life. ", "The day he is supposed to begin training as a knight.", "\n\nThen why is everything going so wrong?", "\n\nConnor and his friend Simon, a boy with a talent for magic, soon find themselves caught between goblins and skeletons in an ancient castle buried deep underground. ", "When they stumble upon a talking skull locked in a birdcage, it could cost them their lives.", "\n\nDavid Anthony, along with co-author Charles David Clasman, has written over 20 books for kids in three series, including Mystery Underground, Heroes A2Z, and Knightscares.", "\n\nDavid Anthony received his first typewriter in the eighth grade and has been banging on keyboards ever since. ", "As a child, some of David's best friends were books. ", "He always loved to read. ", "A friend first inspired him to write, and the steady encouragement of his parents and teachers kept him at it. ", "Today he writes with the passion of his youth. ", "No story can ever be too fantastic, too impossible, too spooky, or too silly.", "\n\nDavid currently lives in West Bloomfield, Michigan with a patient wife, a semi-patient son, and a demanding dog. ", "At least two of them usually need a haircut. ", "When not writing or reading, David plays tabletop games with his son, engages in social media, and roots for the Detroit Red Wings." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0.023121387283236993, 0.008928571428571428, 0.018867924528301886, 0, 0.009009009009009009, 0, 0, 0, 0, 0.015267175572519083 ]

[ "1. ", "Introduction\n===============\n\nSchistosomiasis is a parasitic disease affecting over 200 million people in many parts of the developing world but as yet an effective vaccine has not been developed. ", "Infection of the mammalian host occurs by penetration of the skin by free-swimming larvae present in contaminated water. ", "Once infective cercariae locate host skin, they enter the stratified epidermis, aided by the secretion of enzymes from the parasites' acetabular glands ([@bib43]). ", "The schistosome larvae then move through the skin until they reach the epidermal--dermal basement membrane, which acts as a barrier prior to their entry into the dermis. ", "Although the timing of parasite migration through the skin is not agreed ([@bib28; @bib5]), studies in the mouse suggest that penetration of the epidermis occurs within 30 min and the majority of larvae remain in the skin for at least 40 h ([@bib59]). ", "The parasites then exit the skin via blood venules or lymphatic vessels, en route to the lungs and then the blood vessels of the hepatic portal system (*Schistosoma mansoni*) or the bladder vesical plexus (*S. haematobium*).", "\n\nIrrespective of the final site of parasitisation, a skin phase of migration is common to all species of schistosomes and can be analysed effectively using a murine model ([@bib48]). ", "Although penetration of the skin usually only elicits transient dermal inflammation ([@bib17; @bib15]), repeated exposure can result in cercarial dermatitis, which in the case of avian schistosomes is characterised by a Th2-associated immediate hypersensitivity reaction ([@bib26]). ", "Nevertheless, the skin also provides a logical site to target in the development of an anti-larval vaccine ([@bib35]). ", "In this context, radiation-attenuated (RA) *S. mansoni* cercariae consistently elicit high levels of protection characterised by the induction of Th1-associated immune responses ([@bib13]). ", "Analysis of the skin exposure site after vaccination reveals focal inflammatory reactions composed of a heterogeneous array of infiltrating leukocytes orchestrated by a cascade of chemokines and cytokines ([@bib39; @bib15; @bib16]). ", "Significantly, secretion of IL-12p40 by in vitro-cultured skin biopsies from vaccinated mice was more sustained compared with its transient production by skin biopsies from mice exposed to normal (non-irradiated) larvae ([@bib15]). ", "Of those cells that had the capacity to migrate from the skin to the skin-draining lymph nodes (sdLNs) many were MHCII^+^. Moreover, the majority of the dermal exudate cells (DECs) that were positive for intracellular IL-12p40 also expressed surface CD11c and/or F4/80, indicating that they were dendritic cells (DCs) and/or macrophages ([@bib15]).", "\n\nThe fact that a large proportion of larvae remain in the epidermis for greater than 24 h, and that cells with the potential for antigen-processing presentation (i.e. were MHCII^+^) migrated from the skin, raised the question as to whether epidermal Langerhans cells (LCs) were a significant feature of the dermal immune response leading to the induction of protective immunity by RA schistosomes. ", "Epidermal LCs are efficient antigen-presenting cells (APCs) in that they capture foreign antigens and process them into antigenic fragments ([@bib41]). ", "They also acquire the ability to migrate and so can transport antigen to the sdLN where initiation and differentiation of the adaptive T-cell response occurs ([@bib45; @bib47]). ", "Although LCs share a number of surface markers/receptors with other APCs including DCs (e.g. CD11c), a transmembrane lectin named langerin (CD207) unique to LCs was recently discovered ([@bib54]). ", "CD207 is abundantly expressed by epidermal LCs and freshly isolated LCs but is down-regulated upon stimulation via CD40 and in vitro culture ([@bib55; @bib49]). ", "It is also an important marker to enable the tracking of LC migration and distinguishing them in the sdLN where several different populations of DCs are present ([@bib42; @bib11; @bib49]). ", "In this manner, we can determine the importance of LCs relative to other dermal DCs in initiation of the immune response to schistosome antigens in the sdLN.", "\n\nIn the context of parasite infection, LCs may be an important APC in the development of cutaneous immunity to *Leishmania major* ([@bib29; @bib31]), since LCs carry a substantial load of *L. major* promastigotes ([@bib4]), and *Leishmania*-exposed LCs are thought to be the major cell type responsible for the production of functional IL-12 ([@bib57]). ", "Moreover, LCs directly transport ingested *L. major* from the site of infection to the T-cell areas of sdLN ([@bib3]), although others have more recently questioned the relative importance of LCs in the priming of acquired immunity against *L. major* ([@bib8; @bib27; @bib40]). ", "The parasitic helminth *Brugia malayi* also induces the migration of LCs from human epidermis ([@bib46]). ", "In contrast, little is known about how LCs respond to cutaneous schistosome infection. ", "Recently, schistosomes were shown to delay the migration of LCs (defined as MHCII^+^) from the skin, mediated by PGD~2~ produced by parasites themselves ([@bib2]). ", "However, it is not known whether LCs play a significant role in the priming of the Th1-acquired response to the well studied RA schistosome vaccine in the mouse, although LCs have been implicated in the induction of protection in a guinea pig model ([@bib44]).", "\n\nIn the present study, we used an antibody against CD207 ([@bib49]), specifically to track LC migration from the epidermis to the sdLN following percutaneous exposure of mice to RA schistosome larvae. ", "We report for the first time that schistosomes induce the migration of CD207^+^ LCs from the epidermis to the sdLN but in this site they represent only a minor population of skin-derived APCs after schistosome exposure.", "\n\n2. ", "Materials and methods\n========================\n\n2.1. ", "Host and parasite\n----------------------\n\nAnaesthetised female C57BL/6 strain mice (8--10 weeks old) were exposed to between 200 and 500 optimally irradiated (20-krad; ^60^Co source) or normal (non-irradiated) cercariae of *S. mansoni* via each pinna as described previously ([@bib34]).", "\n\n2.2. ", "Preparation of tissues\n---------------------------\n\nThe skin site of exposure and the sdLN (auricular) were obtained from groups of mice at 0, 8, 16 and 24 h, and on days 2, 4 or 8 after parasite exposure. ", "Tissues were prepared for histology, culture in vitro, or analysis by flow cytometry as described below. ", "For conventional histology, 5 μm traverse sections of wax-embedded pinnae (fixed in 10% buffered formalin) were stained with H&E. For immunohistological analysis, pinnae and the sdLN were embedded in OCT compound (H&E Ltd., Nottingham, UK) and snap frozen in 2-methylbutane on liquid N~2~. Cryosections were then cut (7--14 μm; Leica Microsystems cryostat, Germany) and placed on poly-[l]{.smallcaps}-lysine-coated glass slides (Superfrost Plus; Invitrogen, Paisley, UK) before fixing in 3.7% paraformaldehyde. ", "Epidermal sheets were obtained by splitting pinnae and floating them on 0.5 M ammonium thiocyanate in PBS at 37 °C for 30 min ([@bib10]). ", "The sheets were then peeled from the underlying dermis and rinsed in PBS prior to fixing in 3.7% paraformaldehyde on ice for 15 min.", "\n\nFor analysis of cells either on cytospins or by flow cytometry, single suspensions were obtained as follows. ", "Epidermal cells were isolated by floating split pinnae on 0.8% trypsin-PBS (Roche Applied Science, Germany) in 24-well culture plates (Nalgene, Nunc) at 37 °C for 30 min ([@bib25; @bib49]). ", "Trypsin digestion was stopped with RPMI medium containing low endotoxin 10% FCS (Seralab, Oxon.", "UK), 2 mM [l]{.smallcaps}-glutamine, 200 U/ml penicillin and 100 mg/ml streptomycin (RPMI/10). ", "The epidermal sheet was then removed, disrupted on a vortex mixer for 10 s to break up the cell aggregates and then filtered through steel gauze to yield a single cell suspension.", "\n\nCells that emigrate from the skin (DEC) were isolated as described previously ([@bib34]; [@bib15; @bib16]). ", "Briefly, pinnae were split and floated on 0.5 ml RPMI/10 in 24-well hydrophobic culture plates (Greiner Labortechnik, Frickenhausen, Germany) for 18 h at 37 °C in 5% CO~2~. Cells which spontaneously detach from the split pinnae were harvested, enumerated and resuspended in PBS containing 0.5 mM CaCl~2~, 0.5 mM MgCl~2~ and 0.1% BSA. ", "The sdLN were digested with collagenase D (0.5 mg/ml; Roche, Germany)/DNAse (0.02 mg/ml; Sigma) at room temperature for 20 min ([@bib58]) and the stromal fragments disrupted before treating with 0.5 mM EDTA for 5 min to disrupt DC-T cell complexes.", "\n\n2.3. ", "Antibodies\n---------------\n\nRat anti-mouse Langerin mAb (clone F929F3, rat IgG; provided by Dr. Saeland, Schering-Plough, Dardilly, France) was used to identify CD207^+^ LCs ([@bib55; @bib49]) followed by goat anti-rat Ig conjugated with Alexafluor 488 (MolecularProbes, Leiden, The Netherlands) or Allophycocyanin (Caltag-Medsystems, Towester, UK). ", "This primary mAb specifically reacts with cytoplasmic epitopes of CD207, therefore immunolabeling was performed using an intracellular staining protocol including 0.1% saponin at each incubation step. ", "To stain cell surface markers, biotinylated antibodies were as follows: anti-CD4 (clone H129.19 Pharmingen, BD Biosciences), anti-MHC II (I-a^b,d^, clone B21.2, Caltag-MedSystems) or anti-CD11c (clone HLA-3, Pharmingen) followed by streptavidin-conjugated Texas-Red (Vector Laboratories, Peterborough, UK), APC or fluorescein isothiocyanate (FITC) (Caltag MedSystems). ", "Appropriate isotype-matched non-specific antibodies were used throughout to establish control level background staining. ", "Parasites in the skin were localised using a polyclonal rabbit antiserum against solubilised schistosome larvae ([@bib33]) and probed using goat anti-rabbit antibody conjugated to Alexa 594 (Molecular probes).", "\n\n2.4. ", "Immunofluorescent staining\n-------------------------------\n\nFixed sections of pinnae and sdLN or epidermal sheets were first treated with Avidin--Biotin blocking kit (Vector Labs) to block non-specific binding due to endogenous biotin. ", "Sections were subsequently incubated with relevant primary unlabelled, or biotin-labelled antibodies, as described above, alongside irrelevant isotype-matched control antibodies. ", "Tissue sections were then probed as appropriate with fluorescent-conjugated streptavidin, or secondary mAbs prior to mounting with VectorShield (Vector Labs). ", "Alternatively, aliquots of relevant cell suspension were spun at 500 rpm for 5 min (Cytospin 2, Shandon, UK) and labelled as above for CD207 and MHCII.", "\n\n2.5. ", "Skin sensitisation with FITC\n---------------------------------\n\nNaïve mice were painted with 25 μl 1% FITC (Sigma) preparation dissolved in 1:1 acetone:dibutylphalate (Sigma) on the dorsal side of both ears, or with control vehicle only (acetone:dibutylphalate). ", "Tissues were removed at 24 h for analysis.", "\n\n2.6. ", "Analysis of cells in tissue sections\n-----------------------------------------\n\nTissue sections were viewed using a Nikon Labophot fluorescent microscope (Nikon Corp, Tokyo, Japan) and photographed using a Nikon Coolpix 995 (Nikon Corp) with subsequent analysis performed with Adobe Photoshop version 6. ", "Confocal images were acquired on a Zeiss Axiovert 200 M with an LSM 510 META system. ", "All multicolour samples were imaged sequentially and controls showed no bleed-through. ", "Images were collected using the LSM 510 software v3.2 and copied using Zeiss Image Browser. ", "The number of CD207^+^ cells was determined per image, the frequency was converted to LC/mm^2^ and the results expressed as mean + SEM of a minimum of 10 images.", "\n\n2.7. ", "Flow cytometric analysis of LCs in epidermal, dermal exudate and sdLN cell suspensions\n-------------------------------------------------------------------------------------------\n\nAliquots of up to 5 × 10^5^ cells from the epidermis, DEC and sdLN were briefly fixed in 1% formaldehyde in PBS and then permeabilised with 0.1% saponin in PBS containing 2% FCS. ", "Cells were blocked with 2 μl rabbit IgG (Vector Labs) prior to staining for intracellular CD207 as above. ", "To label surface markers, CD207-stained cells were washed twice with saponin-free PBS plus 2% FCS before an excess of rat IgG (Sigma) was added to block residual-free antibody binding sites ([@bib49]). ", "Cells were then labelled with phycoerythrin conjugated anti-MHCII^+^ (M5/114.15.2, PharMingen) or anti-CD11c mAb. ", "Phenotypic data were acquired using a Cyan flow cytometer (Dakocytomation, UK) and analysed with Summit^®^ software.", "\n\n2.8. ", "Statistics\n---------------\n\nData were compared using the Student's *t* test. (", "∗∗∗, *P* \\< 0.001; ∗∗, *P* \\< 0.01; ∗, *P* \\< 0.05; non-significant, *P* \\> 0.05). ", "Arithmetic means ± SEM are shown. ", "Data shown are representative of two to four experimental repeats.", "\n\n3. ", "Results\n==========\n\n3.1. ", "LCs are present in the epidermis but at reduced numbers after parasite exposure\n------------------------------------------------------------------------------------\n\nAnalysis of epidermal sheets of naïve mice probed with anti-CD207 mAb specifically revealed the presence of LCs with a characteristic dendritic morphology ([Fig. ", "1](#fig1){ref-type=\"fig\"}b and c). ", "The cells were evenly distributed throughout the epidermal sheet with the dendrites reaching out to access most of the tissue area. ", "CD207^+^ LCs were distributed along the suprabasal layer of the epidermis but not within the dermis of naïve mice as observed in transverse sections through the mouse pinna ([Fig. ", "1](#fig1){ref-type=\"fig\"}d and e). ", "All of the CD207^+^ cells were also positive for surface MHC II ([Fig. ", "1](#fig1){ref-type=\"fig\"}f). ", "However, while CD207 was observed even in the remote thin part of the dendrites, MHC II molecules were sparse in the cell extremities and tended to be concentrated around the main cell body.", "\n\nUpon visual enumeration of CD207^+^ cells in epidermal sheets of mice exposed to RA larvae, there were 40% fewer cells on day 4 compared with naïve controls (day 4 = 270 ± 33 *cf*. ", "day 0 = 454 ± 77; *P* \\< 0.05, data not shown). ", "However, due to concerns about the subjectivity of LC enumeration in epidermal sheets, cell suspensions of the epidermis were also analysed by flow cytometry. ", "In naïve tissues, approximately 2% of the total epidermal cell population was identified as CD207^+^MHCII^+^ ([Fig. ", "2](#fig2){ref-type=\"fig\"}a and b); there were no CD207^+^MHCII^−^ cells detected. ", "However, although the proportion of CD207^+^MHCII^+^ cells did not change at 8, 16 or 24 h, a significant 32% decrease (*P* \\< 0.05) was detected at 48 h when the LCs comprised only 1.4% of the total epidermal cell suspension ([Fig. ", "2](#fig2){ref-type=\"fig\"}b). ", "The expression of MHCII on CD207^+^ epidermal cells increased significantly within 1 day of vaccination ([Fig. ", "2](#fig2){ref-type=\"fig\"}c) and remained significantly elevated out to day 4, although the level was declining to that detected in naïve mice. ", "The decrease in the number of CD207^+^ cells in the epidermis followed an increase in the thickness and cellularity of both the epidermis and dermis at times when parasites were still present in the epidermis ([Fig. ", "2](#fig2){ref-type=\"fig\"}d).", "\n\n3.2. ", "CD207^+^ LCs emigrate from the epidermis after parasite exposure\n---------------------------------------------------------------------\n\nThe DEC population that spontaneously migrated from pinna biopsies during in vitro culture comprised a substantial number of MHCII^+^ cells but only a minority were also positive for intracellular CD207 ([Fig. ", "3](#fig3){ref-type=\"fig\"}a). ", "Between 15.1 ± 0.86% (day 2), 25.1 ± 1.51% (day 4) and 32.4 ± 2.83% (day 8) of the DEC population were MHCII^+^ but less than 1% (0.29--0.57%) of the total were CD207^+^. However, all CD207^+^ cells were MHCII^+^ since no CD207^+^MHCII^−^ cells were detected at any time point. ", "Multiplication of these percentages by the total number of cells recovered at different times after vaccination show that the number of CD207^−^MHCII^+^ and CD207^+^MHCII^+^ DECs increased significantly by day 1 (both *P* \\< 0.01; [Fig. ", "3](#fig3){ref-type=\"fig\"}a). ", "This was followed by a consistent increase in both groups of cells at later time points. ", "The numbers of CD207^−^MHCII^+^ cells in the DEC population was about 15-fold greater than the number of CD207^+^MHCII^+^ cells at all times (*P* \\< 0.01--0.001). ", "There is a hint that the extent of MHCII expression on migrating CD207^+^MHCII^+^ cells increases after vaccination (i.e. day 1 *cf*. ", "day 0) but this was not significant ([Fig. ", "3](#fig3){ref-type=\"fig\"}b). ", "In comparison, the level of expression of MHCII on CD207^−^MHCII^+^ cells decreases significantly on days 1 and 2 post vaccination ([Fig. ", "3](#fig3){ref-type=\"fig\"}b). ", "Therefore, CD207^+^ cells appear to have the potential to be better APCs than CD207^−^ cells, although they appear much less frequently ([Fig. ", "3](#fig3){ref-type=\"fig\"}a).", "\n\nHistological examination of CD207^+^ cells in the dermal tissue confirmed that while they were found exclusively in the epidermis of naïve mice ([Fig. ", "1](#fig1){ref-type=\"fig\"}d and e), a small number were observed in the dermis on days 2 ([Fig. ", "4](#fig4){ref-type=\"fig\"}b) and 4 ([Fig. ", "4](#fig4){ref-type=\"fig\"}c and d) post vaccination. ", "A schistosome larva observed in the epidermis on day 2 is associated with CD207^+^ cells in the underlying region of the dermis ([Fig. ", "4](#fig4){ref-type=\"fig\"}a and b). ", "CD207^+^ cells were also evident in the epidermis but were absent in the immediate vicinity of the parasite. ", "CD207^+^ cells in the dermis tended to be observed in groups and were not evenly scattered, suggesting a focal response to parasite exposure ([Fig. ", "4](#fig4){ref-type=\"fig\"}c and d). ", "There was evidence that the number of CD207^+^ cells in the epidermis immediately adjacent to the groups of dermal-located cells was reduced but this was not possible to enumerate. ", "The scarce presence of CD207^+^ cells in the DEC population ([Fig. ", "3](#fig3){ref-type=\"fig\"}a) was confirmed visually by staining of DECs on cytospins revealing occasional CD207^+^ cells ([Fig. ", "4](#fig4){ref-type=\"fig\"}e and f), which were always MHCII^+^ but most MHCII^+^ DEC were not CD207^+^ ([Fig. ", "4](#fig4){ref-type=\"fig\"}g). ", "Visual enumeration of CD207^+^ cells in the dermis shows there to be over 5-fold more cells in the dermis on day 4 after vaccination than in naïve mice (*P* \\< 0.01; [Fig. ", "4](#fig4){ref-type=\"fig\"}h).", "\n\n3.3. ", "CD207^+^ cells selectively accumulate in lymph nodes draining inflamed skin\n--------------------------------------------------------------------------------\n\nOf the three peripheral lymph nodes (LNs) located in the neck/throat region, only the auricular LN contained CD207^+^ cells ([Fig. ", "5](#fig5){ref-type=\"fig\"}a and b). ", "Virtually no CD207^+^ cells were observed in the adjacent cervical and axillar LN, or the distant mesenteric LN draining the large intestine (data not shown). ", "Significantly, CD207^+^ cells were restricted to the T-cell zone in the inner paracortical areas and none were found in the B cell follicles of the marginal cortex ([Fig. ", "5](#fig5){ref-type=\"fig\"}a). ", "At higher magnification, CD207^+^ cells can be observed with extended processes in close apposition to CD4^+^ cells in the T-cell zone ([Fig. ", "5](#fig5){ref-type=\"fig\"}a inset). ", "The overall increase in the number of cells in the sdLN after vaccination was mirrored by a significant increase in the number of CD207^+^MHCII^+^ cells by days 2 and 4 (*P* \\<  0.05; [Fig. ", "5](#fig5){ref-type=\"fig\"}b). ", "An increase in the number of CD207^+^MHCII^+^ cells was also apparent by day 1, although this was not statistically significant. ", "The profile of CD207^+^MHCII^+^ cell numbers was similar to the increase in the overall number of CD207^−^MHCII^+^ cells which were 8-fold (day 1) to 26-fold (day 4) more abundant.", "\n\n3.4. ", "Dermal APCs are preferentially recruited to the sdLN after sensitisation\n-----------------------------------------------------------------------------\n\nSince the number of CD207^+^ cells recruited to the sdLN after parasite exposure seemed very limited, we made a comparison with cell migration following a conventional skin sensitising agent known to cause the migration of LCs ([@bib6; @bib23]). ", "To increase the sensitivity of detection, the percent-positive events were gated to the largest and most granular cells (LGC; represents approximately 10% of the total sdLN cell pool). ", "By day 1 after painting the epidermis with FITC, the proportion of MHCII^+^ LGC that were CD207^+^ doubled from 2.3% in mice painted with control vehicle only, to just over 5% ([Fig. ", "6](#fig6){ref-type=\"fig\"}a). ", "The proportion that were CD207^−^ increased 3-fold from 7.3% to over 20%. ", "By comparison, after parasite exposure the proportion of MHCII^+^ LGCs that were CD207^+^ increased only 1.5-fold from 1.6% to 2.5%, and the proportion of CD207^−^ cells increased by just 1.9-fold to 15.3% ([Fig. ", "6](#fig6){ref-type=\"fig\"}c).", "\n\nA similar picture emerges from analysis of cells probed with the conventional DC marker CD11c ([Fig. ", "6](#fig6){ref-type=\"fig\"}b). ", "The proportion of CD207^+^ cells increased by 2.2-fold to 3.6% in the sdLN of mice painted with FITC, while the proportion of CD207^−^ cells which will be dermal DCs (not LCs) increased 2.7-fold to over 7%. ", "In comparison, the proportion of CD207^+^CD11c^+^ cells in the sdLN of mice exposed to schistosome larvae only increased by 1.1-fold to 3.1% but the proportions of CD207^−^CD11c^+^ cells again increased by 4-fold to reach over 7% ([Fig. ", "6](#fig6){ref-type=\"fig\"}d).", "\n\n3.5. ", "Migration of LCs in response to RA and normal schistosomula\n----------------------------------------------------------------\n\nSince RA schistosome larvae exhibit retarded migration from the skin compared with normal larvae ([@bib32]), it is possible that the emigration of CD207^+^ LCs from the skin to the sdLN in response to these two forms of parasite differs. ", "A reduction in the CD207^+^ cell population in the epidermis was evident by 48 h following exposure to RA larvae ([Fig. ", "2](#fig2){ref-type=\"fig\"}a). ", "However, in a direct comparative analysis, the numbers of CD207^+^ cells observed in the epidermis following exposure to normal and RA larvae were shown to be similar and not significantly different (*P* \\> 0.05; [Fig. ", "7](#fig7){ref-type=\"fig\"}a). ", "In this experiment, significantly reduced numbers of epidermal CD207^+^ cells were apparent only by day 4 (*P* \\< 0.01); the reduction was still evident by day 8 after parasite exposure in both groups of mice.", "\n\nAnalysis of the CD207^+^ population in the sdLN revealed that both RA and normal larvae initiated similar changes to the proportions of CD207^+^MHCII^+^ cells at all time points. ", "This equated to between 2% and 3% of the large granular cell population as noted earlier ([Fig. ", "6](#fig6){ref-type=\"fig\"}a). ", "However, when the cellularity of the sdLN in the two groups of mice was taken into account, it became evident that the number of LCs in the sdLN of mice exposed to normal larvae was significantly greater than in the sdLN of mice exposed to RA larvae on day 2 (*P* \\< 0.05; [Fig. ", "7](#fig7){ref-type=\"fig\"}b). ", "The number of CD207^+^MHCII^+^ in mice immunised with RA larvae was only greater than in infected mice by day 8, although this difference was not significant.", "\n\n4. ", "Discussion\n=============\n\nFor the first time to our knowledge, we show that schistosome larvae induce the migration of CD207^+^ LC from the site of immunisation to the sdLN. ", "However, although LCs have the potential to be important antigen-processing and -presenting cells, the limited numbers of migrants in the context of a substantial antigenic insult (i.e. the immunising larvae) makes it unlikely that they have a dominant role in priming the early CD4^+^ immune response in the draining lymphoid tissue.", "\n\nUsing the rat mAb F929F3 which specifically recognises a cytoplasmic epitope of CD207 (langerin; [@bib55]), we confirm that LCs are a relatively common cell within the epidermis and they form an evenly distributed network across the epidermal surface ([@bib55; @bib49]). ", "Although LCs express other surface antigens (e.g. MHCII, CD205 and CD11c), these are also expressed by other cell types such as DCs and macrophages, and only CD207 is restricted to LCs. ", "LCs have been reported to occur in a ratio of 1:15 relative to keratinocytes ([@bib36]); in the present study using flow cytometric enumeration, the CD207^+^ cell population of the naïve epidermis appeared to be less frequent, being approximately 2% of the total epidermal cell population. ", "In our immunohistochemical studies, CD207^+^ cells locate in the suprabasal layer of the epidermis, above the epidermal basement membrane which also acts as a barrier to onward parasite migration ([@bib59]). ", "Indeed, multi-photon imaging of LCs positions them approximately 3 μm above the basement membrane ([@bib36]), ideally located to come into contact with schistosome larvae. ", "We confirmed that all CD207^+^ cells in the epidermis are also MHCII^+^. Interestingly, the relative level of MHCII expression by CD207^+^ cells in the epidermis is enhanced after vaccination, probably in response to acute phase cytokines such as IL-1β which we know is released soon after vaccination ([@bib15]). ", "This reinforces the notion that they could be efficient antigen-processing cells with the ability to present antigen. ", "The dendrites of the LC population can be seen to extend across and access virtually the entire epidermal layer acting as a well-placed sentinel to detect and pick up antigens from incoming pathogens. ", "The dendrites are thought to exhibit dSEARCH (dendrite surveillance extension and retraction cycling habitude) activity and the cells can also move laterally in response to inflammatory stimuli ([@bib37]). ", "Therefore, the intricate network of LCs in the epidermis should be able to detect most, if not all, of the percutaneously applied schistosome larvae used to immunise the murine host in our studies. ", "Indeed, the much greater size of schistosome larvae makes it highly likely that they would come into contact with at least one LC.", "\n\nExposure of the skin to *S. mansoni* larvae induced the migration of some CD207^+^ cells from the epidermis within 24 h, which was confirmed by histological examination of the immunisation site, demonstrating that limited numbers of CD207^+^ cells migrate from the epidermis into the underlying dermis. ", "The migratory response of CD207^+^ cells appeared to be focal with cells detected as groups in the dermis rather than as an even scatter. ", "In sections where a parasite was detected at the epidermal basement membrane (e.g. at day 2), the CD207^+^ cells were located 'downstream' of the parasite and it is probable that these cells were migrants on their way to dermal lymphatic vessels leading to the sdLN. ", "There was no evidence that CD207^+^ cells migrate laterally towards schistosomes since, rather than an accumulation, there was a relative absence in the immediate vicinity of epidermally located parasites. ", "In tissue sections where a parasite was not detected, groups of CD207^+^ cells were also detected in the dermis. ", "This might be due to the parasite having already left the skin site or the parasite had migrated out of the plane of view. ", "Microscopy studies of living tissues using multi-photon technology should establish the precise inter-relationship of LCs and parasites in the epidermis.", "\n\nAnalysis of the number of CD207^+^ cells in the epidermis initially supports the notion of parasite-induced migration of LCs from the epidermis since fewer were counted in epidermal sheets 4 days after parasite exposure. ", "However, flow cytometric enumeration of digested epidermal cell suspensions revealed that the number of CD207^+^ cells only declined in the epidermis by days 2--4 and the numbers detected within the first 48 h were similar to those in naïve mice. ", "In this respect, it is possible that CD207is down-regulated by inflammatory stimuli such as lipopolysaccharide and ligation of CD40 ([@bib53]), such that LCs are no longer identified as CD207^+^ and might be underestimated, but this could be just a feature of in vitro culture ([@bib49]). ", "On the other hand, CD207 is believed to be expressed during the migration of LCs ([@bib22; @bib49]) and characterises mature rather than immature LCs ([@bib54]). ", "The phenomenon of LC migration blockade following exposure to *S. mansoni* was originally reported by [@bib2]. ", "They showed that the migration of epidermal LCs identified only by the expression of MHCII^+^ was inhibited following schistosome infection; this was transient and mediated by the production of parasite-derived prostaglandin D2 which specifically disrupted TNFα-induced migratory potential ([@bib2]). ", "Furthermore, the active parasite component was later described to be a molecule with glutathione-*S*-transferase activity by acting on the D prostanoid receptor 1 ([@bib12]). ", "In part, our studies support the reported inhibition of LC migration following parasite exposure. ", "However, through use of the anti-CD207 mAb as a specific marker for LCs, as distinct from other dermal-derived MHCII^+^ cells, we are also able to show that some LCs are able to migrate out of the epidermis within the first 48 h and begin to accumulate in the sdLN as early as 24 h after parasite exposure. ", "Combined, our results suggest that the total number of LCs increases after parasite exposure, possibly from a population of Gr-1^hi+^ monocytes ([@bib9]), and that while some are retained in the epidermis, a proportion successfully leave within the first 24--48 h and migrate via the dermis to accumulate in the sdLN. ", "Another conclusion that might be made from our results, is that migrating CD207^+^MHCII^+^ DECs express greater amounts of MHCII after vaccination than CD207^−^MHCII^+^ DECs. ", "This suggests that migrating CD207^+^ LCs have a greater capacity to efficiently present antigen upon arrival at the draining LN than migrating CD207^−^ cells, such as dermal DCs or macrophages.", "\n\nThe detection of CD207^+^ cells in the sdLN of naïve mice was at first surprising but the staining was clearly specific since CD207^+^ cells were not observed in other LNs such as the mesenteric LN. ", "This supports the view that the CD207^+^ cells in the sdLN observed in our studies were not the minor subset of lymphoid origin recently identified as CD11c^hi^, CD8α^+^, CD11b^lo^ which can be located in the mesenteric LN and spleen; rather they are of the CD11c^lo^, CD8α^lo^, CD11b^hi^ subset of epidermal origin ([@bib6]). ", "The presence of CD207^+^ cells in substantial numbers in the sdLNs of naïve mice most likely reflects their traffic under normal conditions in the absence of an inflammatory stimulus ([@bib50]). ", "Nevertheless, elevated numbers of CD207^+^MHCII^+^ cells were clearly detected in the sdLN after parasite exposure which progressively increased by day 4. ", "Although this increase was marked, it was overshadowed by a far greater increase in the numbers of MHCII^+^ cells that were CD207^−^. Indeed, the number of MHCII^+^CD207^−^ cells were 10 times more frequent than CD207^+^ cells; this does not just reflect a proportionally greater increase of MHCII^+^ B lymphocytes in the sdLN but also an increase in CD207^−^CD11c^+^ cells which increased 16-fold compared with a 3.1-fold increase in CD207^+^CD11c^+^ cells. ", "The increase in cells with APC function is likely to be cells originating from the skin in response to signalling via CCR7 ([@bib38]) but it is clear that only a small proportion are classical CD207^+^ LCs. ", "The majority of APCs are likely to be macrophages and CD11c^+^ DCs, since both are abundant components of the dermis ([@bib7]). ", "Our data comparing the migration of CD207^+^ and CD207^−^ cells in response to a contact sensitising agent (FITC) or RA schistosome larvae, support the view that, under inflammatory conditions, MHCII^+^ macrophages and/or dermal DCs are the most abundant cells to migrate from the skin to the sdLN and that CD207^+^ LCs are only a minor constituent despite expressing greater levels of MHCII. ", "This difference in cell numbers may be a function of their relative migratory dynamics since data accrued from intravital imaging of LC migration in vivo using transgenic mice with the enhanced green fluorescent protein under the *CD207* gene, proposes that CD207^+^ LCs are slower to migrate to the sdLN than dermal DCs ([@bib23; @bib24]).", "\n\nAlthough we have evidence that CD207^+^ and other cells with APC function migrate from the skin to the sdLN, we have no proof that they process parasite antigen in the skin prior to departure or that they present the same antigen to CD4^+^ cells in the sdLN. ", "They may even cross-present antigen to other APCs ([@bib51]) in the skin prior to migration of the latter to the sdLN. ", "Furthermore, both parasites and parasite antigen drain directly to the sdLN ([@bib32]) independent of any migrating APCs, and antigen could be presented by resident APCs in situ. ", "Unfortunately, it has not yet proven possible to stably transfect invasive cercariae with a plasmid expressing fluorescent probe(s) to allow visual detection of antigen uptake by MHCII^+^ cells. ", "Another unresolved issue is whether CD207^+^ LCs in the DEC population are IL-12p40^+^ as originally proposed ([@bib15]). ", "We have been unable to convincingly co-detect intracellular IL-12p40 and intracellular CD207 using the currently available mAbs (Gavin Jenkins, unpublished data). ", "IL-12 production by LC may actually be down-regulated, as reported to occur in susceptible strains of mice after infection with *L. major* ([@bib30]), although intriguingly, ligation of CD154 on LCs is reported to stimulate IL-12p40 production ([@bib52]) and may explain the up-regulation of IL-12p40 release by skin biopsies following anti-CD40 mAb treatment of CD154^−/−^ mice exposed to the RA schistosome vaccine ([@bib14]).", "\n\nThe rationale for analysing the migration of CD207^+^ LCs in our model of parasite immunisation was that LCs would be important in the priming of a CD4^+^ mediated immune response in the sdLN, which ultimately would lead to the development of a protective immune response ([@bib44; @bib15; @bib13]). ", "Therefore, we compared the dynamics of CD207^+^ cell migration in mice exposed to protective RA larvae or non-protective normal parasites. ", "The vast majority of normal parasites exit from the skin by day 8, whilst nearly one third of RA larvae remain ([@bib32]). ", "However, no difference was determined in the rate of CD207^+^ cell migration out of the exposure site, despite the prolonged antigenic stimulus in the pinnae of vaccinated mice. ", "Similarly, no difference was observed in the proportion of CD207^+^ cells between the sdLN from the two groups of mice. ", "Therefore, the presence of CD207^+^ cells in the sdLN does not correlate with the previously reported enhanced CD4^+^ cell proliferation and Th1 cytokine production that is a feature of mice exposed to the RA schistosome vaccine ([@bib16; @bib13]).", "\n\nOn the other hand, it is possible that CD207^+^ cells, despite expressing slightly greater amounts of MHCII, do not have an immune priming role but regulate events in the sdLN, or cross-present antigen to other APCs ([@bib51]). ", "In certain viral infection models, CD8α^+^ dermal DCs and not LCs have the major antigen-presenting function ([@bib1; @bib60]). ", "Moreover, several studies of *L. major* infection undermine the role of LCs as being responsible for priming the CD4^+^-mediated acquired immune response and instead highlight the role of dermal DCs ([@bib8; @bib27; @bib40]). ", "In this context, we recently reported that molecules released by the invading schistosome larvae in the first few hours (i.e. equivalent to when the parasite is still in the epidermis) activate bone-marrow-derived DCs to become potent stimulators of Th2-type responses in vitro and in vivo ([@bib21]). ", "These molecules may have an immunomodulatory function via their constituent glycans through the ligation of toll-like receptor 4 leading to the production of IL-10 ([@bib19; @bib20]). ", "Indeed, it is reported that *B. malayi* larvae act on LCs to depress MHCII expression and gene transcripts for cytokines associated with antigen presentation leading to a decreased ability to prime CD4+ cells responses ([@bib46]). ", "It is therefore possible that CD207^+^ LCs have an, as yet, unappreciated role in modulating the immune response to schistosomes distinct from its presumed role as an APC. ", "Indeed, recent observations on the dynamics and functions of CD207^+^ cells fuel speculation in a number of different inflammatory situations that LCs have a regulatory, rather than stimulatory, role ([@bib18; @bib6; @bib56; @bib24]).", "\n\nS.K. was supported by a PhD studentship awarded by the Royal Thai Government. ", "A.P.M. and G.R.J. were supported by the Wellcome Trust (\\# 056213 and 071762, respectively); R.A.P. was in receipt of a PhD studentship form the Biotechnology and Biological Sciences Research Council of the UK. ", "The following are thanked: Ann Bamford for maintaining the parasite life cycle, Peter Cook for experimental help and Peter O'Toole and Karen Chance of the Imaging and Cytometry laboratories in the Department of Biology.", "\n\n{#fig1}\n\n{#fig2}\n\n{#fig3}\n\n{#fig4}\n\n{#fig5}\n\n{#fig6}\n\n{#fig7}\n\n[^1]: Present address: Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok, Thailand.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0, 0, 0.006097560975609756, 0, 0.011904761904761904, 0, 0.005434782608695652, 0.01060070671378092, 0.008403361344537815, 0.010526315789473684, 0.012875536480686695, 0.004310344827586207, 0.008620689655172414, 0.002506265664160401, 0.006578947368421052, 0.011235955056179775, 0.01015228426395939, 0.018633540372670808, 0.015873015873015872, 0, 0.014084507042253521, 0.014388489208633094, 0.009433962264150943, 0, 0.006097560975609756, 0.007692307692307693, 0.01485148514851485, 0, 0, 0, 0.006993006993006993, 0, 0, 0, 0.009784735812133072, 0.014492753623188406, 0.007575757575757576, 0, 0.02631578947368421, 0.031578947368421054, 0.010526315789473684, 0, 0.03636363636363636, 0.005988023952095809, 0.012096774193548387, 0, 0.02857142857142857, 0.004975124378109453, 0.02168021680216802, 0, 0.004784688995215311, 0, 0.00423728813559322, 0, 0.012578616352201259, 0.006622516556291391, 0, 0.0038022813688212928, 0, 0, 0.01644736842105263, 0.023529411764705882, 0, 0.010869565217391304, 0, 0, 0.008356545961002786, 0.009433962264150943, 0.019801980198019802, 0.017543859649122806, 0, 0, 0, 0.012048192771084338, 0, 0, 0, 0, 0.003048780487804878, 0, 0, 0.005555555555555556, 0, 0.014084507042253521, 0, 0.005263157894736842, 0.00546448087431694, 0, 0, 0.008620689655172414, 0, 0.004291845493562232, 0, 0.009009009009009009, 0, 0.004629629629629629, 0, 0, 0.008670520231213872, 0, 0.0035971223021582736, 0.004219409282700422, 0, 0, 0.006134969325153374, 0, 0.023255813953488372, 0, 0.007246376811594203, 0, 0.006993006993006993, 0, 0.006535947712418301, 0.010526315789473684, 0.024390243902439025, 0, 0.007407407407407408, 0, 0, 0.006756756756756757, 0, 0, 0.029850746268656716, 0.007874015748031496, 0.01834862385321101, 0, 0.005813953488372093, 0, 0, 0.0034602076124567475, 0, 0, 0.005847953216374269, 0, 0.007042253521126761, 0, 0.005263157894736842, 0, 0, 0, 0, 0.005025125628140704, 0.005405405405405406, 0.01092896174863388, 0, 0, 0.004694835680751174, 0, 0.019417475728155338, 0, 0.004830917874396135, 0.004219409282700422, 0, 0, 0.005494505494505495, 0.008333333333333333, 0, 0.0091324200913242, 0, 0, 0.0055248618784530384, 0.010416666666666666, 0, 0.0035842293906810036, 0, 0.006329113924050633, 0, 0, 0, 0.018315018315018316, 0.010752688172043012, 0.0034482758620689655, 0.004807692307692308, 0.005813953488372093, 0.009554140127388535, 0, 0, 0.0048543689320388345, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006920415224913495, 0.024691358024691357, 0.009009009009009009, 0.0033222591362126247, 0.005714285714285714, 0, 0, 0.0031446540880503146, 0, 0, 0, 0.009174311926605505, 0.005128205128205128, 0, 0, 0.00966183574879227, 0.015625, 0.005089058524173028, 0.0058823529411764705, 0.0038314176245210726, 0.008403361344537815, 0.00558659217877095, 0, 0.01639344262295082, 0.012269938650306749, 0.009345794392523364, 0.009933774834437087, 0.007194244604316547, 0.016260162601626018, 0, 0, 0.012096774193548387, 0.004347826086956522, 0.015625, 0.01327433628318584, 0.0033112582781456954, 0.010869565217391304, 0.004329004329004329, 0.005813953488372093, 0.017094017094017096, 0.0125, 0.018957345971563982, 0.0273972602739726, 0, 0, 0.01675977653631285, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.006024096385542169, 0.0136986301369863, 0, 0.009708737864077669, 0.015384615384615385, 0, 0, 0, 0, 0, 0.019417475728155338, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.008928571428571428, 0 ]

[ "Last updated on .From the section Football\n\nThe temporary dismissals will only apply to yellow cards shown for dissent\n\nThe Football Association has confirmed 32 grassroots leagues in England will trial sin-bins in the 2017-18 season.", "\n\nThe \"temporary dismissals\" will apply to selected divisions in England's 'step seven' - six tiers below the National League - and leagues below.", "\n\nPlayers will now spend 10 minutes out of the game if they are shown a yellow card for dissent.", "\n\nMen's, women's, adult, youth, Saturday and Sunday leagues have all been picked for the pilot scheme.", "\n\nThe FA said 130 leagues registered interest in the trial and a mixture of leagues across the country were chosen.", "\n\nClubs are normally charged a £10 fine for each yellow card but the FA will not be charging this administration fee for those that participate.", "\n\nStep seven is the bottom level of English football's National League System, which feeds into the country's professional leagues.", "\n\nThe highest league within that structure - step one - is the National League.", "\n\nSelected leagues" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.004273504273504274, 0.00684931506849315, 0, 0, 0.008695652173913044, 0, 0.007633587786259542, 0.012658227848101266, 0 ]

[ "Just like the ending of a horror movie, Circuit City has gone and plunged its soil-covered claw from its grave. ", "Its site may have new owners, but that doesn’t mean it’s lost all of your tasty personal info.", "\n\nCircuitCity.com is back, and it looks eerily familiar. ", "The zombie website is now controlled by Systemax, the same folks who own Tiger Direct. ", "Though the new site may look similar to the old, no doubt part of Systemax’s goal to keep alive a “proud brand that America has grown to count on,” it isn’t nearly as consumer-friendly as we would like…" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0.022988505747126436, 0.0049504950495049506 ]

[ "Monthly Archives: July 2017\n\nThe following blog post was originally posted here: Some Clarity on The Temple Mount … (hopefully)\nAnd they shall fall by the edge of the sword, and shall be led away captive into all nations: and Jerusalem shall be trodden down of the Gentiles, until the times of the Gentiles be fulfilled.(Luke 21:24) In […]\n\nThe following blog post was originally posted here: On Forsaking the Body of Christ…church\nAnd let us consider one another to provoke unto love and to good works: Not forsaking the assembling of ourselves together, as the manner of some is; but exhorting one another: and so much the more, as ye see the day […]\n\nThe following blog post was originally posted here: The Temple Mountain; The Eye Of The Storm…endtimes prophecy\nWhy do the heathen rage, and the people imagine a vain thing? ", "The kings of the earth set themselves, and the rulers take counsel together, against the Lord, and against his anointed, saying, Let us break their […]\n\nThe following blog post was originally posted here: The Times Of The Gentiles?", "\n…Jerusalem shall be trodden down of the Gentiles, until the times of the Gentiles be fulfilled.(Luke 21:24 b) In my last article I observed that the events of the past week may well lead to the complete fulfillment of several end […]\n\nThe following blog post was originally posted here: The Temple Mount; Why It took So long…\nBut if ye shall at all turn from following me, ye or your children, and will not keep my commandments and my statutes which I have set before you, but go and serve other gods, and worship them: Then […]\n\nThe following blog post was originally posted here: Rodney Howard-Browne; the meaning of Spiritual Drunkenness\nBe sober, be vigilant; because your adversary the devil, as a roaring lion, walketh about, seeking whom he may devour: Whom resist stedfast in the faith, knowing that the same afflictions are accomplished in your brethren that are in the […]\n\nThe following blog post was originally posted here: Rodney Howard Browne, The Heretic Who Laid hands On Trump…\nI was heartened the other day when I read that the President of the United States took time out of his busy schedule to allow an “Evangelical Minister” to lay hands on Him and pray. ", "He […]\n\nThe following blog post was originally posted here: A Jupiterian President?…The West in Prophecy pt 10\nFrench president Emmanuel Macron has declared he will govern France like Jupiter, the Roman king of the gods, shortly after officials told the media his thought process was “too complex” for journalists to understand.", "Summoning over 900 politicians from […]" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0012077294685990338, 0.004329004329004329, 0.004244482173174873, 0.003048780487804878, 0 ]

[ "---\nabstract: 'The neutron-rich nuclei $^{109}$Pd and $^{111}$Pd were produced as fission fragments following the $^{30}$Si + $^{168}$Er reaction at 142 MeV. Using the identification based on the coincidences with the complementary fission fragments, the only positive-parity bands observed so far in $^{109}$Pd and $^{111}$Pd emerged from this work. ", "A band, built on top of the 5/2$^+$ ground state exhibiting $\\Delta I$ = 1 energy-level staggering, was observed in each of these nuclei. ", "Both nuclei of interest, $^{109}$Pd and $^{111}$Pd, are suggested to lie in the transitional region of Pd isotopes of maximum $\\gamma$-softness. ", "The ground states of both nuclei are predicted by TRS calculations to be extremely $\\gamma$-soft with shallow triaxial minima. ", "The first crossing in the new bands is proposed to be due to an alignment of $h^2_{11/2}$ neutrons.'", "\nauthor:\n- 'E.A. Stefanova$^1$[^1], S. Lalkovski$^2$, A. Korichi$^3$, T. Kutsarova$^1$, A. Lopez-Martens$^3$, F.R. Xu$^4$, H.L. Liu$^4$, S. Kisyov$^2$, A. Minkova$^2$, D. Bazzacco$^5$, M. Bergström$^6$, A. Görgen$^7$[^2], F. Hannachi$^3$[^3], B. Herskind$^6$, H. Hübel$^7$, A. Jansen$^7$, T. L. Khoo$^8$, Zs.", " Podolyák$^9$[^4], and G. Schönwasser$^7$'\nbibliography:\n- 'tf.bib'\ntitle: 'Observation of Positive-Parity Bands in $^{109}$Pd and $^{111}$Pd: Enhanced $\\gamma$-Softness'\n---\n\nIntroduction\n============\n\nThe investigated in the present study $^{109}$Pd and $^{111}$Pd belong to the region of the neutron-rich nuclei with $A \\approx$ 100 (38,40 $\\le$ $Z \\le$ 50, $N >$ 56). ", "The nuclei in this region are known to exhibit a variety of structural phenomena and shapes and were for example a subject of detailed theoretical study by the Nilsson-Strutinski calculations with cranked Woods-Saxon average potential in Ref. [", "@ska97]. ", "The neutron-rich nuclei in this region undergo transition from nearly spherical vibrational to deformed rotational character. ", "This transition is known to be more abrupt in Sr and Zr isotopes than for example in Mo, Ru and Pd isotopes [@hot91]. ", "Due to the scarcity of experimental information, the gradual character of the deformation development transition in the Pd isotopes is still under investigation. ", "The calculations cited above [@ska97] predict that the spherical-deformed shape transition goes through a region of $\\gamma$-softness in the chain of Pd isotopes. ", "Indeed, the $E(4_1^+)/E(2_1^+)$ ratios for $^{108}$Pd, $^{110}$Pd and $^{112}$Pd are close to the gamma-soft $O(6)$ limit of 2.5. ", "Furthermore, the energy staggering behavior of the $\\gamma$-bands in the Pd and Ru isotopes was investigated in details in Ref. [", "@lal03]. ", "It was concluded that $^{108,110,112}$Pd are softer than $^{114,116}$Pd and that Pd isotopes are softer than Ru isotopes [@lal03]. ", "The present study of $^{109}$Pd and $^{111}$Pd is intended to shed more light on the question of $\\gamma$-softness in the chain of Pd isotopes. ", "Moreover, both nuclei may be expected to form the region of maximum $\\gamma$-softness for the Pd chain of isotopes.", "\n\nPrior to the present work, a search for band structures in the neutron-rich nuclei $^{109}$Pd and $^{111}$Pd was performed using a fusion-fission reaction [@kut98] and the negative-parity $\\nu(h_{11/2})$ bands were identified. ", "The first crossing is proposed to be a result of $\\nu(h_{11/2})^2$ alignment, which stabilizes the prolate shape [@kut98]. ", "How to understand that in the light of the expected enhanced $\\gamma$-softness? ", "The situation was expressed in Ref. [", "@kru99] as “a prolate, but still $\\gamma$-soft shape is stabilized with increased rotational frequency” in $^{110,112,114,116}$Pd isotopes. ", "The basis of this assumption are cranked Woods-Saxon and total Routhian surface (TRS) calculations [@kru99]. ", "With respect to the first band crossings in Pd isotopes heavier than $^{111}$Pd, which was argued to be due to a pair of $h_{11/2}$ neutrons or $g_{9/2}$ protons, the recent studies definitely agrees on $h_{11/2}^2$ neutrons alignment. ", "Indeed, that is the case with the $h_{11/2}$ bands in $^{111,113,115}$Pd [@kut98; @kru99; @hou99; @zha99] and with the ground-state bands in $^{112,114,116,118}$Pd [@lal03; @hou99; @zha01].", "\n\nMost of the nuclei in the discussed region are neutron rich and are not accessible through conventional fusion-evaporation in-beam techniques. ", "Therefore, the experimental information is incomplete, even at low spin. ", "Before the present study, the information on the positive-parity states in $^{109}$Pd and $^{111}$Pd was limited to a very few low-energy levels with no connections in a band structure. ", "Positive-parity bands built on the 5/2$^+$ ground states were observed in $^{101,103}$Pd [@ric73; @nya99], $^{105}$Pd [@ric77], $^{107}$Pd [@poh96] as well as in $^{113,115}$Pd [@zha99], but not in $^{109}$Pd and $^{111}$Pd. ", "Filling this gap of experimental information may shed light on the deformation evolution of the positive-parity ground-state bands through the transitional region. ", "Considering that this is expected to be a region of maximum $\\gamma$-softness for the transitional Pd isotopes, the observation of these structures is important for understanding the whole transitional region.", "\n\nThe aim of the present work was to find positive-parity bands in $^{109}$Pd and $^{111}$Pd in order to fill up the gap of missing experimental information. ", "Furthermore, to investigate how these nuclei behave in the expected region of maximum $\\gamma$-softness from one hand and a prolate driving alignment of a pair of $h_{11/2}$ neutrons on the other hand.", "\n\nExperiment and analysis {#sec:exp}\n=======================\n\nExcited states in the neutron-rich nuclei $^{109}$Pd and $^{111}$Pd were populated via an induced fusion-fission channel of the $^{30}$Si + $^{168}$Er reaction. ", "Excited yrast states of $^{98,100,102}$Mo, produced also as fission fragments in the same experiment, were already studied and published [@lal07]. ", "The beam of $^{30}$Si at an energy of 142 MeV was provided by the XTU tandem accelerator at the Legnaro National Laboratory. ", "Prompt $\\gamma$ rays emitted from the excited nuclei were detected with the EUROBALL III [@sim97] multidetector array consisted of 30 single HpGe Compton-shielded detectors, 26 Clover [@duc99] and 15 Cluster [@ebe90] composite Compton-shielded detectors. ", "The $^{168}$Er target foil of 1.15 mg/cm$^2$ thickness was evaporated on a 9 mg/cm$^2$ gold backing, in which the recoiling nuclei were slowed down and finally stopped. ", "Events were collected with the requirement that at least five unsuppressed Ge detectors fired in coincidence. ", "A total of about 2$\\cdot$10$^9$ three- and higher-fold events were recorded. ", "In the off-line analysis two $E_{\\gamma}$-$E_{\\gamma}$-$E_{\\gamma}$ cubes with energy ranges up to 4 MeV and up to 1 MeV, respectively, were sorted using the RADWARE package [@rad95]. ", "Triple gamma-ray coincidence spectra were then produced by setting double gates on the $E_{\\gamma}-E_{\\gamma}-E_{\\gamma}$ cubes.", "\n\nIn order to search for new transitions in $^{109}$Pd and $^{111}$Pd, populated as fission fragments, we examined spectra double gated on low-lying transitions in the complementary fission fragments $^{84,82}$Kr, respectively. ", "They clearly revealed the transitions of the even-even neighbors $^{108,110}$Pd in the $^{84}$Kr spectra and $^{110,112}$Pd in the $^{82}$Kr spectra, observed in the $6n$ and $4n$ channels, respectively. ", "The transitions from the previously known negative-parity $\\nu(h_{11/2})^2$ bands [@kut98] were seen in the respective $5n$ channels, confirming the observation of the odd Pd isotopes. ", "The structures built on the ground states in the odd-mass Pd isotopes are expected to be populated weaker than the yrast $\\nu(h_{11/2})^2$ bands. ", "Indeed, the data confirmed this expectation. ", "In $^{109}$Pd, only the 276 keV transition and 597 level were known [@nds109Pd]. ", "In order to identify the states above the known low-energy positive-parity levels, double gates on one of these transitions with the lowest-lying yrast transitions in the complementary Kr isotopes were created. ", "A sample spectrum, double gated on the 276 keV transition from $^{109}$Pd and on the 882 keV transition from $^{84}$Kr, is shown in Fig. ", "\\[fig:PdKr\\]. ", "Three transitions (230, 293, 523 keV) were observed previously [@nds111Pd] in $^{111}$Pd. ", "In this case, a double gate on 230 and 293 keV transitions, known to be in coincidence, was used in addition to cross-double gates on the known transitions in $^{111}$Pd and on the transitions of Kr isotopes to identify new transitions in $^{111}$Pd. ", "Although the new transitions are weak and the spectra are contaminated, the coincidences were unambiguous and level schemes of the positive-parity structures in $^{109,111}$Pd are constructed.", "\n\nThe low statistics does not allow the deduction of relative $\\gamma$-ray intensities with reasonable precision for the observed transitions in $^{109,111}$Pd. ", "In order to study the levels decay branches further experiments are needed.", "\n\nThe spin and parity assignments are based on the previously known adopted values for the lowest-lying excited positive-parity states [@nds109Pd; @nds111Pd], systematics of the neighboring nuclei and on the fact that well defined band structures, with $\\Delta I$ = 2 and $\\Delta I$ = 1 transitions, are developed on top of them. ", "Based on all that, the spin and parity assignments can be done unambiguously.", "\n\nExperimental results\n====================\n\nPositive-parity rotational (quasi-rotational) bands were observed for the first time in $^{109}$Pd and $^{111}$Pd in the present work and are shown in Figs. ", "\\[fig:schemep109\\] and \\[fig:schemep111\\]. ", "Low-lying negative-parity yrast bands in both nuclei were previously observed in [@kut98] and are displayed in Fig. ", "\\[fig:schemenPd\\]. ", "They are given for completeness.", "\n\nPositive-parity band in $^{109}$Pd\n----------------------------------\n\nNo band structures built on the two known low-lying positive-parity states were observed in $^{109}$Pd before the present study. ", "The first 7/2$^+$ and (9/2$^+$) states at energies of 276 keV and 597 keV, respectively, were observed previously as single not connected levels. ", "A positive-parity band, with two signature partners developing on both these states, was observed in the present experiment as presented in Fig. ", "\\[fig:schemep109\\]. ", "The 7/2$^+$ state at 276 keV, as well as the one at 597 keV assumed to be with spin and parity of 7/2$^+$ or 9/2$^+$, were firstly observed by M. Kanazawa et al. [", "@kan78] in $\\beta$$^-$-decay experiment. ", "The 7/2$^+$ state together with the 276 keV transition depopulating it to the ground state were also observed by Casten et al. [", "@cas80] in $(n,\\gamma)$ experiment, while a 596(4) keV state was observed in $(d,t)$ experiment [@die70] with an assignment of 7/2$^+$. The 597 keV transition was not observed before the present study. ", "We assign (9/2$^+$) to the 597 keV state based on the band structure observed. ", "Based on the fact that a rotational (quasi-rotational) band is observed, the previously existed experimental assignment of 7/2$^+$ for the 276 keV state as well as systematics of the ground-state bands in the region, the spin and parity of all levels can be proposed quite unambiguously. ", "Three sample spectra double gated on the 276-321 keV, 276-728 keV and on the 310-728 keV transitions are shown in Fig. ", "\\[fig:spectra109\\].", "\n\nPositive-parity band in $^{111}$Pd\n----------------------------------\n\nNo positive-parity rotational band was observed in $^{111}$Pd before the present experimental study. ", "Only two excited positive-parity states were known in $^{111}$Pd prior to the present study, but not with the assigned spin and parity. ", "A rotational band, with two signature partners developing on the two known levels, was extracted from the present experimental data and presented in Fig. ", "\\[fig:schemep111\\]. ", "The state at 230 keV was previously observed in $(d,p)$, $\\beta$$^-$-decay and $(n,\\gamma)$ experiments with possible spin and parity assignments of 7/2$^+$ or 9/2$^+$ [@nds111Pd]. ", "The 230 keV transition depopulating it to the ground state was also observed [@nds111Pd]. ", "The level at 523 keV was observed before in $\\beta$$^-$-decay experiments [@nds111Pd]. ", "However, no spin assignment was adopted for it [@nds111Pd]. ", "The 293 keV and 523 keV transitions depopulating the state at 523 keV to the 230 keV level and to the ground state, respectively, were also known [@nds111Pd]. ", "Based on the observed rotational (quasi-rotational) band structure with $\\Delta I$ = 1 and $\\Delta I$ = 2 transitions and on the systematics of the ground-state bands in the region, the spins and parities of the observed states can be assigned quite unambiguously. ", "Two sample spectra double gated on the 230-570 keV transitions and on the 277-657 keV transitions are shown in Fig. ", "\\[fig:spectra111\\].", "\n\n![", "\\[fig:spectra109\\] Sample spectra double gated on the 276-321 keV, 276-728 keV and on the 310-728 keV transitions in $^{109}$Pd. ", "The lines marked with asterisks $(*)$ are from contaminants.](109-111Pd-fig5.ps){height=\"14.0cm\"}\n\nDiscussion\n==========\n\nA region of $\\gamma$-softness\n-----------------------------\n\nThe nuclei $^{109}$Pd and $^{111}$Pd lie in the transitional region between vibrational and rotational nuclei. ", "It is known that this transition from sphericity to deformation in the Pd isotopes is more gradual than it is in the Sr and Zr isotopes [@hot91], which form one of the border at $N =$ 50 and $Z =$ 38,40 of the neutron-rich $A \\approx$ 100 region. ", "As it is also studied [@ska97], this transition in palladium goes rather through $\\gamma$-softness than just through softness to axial quadrupole deformation. ", "Taking into account that it is not straight forward to distinguish between triaxiality and $\\gamma$-softness experimentally, the appearance of stable triaxiality is also possible. ", "The ratios of $E(4_1^+)/E(2_1^+)$ is 2.42 for $^{108}$Pd [@nds108Pd] and 2.46 for $^{110}$Pd [@nds108Pd]. ", "These values are very close to the ones predicted by the IBM-2 model value of 2.5 for a $\\gamma$-soft $O(6)$ rotor. ", "Additional arguments may come from the investigation of the $\\gamma$-bands in the region. ", "In principle, an odd-even energy-level staggering in a $\\gamma$-band is known to be a sign of a non-axial shape (soft or rigid) [@cas00]. ", "The staggering effect has been analyzed in a framework of a ground-state band and a $\\gamma$-band interaction (see for example [@min00] and references therein). ", "Such an energy staggering was actually observed. ", "The levels of the $\\gamma$-bands in $^{108}$Pd [@lal03], $^{110}$Pd [@lal03], $^{112}$Pd [@kru01] are grouped as 2$^+$, (3$^+$,4$^+$), (5$^+$,6$^+$) and etc., ", "which is consistent with $\\gamma$-soft behavior accordingly to the model of Wilets and Jean [@wil56]. ", "On the contrary, the Davidov’s model describing rigid triaxiality predicts the levels of the $\\gamma$-band to be grouped as (2$^+$,3$^+$), (4$^+$,5$^+$) and etc. [", "@dav58]. ", "The 2$^+$, (3$^+$,4$^+$), (5$^+$,6$^+$) spacing has its maximum expression in the Pd isotopic chain in $^{110}$Pd, while in the $\\gamma$-bands of the even-even isotopes lighter than $^{108}$Pd and heavier than $^{112}$Pd, the level spacing is going towards more equidistant or regular distribution. ", "Such behaviors suggest more axially symmetric quasi-rotations (with quadrupole vibrational mixing) from one hand or more rigid axial symmetry rotations on the other hand.", "\n\nThe $\\gamma$-bands in the transitional Pd region were systematically discussed in [@lal03] and compared with the $\\gamma$-bands systematics in corresponding Ru isotones. ", "Similarly, $\\gamma$-softness rather than rigid triaxiality was suggested. ", "The staggering effect was studied. ", "It revealed that the energy staggering in $^{108}$Pd, $^{110}$Pd and $^{112}$Pd has a larger amplitude that in the neighboring Pd isotopes. ", "While the $\\gamma$-bands are not so well developed in $^{102,104,106}$Pd as in the heavier Pd isotopes, the amplitude of the staggering effect decreases in $^{114}$Pd and $^{116}$Pd [@lal03]. ", "It was concluded that $^{114,116}$Pd are not so soft as $^{108}$Pd, $^{110}$Pd and $^{112}$Pd as well as that the Pd isotopes are softer than Ru isotopes [@lal03]. ", "The experimentally observed decrease in the energy of the 2$^+$ states (see Fig. ", "6 in [@lal03]) of the $\\gamma$-bands from 1128 keV in $^{106}$Pd (N=60) to 695 keV in $^{114}$Pd (N=68) was suggested to be due to an increase of collectivity [@lal03]. ", "Beyond $^{114}$Pd, the energy of the 2$_2^+$ state increases again. ", "Similar is the behavior of the 2$_1^+$ states, which energies decrease up to $^{114}$Pd ($N=68$) and then increase again. ", "The ratio $E4_1^+/E2_1^+$ also reaches its maximum of 2.6 at $N = 68$. The behavior of $^{114}$Pd may have midshell effects origin as $N = 68$ is approximately between $N$ = 50 and $N$ = 82.", "\n\nIn agreement with the above discussion based on experimental observables, the Pd isotopes are also predicted to be $\\gamma$-soft at ground state by the Nilsson-Strutinski calculations [@ska97]. ", "In Ref. [", "@kru99], TRS calculations using Woods-Saxon potential as well as Ultimate Cranker were performed for the even-even Pd isotopes from $^{110}$Pd to $^{116}$Pd. ", "Both type of calculations predict $\\gamma$-softness at low-rotational frequencies.", "\n\nThus, one may expect a significant degree of $\\gamma$-softness at low energies and angular momenta for the nuclei of interest, $^{109}$Pd and $^{111}$Pd. ", "Moreover, according to the behavior of the $\\gamma$-bands in the even-even Pd isotopes, one may suggest that both nuclei lie in the region of maximum $\\gamma$-softness. ", "This suggestion is also supported by the TRS calculations [@wys88] reported below.", "\n\nNegative-parity bands in $^{109}$Pd and $^{111}$Pd\n--------------------------------------------------\n\nThe only rotational structures in $^{109}$Pd and $^{111}$Pd observed before the present study were the negative-parity bands built on the low-lying 11/2$^-$ isomer [@kut98] (see Fig. ", "\\[fig:schemenPd\\]). ", "They were interpreted as built on an orbital in the middle of $h_{11/2}$ neutron subshell with a prolate deformation [@kut98]. ", "Analogous bands were observed in the neighboring odd-mass Pd isotopes as for example in $^{105}$Pd [@ric77], $^{107}$Pd [@poh96], $^{113}$Pd [@kru99; @hou99; @zha99; @fon05], $^{115}$Pd [@kru99; @zha99; @hou99; @fon05]. ", "They appear as quasi-rotationally aligned except for the ones in $^{109}$Pd [@kut98] and $^{113}$Pd [@hou99], where the signature partner was observed. ", "The $\\Delta I$ = 1 staggering of the level energies of the signature partners suggests kind of semi-decoupled or so called Coriolis-distorted structures. ", "It has not been possible so far, to investigate on the origin of the different band behavior observed in $^{109}$Pd and $^{113}$Pd and in the other odd-even isotopes. ", "It could be that the second partners were just not observed in the other isotopes or that they appear, forming a $\\Delta I$ = 1 band staggering pattern, only in the region of maximum $\\gamma$-softness. ", "In the latter case, as $^{111}$Pd lies in this region of maximum $\\gamma$-softness, the second signature partner, energetically shifted towards the first one, may be expected here as well. ", "An attempt to search for it in our data was unsuccessful, probably due to the low statistics.", "\n\nThe $h_{11/2}$ bands in the odd-mass Pd isotopes from $^{107}$Pd to $^{115}$Pd show the first band crossing at a frequency of about 0.47 MeV [@poh96; @kut98; @hou99; @kru99; @zha99], suggesting similar crossing nature for all of them. ", "It is at about 0.56 MeV in $^{105}$Pd [@ric77] explained as a result of its smaller deformation [@ric77; @poh96]. ", "The crossing in the odd-mass isotopes is delayed with respect to the first crossing ($\\approx$ 0.35 MeV) in the neighboring even-mass Pd isotopes, explained to be due to a blocking effect caused by the $h_{11/2}$ neutron. ", "Therefore, the alignment of $h^2_{11/2}$ neutrons rather than $g^2_{9/2}$ protons, which was the alternative interpretation, was proposed to be the nature of this crossing in the odd-mass Pd isotopes (see e.g. [@poh96; @kut98; @hou99; @kru99; @zha99]) and in the even-mass Pd isotopes $^{108}$Pd [@poh96; @reg97; @lal03], $^{110}$Pd [@hou99; @lal03], $^{112,114,116,118}$Pd [@hou99; @zha01]. ", "Additional arguments supporting the $h^2_{11/2}$ neutron alignment comes for example from CSM calculations [@reg97] and TRS calculations [@poh96] performed for $^{108}$Pd, and cranked-HFB for $^{112}$Pd [@hou99].", "\n\nIt is known that the alignment of $h^2_{11/2}$ neutrons drives the nucleus towards prolate shape. ", "Indeed, in the mentioned above calculations, prolate driving force is predicted by the CSM and cranked-HFB models for the aligned pair of $h_{11/2}$ neutrons. ", "At the same time, Nilsson-Strutinski calculations [@ska97] predict very $\\gamma$-soft potential for the transitional Pd nuclei. ", "The TRS calculations for $^{108}$Pd [@poh96] also show a shallow prolate minimum, soft with respect to $\\gamma$- and $\\beta$-deformation at $\\hbar w =$ 0 MeV. With an increase of the rotational frequency the minimum moves towards soft non-axial deformation. ", "Then, the alignment of $h_{11/2}$ pair of neutrons stabilizes the prolate shape, but the potential surface is still quite soft towards $\\beta$- and $\\gamma$-deformation [@poh96]. ", "The performed TRS calculations for $^{110}$Pd (not shown) revealed that the potential is more $\\gamma$-soft than that in $^{108}$Pd. ", "Kruecken et al. [", "@kru99], reported on TRS calculations for the even-even isotopes $^{110,112,114,116}$Pd. ", "They predict very $\\gamma$-soft minima at low rotational frequency. ", "After the alignment of the $h_{11/2}$ pair of neutrons, the prolate but otherwise $\\gamma$-soft shape is going towards stabilization [@kru99]. ", "Will a shallow prolate minimum of a very $\\gamma$-soft potential be the case of $^{109}$Pd and $^{111}$Pd as well?", "\n\nIn Fig. ", "\\[fig:TRSn\\], TRS calculations [@wys88] for the negative-parity bands built on the 11/2$^-$ states in $^{109}$Pd and $^{111}$Pd are shown. ", "The calculations were performed separately for both signatures in both nuclei. ", "At $\\hbar w =$ 0.100 MeV, the $\\alpha$ = +1/2 signature partner in $^{109}$Pd is calculated with a shallow minimum at $\\gamma$ = +24$^{\\circ}$, while the $\\alpha$ = -1/2 signature partner is at $\\gamma$ = -21$^{\\circ}$. Both surfaces reveal pronounced $\\gamma$- and $\\beta$-softness. ", "The described pictures persist in both nuclei up to around the frequency at which the crossing is expected. ", "It must be noted that both minima lie within a shallow $\\gamma$-soft valley between $\\gamma$ $\\approx$ +30$^{\\circ}$ to $\\gamma$ $\\approx$ -30$^{\\circ}$. Interpreting the calculations one shall consider that the minima are very shallow and the energy potential surface is predicted very soft and they may be very sensitive to the calculation parameters. ", "Indeed, the average $\\gamma$-deformation of both minima is $\\gamma$ $\\approx$ 0$^{\\circ}$, which corresponds to a prolate shape. ", "On the other hand, a non-axial very $\\gamma$-soft shape is predicted for the branches itself. ", "This behavior can be described as two different shallow potential wells almost symmetrically displaced from $\\gamma$ = 0$^{\\circ}$ for both signatures. ", "The very low barrier between them would easily allow a change of the $\\gamma$-deformation. ", "Although only $\\alpha$ = -1/2 signature was observed in $^{111}$Pd, calculations for both band signatures are presented in Fig. ", "\\[fig:TRSn\\]. ", "A pronounced $\\gamma$-deformation is predicted for both signatures and, especially for $\\alpha$ = -1/2 one, at $\\hbar w =$ 0.100 MeV with $\\gamma$ = -28$^{\\circ}$ and $\\beta_2$ = 0.248. ", "Independently of the softness of the potential with very shallow minima and of the uncertainties of the present calculations, the TRS calculations reveal a different picture for $^{109}$Pd and $^{111}$Pd than for $^{107}$Pd for example. ", "While the TRS calculations predict $\\gamma$-soft prolate minima for this band in $^{107}$Pd (not presented), $^{109}$Pd and $^{111}$Pd are predicted quite $\\gamma$-soft with non-axial minima.", "\n\n![", "\\[fig:TRSn\\] Total Routhian surface calculations for the negative-parity bands in $^{109}$Pd and $^{111}$Pd. ", "Contour lines are in 200 keV increment. (", "a) $^{109}$Pd, (-,+1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.243, $\\gamma$ = +24$^{\\circ}$; (b) $^{109}$Pd, (-,+1/2), $\\hbar w$ = 0.400 MeV, $\\beta_2$ = 0.249, $\\gamma$ = -20$^{\\circ}$; (c) $^{109}$Pd, (-,-1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.236, $\\gamma$ = -21$^{\\circ}$; (d) $^{109}$Pd, (-,-1/2), $\\hbar w$ = 0.400 MeV, $\\beta_2$ = 0.215, $\\gamma$ = +17$^{\\circ}$; (e) $^{111}$Pd, (-,+1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.262, $\\gamma$ = -20$^{\\circ}$; (f) $^{111}$Pd, (-,+1/2), $\\hbar w$ = 0.350 MeV, $\\beta_2$ = 0.269, $\\gamma$ = -21$^{\\circ}$; (g) $^{111}$Pd, (-,-1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.248, $\\gamma$ = -28$^{\\circ}$; (h) $^{111}$Pd, (-,-1/2), $\\hbar w$ = 0.350 MeV, $\\beta_2$ = 0.255, $\\gamma$ = -26$^{\\circ}$.](109-111Pd-fig7.ps){height=\"16.0cm\"}\n\nThe TRS calculations do predict a band crossing with $h^2_{11/2}$ neutrons in agreement with the above discussion. ", "The alignment of the $h_{11/2}$ pair of neutrons in $^{109}$Pd moves the minimum in the $\\alpha$ = +1/2 signature branch from $\\gamma$ = +24$^{\\circ}$ to $\\gamma$ = -20$^{\\circ}$, while the opposite (minimum moves from $\\gamma$ = -21$^{\\circ}$ to $\\gamma$ = +17$^{\\circ}$) is predicted for the $\\alpha$ = -1/2 signature. ", "The potential is still very $\\gamma$-soft. ", "In $^{111}$Pd, on the other hand, the $\\gamma$ $\\approx$ -28$^{\\circ}$ minimum of the $\\alpha =$ -1/2 signature persists through the alignment of the $h_{11/2}^2$ neutrons. ", "The TRS calculations predict both signatures in $^{111}$Pd with similar $\\gamma$-deformation, less $\\gamma$-softness and a stronger $\\beta_2$ deformation due to the alignment of $h_{11/2}^2$ neutrons. ", "Thus, the alignment of $h_{11/2}^2$ neutrons stabilizes the triaxial minimum at negative $\\gamma$-deformation in $^{111}$Pd. ", "Prolate and not so soft shapes are calculated for both nuclei at higher frequency ($\\hbar w =$ 0.600 MeV) and angular momentum.", "\n\nPositive-parity bands in $^{109}$Pd and $^{111}$Pd\n--------------------------------------------------\n\nIn the present experiment, the ground-state positive-parity bands were observed in $^{109}$Pd and in $^{111}$Pd. ", "They exhibit energy-staggered $\\Delta I$ = 1 transitions and thus, appear as semi-decoupled bands. ", "Reasons for an energy-staggered appearing of a band can be due to a band mixing, Coriolis distortion due to high-$j$ orbital, $\\gamma$-softness, triaxiality. ", "The observed bands pattern may be explained by the $\\gamma$-softness of $^{109}$Pd and $^{111}$Pd. ", "However, analogous bands, on top of the 5/2$^+$ ground state with two energetically-staggered signature partners, were also observed in $^{101}$Pd [@ric73], $^{103}$Pd [@nya99], $^{105}$Pd [@ric77], $^{113}$Pd [@zha99], $^{115}$Pd [@zha99]. ", "The $\\Delta I$ = 1 staggering of this band in $^{101}$Pd [@ric73] for example can not be explained by $\\gamma$-softness as this nucleus is expected to be more $\\beta$-soft rather than $\\gamma$-soft. ", "It may be rather due to a band mixing for instance. ", "It can be seen from the level schemes of these nuclei that bands or levels which may cause band mixing have, indeed, been observed. ", "In the heavier $^{113}$Pd, on the other hand, the positive-parity band may be explained by $\\gamma$-softness. ", "Again, we have performed TRS calculations for the ground state of $^{113}$Pd and they clearly show this nucleus being considerably $\\gamma$-soft. ", "In $^{107}$Pd [@poh96], on the other hand, a strongly populated band (band 4) looking like a quasi-rotationally aligned was observed. ", "The TRS calculations for this band (not shown) reveal a $\\gamma$-soft prolate minimum for the $\\alpha$ = -1/2 signature and a nearly prolate $\\gamma$-soft minimum with $\\gamma =$ 10$^{\\circ}$ for the $\\alpha =$ +1/2 signature. ", "Thus, the calculations predict a signature splitting. ", "A more detailed theoretical study is needed in order to explain the behavior of the positive-parity ground-state bands in the chain of the odd-A Pd isotopes.", "\n\nWhile $^{107}$Pd is predicted to be moderately $\\gamma$-soft at its ground state, but still around prolate deformation by the TRS calculations, the TRS plots presented in Fig. ", "\\[fig:TRSp\\] for $^{109}$Pd and $^{111}$Pd draw a long valley from $\\gamma =$ 60$^{\\circ}$ till $\\gamma =$ -120$^{\\circ}$ revealing extreme $\\gamma$-softness (especially for $^{111}$Pd). ", "Indeed, the nucleus $^{109}$Pd at ground state looks considerably $\\gamma$-soft with a minimum at $\\gamma = -20^{\\circ}$ and extreme $\\gamma$-softness with a minimum at $\\gamma = -30^{\\circ}$ is seen for $^{111}$Pd. ", "The corresponding predominant configurations are calculated to be $d_{5/2}$ neutrons for $^{109}$Pd and $g_{7/2}$ neutrons for $^{111}$Pd. ", "These minima in both nuclei persist up to around the crossing with $h_{11/2}$ pair of neutrons. ", "Calculations were performed separately for both signature partners of these bands in $^{109}$Pd and $^{111}$Pd as shown in Fig. ", "\\[fig:TRSp\\]. ", "The signature partners have almost the same deformation up to the crossing.", "\n\n![", "\\[fig:TRSp\\] Total Routhian surface calculations for the positive-parity bands in $^{109}$Pd and $^{111}$Pd. ", "Contour lines are in 200 keV increment. (", "a) $^{109}$Pd, (+,+1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.256, $\\gamma$ = -19$^{\\circ}$; (b) $^{109}$Pd, (+,+1/2), $\\hbar w$ = 0.350 MeV, $\\beta_2$ = 0.245, $\\gamma$ = -21$^{\\circ}$; (c) $^{109}$Pd, (+,-1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.253, $\\gamma$ = -20$^{\\circ}$; (d) $^{109}$Pd, (+,-1/2), $\\hbar w$ = 0.350 MeV, $\\beta_2$ = 0.191, $\\gamma$ = +7$^{\\circ}$; (e) $^{111}$Pd, (+,+1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.246, $\\gamma$ = -29$^{\\circ}$; (f) $^{111}$Pd, (+,+1/2), $\\hbar w$ = 0.350 MeV, $\\beta_2$ = 0.244, $\\gamma$ = -31$^{\\circ}$; (g) $^{111}$Pd, (+,-1/2), $\\hbar w$ = 0.100 MeV, $\\beta_2$ = 0.244, $\\gamma$ = -30$^{\\circ}$; (h) $^{111}$Pd, (+,-1/2), $\\hbar w$ = 0.350 MeV, $\\beta_2$ = 0.204, $\\gamma$ = -9$^{\\circ}$.](109-111Pd-fig8.ps){height=\"16.0cm\"}\n\nThe alignments, $i_x$, of the newly observed positive-parity bands in $^{109}$Pd and $^{111}$Pd and for those in the neighboring isotopes $^{108}$Pd and $^{110}$Pd are presented in Fig. ", "\\[fig:alignment\\]. ", "The staggering pattern of the levels within the bands suggest that $K$ changes within the bands. ", "However, the behavior of the $i_x$ does not change strongly with $K$ and $K =$ 5/2 is used for both nuclei. ", "It is seen that the crossing in $^{109}$Pd occurs at around 0.35 MeV, which is at about the same frequency as in the even-even Pd neighbors. ", "This behavior is consistent with an alignment of a pair of $h_{11/2}$ neutrons, as no blocking is expected in these bands. ", "It cannot be seen in $^{111}$Pd in the present data. ", "Similarly, the first crossings in the bands on top of the 5/2$^+$ ground states in $^{107}$Pd [@poh96] and $^{113}$Pd [@zha99] are observed at $\\hbar w$ $\\approx$ 0.32 MeV. In both nuclei, the crossing was interpreted as caused by an alignment of $h^2_{11/2}$ neutrons. ", "In agreement, an alignment of $h_{11/2}$ pair of neutrons is predicted by the TRS calculations for the positive-parity bands in $^{109}$Pd and $^{111}$Pd. ", "The calculations predict that the alignment of the $h_{11/2}$ neutron pair (at frequency about 0.300 MeV) forces the $\\alpha$ = -1/2 signature partners in $^{109}$Pd and $^{111}$Pd towards more $\\gamma$-stable near prolate shape. ", "However, the $\\alpha$ = +1/2 signature partners in both nuclei are predicted to preserve and actually to stabilize the triaxial deformation. ", "Thus, a more stable triaxiality is predicted at higher spin. ", "Experimental observation of the bands at higher spins in future experiments may allow to test this predictions. ", "A negative-parity band with two signature partners connected with staggered $M1$ transitions was observed at higher excitation energies in $^{112}$Pd [@kru01]. ", "TRS calculations also predict possibly a triaxial shape for this band [@kru01].", "\n\n![", "\\[fig:alignment\\] (color online) Experimental alignments $i_x$ for the ground-state positive-parity bands in $^{109}$Pd and $^{111}$Pd and compared to the $i_x$ for the ground-state positive-parity bands in the neighboring even-even $^{108}$Pd and $^{110}$Pd isotopes. ", "The Harris parameters used were $J_0$ = 5$\\hbar^2$/MeV and $J_1$ = 16$\\hbar^4$/MeV$^3$. For the bands in $^{109}$Pd and $^{111}$Pd, $K$ = 5/2 was used. ", "The letters A, B correspond to the band signature partners labels used on the level schemes.](109-111Pd-fig9.eps){height=\"10.0cm\"}\n\nThus, basically all experimental observables, calculations and arguments suggest that $^{109}$Pd and $^{111}$Pd, probably together with $^{113}$Pd, lie in the region of maximum $\\gamma$-softness for the transitional region of Pd isotopes. ", "The alignment of $h_{11/2}$ pair of neutrons is predicted by the TRS calculations to drive the nuclei towards more stable deformation, prolate or even triaxial.", "\n\nSummary\n=======\n\nThe neutron-rich nuclei $^{109}$Pd and $^{111}$Pd were produced as fission fragments at high-excitation energies and angular momentum through the induced fusion-fission reaction $^{30}$Si + $^{168}$Er at a beam energy of 142 MeV. The beam of $^{30}$Si was provided by the XTU tandem accelerator at the Legnaro National Laboratory. ", "Although few low-lying positive-parity states were known before the present study, no band structures built on them were observed. ", "Positive-parity bands in $^{109}$Pd and $^{111}$Pd were observed for the first time in this work and reasonable spin and parities assignments could be made.", "\n\nIt was concluded that $^{109}$Pd and $^{111}$Pd, together with $^{113}$Pd, lie in the transitional Pd region where maximum $\\gamma$-softness is expected to occur. ", "Indeed, the nuclei $^{109}$Pd and $^{111}$Pd are predicted to be $\\gamma$-soft with shallow triaxial minima for the lowest-lying states of the observed negative-parity as well as positive-parity bands by the TRS calculations. ", "An extreme $\\gamma$-softness is predicted for $^{111}$Pd. ", "The TRS calculations do confirm the proposed alignment of $h_{11/2}^2$ neutrons [@kut98] for the negative-parity bands built on the $11/2^-$ states in both nuclei. ", "However, the stabilization towards prolate shape is predicted at higher frequencies than the crossing, while the crossing itself goes through $\\gamma$-soft non-axial behavior. ", "The observed positive-parity bands in $^{109}$Pd and $^{111}$Pd appear like semi-decoupled bands, with a $\\Delta I$ = 1 level-energy staggering, which can be consistent with a $\\gamma$-soft potential [@cas00]. ", "The analogous band in $^{107}$Pd has a rotationally-aligned behavior while odd-even level-energy staggering is revealed for the analogous bands in lighter Pd isotopes ($^{101-105}$Pd). ", "Detailed theoretical studies are needed in order to explain the behavior of the positive-parity ground-state bands in the chain of Pd isotopes. ", "The first band crossing in the observed positive-parity bands of this work, is proposed to be caused by the alignment of the $h_{11/2}^2$ neutrons. ", "The calculations predict that this alignment drives one of the band signatures in both nuclei to a less $\\gamma$-soft near-prolate shape, while a stabilization of the triaxial shape is predicted for the other signature in both nuclei. ", "Further experiments are definitely needed in order to investigate on the predicted band signature splitting and also search for a possible stable triaxiality.", "\n\nThe authors would like to acknowledge the useful discussions with N. Minkov. ", "This work was partly supported from the Bulgarian National Science Fund, contract No: DMU02/1 and the collaboration agreement between Bulgarian Academy of Sciences-CNRS under contract No. ", "4847, and by the German BMBF under Contract No. ", "06BN109.", "\n\n[^1]: E-mail address: elenas@inrne.bas.bg\n\n[^2]: Present address: DAPNIA/SPhN, CEA-Saclay, Gif-sur-Yvette, France\n\n[^3]: Present address: Centre d’Etudes Nuclaires de Bordeaux-Gradignan, Gradignan, France\n\n[^4]: Present address: Department of Physics, University of Surrey, Guildford, GU27XH, UK\n" ]

{ "pile_set_name": "ArXiv" }

[ 0, 0, 0, 0, 0, 0.00974025974025974, 0.002688172043010753, 0.004098360655737705, 0.1111111111111111, 0, 0.025423728813559324, 0, 0.006134969325153374, 0, 0, 0.1111111111111111, 0.007633587786259542, 0, 0, 0.004366812227074236, 0.008130081300813009, 0, 0, 0.007142857142857143, 0.01834862385321101, 0, 0.037037037037037035, 0, 0, 0, 0.022222222222222223, 0, 0, 0, 0, 0.008968609865470852, 0.006802721088435374, 0.024, 0.0196078431372549, 0, 0.00909090909090909, 0, 0.005434782608695652, 0, 0, 0, 0.005405405405405406, 0, 0, 0.024691358024691357, 0.004739336492890996, 0.021897810218978103, 0, 0.022222222222222223, 0.00398406374501992, 0, 0, 0, 0.006060606060606061, 0, 0, 0, 0.017241379310344827, 0, 0, 0, 0.0136986301369863, 0.006896551724137931, 0, 0.018404907975460124, 0.024390243902439025, 0.0078125, 0.024752475247524754, 0.012658227848101266, 0, 0.025210084033613446, 0, 0, 0, 0.006493506493506494, 0, 0.016574585635359115, 0.022222222222222223, 0.011494252873563218, 0.016666666666666666, 0.025157232704402517, 0, 0.017241379310344827, 0, 0, 0.015503875968992248, 0, 0.004048582995951417, 0.006289308176100629, 0, 0.018867924528301886, 0, 0, 0.007246376811594203, 0.006211180124223602, 0, 0.018867924528301886, 0.029411764705882353, 0, 0.1111111111111111, 0, 0, 0.005813953488372093, 0, 0, 0, 0.005208333333333333, 0.006097560975609756, 0.012345679012345678, 0.029585798816568046, 0, 0, 0, 0.01020408163265306, 0, 0.0189873417721519, 0, 0, 0, 0.012195121951219513, 0.010416666666666666, 0, 0.015748031496062992, 0.045454545454545456, 0.013157894736842105, 0, 0, 0, 0, 0, 0.02109704641350211, 0.02631578947368421, 0, 0.030612244897959183, 0.018867924528301886, 0, 0.006289308176100629, 0.015625, 0.003875968992248062, 0.00558659217877095, 0, 0, 0.011235955056179775, 0, 0.006993006993006993, 0, 0.1, 0.007194244604316547, 0, 0, 0, 0, 0, 0, 0, 0, 0.0078125, 0, 0, 0, 0, 0, 0, 0.024390243902439025, 0.0011061946902654867, 0, 0, 0, 0, 0, 0, 0.0045871559633027525, 0, 0.006329113924050633, 0, 0.02074688796680498, 0.005025125628140704, 0, 0, 0, 0, 0.007462686567164179, 0, 0, 0, 0.0056179775280898875, 0.0053475935828877, 0, 0, 0, 0.0078125, 0.07142857142857142, 0, 0, 0, 0.024390243902439025, 0.0010277492291880781, 0, 0, 0, 0, 0, 0, 0.007407407407407408, 0, 0, 0, 0, 0, 0.00625, 0.012658227848101266, 0, 0, 0.006578947368421052, 0, 0, 0.005714285714285714, 0, 0, 0, 0, 0, 0.006097560975609756, 0, 0.004761904761904762, 0, 0, 0, 0, 0, 0.012658227848101266, 0.010638297872340425, 0, 0, 0.020134228187919462 ]

[ "The BSE Sensex opened at 17977, down 320 pts, while the Nifty opened at 5308, down 106 points. ", "The BSE Sensex is down nearly 1400 pts in just 3 days. ", "The Indian rupee opened at new record low of 63.76.", "\n\n3. ", "30 pm: Sensex closes in green, rupee recovers\n\nThe Indian markets closed in the green today even as the rupee hovered near 65. ", "The BSE sensex closed at18517.90, up 1.12 percent, while the Nifty closed at5471.75, up 1.17 percent.", "\n\nGlobal financial services major HSBC has downgraded Indian equities from \"overweight\" to \"neutral\" citing that the country would struggle to defend a falling currency and declining growth. \"", "We lower our weighting in India from overweight to neutral. ", "In our view, India will continue to struggle with the trade-off between defending a currency and supporting growth,\" HSBC said in a research note today. ", "CRISILexpects the rupee to recover from its current level and end fiscal 2013-14 at 60 per dollar.", "The rating agency says that the strengthening of rupee by March 2014 will be driven by two factors. \"", "First, we now expect the current account deficit (CAD) to fall to 3.9 per cent of GDP in 2013-14 compared with 4.8 per cent last year. ", "CAD is expected to correct significantly in the second half of the year due to a decline in non-oil imports, including gold. ", "Second, foreign capital inflows are expected to pick up in the second half of the year when the steps announced by the government to attract USD 11 billion in capital inflows (via foreign borrowings by state-owned financial institutions and public sector oil companies and measures to attract non-resident deposits) begin to materialize,\" CRISIL explained. ", "Stocks in news: Ranbaxy Laboratories closed o.08 percent down after thegovernment today said it has ordered the Drug Controller General of India (DCGI) to check the quality of drugs produced byRanbaxy and to ensure that the firm is following standard manufacturing norms at its various manufacturing plants. ", "Reliance Infrastructureshares surged 4 percent as the Maharashtra Electricity Regulatory Commission (MERC) allowed the company to recover Rs 925 crore arrears per year. ", "RIL stocks soared 1. ", "64 percent after the company announced it has discovered a new gas condensate off the east coast in the Cauvery basin along with itsUK-based partner British Petroleum.", "\n\n12. ", "25 pm:Nifty holds at 5400 amid volatility\n\nThe market is marginally in the green amid volatility in noon trade as it is consolidating at current levels sharp ups and downs seen from last Friday.", "\n\nThe BSE Sensex is at 18406.30, up 0.51 percent while the Nifty is at 5436.85, up 0.53 percent.", "\n\nSun Pharmaceutical Industries Ltd is up 1 percent after a competitor raised its revenue guidance, citing strong sale of a generic antibiotic also sold by Sun Pharma, reported Reuters.", "\n\nHikma Pharmaceuticals Plc on Wednesday raised its full-year revenue forecast for the third time in four months, riding on strong sales of generic antibiotic doxycycline, a drug used to prevent and treat malaria and other infections.", "\n\nAnalysts expect generic doxycycline to contribute around US$60-80 million in sales in FY14 for Sun Pharma.", "\n\nThe Indian rupee remained volatile from early trade, trading around 64.55 against the US dollar.", "\n\nThe underlying pressure on the rupee is not over yet, believes Mitul Kotecha, global head of currency strategy, Credit Agricole. ", "Kotecha adds that theIndian currency is merely taking a breatherafter the sharp volatility seen in the past few days.", "Speaking to CNBC-TV18, Kotecha adds that the rupee will take a long time to regains its lost strength.", "\n\n11. ", "45 am:Sensex and Nifty gain; FIIs selling weighs\n\nParing early losses, the BSE benchmark Sensex today recovered by 56 points in late morning trade on fresh buying in consumer durable, capital goods, auto, realty and banking counters on firm Asian cues.", "\n\nThe market sentiment was also boosted after Finance Minister P Chidambaram said yesterday that revival and encouragement of growth will continue to be the focus of the government.", "\n\nAt 11. ", "45 am, the BSE Sensex is at 18371.54, up 0.32 percent while the Nifty is at5427.25, up 0.35 percent.", "\n\nMeanwhile, foreign institutional investors (FIIs) sold shares worth a net Rs 1,277.64 crores yesterday, as per provisional data from the stock exchanges.", "\n\nThe Indian rupee is nearing the 65 zone once again. ", "At 11.45 am, the rupee was trading at 64.80.", "\n\n10. ", "45 am: Markets recover, RIL surges\n\nThe markets have recovered a bit. ", "The BSE Sensex is at 18378.94, up 0.36 percent, while the Nifty is at 5 432.60, up 0.45 percent. ", "Reliance Industries is almost up 2 percent after RILand and its UK-based partner British oil company BP Plc announced a new gas condensate discovery off the east coast of India in the Cauvery basin. ", "Shares in metal companies continue to gain for a second day after a positive reading on China's manufacturing sector on Thursday. ", "However, the Indian rupee is still hovering at around 65. ", "At 10.48 am, the rupee is trading at 64. ", "48.", "\n\n9.33 am: Rupee turns choppy again, Sensex falls\n\nThe Indian markets opened in the green but soon moved to red even as the rupee recovered in the morning trade.", "\n\nThe BSE Sensex opened up 73 points while the Nifty advanced 23 points. ", "However, at 9.40 am, the BSE Sensex is at 18275.01, down 0.21 percent while the Nifty opened at 5397.55, down 0.20 percent.", "\n\nThe Indian rupee opened higher today, a day after Finance Minister P Chidambaram said there was no need for unwarranted pessimism and the rupee was \"undervalued\". ", "However, the currency slipped into the red as the finance minister did not announce any new measure to shore up the currency.", "\n\nThe partially convertible currency opened higher at 64.31 against Thursday's close of 64.55. ", "However, it traded at 64.60, down 5 paise from yesterday's close.", "\n\nThe rupee had hit a record low of 65.56 yesterday.", "\n\nBSE healthcare, FMCG indices are the top sectoral losers -- Ranbaxy falls 3.5 pct, Ruchi Soya down 5.7 pct\n\nMetal stocks cotinues to do well in trade -- Jindal Steel gains 3.4 pct, Jindal Saw up 2 pct, Bhushan Steel gains 1.4 pct, Tata Steel gains 1 pct, Hindalco rises 0.9 pct.", "\n\nForeign funds continue to be sellers in equities, having sold for five successive sessions\n\nAs of 9:25 a.m., the rupee is trading at 64.56 versus the dollar, largely unchanged from yesterday's close\n\nReliance, BP make new gas discovery off India's east coast\n\nMeanwhile, RBI's annual report said a recovery is possible by the end of the year on the back of better agricultural growth. ", "It said household financial savings are up and investment in gold is down. ", "It added that expects current account deficit to come down from the second quarter.", "\n\nRatings agency Fitch has dispelled some fears that India may be staring at a ratings downgrade. ", "It has maintained its stable outlook for India's triple-B-minus rating.", "\n\nIn the global front, US markets rebounded to close higher on Thursday and Europe too clocked in gains on the back of upbeat PMI data. ", "Indian indices reversed all the previous day's losses with the Sensex gaining more than 400 points while the Nifty gained 105.90 points to shut at 5408.45.", "\n\nAsian markets were trading positive in morning with Japan up over 2 percent.", "\n\nEnd of updates for 22 August, Thursday\n\n17:26: Finance Minister P Chidambaram, today attempted to shore up the economy and markets and said that rupee at the current level is undervalued and should find its own level once the capital flows pour in.", "\n\n\"Rupee has overshot it's reasonable level. ", "There is unwanted panic in currency market,\" he said at a press conference this evening. ", "He added that he will not put a value on the undervalued rupee but was confident that the rupee will stabilise as foreign direct investment in the first quarter of the current fiscal have risen 70 percent to $94.1 billion against the last quarter.", "\n\nHe reiterated that the RBI's measures unveiled last week were only meant to stabilise the foreign exchange market and that the government has no intentions to resort to capital controls.", "\n\nChidambaram said there is widespread concern over volatility in rupee. ", "However, there is volatility in all emerging market currencies due to global factors.", "\n\nHowever, he said, \"we have taken many measures to revive investment and growth and they were committed to reduce fiscal deficit, and Current Account Deficit will be met\".", "\n\nHe also maintained that growth would remain flat in the first quarter of current fiscal but will pick up in the second and third quarter.", "\n\n3. ", "30 pm: Markets close in green even as rupee remains near 65\n\nThe Indian markets gained much in the afternoon trade even as the Indian rupee remained at 64. ", "93.", "\n\nThe BSE Sensex closed at18300.91, up 395 points while the Nifty closed at 5409.20, up 106.65 points.", "\n\nJim Walker of Asianomics said thatIndia needs a sensible, responsible fiscal policy. \"", "Schemes such as the Food Security Bill, National Rural Employment Guarantee Scheme, or NREGS, should be taken off the table, especially at a time when the economy is slowing down,\" Walker told CNBC-TV18 in an interview.", "\n\nReliance Communications is 5.67 percent even asADAG ChairmanAnilAmbani today appeared as a prosecution witness before a Delhi court trying the 2G spectrum case. ", "Ambani said he does not \"recall\" the various board meetings of a company, said to be an associate of RADAG, as the minutes were \"not prepared\" by him.", "\n\nRanbaxy Laboratories is up almost 16 percent. ", "Sesa Goashares today soared by nearly 8.6 percent on inclusion in the 30-share benchmark S&P BSE Sensex from August 27.", "\n\n2:35 pmReserve Bank of India has reasons to cheer, well almost. ", "The recent spike in US bonds yields will benefit the Indian central bank with more dollars. ", "Thanks to the hardening yields in the US, a rough calculations done by Economic Times showsthat the Reserve Bank of India (RBI) can earn as much as $2 billion in extra returns if the spike in the US bond yields continues.", "\n\nWith the ten-year US bond yields which have risen to 2.88% currently, RBI stands to earn a mouth watering income on its $251 billion parked in securities. ", "And with current rupee depreciation, the earnings could be even higher. ", "In fact, as per RBI data, the total interest income earned increased 8.9 percent to $1.84 billion against $1.69 billion in the quarter before. ( ", "Read the full report here)\n\nRBI's 'Operation Twist' causes collateral damange, fails to save rupee\n\n2:21 pm The rupee fell as much as 2.2 percent to 65.56, heading for a sixth straight session of declines, and is down 16 percent so far this year despite efforts by policymakers to prop it up.", "\n\nCurrencies in Indonesia, Malaysia and Thailand all hit multi-year lows on Thursday on concerns that the Fed's scaling back of stimulus would lead to further capital outflows from emerging markets, which have benefited for the last two years from waves of cheap money printed by Western central banks.", "\n\nRupee buyers in the forex market seemed to be drying up, with the central bank suspected to have intervened in the last several sessions to support the currency, although dealers said its dollar selling was not substantial enough to stop the decline.", "\n\nMeanwhile, some strategists made increasingly bearish calls on the rupee, with Credit Agricole saying that unless capital flows returned, it did not see the fundamental value for the rupee below 70 to the dollar and would not recommend buying it for fundamental reasons below 75. ", "Deutsche Bank said on Wednesday the rupee could fall to 70 in a month or so.", "\n\nIn what was seen as a partial roll-back that some market participants say sent a mixed message, the RBI late on Tuesday took steps to support a bond market which has been bludgeoned by its rupee defence steps.", "\n\nSome analysts said the move was similar to the Fed's \"Operation Twist\" begun in 2011 to buy long-end bonds.", "\n\n\"Policymaking is essentially in a quandary, as the framework comprises of multiple and often conflicting objectives,\" said Radhika Rao, economist at DBS Bank in Singapore.", "\n\n\"To this end, a single-minded focus on correcting the currency's course entails collateral damage - dampens equity and bond markets and carries risks to growth,\" she added. ( ", "Reuters)\n\n1. ", "10 pm:Markets yo-yo as Sensex now up 300 pts, rupee stuck at 65\n\nThe Indian markets have recovered quite a bit on buying mainly in metal, PSU, oil & gas, consumer durables and healthcare sectors.", "\n\nAt 1.11 pm, the BSE Sensex is at 18246.42, up 340.51 (1.90%) while the Nifty is up 5394.65, up 1.74 percent.", "\n\nHowever, the market is still under pressure as the rupee hit a new record low of 65 against the dollar after minutes of the Federal Reserve's last meeting signalled the US central bank was on course to pare bond purchases this year.", "\n\nThe rupee continues to remain weak and has touched a new low of 65.50 against the US dollar,continuing its sharp slide among emerging market currencies after the Federal Reserve minutes hinted that the United States may start tapering its stimulus as early as next month.", "\n\nAccording to UR Bhat of Dalton Capital Advisors, India is now paying the price for too much dependence on hot money.", "\n\nIn an interview with CNBC-TV18, Bhat said that emerging markets (EMs) have been huge beneficiaries of the US Federal Reserve's Quantitative Easing (QE) seen for the last several quarters.", "\n\n\"If there is going to be a tapering off then certainly we got to pay the price. ", "And that is the price that we are paying. ", "It is not as if something has happened suddenly,\" Bhatt added.", "\n\nOn the positive side, Bhat believes the government's corrective actions can inspire confidence and boost FII flows.", "\n\n\"The big doubt is about FIIs' continued love for India. ", "If they don't withdraw too much money, I think the market should stabilise around 5200 level. ", "The big bet is whether outflows would happen or not. ", "If outflows were not to happen and if business is as usual, then the market would probably stabilise around 5000-5200 levels. ", "But if not, if there is further outflow which cannot be ruled out, I think we have to take all the bets off the table,\" said Bhat.", "\n\n10. ", "15 am: JP Morgan on rupee fall\n\nAccording to JP Morgan, recent RBI measures had a negative impact on the economy. ", "However, they believe that currencies of all emerging markets with large CAD have taken a beating.", "\n\nAsked on the measures that the government may take, the brokerage firm said, \"Don't see govt taking ad-hoc steps to boost sentiment.", "Diesel price hike will not change sentiment significantly.\"", "\n\nJP Morgan is of the opion that the government needs to do everything to bring money into market. \"", "Govt needs to restructure its reform plans.\"", "\n\n10:00 am : Rupee is not the problem, government policies are the problem: Marc Faber\n\nSwiss investor and editor of Gloom and Doom report, Marc Faber believes the economic policies of the current government have been a disaster and have taken a toll on both equity and bond markets.", "\n\nIn an interview with Economic Times, he said,' the rupee is weak because India has higher inflation than other countries, and the problem is that a weak rupee can lead to even higher inflation and India's ratings downgrade is quite likely.\"", "\n\nHe further blamed the Indian bureacracy for the currenct economic crisis.", "\n\n\"The government in India, through its incredible bureaucracy, has retarded economic growth in the last 20-30 years by at least 3% per annum in real terms. ", "It's a miracle that the Indian economy has performed well, considering the quality of its government,' Faber added.", "\n\n9. ", "25 am: Markets extremely volatile on rupee fall\n\nSensex is back in red. ", "It's an extremely volatile session with Sensex down almost 50 points now. ", "Nifty is trading at5308.40, up 0.07 percent.", "\n\nYes Bank is down 4.4 pct, IndusInd Bank down 1.1 pct, SBI down 0.9 pct, ICICI down 0.6 pct.", "\n\nMeanwhile, the rupee has hit a fresh record low of 65.12 against the dollar,continuing its sharp slide among emerging market currencies after the Federal Reserve minutes hinted that the United States may start tapering its stimulus as early as next month.", "\n\nThe main reason for the rupee to fall 15 percent in the last three months is India's wide current account deficit. ", "Fears of QE3 tapering aggravated the slide. ", "In order to arrest the volatility in the forex market, the RBI started tightening its monetary policy July 15. ", "It signaled increase in short-term rates by hiking marginal standing facility rate by 200 basis points. ", "On 23 July and 8 August, it followed up with further tightening measures. ", "All this while, the rupee continued to decline and interest rates kept going up. ", "On 20 August, the RBI signaled a reversal of tightening policy.", "\n\nAccording to Macquarie, the Reserve Bank of India is sending confusing signals on monetary policy, due to which rupee will continue to depreciate.", "\n\nHowever, Aditya Puri, chief executive of HDFC Bank believes the RBI and the government are moving in the right direction.", "\n\n\"The movements in bonds and currencies reflect a dysfunctional market. ", "Tuesday's decision by RBI was in the right direction. ", "More relaxations need to be matched with import controls. ", "I don't believe that raising import duties is anti-reform,\" Puri was quoted as saying by the Economic Times.", "\n\n9. ", "15 am: Sensex turns green\n\nThe BSE Sensex have moved to green after falling more than 100 points in opening bell.", "\n\nStocks like Tata Motors have gained 2.1 pct (a day after its AGM), Infosys rises 0.8 pct, RIL gains 0.9 pct pushing the Sensex up. ", "But, the markets are likely to take a beating today.", "\n\n9. ", "10 am: Sensex in red; bank, realty stocks hit\n\nThe Indian markets extended losses for the fourth straight day. ", "The BSE Sensex opened at 17795, down 117 pts, while the Nifty opened at 5260, down 40 pts.", "\n\nBSE realty, banking indices are the top sectoral losers.", "Top Nifty losers -- DLF down 4.4 pct, ITC down 2.5 pct, Reliance Infra down 2.3 pct.", "Sensex losers -- SBI down 2 pct, GAIL down 2.2 pct, M&M down 1.8 pct, HDFC Bank down 1 pct\n\nMacquarie told CNBC-TV18, that the RBI is sending confusing signals to markets and the rupee will continue to depreciate. \"", "From here, noinvestor wants to buy Indian bonds.\"", "\n\n9.05 am: Rupee hits 65, new record low\n\nThe Indian rupee hit 64.90 against the dollar at the opening today. ", "Soon after, it touched 65on the back of bank's heavy dollar demand and poor market sentiments. ", "At 9:10 am, the Indian rupee is at 65.05. ", "It fell more than 1.4 per cent against Wednesday's close of 64.11.", "\n\nItclosed on Wednesday at 64.04 to the dollar - down 81 paise, or 1.27%, from the previous close.", "\n\nAshutosh Raina ofHDFC Banksaid, \"Yesterday's Fed minutes confused the markets, not giving timing on tapering. ", "Across the board, EM currencies sold off and the sell-off in equities are also adding to the pressure. ", "Expect the rupee to open weak in the range of 64.7-65.", "\n\nStocks around the globe took a beating on Wednesday as investors couldn't find the clues they were desperately looking for from the just released Federal Reserve's July policy meeting. ", "In the minutes, Fed policymakers indicated they are still on track to slow the central bank's $85 billion bond-buying program this year and end it in mid-2014, but gave no signal whether the scale-back could begin in September. ", "Read more.", "\n\nThat belief already has drawn billions of dollars in capital back from countries like India, Brazil and China to US assets with investors seeking the relative safety of US equities.", "\n\nThe rupee on Wednesday hit a low of 64.33 to the dollar amid investor scepticism about the policies of the Reserve Bank of India and theManmohan Singhgovernment. ", "Traders said the sell-off was intensified by \"policy flip-flops\" from the RBI.", "\n\nForeign direct investment inflows into India rose an annual 16 percent in June to $1.44 billion, a government statement said on Wednesday, the lowest monthly inflow so far in 2013.", "\n\nIn stock news, RelianceGroup ChairmanAnil Ambaniwill have to appear as a prosecution witness in a Delhi court today as the Supreme Court rejected a group company's plea that no additional witnesses be allowed at this stage of the trial.", "\n\nUpdates end for 21 August, Wednesday\n\nRBI measures the stem the rupee decline failed miserably taking both the Indian and currency markets down even further today.", "\n\nThe rupee hit a new record low of 64.52 against the USD as heavy dollar buying from large state-run banks along with demand from custodian banks hurt the local currency.", "\n\nThe BSE Sensex and the Nifty ended at the lowest close since September 2012, down about 700 points from the day's high.", "\n\nWhile the Sensex shut shop at17905, down 340points, the Nifty closed down 98 points at 5302.The Sensex is down more than 7 percent so far this month.", "\n\nSock markers wiped out their initial gains and ended the day in red.", "\n\nITC, Sun Pharma, Dr Reddy's Lab, Bharti Airtel, RIL, Sterlite, Hindalco, L&T and Tata Motors were the biggest losers.", "\n\nMarkets have fallen despite steps taken by the government and the Reserve Bank to support the beaten-down bond market. ", "The RBI relaxed rules on mandatory bond holdings for banks, which would help protect lenders from large mark-to-market losses and said it would buy long-dated government bonds worth Rs. ", "8,000 crore.", "\n\nGold, however, hitnear 8-month high of Rs 31,225 due to a weaker rupee, while demand remained subdued ahead of the resumption of imports.", "\n\nFormer deputy governor of Reserve Bank of India (RBI) Subir Gokarn said India needs comprehensive and realistic solution to deal with the ballooning current account deficit, which is the root cause of all macro woes.", "\n\nEarlier, Deutsche Bank said in a research note that the rupee could touch 70 level against the US dollar in a month's time, although some revival of the currency is expected by the end of the year.", "\n\nTo attract inflow of foreign currency, the RBI also simplified rules governing investments by non-resident Indians (NRIs) portfolio investments like equities and debt.", "\n\nUnder the Portfolio Investment Schemes (PIS) for NRIs, banks were given unique code for each branches, making it cumbersome for them to administer the scheme.", "\n\nThe government has been enhancing quantitative limits for FII investments in debt segment, including government securities (G-Secs) to help develop rupee debt markets, Parliament was informed on Tuesday.", "\n\nAccording to JP Morgan report, the Indian financial sector should bottom out after the RBI's strong moves on capping bond yields. ", "However, the immediate rebound will be impacted by some key negative factors such as slowing growth, currency volatility, continued imbalance between CAD and capital inflows, possible Fed tapering and pressure from oil prices.", "\n\nMeanwhile, theMinistry of Finance is looking to lease out the 200 tonnes of gold which it had bought from the International Monetary Fund (IMF) in November 2009, according to a media report.", "\n\nSensex erases gains, down 400 pts after rupee hits 64.52\n\n15:00 pmThe market have crashed further on sharp fall in index heavyweights like ITC , Reliance Industries , Infosys and ICICI Bank ,as rupee slipped to another record low of 64.52 against the US dollar.", "\n\nThe rupee weakened past 64.52 per dollar to hit a record low as heavy dollar buying from large state-run banks along with demand from custodian banks hurt the local currency today.", "\n\nThe Sensex is down 402.37 points or 2.21 percent at 17843.67, and the Nifty is down 118.75 points or 2.20 percent at 5282.70.", "\n\nWhile the Sensex has lost 1400 points in the last four trading sessions, the Nifty has lost 450 points.", "\n\nThe Sensex ended at 19,367 on August 14, and is today trading at 17,923.", "\n\nIndia Volatility Index is trading at 17 month high, up 9.5 percent to 29.81 since March 5, 2013.", "\n\nThe Bank Nifty is off highs, and is down 0.5 percent after earlier rising as much as 5.93 percent after the RBI eased cash and bond holding rules for banks late on Tuesday.", "\n\nBook value or net worth of state-owned banks would become more opaque after the Reserve Bank of India eased bond holding rules, Morgan Stanley said in a report on Tuesday.", "\n\nBrokers said the selling pressure was more confined tocompanies such as software exporters and drug makers withtheir exposure to overseas markets.", "\n\nThey said the falling of rupee to fresh all-timelow of 64.43 raised fears of slowing economic growth.", "\n\nTraders say stability in the rupee will be the key for bonds from the medium-term perspective.", "\n\nThe rupee has lost 5 percent this week alone and is currently trading at 64.40 against the US dollar.", "\n\nClearly, a stable currency is the prime requisite for investment, both in business and markets.", "\n\n14:45 pmGold steady near eight-month high on weak rupee\n\nMeanwhile,gold futures in India traded in the vicinity of their highest level in eight months on Wednesday due to a weaker rupee, while demand remained subdued ahead of the resumption of imports.", "\n\nThe actively traded gold for October delivery on the Multi Commodity Exchange (MCX) was 0.15 percent lower at 30,765 rupees per 10 gram. ", "It touched a high of 31,225 rupees intraday, near an eight-month high hit on August 19.", "\n\nThe rupee, which hit a record low again on Wednesday, plays an important role in determining the landed cost of the dollar-quoted yellow metal.", "\n\nIn the overseas market, gold traders awaited more clarity from the US Federal Reserve on whether it would begin curbing its commodities-friendly economic stimulus from next month.", "\n\n\"India remains largely absent in the physical market amid tighter regulations and a weak currency,\" UBS said in a report to its clients. ( ", "Reuters)\n\nSensex slips below 18000, Nifty below 5300\n\n2:37 pm: The Sensex slipped below the 18,000 levelas the rupee remained under pressure and breached the 64 level after the Reserve Bank of India (RBI) said it will buy bonds to ease a cash crunch, and relaxed bond holding rules for lenders.", "\n\nAt 2:37 pm, the Sensex was down 253 points at 17992, while the Nifty slipped below 5300 to trade at 5280, its lowest level since September 2012.", "\n\nMinutes from Fed's most recent meeting will be released today as investors look for cues regarding the timeframe of the US stimulus programme.", "\n\nThe rupee hits fresh all-time low, trading around 64.43 per dollar as heavy dollar buying from large state-run banks along with demand from custodian banks hurt the local currency on Wednesday. ", "Traders said there was no signs of RBI's intervention in the spot market so far during the session.", "\n\nThe RBI took steps in July to prop the rupee and the central bank took fresh measures yesterday to do the same but the rupee remains in a free-fall.", "\n\nRupee hits new low of 64.43/$, Sensex loses 1,400 pts in 4 days\n\n2:18 pm:The rupee once again breached the 64 level despite several attempts by the RBI to prop up the Indian currency.", "\n\nAt 2:18 pm, the Indian currency hit 64.43 against the USD, down 1.58 percent from yesterday's close of 63.43.", "\n\nYesterday, the rupee had touched an all-time low in intra-day trade by breaching the Rs 64 per dollar mark. ", "But dollar sale by state-run banks acting on behalf of RBI helped the rupee to recover.", "\n\nDeutsche Bank in a note on Wednesday said that the rupee may slide to 70 to the dollar in a month or so, although some revival is expected by the end of the year.", "\n\nAt 2:20 pm, the BSE Sensex was220 points at 18029, while the Nifty was down 70 points at 5332.The BSE Sensex is now down around 1400 points in last 4 sessions.", "\n\nRBI will auction government bonds for a notified amount of Rs 15,000 crore as well as conduct Open Market Operations (OMO) purchase of government bonds up to Rs 8,000 crore on Friday.", "\n\n\"India's macro situation appears to be nothing short of a train wreck. ", "RBI measures aren't helping either with the INR's free fall continuing despite efforts to curb rupee volatility and reduce FX outflows. ", "Weak macro data validates our pared 4.5% GDP est. ", "for FY14,\" said Religare Institutional Research in a report.", "\n\nAccording to Biocon chief Kiran Mazumdar Shaw,incremental measures will not calm the economic panic. \"", "We need swooping policy changes. ", "Eg Approval of all FiPB proposals,\" she tweeted.", "\n\nIndustry experts are largely viewingRBI's measures as a short-term relief measure given the bloodbath on Dalal Street and the sinking rupee hitting fresh all-time lows day upon day.", "\n\n1. ", "10 pm: Markets wipe out gains\n\nThe stock markets have wiped out early gains and enter the red zone.", "\n\nThe BSE Sensex is at 18241.34, down 0.03 percent, while the Nifty is at 5399.75, down 0.03 percent.", "\n\nBank Nifty down nearly 325 points from day's high. ", "the BSE Sensex has lost more than 250 pts from day's high.", "\n\nThe Indian rupee weakened further to 63.64 against the dollar.", "\n\n12. ", "35 pm: RBI's measures ill-equipped to tackle real problem, says Subir Gokarn\n\nFormer deputy governor of ReserveBank of India(RBI) Subir Gokarn believes India needs comprehensive and realistic solution to deal with the ballooning current account deficit, which is the root cause of all macro woes.", "\n\nGokarn finds the measures ill-equipped to tackle the real problem. \"", "The tactical measures taken by the RBI are not addressing heart of problems the CAD. ", "The pressure will continue till fundamental problems are addressed,\" he told CNBC-TV18 in an interview.", "\n\n12.07 pm: IT shares fall on valuation, rupee concerns\n\nShares of IT majors Infosys and TCS fall on concerns about their valuations relative to the market and on fears that the rupee may regain some of its recent losses as it looks oversold at current levels.", "\n\nThe rupee made a record low of 64.13 to the dollar on Tuesday despite various measure by India's central bank and the government since mid-July.", "\n\nInfosys Ltdis down over 2 percent while Tata Consultancy Services Ltdfalls 1.5 percent,Wipro is down 0.6 percent.", "\n\nIndia needs early elections and the jockeying has already begun: Bloomberg\n\nBloomberg on the other hand has taken a strong stand against the UPA government and said that India is not suffering from a currency crisis but it is rather facing a 'crisis of credibility.'", "\n\n\"There are things Singh can do now, administratively, to begin to restore confidence, such as his recent move to clear 1.7 trillion rupees' worth of projects that had been blocked by bureaucratic inaction. ", "He can also try to use his unique credibility to revive the narrative of reform, to explain to ordinary Indians how somewhat abstract structural measures will benefit them and not just corrupt elites.", "\n\nYet it's hard to see how anything other than early elections will break the gridlock in New Delhi. ", "Investors can't be certain that any new government will push forward with difficult reforms. ", "They know for sure, however, that the current government cannot,\" argues Bloomberg. ( ", "Read the full view here)\n\nWhy the panic over rupee, asks Paul Krugman\n\n11:06: The rupee continues to remain under pressure even after the Reserve Bank of India (RBI) said it will buy bonds to ease a cash crunch, and relaxed bond holding rules for lenders.", "\n\nHowever, noted economist Paul Krugman argues that Indians should not yet panic over the rupee fall as India's dollar denominated debt situation is not like the Asian crisis countries of 1997-1998 or Argentina in 2001.", "\n\n\"Now, the depreciation of the rupee will presumably lead to a spike in inflation - but it should be temporary.", "So at first examination this doesn't look like as big a deal as some headlines are suggesting. ", "What am I missing?,\" ", "he says in his blog here.", "\n\nRBI steps a bandage to salvage short-term pain; this is a rally to sell\n\n10:30 am The Bank Nifty surged 5.4 percent in early trade after the Reserve Bank of India eased cash and bond holding rules for banks on Tuesday.", "\n\nThe RBI relaxed rules on mandatory bond holdings for banks, which would help protect lenders from large mark-to-market losses and said it would buy long-dated government bonds worth Rs 8000 crore.", "\n\nState Bank of India Ltd gained 5.5 percent, while ICICI Bank rose 4.5 percent.", "\n\nHowever, Udayan Mukherjee, Managing Editor ,CNBC-TV18, cautions market should not get carried away this morning because of the rally in public sector banks, as the RBI intervention does not address the fundamental problems of the banking sector.", "\n\n\"All that they would have showed is a mark-to-market (MTM) loss at the end of the quarter which the market might have priced in partially. ", "To the extent that MTM loss will be minimized, maybe reported profits will be higher. ", "So, we should understand that MTM, which is going down and none of the other fundamental problems for which banks have been fundamentally getting downgraded, which is very sharply falling off credit growth and a huge balance sheet or a non-NPA problem. ", "Those do not get addressed with this,\" said Mukherjee.", "\n\nHe further said that RBI'ss teps to shore up the rupee will pave way for a near-term rally, one should not think that the moves of yesterday actually mean that the RBI has successfully either fought off the battle on the rupee or will embark an easy monetary policy. ", "This is patchwork, which will pull the yield back a bit, help banking stocks that would have rallied in any case because of the way they have been oversold.", "\n\nEvenRidham Desai, MD & Head of India Research ,Morgan Stanley believes the market is oversold and at some point, the market is likely to rally. ", "However, until the fundamental construct remains the way it is - we think this will be a rally to sell, not buy.\"", "\n\n9. ", "50 am: Markets cool off, Deutsche Bank says rupee could touch 70\n\nMarkets have cooled off considerably from their opening bell highs; Sensex has lost around 150 points from its highest point of the day, but the index is still up 170 points.", "\n\nDeutsche Bank expects rupee to touch 70 against the dollar in a month or so. ", "However, it expects revival by end of year.", "\n\n\"We continue to believe that fundamentally the rupee is undervalued and has overshot its equilibrium level substantially, but as numerous episodes of past currency crises have amply demonstrated, under a scenario of deep pessimism, currencies can overshoot substantially and remain so for a long time,\" economists at the bank wrote in the report.", "\n\n\"India, we fear, is entering such a zone\", it added.", "\n\nThe partially convertible rupee dropped to a record low of 64.13 per dollar on Tuesday and was trading at 63.38/42 on Wednesday, weaker than its close of 63.25/26. (", "Reuters)\n\nMeanwhile, investors are dreading that the rupee's rapid and sharp decline may result in credit ratings downgrade for India. ", "In fact, on Tuesday morning, JP Morgan downgraded India to neutral from overweight citing the rupee weakness as the primary reason for the downgrade. ", "The brokerage house says India will continue to underperform unless rupee stabilises.", "\n\n9.15 am: Markets recover following RBI steps\n\nThe Indian markets recovered today following RBI'ssteps to support the beaten-down bond market.", "\n\nThe BSE Sensex opened at 18642, up 300 pts while theNifty opened at 5490, up 92 pts.", "\n\nBanking stocks are the top gainers with SBI rising 5.8 pct, HDFC Bank up 5 pct, ICICI Bank up 4.9 pct.", "\n\nFinancial Technologies is one of the biggest loser in the BSE Sensex, down by almost 7 percent.", "\n\nThe 10 year benchmark yield is down 70 bps to 8.3 percent.", "\n\nForget rupee. ", "The 10year benchmark yield is down 70 bps to 8.3%. ", "If this indiciates RBI is reversing it's welcome news. - ", "Ajit Ranade (@ajit_ranade) August 21, 2013\n\nThe RBI yesterday announced a slew of measures to ease liquidity in the banking system after its recent tightening steps aimed at pushing up short-term interest rates also lifted the long-term rates in the economy. ", "Who will benefit from the move? ", "As Firstpost notes in this article, \"Definitely, banks. ", "Bond, rupee and, in turn, equity markets will also benefit from the RBI move. ", "Bond prices will rise, i.e. yields will crash. ", "The rupee will strengthen, instilling confidence in investors.\" ", "Read more here.", "\n\n9.00 am: Rupee recovers, will markets rebound after RBI move?", "\n\nThe Indian rupee opened at 63.45 against dollar, slightly weaker than yesterday's close at 63.23. ", "However, analysts predict it will regain following RBI measures. ", "At 9.10 am, rupee recovered to 63.15 after a weak start.", "\n\nMeanwhile, Congress leader Digvijaya Singh tweeted saying he would like to know the impact of dollar on currencies of other developing countries, suggesting that India is not the only country to suffer.", "\n\nWe share the concern of the falling value of ? ", "against $. ", "Would like to know the impact of $ on currencies of other developing countries - digvijaya singh (@digvijaya_28) August 21, 2013\n\nThe BSE Sensex is likely to rebound, while the battered Indian rupee may see some recovery on Wednesday after the government and the Reserve Bank took steps yesterday to support the beaten-down bond market.", "\n\nPre-open trade suggests markets are off to a good start today.", "Bank Nifty surges 4.7 pct in pre-open after RBI eases cash, bond holding rules.", "SBI gains 5.5 pct, ICICI up 4.6 pct in pre-open after RBI steps.", "\n\nWorried over interest rates rising following its steps to support falling rupee, the RBI has announced slew of measures to ease liquidity, including Rs 8,000 crore bond buyback, to ensure adequate credit flow to the productive sectors of the economy.", "\n\nAccording to technical experts, the Nifty may seek support around 5,360-5,330, while face resistance around 5,445-5,470.Nifty fell to its lowest close in almost a year on Tuesday, weighed down by blue chips including Sun Pharma as the rupee hit another record low and on expectations of a cut in US stimulus as early as next month.", "\n\nAmid rupee sliding below 64 to a dollar, global agency Standard & Poor's said it will maintain negative outlook for the country as currency depreciation is adversely impacting investor confidence.", "\n\nGlobally,it was a mixed close for the US markets on Tuesday as investors stayed cautious ahead of the release of FOMC minutes. ", "European markets closed in the red.", "Asian markets were down in morning trade today. ", "Emerging markets are expected to remain in focus after a brutal sell-off over the past two days.", "\n\nBack home, the 10-bond yields also made a sharp recovery in trade yesterday. ", "After hitting a five-year high of 9.4 percent, bond yields clawed back to end the day way below 9%.", "\n\nAmong the stocks to watch, National Spot Exchange has sacked its entire top management, including CEO Anjani Sinha, as the beleaguered bourse could manage to pay just over half of Rs 175 crore first tranche of payment due to investors Tuesday.", "\n\nBanking stocks will also be in focus today after RBI allowedbanks to shift a part of their AFS portfolio to HTM. ", "The measures will restrict a sharp rise in long-term yields and reduce MTM losses on banks' investment portfolios banks will benefit more from the reduction in MTM losses, withOBCandCanara Bankthe biggest beneficiaries of these measures. ", "Lower wholesale rates will also benefit private banks.", "\n\nReserve Bank of India eased investment rules for NRIs in shares and debentures\n\n17:30 The Sensex had today slipped below the psychological 18,000 mark for the first time since September 2012, before retracing losses to close 0.34 percent lower at 18,246. ", "The markets closed off the day's low tracking recovery in the rupee.", "\n\nThe Indian currency ended at an all-time low of 63.25 for the fourth session in a row.", "\n\nIn yet another step aimed at stemming the decline in the rupee, the Reserve Bank of India eased investment rules for NRIs in shares and debentures of Indian companies listed on a local exchange. ", "The central bank simplified some of the administrative channels for non-residents to invest in shares and debentures, even as these transactions under the portfolio investment scheme would be reported to it on a daily basis, it said in a statement on Tuesday.", "\n\nMeanwhile,rating agency Moody's said that while the rupee depreciation was a new variable for the economy, the bleeding rupee would not to impact rating outlook.", "\n\n15:30Rupee continues to trade off the day's low at 63.63 after earlier hitting a low of 64.11. ", "10-year bond yields too pulled back below 9 percent after touching a five-year high of 9.24 percent earlier today.", "\n\nThe Indian markets erased most of the day's losses butNifty fell to its lowest close in almost a year on Tuesday, weighed down by blue chips including Sun Pharma as the rupee hit another record low and on expectations of a cut in U.S. stimulus as early as next month.", "\n\nThe BSE Sensex closed down 0.34 percent at 18318, while the Nifty closed down 0.25 percent at 5401.", "\n\nThe current intensity of sell-off seen in Indian equities is similar to post Lehman crisis, so the situation is getting scary, Raamdeo Agrawal, Joint MD, Motilal Oswal Financial Services said in an interview with CNBC-TV18.", "\n\nWhile talks of US Federal Reserve rolling back stimulus sooner than later has been making global markets nervous, he feels that the ongoing bloodbath on Dalal street has more to do with domestic factors.", "\n\nAccording to him, Indian Inc will take a hit due to the rupee fall and it would be difficult for them to pass on rupee depreciation costs.", "\n\n15:00 Sesa Goa surges on Hind Zinc stake sale report\n\nShares in Indian units of oil and mining group Vedanta Resources Plc surged after CNBC TV18 reported that the government has cleared legal hurdles to the stake sale in the company's unit Hindustan Zinc.", "\n\nVedanta's unit Sesa Goa , which holds 64.92 percent stake in Hindustan Zinc, is up 12.7 percent, while Hindustan Zinc gains 9.4 percent.", "\n\nAlso, Sesa Goa said on Saturday its merger with Sterlite Industries and the group's various Indian arms to create a single unit has become effective.", "\n\n14:45 State-run oil companies fall after Moody's report\n\nShares in state-owned oil companies fell after Moody's said credit quality of Indian oil companies may weaken if the government continues to use the same subsidy-sharing mechanism as it did for the June quarter.", "\n\nMoody's added the fuel subsidy for July-September will likely rise to Rs 35000 crore to Rs 40000 crore compared with Rs 25600 crore in April-June due to the ongoing depreciation of the rupee and the rising crude oil prices.", "\n\nThe rupee slumped to a record low in early trade on Tuesday and bond yields hit another five-year high as Asia's third-largest economy bore the brunt of growing money flows out of emerging markets.", "\n\nOil and Natural Gas Corporation is down 3.98 percent while Indian Oil Corporation fell 0.6 percent.", "\n\nGold futures eased from their highest level in eight months on profit-taking as the rupee came off its early low and overseas markets fell.", "\n\nAt 2:47 p.m., the actively traded gold contract for October delivery on the Multi Commodity Exchange (MCX) was 1.83 percent lower at Rs 30,595 per 10 grams, after hitting a high of 31,278 rupees in the last session, the level last seen on December 18.", "\n\nTechnical indicators show highly overbought conditions, leading to profit-booking, said Gnanasekar Thiagarajan, director with Commtrendz Research.", "\n\nThiagarajan said the outlook was negative for gold prices on a weekly basis, with the U.S. Fed minutes and subsequent news of tapering off likely to dent gold prices. ( ", "Reuters)\n\nUncertainty cripples markets, Citi cuts Sensex target to 18,900\n\n13:30 : Global investment bank Citigroup has cut its year-end target for the Sensex to 18,900 from 20,800 earlier, citing increasing uncertainty after the rupee's slide despite the Reserve Bank of India's measures to stem the fall.", "\n\nThe trend and the mood in the market are bearish, but Citigroup has warned investors to watch out for any short-term reversals.", "\n\nThe Nifty is currently hovering close to 5400 and the Sensex is currently holding above 18,200.", "\n\n13:15 Pendulum is swinging back in favor of advanced countries\n\nAccording to a Bloomberg report, Asia's role as the world's growth engine is waning as economies across the region weaken and investors pull out billions of dollars.", "\n\n\"The clouds forming in Asia as liquidity tightens and China's slowdown curbs demand for commodities and goods are fueling a selloff of emerging-market stocks, reversing a flow of money into the region in favor of nascent recoveries in the US and Europe,\" says the report.", "\n\nIndia 'not quite yet' a buying opportunity: Mobius\n\n12:55 pmThe steep fall in the Nifty raisesthe question whether this is the time to buy.", "\n\nAccording to Mark Mobius, executive chairman of Templeton Emerging Markets Group, the equity markets need to fall further to represent a buying opportunity for long-term investors.", "\n\nIndia is beset by high inflation, slowing growth, a ballooning current account deficit and a record low currency. ", "At the core of the problem - foreign capital outflows precipitated by expectations cheap liquidity will come to an end with the September wind-down in the US Federal Reserve`s asset purchase programme.", "\n\n\"Indian markets have not fallen far enough to make them attractive,\" Mobius was quoted as saying by CNBC.", "\n\nMore pressure is in store for India's currency, Mobius warned. \"", "With the US dollar getting stronger, the rupee could get hit further,\" he said, adding \"significant declines\" may be on the horizon unless controls were imposed to limit capital outflows.", "\n\nAccording to investment bank Morgan Stanley,the Indian markets seem to be reaching an oversold territory, which implies that the market is liekly to rally soon. ", "However, it cautioned that \"until the fundamental construct remains the way it is - we think this is will be a rally to sell, not buy.\"", "\n\nOnly rupee will improve sentiment on India\n\n11:26 amAccording to a Bank of America Merill Lynch report, the single biggest factor making investors nervous on India is the currency. \"", "A stabilization of the currency would make investors more positive on India. ", "While the Govt has taken a series of steps to stabilize the currency, it has not worked partly due to nervousness on the Fed tapering. ", "Even after the start of these measures, India is the 3rd worst performing currency amongst EMs,\" saidJyotivardhan Jaipuria, research analyst at DSP Merrill Lynch.", "\n\nSentiments of investors on India have turned negative and they seem genuinely concerned of the risk of the policy mistake in order to curb the currency volatility.", "\n\n\"Indian markets are now less loved than what they were 3 months back. ", "However, these sentiments are still some distance away from the extreme bearishness of the past,\" the report added.", "\n\nBut it also cautioned that any policy mistake could likely result in accelerated selling by the FIIs which could bring down the markets rapidly.", "\n\nCong only worried about saving its chair, not rupee, says Modi\n\n11:15 amWith rupee at an all-time low of 64.05/ USD and Nifty too opening below 5400, there is no doubt in the minds of most that India maybe heading towards deeper trouble. ", "Taking advantage of the market carnage, Gujarat chief minister Narendra Modi hit out at UPA,accusing the government of not caring about the economy.", "\n\n\"The country has drowned in despair, Congress is only worries about saving its chair. ", "The rupee has fallen rapidly in the past 3 months. ", "UPA has failed to stop it, \" said Modi.", "\n\n\"If the rupee keeps falling like this and inflation keeps increasing, other countries will start taking advantage of India,\" he added.", "\n\n11:oo am Moody's says factors underpinning rupee fall part of Baa3 rating\n\nMoody's India sovereign rating of Baa3 incorporates macro-economic challenges of weaker growth, a fall in the rupee and the twin deficits, credit ratings analyst Atsi Sheth said on Tuesday. \"", "So while (the) rupee depreciation may be a new development, the factors that underpin it are not, and have been incorporated into India's Baa3 rating,\" Sheth said in an e-mailed response to Reuters.", "\n\nFor India to meet the fiscal deficit target will be \"very challenging\" this year, Sheth added, citing lower-than- anticipated growth and a steep fall in the rupee.", "\n\nMarkets are overreacting to rupee decline, says Arvind Mayaram\n\n10:44 am: Despite rupee free fall, theDepartment of economic affairs (DEA) secretary Arvind Mayaram told CNBC-TV18 that the markets were overreacting and thatfears of government imposing capital controls were completely unfounded.", "\n\nHe further added that fears of current account deficit being difficult to manage are irrational.", "\n\nDefending the rupee slide, Mayaram said all emerging economies are under pressure, with the Indonesian Rupiah, Brazillian Real doing worse that the Indian currency.", "\n\nThe Malaysian ringgit is the weakest in over three years, while Thai baht hit a one-year low today.", "\n\nMeanwhile, the Sensex recovered more than 200 points from the day's low and was trading at18149.", "\n\nHowever, banks remained under pressure after surge in bond yields will result in heavy mark-to-market (MTM) losses in SLR and non-SLR bond portfolios for banks.", "\n\nThe rupee too istrading at 63.71 versus the dollar, after falling as much as 64.13 in early trade.", "\n\nThe Reserve Bank of India has not been able to stem the rupee's selloff, despite intervention and curbs on outflows from companies and individuals, which have dented India's stock and bond markets.", "\n\n10:24 am: RBI trying to save rupee\n\nAccording to a Reuters flash, traders say the Reserve Bank of India is selling dollars via state-run banks starting around 63.85 rupee levels.", "\n\nReacting to the rupee free fall, Biocon founder Kiran Mazumdar Shah said the government can do very little about the decline.", "\n\n\"Is this the time to scrap P notes n allow Foreign investors,\" she tweeted.", "\n\nThe Rupee is in a free fall n there seems to be very little we can do about it. ", "Is this the time to scrap P notes n allow Foreign investors - Kiran Mazumdar Shaw (@kiranshaw) August 20, 2013\n\nThe Rupee is in free fall. ", "I guess the ban on mining in Goa n Karnataka will have to be lifted to get some dollars in - Kiran Mazumdar Shaw (@kiranshaw) August 20, 2013\n\n10. ", "00 am: JP Morgan downgrades India shares to neutral\n\nJP Morgan has downgraded Indian shares to \"neutral\" from \"overweight\", citing strain in balance of payments, while upgrading China shares to \"neutral\" from \"underweight\".", "\n\nThe brokerage adds it is late in downgrading India, but if the rupee continues to slide it would continue to underperform.", "\n\nCiti also lowered its target for the BSESensexto 18,900 from 20,800, citing increasing uncertainty after the rupee's slide despite Reserve Bank of India's measures since mid-July.", "\n\n9.22 am: Rupee breaches 64/USD\n\nThe Indian rupee has reached a new record low.", "The rupee fell to 64.05 to a dollar, a record low, breaching a key psychological level of 64.", "\n\nThe rupee has been down over 5 percent in last six days.", "\n\nThe rupee extended losses past 64 to a dollar on continued concerns about how India will fund its current account deficit in case fund flows taper out of emerging markets.", "\n\nMohan Shenoi,Kotak Mahindra Banktold CNBC-Tv18, \"Rupee depreciation is largely a local phenomenon. ", "Weak equity markets on concerns of decelerating growth is impacting the rupee. ", "A depreciating rupee is making unwinding of tight liquidity difficult. ", "Rupee is expected to depreciate further today and is likely to test 64/USD levels.\"", "\n\n9. ", "10 am: Markets open in red, Sensex down more than 300 pts\n\nThe Indian markets opened in the red for a third consecutive today.", "\n\nThe BSE Sensex openedat 17977, down 320 pts, whilethe Nifty opened at 5308, down 106 points. ", "The BSE Sensex is down nearly 1400 pts in just 3 days.", "\n\nThe BSE Sensex closed almost 300 points lower on Monday at 18,307. ", "The BSE Sensex has lost 1000 points in the last two trading sessions alone. ", "Sensex down almost 1 percent or 165 points in pre-opening trade. ", "Nifty down more than 1 percent in pre-open trade.", "\n\n9.00 am: Rupee headed to 64 against dollar?", "\n\nThe Indian rupee opened at new record low of 63.76, while the Indian stock markets are likely to open lower for a third consecutive day today.", "\n\nThe INR crossed all-time lows of Rs 63.13 to the US dollar post India's actions on capital controls. ", "The INR weakness is feeding to equities and bonds with the Sensex and Nifty down by more than 4 percent each while the 10-year benchmark bond yield trades at over five-year highs.", "\n\nThe Reserve Bank of India has proven unable to stem the rupee's selloff, despite intervention and curbs on outflows from companies and individuals, which have dented India's stock and bond markets.", "\n\nMeanwhile, Asian stocks opened lower on Tuesday under a cloud of uncertainty about when the US Federal Reserve will start to reduce its stimulus, which pushed up yields on US Treasuries to two-year highs.", "\n\nShares of India-focused exchange traded funds were sharply lower in New York stock market trading.", "\n\nInvestor anticipation of the Fed's move to slow its purchases of bonds has resulted in higher yields on government bonds, raising the attractiveness of the dollar and dollar-denominated assets.", "\n\nWhy are the rupee and the Indian stock markets crashing? ", "As R Jagannathan explains here, \"The UPA government's credibility on the economy has fallen so low that it ends up achieving the exact opposite of what it intends. \"", "\n\n\"The Reserve Bank placed new curbs on external remittances to shore up the rupee, but the currency is sinking further. ", "P Chidambaram told us the other day that the 770-point fall in the Sensex last Friday was because our markets were closed for I-Day. ", "Well, on Monday the index fell by a further 290 points to tell him that he is wrong.\" ", "Read more here.", "\n\nEven Mark Mobius, executive chairman of Templeton Emerging Markets Groupis bullish on emerging markets, he is less optimistic on the outlook for India. ", "He said he is concerned about the country's bureaucracy. \"", "They're just moving too slowly,\" he said, adding the barriers to investment are too high. ", "While he still invests in the country, \"it's not at the top of the list.\"", "\n\nIn stock specific action, NSEL is heading towards a payment default. ", "FMC sources say the exchange has so far managed only Rs 68 crore in the escrow account created for investors, but faces a payout of Rs 174 crore today as part of its 30-week payout plan.", "\n\nUpdates end for 20 August, 2013\n\nThe rupee today breached the 63 level to end at 63.13 against the US dollar.", "\n\nYields on the 10-year benchmark bond hit a five-year high of 9.24 percent.", "\n\nYields are inversely proportional to prices, i.e. bond prices crashed due to rupee free fall. ", "Data by CNBC-TV18 shows, the rupee marked its biggest single day fall in the last 10 years by plunging 2.8 percent in the last two trading sessions.", "\n\nAccording to analysts,fears about more steps from the Reserve Bank of India (RBI) to shore up rupee is weighing on yields. ", "Moreover, financial markets are not optimistic about UPA's ability to revive growth.", "\n\nRBI has undertaken several measures to drain excess liquidity in the banking system and curb forex outflows, in a bid to support the rupee.", "RBI raised short rates through marginal standing facility and mopped up cash through the liquidity adjustment facility on July 17, although Governor Duvvuri Subbarao had maintained that the central bank's objective was to reduce exchange rate volatility and not its level. ", "But anticipating this move,foreign institutional investors had already pulled out $4 billion from investment in debt.", "\n\nThen on 8 August, the RBI announced o that it would auction Rs 22000 crore of government cash management bills every Monday. ", "As if these measures weren't enough,RBI partially rolled back the currency's convertibility and imposed capital controls on resident Indians.", "\n\nThe central bank also reduced the limit under the Liberalised Remittance Scheme from $200,000 to $75,000, which further spooked investors.", "\n\nThe Indian currency has lost 15 percent this year-to-date.", "\n\nWith signs of US tapering its bond buying programme, FIIs are pulling out and there is general mayhem in the market, Dipen Sheth, Head-Institutional Research, HDFC Securities told CNBC-TV18.", "\n\nWorsening financial scenarios, tighter credit conditions and rising burden of structural adjustments are likely to diminish prospects of recovery in the short and medium term.", "\n\nClearly, the government's defence of the currency failed to stop a declining rupee from plunging further but exacted a rising toll, with bond yields surging to five-year highs and investors demanding higher returns in an auction of cash bills.", "\n\nPolicymakers' measures to prop up the currency, which has tumbled 12 percent against the dollar so far in 2013, have thus far proved ineffective, making it the worst performer in emerging Asia and threatening to drive India towards a full-blown crisis.", "\n\nThe rupee's slide has fuelled expectations of more action from the Reserve Bank of India (RBI), which last week curbed outflows from companies and individuals, roiling stock and bond markets.", "\n\n\"A depreciating rupee will result in increased costs for various companies, thereby impacting margins. ", "Thus, even at lower stock prices, the valuations have not turned appealing,\" said Dipen Shah, head of Private Client Group Research, Kotak Securities.", "\n\n\"Rupee has remained weak despite various measures undertaken by the Government and RBI. ", "This is due to the high level of CAD. ", "The FM has reiterated his intent on controlling the CAD to about $70bn in the current fiscal and financing the same without draining forex reserves. ", "Further announcements on attracting investments in infrastructure and other core sectors will likely attract more forex flows and instill some confidence in the rupee. ", "This may have a consequent positive impact on market sentiment,\" Shah added.", "\n\nDeteriorating economic troubles at home have added to the currency's woes.", "\n\nThe government is struggling to reduce its current account deficit, which currently stands at 4.8 percent of gross domestic product (GDP), while attempts to push through structural reforms by relaxing restrictions on foreign direct investment have seen little progress.", "\n\nThe Sensex fell 1.56 percent, or 290.66 points, to end at 18,307.52, adding to Friday's 4 percent fall, marking its lowest close in nearly four months.", "\n\nThe Nifty slumped 1.69 percent, or 93.10 points, to end at 5,414.75, marking its lowest close since September 11, 2012.", "\n\nInvestors are also waiting to see if minutes of the Federal Reserve's last policy meeting due on Wednesday will provide some clarity on when it might start scaling back stimulus.", "\n\nSensex pulls back slightly, closes 300 points lower as FIIs panic\n\n15:30: Bloodbath on Dalal Street continued today with the Sensex closing down 290 points at18307, while the Nifty shut shop 93 points lower at 5414.", "\n\nWhile the Sensex did recover around 0.8 percent from the day's low, barring IT and metals, all indices ended the trade in red today.", "\n\nBSE banking index was down 3.9 percent, the auto index was down 3.1 percent, FMCG index closed down 2.3 percent while the metals index ended up 1.8 percent.", "\n\nTheexpected withdrawal of US monetary stimulus prompted investors to shun emerging markets burdened by weak external balances, slowing economies and inflation.", "\n\nHowever, Mark Mobius, executive chairman of Templeton Emerging Markets Group, believes the fear of US tapering its quantitative easing is quite overdone.", "\n\n\"What people fail to realize is that the so-called tapering is on top of an incredible increase in money supply in the US,\" he said. \"", "These QE programs have been cumulative. ", "It`s not a situation where one stops and all that money goes away. \"", "It stays in the system,\" he said in an interview with CNBC.", "\n\n\"You`re going to see more money going into emerging markets,\" Mobius predicted. ", "He noted that while emerging market fixed income funds have seen net outflows recently, fund flows for the segment`s equity funds have actually been flat.", "\n\nBut Mobius is less optimistic on the outlook for India, which has been suffering from capital outflows, with its currency weakening to another fresh record low of 62.82 against the dollar on Monday.", "\n\nHe said he is concerned about the country's bureaucracy. \"", "They're just moving too slowly,\" he said, adding the barriers to investment are too high.", "\n\nWhile he still invests in the country, \"it's not at the top of the list.\"", "\n\nWorld Bank's chief economist too tried to downplay the economic gloom and said the country's economic problems were being \"overplayed\".", "\n\nKaushik Basu said India was not in danger of a full-blown economic crisis, despite mounting fears about India, which is struggling with a gaping current account deficit that has helped push the rupee to record lows.", "\n\n\"Growth may not have bottomed out. ", "We have further to go (down), but the situation is not as bad as is being captured by the mood and captured in the headlines,\" Basu said in Delhi today.", "\n\nMeanwhile, gold prices hit their highest level in more than seven months, helped by a rupee that weakened to a record low again.", "\n\nThe actively traded gold contract for October delivery on the Multi Commodity Exchange (MCX) was 0.1 percent lower at Rs 30,809 per 10 grams, after hitting a high of Rs 31,000 earlier in the day, a level last seen on January 7.", "\n\n15:00 pmFM takes stock of eco situation as rupee inches closer to 63\n\nFinance Minister P Chidambaram today met senior officials of various departments to take stock of the current economic situation and deliberated on steps to improve it.", "\n\nSources told PTI that the Finance Minister took stock of the functioning of various department and sought suggestions from officials for improving the economic situation.", "The agenda for next three months was discussed, another source said.", "\n\nMarket off day's low but trading 300 points down\n\n14:40The Sensex is off the day's low but is still down around 300 points at 18245.But not just Indian equities, several emerging markets are under a pall of gloom as an eventual tapering of the Fed stimulus looms\n\nThe Bank Nifty slipped below 9100 for the first time since August 29, 2011. ", "It lost 3.71 percent to 9100.65 with the ICICI Bank and Axis Bank falling 5-6 percent. ", "State Bank of India dropped 2.7 percent while its rival HDFC Bank trimmed its losses to 1.86 percent from 3.29 percent.", "\n\nIndex heavyweight Reliance Industries and ITC declined 1.56 percent & 2.8 percent, respectively.", "\n\nMeanwhile,World Bank chief economist Kaushik Basu has saidIndia does not need to seek a line of credit from the International Monetary Fund (IMF) to help fix the economy.", "\n\n\"I don't think that we are in a situation where there is any need for that,\" Basu told reporters after giving a lecture in the Indian capital, when asked whether India should ask the IMF for money. \"", "India has enough foreign exchange reserves, so the question of having to turn to the IMF is not there.\"", "\n\n14:25 RBI needs to abandon its rupee-defending policies: Andrew Hollande\n\nThe rupee crashed to a record low and is nearing 63 against the US dollar as the expected withdrawal of US monetary stimulus prompted investors to shun emerging markets burdened by weak external balances, slowing economies and inflation.", "\n\nAt 2:21 pm, the rupee had touched a new all-time low of 62.82 against the USD\n\nMost market experts have cautioned that rupee's continued weakness may lead to a ratings downgrade.", "\n\nAndrew Holland, CEO, Ambit Investment Advisoralso feels that hardening rates continuously would lead to negative growth.", "\n\nThe only way forward for India is to get growth back. ", "RBI needs to abandon its rupee-defending policies. ", "Hardening rates continuously would lead to negative growth,\" he told CNBC-TV18 in an interview.", "\n\nBetween 2003 and 2007, markets went up seven times and created distortions in terms of expectations of growth and valuations. ", "However, Bharat Iyer, MD & Head of India Equity Research, JPMorgan said he would be extremely wary of using historic comparatives and extrapolating them over the future as global environment back then was different.", "\n\n\"The equity market has been living in denial and it is just catching up now,\" he added.", "\n\n1.50 pm: \"Move to gold,\" says Marc Faber\n\nGloom Boom & Doom Report Editor Marc Faber said today that it's a good time to move to gold as stocks are in \"bubble territory.\"", "\n\n\"The S&P is down 3 percent from its high, 1,709, and yesterday we had over 400 new 12-month lows on the New York Stock Exchange. ", "That is remarkable,\" he said. \"", "That shows that the internal picture of the market is very different than what the indices show. ", "The indices Nasdaq, S&P, Dow are driven by just a few stocks that are very strong. ", "They are in bubble territory.\"", "\n\nFaber noted weakness in sectors such as home builders, retailers, airlines and food companies made the precious metal a strong play.", "\n\n1:22 pm: Indian markets and the rupee are in a free fall with the government's measures being seen as inadequate to halt decline in the Indian currency.", "\n\nAt 1:22 pm, the Sensex plunged 400 points to 18211 levels, while the Nifty was trading below 5400. ", "The rupee too is inching closer to the 63 mark and breached a new low of 62.72 against the USD.", "\n\nTechnical analyst Laurence Balanco of CLSA feels the Nifty is likely to slip into its 2011-12 trading band of 5500-4700 after the over 5 percent crash in the last three trading days.", "\n\nHis short-term target for the rupee is 63.30 against the US dollar.", "\n\nThe market extended losses on fears that country's current account deficit may increase from current level after the rupee touched a new record low.", "\n\nPanic stricken Indian equities, which saw a bloodbath last week are suffering from a bipolar disorder, said Nirmal Jain, chairman, IIFL.", "\n\nRupee breaches past 62.50,Nifty slips below 5400 for the first time since September 2012\n\n12:28 PM: The Indian rupee just breached past 62.50 against the US dollar and hit a new all-time low of 62.57 while the Sensex plunged further, down 330 points at 18287,weighed down by financials, telecom, healthcare and auto stocks.", "\n\nEven the Nifty slipped below 5400 for the first time since September 2012.", "\n\nThe benchmark 10-year government bond yield rose to 9 percent as the rupee continued to make a series of record lows.", "\n\nThe benchmark 10-year bond yield was trading at 9 percent, up 12 basis points on the day at 12:32 p.m., its highest level since November 15, 2011.", "\n\nAccording to a Reuters report, some dealers are expecting further dollar selling by the central bank as well as other measures to prop up a currency that is down 10.8 percent in 2013, making it the worst performer in emerging Asia.", "\n\n\"Forex intervention will continue by the central bank. ", "Further measures are expected from the RBI but are unlikely to be effective. ", "The rupee is expected to touch 63 in no time,\" said Param Sarma, chief executive at Brokerage NSP Forex.", "\n\nAnanth Narayan of Standard Chartered Bank believes quick fix solutions to the Indian \"big bag of worms\" will keep sentiment weak.", "\n\nIn an interview to CNBC-TV18, Narayan says: \"The statement coming in from the ministry that they will restrict the current account deficit (CAD) to $70 billion, actually is a step in the right direction. ", "That communication ought to be self embedded. ", "But a lot depends upon how both these issues; current account deficit and the stuck infrastructure projects continue from here and that will determine that trajectory of all the asset classes,\" said Narayan.", "\n\n12:19 pm:Why have equity mutual funds performed poorly despite the barometer index not falling as much?", "\n\nAccording to Gaurav Dutta, analyst at Morningstar India, the Sensex reached a high of 20302 in July because of a few handful large-cap scripts even while almost two-third of the Sensex had taken a beating.", "\n\n\"The Sensex has not fallen as much this year, but equity mutual funds have taken a beating due to the markets being heavily polarized.", "In such polarized markets, it is unwise to use one specific index to measure the health of the market. ", "While one index may give a rosy picture of current events, the actual performance might be far from it. ", "In such a scenario it is advisable to review the performance of a fund versus its respective benchmark index, which could also include the broader markets. ", "This should be coupled with a thorough analysis of portfolio allocation of the fund, to arrive at a conclusion of the performance of the fund,\" Dutta says in a research report.", "\n\nSensex loses 1000 points in just two days\n\n11:40 am: Foreign institutional investors (FIIs) extended selling in index futures for a fourth day on Friday, totalling sales of Rs 2,063 crore, indicating they are bracing for lower levels in cash shares in the near term, dealers said.", "\n\nDerivatives analysts said the rise in outstanding positions in index futures, coupled with a fall in cash share indexes, indicates the formation of short positions.", "\n\nFIIs sold Rs 563 crore of cash shares on Friday, when the Nifty slumped 4 per cent, ending a three-day buying streak, exchange data showed.", "\n\nNifty futures represent about 85 per cent of the total outstanding positions and the banking sub-index represents about 12 per cent of index futures contracts, NSE data shows. ((", "Reuters)\n\nNirmal Jain, chairman, IIFL, in an interview with CNBC-TV18 said all emerging markets are facing economic crisis and the outlook remains grim. ", "Given the fragile state of Indian equity market, overseas investors are scared of putting fresh money in India now.", "\n\nThe Nifty fell 1.3 per cent after marking its lowest intraday level in 11 months, extending Friday's 4 percent slump as a record low rupee weighed.", "\n\n09.54 am: Rupee hits new record low of 62. ", "45\n\nThe Indian rupee opened at its weakest ever against the US dollar on Monday morning. ", "The partially convertible rupee dropped over 1 per cent to hit a record low of 62.45 surpassing the previous low of 62.03 hit on Friday.", "\n\nBanks slumped on tightening short term rates. ", "ICICI Bank fell 3 percent and HDFC Bank was down 1.8 percent.", "\n\nAlso, foreign institutional investors sold Rs 563 crore of cash shares on Friday, ending a 3-day buying streak, exchange data showed.", "\n\n09:45 amBeaten, battered Indian equities are sending signals of a breakdown:Geosphere Capital\n\nNifty is trading at its lowest level in 2013 and has broken its April 2010 low of 5,477.", "\n\nIT, TECk, Healthcare and Consumer Durables are the gainers, while Bankex, Capital Goods, Auto, PSU, Metal, Realty, FMCG and Power are among the losers on the BSE.", "\n\nThe beaten, battered and bruised Indian equities are now sending signals of a breakdown, said Arvind Sanger of Geosphere Capital Management as there are no positive trigger for market over the next six months.", "\n\nSanger also feels that RBI's actions to protect the rupee have not yielded desired results and further slide in the rupee may lead to rating downgrade. ", "Further global crude trading over USD 110/barrel poses a big risk to India's ballooning current account deficit (CAD), he said in an interview with CNBC-TV18.", "\n\nPolicies followed since 2008-09 have led to economic crisis: Yashwant Sinha\n\nIn an interview with ET NOW, senior BJP leader Yashwant Sinha said that the rupee and and markets are in a free fall because the government has lost control of the economy.", "\n\nSinha further said that India needs to fight current economic challenges with tough reforms but the current government is treating symptoms rather than curing fundamental problems.", "\n\nSensex dips 200 pts, expect more carnage from here on\n\n9:15 am The carnage in markets continued this morning with the BSE Sensex and Nifty extending losses in morning trade.", "\n\nAt 9:12 am, the BSE Sensex was down 200 points at 18408, while the Nifty broke its April 2013 lows and was down over 70 points at 5440.", "\n\nThe Indian stocks, took a dive off the cliff on Friday as investors resorted to panic selling. ", "The fear that the government was about to make it difficult for them to take money out of the Indian market.", "\n\n\"India has a structural problem. ", "With the first signs of tapering of quantitative easing, India's problems are becoming more visible now and there is little that RBI can do now. ", "You can only expect more pain from here on as the currency weakness is driven entirely by current account deficit worries, \" said Dipen Sheth of HDFC Securities in an interview with CNBC-TV18.", "\n\nHe added that markets will look for incremental signs of corrective action by the government without which there will be a downward drift in the market.", "\n\nMeanwhile,Macquarie has downgraded India rating to Underweight from Overweight. ", "It is of the view that the downgrade cycle in India is accelerating and it seems an \"overbought\" market, with the region's highest exposure to volatility of global flows.", "\n\nAccording to Jayant Manglik, president, retail distribution, Religare Securities: \"Vulnerability in rupee has been haunting equity markets on regular intervals and we do not see ending it here. ", "On charts, 5,450 is the next immediate support area and breakdown of the same will open floodgates to 5,300 levels in near future. ", "Considering the same, one should avoid opposing positions and maintain bearish bias.\"", "\n\n9. ", "00 am: Rupee hits new record low at 62.35\n\nThe rupee hit a new record low of 62.35 against the US dollar after closing at61.65 on Fridayas the government's steps unveiled last week seemed inadequate to stall the currency's fall.", "\n\nGovernment bond yields remained at 21-month highs with the 10-year bond at 8.95 percent, up 7 basis points.", "\n\nOver the medium -term there is a high probability that the rupee may touch 65 against the Dollar onrenewed fears of tapering of quantitative easing in the US.", "\n\nHowever, some analysts believe that the rupee mayclaw backto the 61 level this week on more capital inflows fromoverseas.", "\n\nThe measures undertaken by the RBI to check speculation and outflows have seen little effect.", "\n\nOn 14 August, the RBI clamped down on Indians' ability to take money out of the country in two ways. ", "The limit on personal remittances has been cut to $75,000 per year, from $200,000 per year. ", "And companies are now barred from spending more than their own book value on direct investments abroad, unless they have specific approval from the central bank.", "\n\nPramit Brahmbhatt, CEO, Alpari India in an interview with CNBC-TV18 said, \"Rupee will continue to trade weak as recent policy decisions by the RBI have forced FIIs to withdraw money from the market. ", "Moreover a weak equity high dollar demand from importers and strong dollar in the overseas market will put pressure on the rupee. ", "The range for the day is seen between 61.2-62.3/USD.\"", "\n\n8. ", "50 am: Will markets remain in red even today?", "\n\nOn Friday, panic gripped the street as key indices saw their biggest intraday fall in two years as theNiftytanked over 230 points even breaking below the 5,500 mark in intra-day trade. ", "TheSensexshed over 750 points to tumble way below the 19,000 mark. ", "Rupee ended at an all-time closing low of 61.65 to the dollar.", "\n\n\"It doesn't appear that we are in for a massive pullback. ", "The markets could stabilise around these levels but sentiment has got whacked really bad, said Udayan Mukherjee, managinag editor, CNBC-TV18.", "\n\nEven UR Bhat of Dalton Capital believes the ongoing pullback in market is real since there is no fundamental reason to buy markets now. ", "For the markets to look fundamentally strong, economy has to resurrect, CAD has to come down, exports have to pick up. ", "It is important to get industries back which can be done only through policy measures, Bhat told CNBC-TV18.", "\n\n\"Given the economic environment and the challenges in India, I wouldn't rule out the fact that there could be more correction...First, we will look at what Ben Bernanke does with respect to the bond buying because that is something widely talked about. ", "We may see a new central bank governor in the US and also in India. ", "So there will be some changes and that could create volatility,\" said Punita Kumar Sinha of Paradigm Advisors.", "\n\nAccording to a Mint analysis,net institutional selling activity (foreign and domestic institutional investors) on Friday was a mere Rs 73 crore which included foreign institutional investor activity in cash, index futures and stock futures. ", "The figurewas the lowest net institutional selling among episodes when the Nifty fell sharply in the last four years.", "\n\nKaushik Basu, the chief economist of World Bank says that the concern regarding the QE is a change from abundant liquidity to more normal times.", "\n\nGlobally, US markets finished marginally lower last week. ", "Major indices posted their first back-to-back weekly losses since late June. ", "European markets ended in the green.", "Asian markets were cautious in morning trade todaywaiting to see if minutes of the Federal Reserve's last policy meeting will provide some clarity on when it might start scaling back stimulus -- with far-reaching implications for borrowing costs across the globe.", "\n\nUpdates closed for Friday, 16 August, 2013.", "\n\n17:00 pm The Indian rupee closed off the day's low at 61.55 against Wednesday's close of 61.43 against the US dollar. ", "Traders told Reuters that the Reserve Bank likely sold dollars via state-run banks from 61.85 rupee levels, propping the local currency.", "\n\nThe partially convertible currency had earlier breached the 62 mark against the greenback, surpassing the previous all-time low of 61.80 hit just last week.", "\n\nThe broad selloff in the equity and debt market added to the rupee's woes with foreign funds pulling out their investments. ", "Foreign funds have sold debt and equity worth more than $11.7 billion, with over $10 billion coming from debt, since late May when fears of the U.S. tapering first started.", "\n\nThe S&P BSE Sensex on Friday crashed 769 points, the most in 4 years mid fears the government may move to a capital- control regime to curb forex volatility and narrow CAD.", "\n\nThe markets were also spooked by expectations that an improving US economy would lead to a flight of foreign capital from the domestic markets.", "\n\n\"FIIs (foreign institutional investors) may pull out further on continued concerns over Fed's potential tapering and as the rupee continues to make record lows,\" said Sachin Shah, a fund manager at Emkay Investment Managers Ltd.\n\nConcerns that foreign investors would sell were also reinforced after upbeat U.S. jobless claims data on Thursday suggested an early end to the Federal Reserve's asset purchases.", "\n\n\"I am not surprised to see the rupee continuing to fall,\" Suresh Kumar Ramanathan, regional fixed income and currency strategist for CIMB in Kuala Lumpur told Reuters\n\n\"The natural action should be to provide additional local flows and liquidity. ", "That never came by, so India is paying for it now,\" he added.", "\n\nSensex sheds 750 pts as RBI's rupee measures scare foreign investors\n\n15:42 pm:As the central bank looks to curtail Indians from investing abroad, the stock markets took a beating and BSE Sensex crashed over 700 points as Dalal St feared that the curbs could spark further selling if they spook foreign investors.", "\n\nWhile the BSE Sensex closeddown 749 points at 18616, Nifty closed down 225 points at 5516, posting thebiggest single day percentage fall since September 22, 2011. ", "Across the market, around 1,583 stocks fell and just 729 rose. ", "Investor wealth worth Rs 221,268 lakh crore was eroded in today's fall.", "\n\nThe bear grip was so fierce that none of the sectoral indices on the Bombay Stock Exchange ended in positive terrain. ", "Interest rate sensitives were the worst hit after July inflation came in higher-than-expected at 5.79%, virtually ruling out a policy rate cut.", "\n\nGold prices, on the other hand, hit a 2-year high of Rs 31,000 on rising demand for the festive season amid a firm global trend.", "\n\nThe government and the Reserve Bank unveiled several measures to stop the slide in the rupee on Wednesday, but these steps failed to shore up the rupee.", "\n\nAnalysts said the massive drop in markets is due to panic selling by investorsbecause the local currency has moved from 54 to 62 in just 3 months.", "\n\nForeign investors are witnessing erosion of wealth as the rupee continues to slide to historic lows virtually every week. ", "This continued weakness has forced them to book losses and unwind their positions.", "\n\nBrijen Puri of JPMorgan believes the Indian rupee could reach 65 against the dollar much before December.", "\n\nIn an interview to CNBC-TV18 he said so far the government has taken serious measures to contain current account deficit (CAD) only on behalf of the rupee but nothing significant has been done to check the oil, fertiliser, coal, iron prices.", "\n\nAmar Ambani, Head of Research at IIFL, expects market participants to look towards international cues for further direction given that the results season is behind us.", "\n\n\"In the US, the Federal Reserve would release minutes of the FOMC meeting next week. ", "Technically, the Nifty has reversed from its 38.2% retracement level, which also coincides with the intermediate rising trendline resistance levels. ", "If the Nifty breaches the 5,470 mark on a closing basis, selling pressure could accentuate,\" he stated in a note.", "\n\nRBI move on capital control is by far the most damaging for the INR\n\nAccording to Firstpost columnist Arjun Parthasarthy, RBI's move on capital controls is by far the most damaging for the INR. ", "Foreign investors will now worry about some form of capital controls on their investments. ", "The fact that the Indian government is falling head over heels to bring in foreign investors will not prevent worries on capital controls in the minds of the investors. ( ", "Read more here).", "\n\nHe believesRBI and the government will now have to send out clear messages to foreign investors that there will be no controls on their investments in India. \"", "However, the damage has been done and markets will trade weak until some calm emerges. ", "The calm can emerge only when foreign investors do not fear capital controls,\" he added.", "\n\nRBI on Wednesday restricted how much its citizens and companies can invest abroad to reduce pressure on the rupee, while targeting the current account deficit by banning imports of gold coins and medallions among other measures.", "The RBI also eased some of the rate limits for deposits targeted at non-resident Indians (NRIs), though that is also seen as unlikely to attract inflows in the near term given that NRI deposits have seen net withdrawals of $1.1 billion in May and June, according to DBS.", "\n\nHowever, efficacy of the steps remains in doubt, given outflows have already been declining this year and that they ultimately do not address the need to attract overseas investments to narrow a current account deficit that hit a record 4.8 per cent of gross domestic product in the year ended in March.", "\n\nShankar Sharma, Global Trading Strategist at First Global does not see this bear rally ending ant time soon.", "\n\n\"The bear market started in 2008 and is now becoming a true bear market. ", "This is a global bear market in EM countries,\" he said in an interview with ET Now.", "\n\nOnly Fed can save the rupee\n\nWriting in Business Standard, Shishir Asthana says only the Fed Chairman, Ben Bernanke, cam help the rupee.", "\n\n\"If he continues with the quantitative easing, liquidity flow can continue and there can be some hope of money coming to India. ", "Otherwise,the only possible way of reviving the rupee would be through direct intervention by the RBI,\" he writes. ( ", "Read more here).", "\n\nEven the Finance Ministry said that excessive rupee volatility is impacting the equity markets.", "\n\n\"Our sense is that what is seen in India is happening due to what is happening all over the world. ", "The rupee worry also spills over to the equity markets and the equity worry spills over to the rupee. ", "It is potentially vicious,\" a ministry official said.", "\n\n\"The rupee will finally find a level based on the state of the economy...We are happy or prepared to live with orderly movement in the value of the rupee,\" he said, adding that the government and the RBI at present do not want to use their armoury and would rather stick to relatively smaller measures that won't choke growth.", "\n\nThe decline in the currency and the equities markets, he said, was also on account of US data showing that joblessness in America was reducing, fuelling fears that the Federal Reserve would start withdrawing its stimulus.", "\n\nUS Federal Reserve Chairman Ben Bernanke had earlier indicated that the Fed could taper its bond-buying programme with an improvement in the US economy.", "\n\n\"The data which has come out indicates this could finally be the beginning of easing. ", "It (the tapering) could be as early as next month's bond-buying programme,\" the official said, adding that this concern affected the markets on Friday.", "\n\nIndia in complete financial distress, says BJP leader Rajiv Pratap Rudy\n\nBJP leader Rajiv Pratap Rudy said the rupee has never in Indian history reached such a low and said that India is in complete financial distress.", "\n\nCMP leader Sitaram Yechury blamed the rupee fall on liberalisation of imports.", "\n\n\"This was bound to happen given the way India has liberalised its imports,\" said Yechury.", "\n\nStocks in news\n\nTitan Industries closed down 12.11 percent after the RBI notified a ban on import of gold coins and medallions.", "\n\nBharti Airtel closed down 2.23 percent even though Singapore Telecom said it will buy around 3.62% of Bharti Airtel shares for about Singapore dollar 383.6 million.", "\n\nAxis Bank was another big loser, down more than 8 percent as it has been removed fro MSCI Global Standard Indices\n\nJain Irrigation closed down 7.83 percent after it posted a consolidated net loss of Rs 60.3 crore in first quarter of the current fiscal against a loss of Rs 48.7 crore in the year-ago period.", "\n\nBlue chips fell across the board. ", "HDFC Bank slipped 5.4 percent, while Reliance Industries tumbled 4.4 percent.", "\n\nTata Motors fell 1.6 percent as Wednesday's 9.7 percent gains on unit Jaguar Land Rover July sales were seen as overdone.", "\n\n15:21 pm Volatility in Indian markets is here to stay, says Mark Mobius\n\nThe weakness in the rupee is the biggest concern for market analysts.", "\n\nInvest analyst Adrian Mowat of JP Morgan said Indian capital markets can see a sharp recovery if the rupee stabilises around the 60-level, while investment guru Mark Mobiusis still bullish on India.", "\n\nIn an interview with CNBC-TV18, Mobius said that the Indian government, which is struggling to arrest the spiraling rupee, has not been moving fast enough to attract foreign inflows.", "\n\nThe key factor investors are now keeping an eye on is additional structural reforms by the government,\" he told CNBC-TV18. ", "He said rating agencies are watching India closely and the threat of a ratings downgrade is still looming.", "\n\nThe rupee hit a historic low of 62 against the dollar on Friday, leading to massive cuts on the benchmarks , as the week wraps up with more data to fuel Federal Reserve consideration of tapering monetary stimulus.", "\n\nThough Mobius agrees that markets are overreacting to QE tapering talks, he says volatility seen in Indian market is here to stay.", "\n\nHowever, he is still notlooking to exit out of India and does not expect large-scale exodus by overseas investors either. \"", "The market is likely to stabilise at current level,\" he said.", "\n\n\"Given the current market environment, one can hide in defensive sectors like IT & FMCG and buy consumer stocks, ITC and HUL on dips,\" he advises.", "\n\n15:15 pm Gold futures touch Rs. ", "30,000/ten gm mark for first time in six months\n\nMeanwhile, domestic prices of gold for the first time since its dramatic fall in April regained the physiological of Rs 30,000 (per 10 grams) mark on Friday.", "\n\nThe price of the yellow metal touched a high of Rs 30,170 on MCX, up 4% from its previous close of Rs 29,017.", "\n\n\"Weak US dollar and sharp slide in US equities prompted aggressive buying in the precious complex. ", "Speculation is rife that large funds, categorically from the Middle East may have initiated out fresh long positions. ", "Turbulent situation in Egypt corroborates this perception. ", "On demand side, the World Gold Council reported that demand for gold hit a four-year low in the second quarter, in spite of a jump in jewelry buying. ", "Consumer demand rose by more than half to 1,083 tons over the course of the quarter compared to a year earlier, but there was a 402.2 ton outflow from gold-backed ETF's and a 93.4 ton drop in central bank buying.\" ", "said a morning note by IIFL Research.", "\n\nDalal St meltdown, Sensex sheds a giant 750 points\n\n15:02 pm: The Indian markets crashed further with the BSE benchmark Sensex tumbling by over 700 points in the afternoon trade tracking a record-low rupee and on fears that an early rollback of US monetary stimulus would trigger a sell-off by foreign investors.", "\n\nAt a time Indian markets are roiled by fears of an early QE rollback, RBI's outflow restrictions steps are seen as further undermining the confidence of foreign investors.", "\n\nAt 3.02 pm, the Sensex was down 760 points at 18609, while the Nifty was down 230 points at 5508.", "\n\nThe Sensex and Nifty had reached this level for the first time since 22 September 2011.", "\n\nThe Bank Nifty crashed too and marked its biggest percentage loss since July 2009.", "\n\nThe rupee pulled back from the 62 mark well but was still trading weak at 61.80 against the USD.", "\n\nThe current account deficit is the main source of the rupee's weakness, which the finance minister has pledged to narrow down to 3.8 percent of the GDP in FY14.", "\n\nOverseas funds have pulled out a combined $11.58 billion in equities and debt from India's markets since June 1 over concerns about the weakening economy, SEBI data showed.", "\n\nOn July 15, RBI announced measures to squeeze cash from the system and raise short-term interest rates, a move seen choking off growth as borrowing becomes more expensive. ", "On Wednesday it eventhe interest rate ceiling on foreign currency non-resident deposits were revised.", "\n\nConsumer Durables, Bankex, Realty, Oil & Gas, Metal, PSU, Capital Goods, Power and FMCG are among the losers on the BSE.", "\n\nAll the sectors were trading in red. ", "The sectors that saw the maximum selling pressure were consumer durables, banking index (bankex), capital goods, metal, oil and gas, public sector undertakings (PSU), fast moving consumer goods (FMCG), auto, IT and healthcare.", "\n\nMajor losers on BSE were - BHEL (7.46 percent), Maruti Suzuki (4.82 percent), HDFC (4.58 percent), HDFC Bank (4.13 percent) and Sterlite Industries (3.94 percent).Sectorally, the banking sector fell the most by declining 4.94 percent, followed by metals (4.49 percent), realty (4.38 percent), oil & gas (4.19 percent) and power index (3.69 percent).", "\n\nMeanwhile, the rupee traded at 61.74 as of 1.55 pm well below the record low of 62.03 reached earlier in the session as exporters stepped in to sell the greenback. ", "The government and the Reserve Bank unveiled several measures to stop the slide in the rupee on Wednesday, but these steps failed to shore up the rupee. ", "To know why the RBI steps failed, read this.", "\n\nAnalysts are not at all bullish and expect the market to crash further. ", "Sanjay Sinha, founder, Citrus Advisors expects theNiftyto slide from the current levels to sub 5500 going ahead. ", "Once quantitative easing comes to an end, money will start moving back to the developed market, he said.", "\n\nIt seems strange that the Indian equity market had two positive days in this week, that too at a time when inflation picked up pace. ", "The jolt finally came a day later, when BSE benchmark, Sensex-30 crashed over 500 points proving that the reality was far more grim than assumed.", "\n\nA slew of experts CNBC-TV18 spoke to have different opinions on the recovery path. ", "Most feel in the near term, a recovery is a difficult proposition. ", "In fact, experts suggest the 50-stock benchmark can fall as deep as 5450 at worst, 5470 at best.", "\n\nAjay Srivastava, Dimensions Consulting said that theRBI moves not just spooked the market, but have also confirmed the reality that it is more grim than seen. \"", "The road to recovery is going to be much, much shallower and not a v-shaped recovery.", "These are one of the days when the shorts have finished the covering, they have booked the profits and now they got fresh capital and ammunition to again go short in the market. ", "Globally what has happened helps us, but Indian stock market should have gone down rather than gone up on Wednesday and that is what is catching up today,\" he said.", "\n\nAnu Jain of IIFLsees BankNiftyat 5470 in the near future. ", "She says, \"Probably if panic ensues, you can see another 50-70 points, but people would wait for the market to come to 5500-5550, maybe that would take a dead market about 10 days before you see any kind of buying interest emerge.\"", "\n\nDeven Choksey, KR Choksey Securitiesbelievesthe kind of tight money policy of the RBI has actually done more harm than otherwise. ", "He says that the steps have not been able to either stop the inflation or the fall in the rupee value. \"", "To my mind some immediate steps are required to be taken wherein a sharp cut in the interest rate will have to be taken and if that happens then in such a situation you might see some amount of stability returning back into the system,\" he added.", "\n\nWith inputs from Reuters" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.021052631578947368, 0, 0, 0, 0, 0.019801980198019802, 0.005208333333333333, 0, 0.006535947712418301, 0, 0, 0.007407407407407408, 0.008, 0, 0.006493506493506494, 0.011834319526627219, 0, 0.011976047904191617, 0, 0, 0.03125, 0.016216216216216217, 0.004273504273504274, 0.018518518518518517, 0, 0.015267175572519083, 0.008547008547008548, 0.0196078431372549, 0, 0.011904761904761904, 0.0055248618784530384, 0, 0.03, 0.0064516129032258064, 0, 0.022727272727272728, 0, 0, 0.030927835051546393, 0.010050251256281407, 0, 0, 0.024390243902439025, 0, 0.012422360248447204, 0.0273972602739726, 0.032520325203252036, 0.006060606060606061, 0, 0.010526315789473684, 0.015384615384615385, 0, 0.025, 0.0103359173126615, 0, 0, 0.01020408163265306, 0, 0.007352941176470588, 0.012903225806451613, 0, 0.004, 0, 0, 0, 0.005319148936170213, 0.0136986301369863, 0, 0, 0, 0, 0.00641025641025641, 0, 0.029411764705882353, 0.011363636363636364, 0.0228310502283105, 0.006134969325153374, 0.013333333333333334, 0, 0.008403361344537815, 0.015151515151515152, 0, 0.013574660633484163, 0.006369426751592357, 0, 0.006896551724137931, 0.010273972602739725, 0.0033112582781456954, 0, 0.0035460992907801418, 0.013157894736842105, 0.004739336492890996, 0.009174311926605505, 0.011560693641618497, 0, 0.07692307692307693, 0.005128205128205128, 0.02727272727272727, 0.004273504273504274, 0.003663003663003663, 0.00847457627118644, 0.021164021164021163, 0, 0, 0.016129032258064516, 0.008547008547008548, 0, 0, 0, 0, 0, 0, 0.02631578947368421, 0.01020408163265306, 0, 0, 0.01, 0, 0.014134275618374558, 0.004132231404958678, 0, 0, 0.008695652173913044, 0, 0, 0, 0, 0.021505376344086023, 0.0038910505836575876, 0, 0, 0.009009009009009009, 0, 0, 0, 0.015873015873015872, 0.013513513513513514, 0.024390243902439025, 0, 0.018518518518518517, 0, 0.018518518518518517, 0, 0.008849557522123894, 0.022556390977443608, 0, 0, 0, 0.022222222222222223, 0, 0.023809523809523808, 0.013953488372093023, 0, 0, 0, 0.023809523809523808, 0, 0.01020408163265306, 0.017857142857142856, 0.009708737864077669, 0, 0.0053475935828877, 0.0043859649122807015, 0, 0, 0.012195121951219513, 0.01282051282051282, 0, 0.008403361344537815, 0, 0.005847953216374269, 0.008264462809917356, 0.019867549668874173, 0, 0.058823529411764705, 0.008264462809917356, 0.005376344086021506, 0, 0, 0.013761467889908258, 0.005025125628140704, 0.005917159763313609, 0.00625, 0.00975609756097561, 0.015151515151515152, 0.008849557522123894, 0.005208333333333333, 0.015209125475285171, 0, 0.023622047244094488, 0.009523809523809525, 0, 0, 0.011494252873563218, 0.011560693641618497, 0, 0, 0, 0.009708737864077669, 0, 0, 0.014388489208633094, 0, 0, 0.0055248618784530384, 0.0070921985815602835, 0.013605442176870748, 0.00684931506849315, 0.006944444444444444, 0, 0.010101010101010102, 0.006666666666666667, 0.005405405405405406, 0.009009009009009009, 0, 0.011494252873563218, 0.006097560975609756, 0.018633540372670808, 0.010810810810810811, 0, 0.022058823529411766, 0, 0.03333333333333333, 0.019230769230769232, 0, 0.020833333333333332, 0, 0, 0, 0.0297029702970297, 0, 0.017241379310344827, 0, 0, 0.013513513513513514, 0, 0.023529411764705882, 0.009708737864077669, 0.007692307692307693, 0, 0.017391304347826087, 0.0037313432835820895, 0, 0, 0, 0, 0.011627906976744186, 0.011764705882352941, 0.0045662100456621, 0, 0, 0, 0, 0.013636363636363636, 0.005050505050505051, 0.0125, 0.012145748987854251, 0.0070921985815602835, 0.011627906976744186, 0.003952569169960474, 0.018518518518518517, 0.007434944237918215, 0, 0.0273972602739726, 0, 0, 0.004166666666666667, 0.012658227848101266, 0, 0, 0, 0.005988023952095809, 0.007407407407407408, 0.006666666666666667, 0, 0.006993006993006993, 0.011627906976744186, 0.019230769230769232, 0.010309278350515464, 0, 0, 0, 0.017543859649122806, 0.011583011583011582, 0, 0, 0.01282051282051282, 0, 0, 0, 0.015873015873015872, 0.02, 0.015384615384615385, 0, 0.00980392156862745, 0, 0, 0.005952380952380952, 0, 0.02531645569620253, 0.015625, 0.003968253968253968, 0.006006006006006006, 0.005050505050505051, 0.007751937984496124, 0, 0, 0, 0, 0, 0.00816326530612245, 0.017391304347826087, 0.008403361344537815, 0, 0, 0, 0, 0.005076142131979695, 0, 0.006134969325153374, 0.010309278350515464, 0, 0.0037174721189591076, 0.0297029702970297, 0.022222222222222223, 0.004878048780487805, 0.007142857142857143, 0.01937984496124031, 0.028985507246376812, 0.013245033112582781, 0.011111111111111112, 0.0044444444444444444, 0, 0.009900990099009901, 0, 0.007905138339920948, 0.013513513513513514, 0.005847953216374269, 0.013071895424836602, 0.007751937984496124, 0.010309278350515464, 0.004329004329004329, 0, 0.014184397163120567, 0.01098901098901099, 0, 0, 0.009345794392523364, 0.015151515151515152, 0, 0.006134969325153374, 0, 0.005434782608695652, 0, 0.014814814814814815, 0.006172839506172839, 0, 0, 0, 0.00684931506849315, 0.004166666666666667, 0.013513513513513514, 0.011363636363636364, 0, 0.02564102564102564, 0, 0.018656716417910446, 0.010101010101010102, 0.006060606060606061, 0.013513513513513514, 0, 0.012048192771084338, 0, 0, 0.012345679012345678, 0.01, 0.005025125628140704, 0.016666666666666666, 0.015748031496062992, 0, 0, 0.007194244604316547, 0.013605442176870748, 0.008968609865470852, 0, 0.0055248618784530384, 0, 0, 0, 0, 0.019801980198019802, 0, 0, 0.012048192771084338, 0, 0, 0.021052631578947368, 0, 0.014492753623188406, 0, 0, 0, 0, 0, 0.009708737864077669, 0.00558659217877095, 0.005025125628140704, 0.009708737864077669, 0, 0.005128205128205128, 0, 0.012121212121212121, 0.008264462809917356, 0.007518796992481203, 0, 0, 0.012987012987012988, 0, 0, 0, 0, 0.005376344086021506, 0.009009009009009009, 0, 0, 0.006756756756756757, 0.016, 0.011904761904761904, 0.0070921985815602835, 0.007326007326007326, 0, 0.007874015748031496, 0.0070921985815602835, 0, 0, 0.015625, 0, 0, 0, 0.010362694300518135, 0, 0.02, 0.011111111111111112, 0.02631578947368421, 0.006711409395973154, 0, 0.013157894736842105, 0, 0.0036900369003690036, 0, 0.008264462809917356, 0.005555555555555556, 0.013824884792626729, 0, 0.006329113924050633, 0, 0.012903225806451613, 0, 0, 0, 0.01694915254237288, 0.012195121951219513, 0, 0.005, 0, 0, 0, 0, 0.004608294930875576, 0, 0.006578947368421052, 0, 0.008733624454148471, 0.004166666666666667, 0, 0, 0.008771929824561403, 0.011494252873563218, 0.01680672268907563, 0.02040816326530612, 0.01744186046511628, 0.004975124378109453, 0.009708737864077669, 0.006389776357827476, 0, 0.00819672131147541, 0, 0.0196078431372549, 0.010526315789473684, 0, 0.018604651162790697, 0, 0.011627906976744186, 0.015267175572519083, 0, 0, 0.03614457831325301, 0, 0, 0, 0.009900990099009901, 0.010526315789473684, 0.010869565217391304, 0, 0, 0.014492753623188406, 0.003076923076923077, 0.013157894736842105, 0, 0, 0.004291845493562232, 0, 0.012987012987012988, 0.019230769230769232, 0.007633587786259542, 0.014563106796116505, 0, 0.004830917874396135, 0, 0.00966183574879227, 0, 0, 0, 0, 0, 0.0035460992907801418, 0, 0.0070921985815602835, 0, 0.026143790849673203, 0, 0.006711409395973154, 0, 0, 0, 0, 0.03278688524590164, 0, 0.005405405405405406, 0.042682926829268296, 0.009478672985781991, 0.012987012987012988, 0.0189873417721519, 0.01593625498007968, 0, 0.011428571428571429, 0.014598540145985401, 0, 0, 0, 0.006896551724137931, 0.015625, 0, 0.024390243902439025, 0, 0.01020408163265306, 0, 0, 0, 0.0043859649122807015, 0.009174311926605505, 0, 0, 0.010526315789473684, 0.009708737864077669, 0, 0, 0.01990049751243781, 0, 0, 0, 0, 0, 0, 0, 0, 0.014184397163120567, 0.007246376811594203, 0.008403361344537815, 0.009345794392523364, 0.00392156862745098, 0, 0.00909090909090909, 0.00411522633744856, 0.008547008547008548, 0.0136986301369863, 0, 0, 0, 0.0038022813688212928, 0, 0.008333333333333333, 0.014705882352941176, 0, 0, 0, 0, 0, 0.012195121951219513, 0.008032128514056224, 0, 0.009523809523809525, 0.012121212121212121, 0, 0, 0.008333333333333333, 0.006993006993006993, 0, 0.006493506493506494, 0, 0, 0, 0.018691588785046728, 0.00823045267489712, 0.005917159763313609, 0.022988505747126436, 0.006711409395973154, 0.008849557522123894, 0.030612244897959183, 0, 0, 0, 0, 0, 0, 0.004347826086956522, 0.011111111111111112, 0, 0.02727272727272727, 0, 0.024096385542168676, 0.021739130434782608, 0, 0.008547008547008548, 0, 0.010309278350515464, 0, 0, 0, 0.003048780487804878, 0.004484304932735426, 0.01948051948051948, 0, 0, 0.01818181818181818, 0.025, 0.01098901098901099, 0.015503875968992248, 0.018072289156626505, 0.003236245954692557, 0, 0.025974025974025976, 0.008130081300813009, 0.006944444444444444, 0.015, 0.010869565217391304, 0.008, 0, 0.004651162790697674, 0, 0, 0, 0.02027027027027027, 0, 0.0048543689320388345, 0.009009009009009009, 0, 0, 0, 0.006666666666666667, 0.004672897196261682, 0.02702702702702703, 0.012738853503184714, 0.005780346820809248, 0.020202020202020204, 0.011235955056179775, 0.011904761904761904, 0.02040816326530612, 0, 0, 0.005747126436781609, 0, 0.040983606557377046, 0, 0.008849557522123894, 0.017094017094017096, 0.006024096385542169, 0.006535947712418301, 0.022727272727272728, 0, 0.02654867256637168, 0, 0, 0.006896551724137931, 0.011764705882352941, 0, 0.010416666666666666, 0.018518518518518517, 0, 0, 0, 0.016666666666666666, 0, 0.007575757575757576, 0, 0, 0.038461538461538464 ]

[ "Rogers Media uses cookies for personalization, to customize its online advertisements, and for other purposes. ", "Learn more or change your cookie preferences. ", "Rogers Media supports the Digital Advertising Alliance principles. ", "By continuing to use our service, you agree to our use of cookies.", "\n\nWe use cookies (why?) ", "You can change cookie preferences. ", "Continued site use signifies consent.", "\n\nNews\n\nVoracek scored the Flyers only goal in a 2-1 loss to the Panthers on Tuesday.", "\n\nImpact\n\nAfter some early season outbursts, Voracek has settled in and has earned a point in five of the last six games. ", "As usual, he's on pace for about 20 goals and is close to a point per game. ", "Voracek has five goals and 17 points with a minus-3 rating in 18 games this season.", "\n\nNews\n\nVoracek is heating up again, as he has points in each of the last three games.", "\n\nImpact\n\nIt started with his performance on Oct. 30, where he posted five shots on goal. ", "Since then, he's recorded seven more shots in the last three contests and has a goal and three points during that stretch. ", "Other than that, it's been a relatively quiet last couple of weeks for Voracek, and yet, he's still averaging a point per game. ", "He has four goals and 15 points in 15 contests.", "\n\nNews\n\nVoracek hasn't recorded a point in three straight games, and yet, he's still averaging a point per contest this season.", "\n\nImpact\n\nIt's been a quiet couple nights, but three multi-point games in October let Voracek end the month with 12 points in 12 games. ", "Owners would like more consistency in November, but it's hard to take issue with that kind of overall production. ", "Voracek has recorded at least 81 points in two of the last four seasons, so a point per game is certainly nothing new for the Flyers star.", "\n\nNews\n\nVoracek scored two goals and three assists while adding six shots, two hits and a plus-3 rating in Wednesday's 7-4 win over the Senators.", "\n\nImpact\n\nHe got Philly on the board with a power-play marker in the first period, then added a helper with the man advantage in the third period for his fourth point of the night as the team put Ottawa away. ", "Voracek had three assists in three games coming into Wednesday, but this eruption gives him a head start on matching or exceeding last season's 85-point career-best campaign.", "\n\nNews\n\nVoracek dished out two assists -- one on the power play -- in Thursday's 5-2 win over the Flyers.", "\n\nImpact\n\nVoracek has been around since 2008, so it's easy to forget he's still just 29 years of age. ", "That means one of the league's most gifted passers is still in his prime and ready to contend for the 80-point mark again after eclipsing it twice in the past four seasons.", "\n\nNews\n\nVoracek dialed up an even-strength assist and another on the power play in Monday's 3-1 preseason win over the Islanders.", "\n\nImpact\n\nVoracek ranked fourth in the NHL with 65 apples last campaign, but he's also reached 20 goals in back-to-back years. ", "While the Czech winger is not very accurate (9.2 career shooting percentage), he makes up for it as a high-volume shooter, averaging 230 shots over the last five years in Philly.", "\n\nNews\n\nVoracek scored an assist during a 5-1 loss during Game 3 on Sunday to Pittsburgh.", "\n\nImpact\n\nThe tally was Voracek's second straight game with an apple, but he also committed a four minute penalty which was a turning point in the contest. ", "So far in the physical series, the Czech native has been logging immense minutes on the power play -- he's averaging 5:46 of time per game -- but Philadelphia's top unit hasn't had the same regular season success that ranked the team 10th in the NHL, but his assist from Game 2 was on the man advantage. ", "Like the regular season, it also seems head coach Dave Hakstol is keen on leaving Voracek on the second line with Nolan Patrick and Oskar Lindblom, which will limit his five-on-five scoring. ", "However, if Philadelphia's power play is able to start clicking, Voracek's steady presence on the right circle is usually a key facilitating piece.", "\n\nNews\n\nImpact\n\nAfter missing the scoresheet in three consecutive games, this was a welcomed multi-point showing from Voracek. ", "He's now up to 19 goals and 63 assists through 79 games and has a good shot of posting his first career point-per-game campaign. ", "The veteran is never going to fill the net, but with 34 power-play points, 224 shots, 44 PIM and a plus-11 rating, Voracek has been a strong cross-category contributor this season.", "\n\nNews\n\nVoracek scored a goal and picked up an assist in a 6-3 win over the Capitals on Sunday.", "\n\nImpact\n\nThis helper gives Voracek 60 assists on the season, a new personal best that also has him tied for the league lead. ", "Additionally, though the Czech didn't notch a power-play point in this game, his 33 points with the extra man is tied for a career high as well (not to mention it's rather impressive).", "\n\nNews\n\nVoracek scored a goal and added an assist in Saturday's 7-6 shootout loss to the Flyers.", "\n\nImpact\n\nVoracek remains the NHL's best set-up man -- his 57 helpers lead the nearest competitor by two. ", "And he's on pace to establish a new career mark in points overall. ", "Voracek is 28, which seems a bit old in today's NHL. ", "But he's playing like a boss. ", "Use him well." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.014925373134328358, 0, 0, 0, 0, 0.011764705882352941, 0.00819672131147541, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007246376811594203, 0, 0, 0, 0.009523809523809525, 0, 0, 0.007751937984496124, 0.007874015748031496, 0, 0, 0.00641025641025641, 0.003289473684210526, 0.015706806282722512, 0.006802721088435374, 0, 0, 0.005555555555555556, 0.010526315789473684, 0, 0, 0.010416666666666666, 0.009433962264150943, 0, 0.018867924528301886, 0, 0 ]

[ "Krauss-Maffei Wegmann\n\nKrauss-Maffei Wegmann GmbH & Co. KG (KMW) is a defence company based in Munich, Germany. ", "The company produces various types of equipment as well as railroad locomotives, tanks, self-propelled artillery, and other armoured vehicles.", "\n\nKrauss-Maffei Wegmann should not be confused with a separate present-day company, KraussMaffei Group, which is also descended from the original Krauss-Maffei merger. ", " KraussMaffei Group manufactures injection molding machines, machines for plastics extrusion technology, and reaction process machinery; it was acquired by ChemChina in 2016.", "\n\nHistory\nKMW's predecessor company, Krauss-Maffei, was formed in 1931 from a merger of the two Munich firms of Maffei (founded 1838) and Krauss & Co. (founded 1860). ", "Both belonged to the leading German makers of locomotives of various types. ", "Maffei also built other steam-operated vehicles and, later, manufactured vehicles with combustion engines, including locomotives, trolleybuses and buses until the 1950s.", "\n\nThe production of armoured vehicles was later spun off and merged with the company Wegmann to form Krauss-Maffei Wegmann. ", "Siemens had a 49% stake, but Wegmann & Co. Unternehmens-Holding KG in Kassel bought this stake in December 2010 to become the sole shareholder of KMW. ", "The family holding is owned by about 26 silent partners. ", "The partners are members of the families Bode, von Braunbehrens, von Maydell and Sethe and are all descendants of the firm's founders or the later owners of Wegmann & Co.\n\nIn 2015, Krauss-Maffei Wegmann merged with the French state-owned defence company Nexter Systems. ", "KMW is now a subsidiary of a newly formed holding company, 50% of which are in turn controlled by the former owners of the German company.", "\n\nProducts\nExamples include:\nLeopard 1 main battle tank\nLeopard 2 main battle tank\nPzH 2000 self-propelled howitzer\nFlugabwehrkanonenpanzer Gepard self-propelled anti-aircraft artillery\nDingo 1 & 2 infantry mobility vehicle\n Panzerschnellbrücke 2\nFLW 100 and FLW 200 remote weapon stations\nGrizzly highly protected vehicle\nGTK Boxer armoured fighting vehicle\nMARS tracked multiple rocket launcher\nArtillery Gun Module (AGM), which has been further developed into the Donar self-propelled howitzer\nMungo ESK armoured transport vehicle\nLeguan armoured bridge layer\nPuma infantry fighting vehicle\nFennek armoured reconnaissance vehicle\nF2 wheeled armoured vehicle\n\nImages\n\nReferences\n\nExternal links\n Official website\n \n\nCategory:Defence companies of Germany\nCategory:Military vehicle manufacturers\nCategory:Locomotive manufacturers of Germany" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.026785714285714284, 0, 0.005952380952380952, 0.011494252873563218, 0.011976047904191617, 0, 0, 0.016129032258064516, 0.033112582781456956, 0, 0.018518518518518517, 0.007246376811594203, 0.007142857142857143 ]

[ "Rashad Evans will live to fight another day.", "\n\nDespite losing his last four fights in a row, the former UFC light heavyweight champion has decided against retirement, Evans told MMAFighting.com recently.", "\n\n“I can’t retire like this,” he said. “", "I would never know peace again in my life. ", "Endless nights I would be left looking at the ceiling unable to accept reality.”", "\n\nEvans hasn’t won since his November 2013 victory over Chael Sonnen. ", "Since then he’s dropped decisions to Ryan Bader, Daniel Kelly, Sam Alvey and was knocked out by Glover Teixeira. ", "He’s also battled multiple knee injuries during that four-year period.", "\n\nEarlier this year, Evans dropped down to middleweight to rekindle his career, however, he’s 0-2 at 185 pounds. ", "He said he’s now considering moving back up to light heavyweight.", "\n\n“I have to talk that over, but I feel like at 205 I had more energy,” he said.", "\n\nEvans, who beat Forrest Griffin to become light heavyweight champion in 2008, doesn’t have a fight booked. ", "His current plan is to return to action in early 2018." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.022727272727272728, 0.012658227848101266, 0, 0, 0, 0.014285714285714285, 0.035398230088495575, 0, 0.008849557522123894, 0, 0, 0.009174311926605505, 0 ]

[ "Q:\n\nTF30172: You don't have permission\n\nI have a tfs server installed, and it allow me to connect, but when try to create a team project, it shows this message.", "\nTF30172: You do not have permission to create a new team project.", "\n\nAll my permission are currently set, or at at least I think so.", "\nWhat else can I check?", "\n\nA:\n\nThis is a know issue with Visual Studio 2010 and Team Foundation Server 2012.", "\nFrom Buck Hodges' blog:\n\nYou must use the Visual Studio Team Explorer 2012 (included in all Visual Studio editions or may be separately downloaded) to create a team project on a TFS 2012 server. ", " If you use VS 2010, you will get an error about not having permission. ", " The error message is very misleading, because it’s not a problem with your permissions.", "\n\nYou should to install this hotfix to resolve this issue.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0, 0, 0.024096385542168676, 0.015306122448979591, 0, 0, 0, 0 ]

[ "Introduction\n============\n\nIntestinal microbes live in a complex and dynamic ecosystem, and to survive in this highly competitive environment, they have developed close (symbiotic) associations with a diverse array of other intestinal microbes and with their host. ", "This has led to a complex network of host-microbe and microbe-microbe interactions in which the intestinal microbes and the host co-metabolise many substrates ([@ref-3]; [@ref-59]). ", "In addition to competition for readily available carbohydrates in the diet, intestinal microbes are able to extract energy from dietary polysaccharides that are indigestible by the host ([@ref-21]). ", "Furthermore, intestinal microbes can utilize host-derived secretions (e.g., mucus) as substrates for metabolic processes ([@ref-48]). ", "In turn, the metabolic activities of the intestinal microbes result in the production of a wide array of compounds, of which some are important nutrients for the host. ", "For example, short chain fatty acids (SCFA), the main end-products of bacterial fermentation in the gut, can be readily absorbed by the host and further metabolized as energy sources ([@ref-20]; [@ref-36]). ", "All together, the metabolic activity of the intestinal microbiota has a major impact on the health of the host, and recent studies have indicated an important role for microbial activity in diseases such as inflammatory bowel disease, irritable bowel syndrome and obesity ([@ref-25]; [@ref-50]).", "\n\nWe only have a limited understanding of the heterogeneity in microbial community composition and activity in different niches along the length of the intestinal tract. ", "To unravel the functional contribution of specific intestinal microbes to host physiology and pathology, we have to understand their metabolic capabilities at a higher resolution. ", "It is still difficult, however, to associate a functionality in this ecosystem to specific sets of genes and in turn to individual microbial species, and vice versa. ", "To this end, the combination of genome mining and functional analyses with single microbes or with simple and defined communities can provide an overall insight in the genetic and functional potential of specific members of the intestinal microbial community ([@ref-28]; [@ref-42]; [@ref-74]).", "\n\nAs mentioned above, intestinal microbes have adapted or even specialized in foraging certain niche-specific substrates. ", "However, little is known about the adaption of intestinal microbes to the conditions in the small intestine ([@ref-9]; [@ref-70]; [@ref-76]). ", "Community composition and activity in the small intestine is largely determined by the host digestive fluids such as gastric acid, bile and pancreatic secretions. ", "The small intestine is a nutrient-rich environment, and previous studies have shown that the microbial communities in the (human) small intestine are driven by the rapid uptake and conversion of simple carbohydrates ([@ref-77]; [@ref-41]). ", "Genomic studies of small intestinal isolates have indicated environment-specific adaptations to the small intestine with respect to their carbohydrate utilization capacities, which was evidenced by the presence of a wide array of genes involved in nutrient transport and metabolism of, mainly simple, carbohydrates ([@ref-69]).", "\n\nHere we describe a model driven genomic analysis of the small intestinal inhabitant *Romboutsia ilealis* CRIB^T^ ([@ref-24]). *", "R. ilealis* CRIB^T^ is currently still the only isolate of the recently descibed species *R. ilealis*, a species that belongs to the family *Peptostreptococcaceae,* of which many members are common intestinal microbes including the well-known species *Clostridioides difficile* (previously known as *Clostridium difficile*) and *Intestinibacter bartlettii* (previously known as *Clostridum bartlettii*) ([@ref-23]). ", "An overview of the metabolic capabilities and nutritional potential of the type strain of *R. ilealis* CRIB^T^ is provided here to identify potential mechanisms that enable this organism to survive in the competitive small intestinal environment.", "\n\nMaterials and Methods\n=====================\n\nGenome sequencing, assembly and annotation\n------------------------------------------\n\n*R. ilealis* CRIB^T^ (DSM 25109) was routinely cultured in CRIB medium at 37 °C as previously described ([@ref-24]). ", "Genomic DNA extraction was performed as previously described ([@ref-69]). ", "Genome sequencing was done using 454 Titanium pyrosequencing technology (Roche 454 GS FLX), as well as Illumina (Genome Analyzer II and HiSeq2000) and PacBio sequencing (PacBio RS). ", "Mate-pair data was generated by BaseClear (Leiden, the Netherlands). ", "All other data was generated by GATC Biotech (Konstanz, Germany). ", "The genome was assembled in a hybrid approach with multiple assemblers. ", "In short, after estimation of the genome size, assembly of the genome was performed with two different assemblers in parallel using the different sequence datasets. ", "After merging the two assemblies three rounds of scaffolding were performed, once with paired-end data and twice with mate-pair data. ", "Gap-filling was performed after each scaffolding step.", "\n\nGenome annotation was carried out with an in-house pipeline. ", "Prodigal v2.5 was used for prediction of protein coding DNA sequences (CDS) ([@ref-31]), InterProScan 5RC7 for protein annotation ([@ref-30]), tRNAscan-SE v1.3.1 for prediction of tRNAs ([@ref-43]) and RNAmmer v1.2 for the prediction of rRNAs ([@ref-35]). ", "Additional protein function predictions were derived via BLAST identifications against the UniRef50 ([@ref-64]) and Swissprot ([@ref-68]) databases (download August 2013). ", "Afterwards the annotation was further enhanced by adding EC numbers via PRIAM version March 06, 2013 ([@ref-12]). ", "Non-coding RNAs were identified using rfam_scan.pl v1.04, on release 11.0 of the RFAM database ([@ref-10]). ", "CRISPRs were annotated using CRISPR Recognition Tool v1.1 ([@ref-8]).", "\n\nQualitative metabolic modelling has been performed with Pathway tools v18.0 ([@ref-38]). ", "A generic default medium consisting out of ammonia/urea, sulfite, hydrogen sulfide and phosphate was assumed, and the qualitative possibility to produce all necessary biomass metabolites was tested with the supply of different carbohydrates, which had been tested before *in vitro*.", "\n\nSee the Supplemental Methods in [Text S1](#supp-1){ref-type=\"supplementary-material\"} for details on the genomic DNA extraction, genome sequencing, assembly, annotation, and metabolic modelling.", "\n\nWhole-genome transcriptome analysis\n-----------------------------------\n\n*R. ilealis* CRIB^T^ was grown in a basal bicarbonate-buffered medium ([@ref-63]) supplemented with 16 g/L yeast extract (BD, Breda, The Netherlands) and an amino acids solution as used for the growth of *C. difficile* ([@ref-32]). ", "In addition, the medium was supplemented with either 0.5% (w/v) D-glucose (Fisher Scientific Inc., Waltham, MA USA), L-fucose (Sigma-Aldrich, St. Louis, MO, USA) or fructo-oligosaccharide (FOS) P06 (DP 2-4; Winclove Probiotics, Amsterdam, The Netherlands). ", "The final pH of the medium was adjusted to 7.0. ", "For each condition, triplicate cultures were set up. ", "For RNA-seq analysis, the cells were harvested in mid-exponential phase (OD~600 nm~  = 0.25--0.55, ∼8--10 h incubation) ([Table S1](#supp-5){ref-type=\"supplementary-material\"}).", "\n\nTotal RNA was purified using the RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany). ", "Depletion of rRNA was performed using the Rib-Zero™ Kit for bacteria (Epicentre Biotechnologies, Madison, WI, USA). ", "The ScriptSeq™ v2 RNA-seq Library Preparation Kit in combination with ScriptSeq™ Index PCR primers (Epicentre Biotechnologies) was used for library construction for whole-transcriptome sequencing (RNA-seq). ", "The barcoded cDNA libraries were pooled and sent to GATC Biotech (Konstanz, Germany) where 150 bp sequencing was performed on one single lane using the Illumina HiSeq2500 platform in combination with the TruSeq Rapid SBS (200 cycles) and TruSeq Rapid SR Cluster Kits (Illumina Inc., San Diego, CA, USA). ", "Reads were mapped to the genome with Bowtie2 v2.0.6 ([@ref-37]) using default settings, after quality control (rRNA removal, adapter trimming, and quality trimming) had been performed. ", "Details on the RNA-seq raw data analysis can be found in [Table S2](#supp-6){ref-type=\"supplementary-material\"} and Supplemental Methods in [Text S1](#supp-1){ref-type=\"supplementary-material\"}.", "\n\nGene expression abundance estimates and differential expression analysis was performed using Cuffdiff v2.1.1 ([@ref-67]) with default settings. ", "Differentially expressed genes were determined by pairwise comparison of a given condition to the other three conditions for a total of six pairwise comparisons. ", "Genes were considered significantly differentially expressed when they showed a ≥1.5 log2 (fold change) in any of the conditions with a false discovery rate (FDR)-corrected *P* value (*q* value) ≤ 0.05 ([Tables S3](#supp-7){ref-type=\"supplementary-material\"}--[S6](#supp-10){ref-type=\"supplementary-material\"}). ", "Principal component analysis was performed with Canoco 5.0 ([@ref-66]) on log-transformed gene transcript abundances using Hellinger standardization. ", "Gene expression heatmaps were generated based on gene transcript abundances using R v3.1.0 and R-packages svDialogs and gplots.", "\n\nSee the Supplemental Methods in [Text S1](#supp-1){ref-type=\"supplementary-material\"} for details on growth on different carbohydrate media and whole genome transcriptome analysis.", "\n\nMetagenomic investigations\n--------------------------\n\nThe datasets [PRJNA237362](http://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA237362) ([@ref-27]) and [PRJNA298762](http://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA298762) ([@ref-1]) were analysed as relevant representative publicly available 16s rRNA gene amplicon datasets for the presence of 16S rRNA gene sequences closely related to that of *R. ilealis* with NG-Tax version 0.3 ([@ref-51]) with the--classifyRatio argument set to 0.9.", "\n\nNucleotide sequence accession number\n------------------------------------\n\nAll related data have been deposited in the European Nucleotide Archive. ", "The raw reads for the genome of *R. ilealis* CRIB^T^ can be accessed via the accession numbers [ERR366773](https://www.ncbi.nlm.nih.gov/sra?term=ERR366773), [ERX397233](https://www.ncbi.nlm.nih.gov/sra?term=ERX397233), [ERX397242](https://www.ncbi.nlm.nih.gov/sra?term=ERX397242) and [ERX339449](https://www.ncbi.nlm.nih.gov/sra?term=ERX339449). ", "The assembly can be accessed under [LN555523](http://www.ncbi.nlm.nih.gov/nuccore/LN555523)--[LN555524](http://www.ncbi.nlm.nih.gov/nuccore/LN555524). ", "The RNAseq data have been deposited under the numbers [ERS533849](https://www.ncbi.nlm.nih.gov/sra?term=ERS533849)--[ERS533860](https://www.ncbi.nlm.nih.gov/sra?term=ERS533860).", "\n\nResults\n=======\n\nGenome analysis\n---------------\n\n### Global genome features\n\n*R. ilealis* CRIB^T^ contains a single, circular chromosome of 2,581,778 bp and a plasmid of 6,145 bp ([Table 1](#table-1){ref-type=\"table\"} and [Fig. ", "1](#fig-1){ref-type=\"fig\"}). ", "The chromosome contains 2,351 predicted protein CDS, of which 321 were annotated as hypothetical and for 91, only a domain of unknown function could be assigned. ", "The plasmid carries eight predicted protein CDS, of which none was recognized for having a metabolic or replicative function. ", "Furthermore, it appears to be a non-mobilizable plasmid, given that it lacks any known mobilization-associated genes. ", "The overall G + C content of the genome is 27.9%, which is in good agreement with a G + C content of 28.1 mol% previously determined for *R. ilealis* CRIB^T^ by HPLC methods ([@ref-24]).", "\n\n10.7717/peerj.3698/table-1\n\n###### General features of the *R. ilealis* CRIB^T^ genome.", "\n\n![](", "peerj-05-3698-g005)\n\n Chromosome Plasmid\n ------------------------ -------------------------------------- ---------\n Size (bp) 2,581,778 6,145\n G + C content (%) 27.9 29.3\n Protein CDS 2,351 8\n Pseudogenes 12 0\n Coding density 1.10 1.02\n Average gene size (bp) 899 531\n rRNA genes \n 16S rRNA genes 14 0\n 23S rRNA genes 14[^a^](#table-1fn1){ref-type=\"fn\"} 0\n 5S rRNA genes 14 0\n tRNAs 109 0\n ncRNAs 28 0\n CRISPR repeats 1[^a^](#table-1fn1){ref-type=\"fn\"}71 0\n\n**Notes.**", "\n\nAn additional 23S rRNA gene is expected in one of the gaps.", "\n\n![", "Circular map of the *R. ilealis* CRIB^T^ genome.\\\nBoth chromosome and non-mobilizable plasmid are shown. ", "For the chromosome tracks from inside to outside are as follows: 1, GC skew; 2, G + C content; 3, RNAs \\[rRNAs (blue), tRNAs (orange) and ncRNAs (purple)\\]; 4, all predicted protein CDS \\[with predicted function (light-blue), hypothetical proteins and proteins to which only a domain of unknown function could be assigned (grey)\\]; 5, genes or gene clusters of interest \\[(mobile genetic elements (red), Cas proteins (pink), urease gene cluster (yellow), choloylglycine hydrolase (black), gene clusters involved in carbohydrate utilization (green)\\]. ", "For the plasmid tracks from inside to outside are as follows: 1, GC skew; 2, G + C content; 3, all predicted CDS.](peerj-05-3698-g001){#fig-1}\n\nWith a total of 14 copies of the 16S ribosomal RNA (rRNA) gene, *R. ilealis* CRIB^T^ is among the species with the highest number of 16S rRNA gene copies reported up to this date ([@ref-40]). ", "High numbers of rRNA operons have been proposed to be indicative for fast growth and to allow microbes to respond quickly to changes in available resources ([@ref-33]). ", "In addition, a high copy number of the rRNA operon has been suggested to be essential for successful sporulation and germination ([@ref-75]). ", "This is also reflected in the observation that in general the species that contain the highest number of reported rRNA operons, including *R. ilealis* CRIB^T^, belong to the spore-forming bacterial orders *Bacillales* and *Clostridiales*. ", "Not all of the 16S rRNA gene copies in *R. ilealis* CRIB^T^ are embedded in the conserved 16S-23S-5S rRNA operon structure. ", "Of the fifteen locations containing rRNA genes, ten are in the classical order 16S-23S-5S. The other five operons are characterized by duplicated or missing rRNA genes, or a different order of the genes. ", "It should be noted that the current assembly contains three gaps, all of which are located within rRNA operons. ", "Diverging rRNA operon structures have been reported for other genomes containing multiple rRNA operons, as a result of duplications ([@ref-6]; [@ref-58]).", "\n\nA cluster of orthologous genes (COG) category ([@ref-65]) could be assigned to 1,647 of the predicted proteins (70%) including 372 proteins (16%) assigned to the categories R (general function prediction only) and S (function unknown) ([Fig.", " S1](#supp-2){ref-type=\"supplementary-material\"}). ", "With InterProScan a predicted function could be assigned to 82% of the predicted proteins. ", "Based on the InterPro and PRIAM classifications ([@ref-12]), an enzymatic function could be predicted for more than 500 proteins.", "\n\n### General metabolic pathways\n\nAnalysis of the CDS predicted from the *R. ilealis* CRIB^T^ genome revealed the presence of a complete set of enzymes for the glycolytic pathway. ", "In line with the anaerobic lifestyle of the organism, enzymes for the oxidative phase of the pentose phosphate pathway could not be detected. ", "Additionally, the genes that encode enzymes involved in the tricarboxylic acid cycle were lacking. ", "Subsequently a metabolic model was constructed with Pathway tools v18.0. ", "A flux balance analysis with the model was performed, suggesting that *R. ilealis* CRIB^T^ is a mixed acid fermenter as previously reported ([@ref-24]). ", "Predicted end products of fermentation are a mixture of acetate, formate, lactate and ethanol, with the possibility of gas formation (CO~2~ and H~2~). ", "In addition to ethanol, which can be produced during mixed acid fermentation, 1,2-propanediol was predicted to be formed via the L-fucose degradation pathway. ", "The fermentation end products formate, acetate and lactate are predicted to be produced from pyruvate. ", "No other solvents were predicted to be produced by the metabolic model. ", "The only metabolite produced by *R. ilealis* CRIB^T^ that was not accounted for by the metabolic model, was propionate. ", "None of the three established pathways for propionate production in the intestinal tract, i.e., the succinate, acrylate or the propanediol pathway ([@ref-52]), could be identified at the genetic level in the genome of *R. ilealis* CRIB^T^. Although propionate is only produced in low amounts (max. ", "3 mM in 24 h) it is noteworthy because propionate production was observed repeatedly during *in vitro* growth in this study (see [Table 2](#table-2){ref-type=\"table\"}) and as previously reported ([@ref-24]).", "\n\n10.7717/peerj.3698/table-2\n\n###### Fermentation end products of *R. ilealis* CRIB^T^ produced during growth on different carbohydrates (glucose, FOS or L-fucose) or in basal medium in the absence of a carbon source (control condition).", "\n\nSamples were obtained during mid-exponential phase (∼8--10 h incubation; used for transcriptome analysis) and in stationary phase (24 h incubation). ", "For the control cultures, fermentation products are shown for the individual cultures separating the carbohydrates used for preconditioning of the inoculum. ", "For the three other conditions, values represent means of triplicate cultures with standard deviations.", "\n\n![](", "peerj-05-3698-g006)\n\n Formate (mM) Acetate (mM) Propionate (mM) Lactate (mM) 1,2-propane-diol (mM) \n ---------------------------------- -------------- -------------- ----------------- -------------- ----------------------- ----------- ------ ----------- ----------- -----------\n Control: basal medium \n (glucose inoc.) ", " 3.2 7.7 2.0 6.2 2.0 2.2 N.D. N.D. N.D. N.D.\n (FOS inoc.) ", " 4.5 9.2 2.4 7.4 2.4 2.9 N.D. N.D. N.D. N.D.\n (L-fucose inoc) 4.8 10.8 2.3 9.8 2.3 3.0 N.D. N.D. 1.0 1.0\n Basal medium + glucose (5% w/v) 4.4 ± 1.2 28.2 ± 4.3 1.0 ± 0.9 16.3 ± 2.2 1.0 ± 0.9 1.3 ± 0.1 N.D. 3.0 ± 0.7 N.D. N.D.\n Basal medium + FOS (5% w/v) 4.7 ± 0.6 27.3 ± 2.5 1.4 ± 0.0 17.7 ± 1.4 1.4 ± 0.0 1.6 ± 0.1 N.D 2.5 ± 0.3 N.D. N.D.\n Basal medium + L-fucose (5% w/v) 6.7 ± 0.1 19.5 ± 3.6 2.8 ± 0.1 16.3 ± 2.9 2.8 ± 0.1 2.8 ± 0.4 N.D. N.D. 1.3 ± 0.1 7.7 ± 1.4\n\n**Notes.**", "\n\nN.D.not detected\n\nThe analysis of the genome and the prediction by the model indicated that fermentation is probably the main process for energy conservation in *R. ilealis.* ", "However, the presence of a sulfite reductase gene cluster (CRIB_1284-CRIB_1286) of the dissimilatory *asrC*-type ([@ref-18]) points at possible anaerobic respiration. ", "Similar siroheme-dependent sulfite reductases are found in many close-relatives of *R. ilealis* such as *I. bartlettii*, *Clostridium sordellii* and *C. difficile* ([@ref-15]). ", "Sulfite reduction by *R. ilealis* CRIB^T^, and close relatives, has been previously demonstrated *in vitro* ([@ref-24]), and increased growth yield and metabolite production was observed in the presence of sulfite for *R. ilealis* CRIB^T^ ([Table S7](#supp-11){ref-type=\"supplementary-material\"}). ", "In the intestinal tract, sulfite is derived from food sources that contain sulfite as a preservative, and it has been shown that neutrophils release sulfite as a part of the host defence against microbes ([@ref-45]).", "\n\n### Metabolism of growth factors and cofactors\n\nComplete pathways are present for the biosynthesis of the amino acids aspartate, asparagine, glutamate, glutamine and cysteine, using carbon skeletons available from central metabolites or via conversion of other amino acids. ", "However, many genes encoding enzymes required for biosynthesis of other amino acids appeared to be absent in *R. ilealis* CRIB^T^. As most missing genes are part of well-studied pathways, it is unlikely these functionalities are encoded by unknown genes and likely represent true auxotrophies. ", "The absence of genes to produce branched-chain amino acids (leucine, isoleucine and valine) was also reflected in the absence of branched chain fatty acids in the cell membrane of *R. ilealis*, which is characteristic for the genus *Romboutsia* ([@ref-24]). ", "From these observations it can be concluded that *R. ilealis* depends on a number of exogenous amino acids, peptides and/or proteins to fuel protein synthesis. ", "The dependency on an exogenous source of amino acids is reflected by the identification of multiple amino acid transporters, including an arginine/ornithine antiporter, multiple serine/threonine exchangers, a transporter for branched amino acids, and several amino acid symporters and permeases without a predicted specificity. ", "Furthermore, numerous genes were annotated as protease or peptidase, including several with a signal peptide.", "\n\n*R. ilealis* CRIB^T^ appears to contain all genes for *de novo* purine and pyrimidine synthesis, as well as for the production of the coenzymes NAD and FAD via salvage pathways from niacin and riboflavin, respectively. ", "While some organic cofactors can be produced by *R. ilealis* CRIB^T^, it mainly relies on salvage pathways (e.g., for lipoic acid) or exogenous sources for the supply of precursors, mainly in the form of vitamins (e.g., thiamin, riboflavin, niacin, pantothenate, pyridoxine, biotin, vitamin B12).", "\n\n### Carbohydrate transport and metabolism\n\nAs previously reported, *R. ilealis* CRIB^T^ is able to utilize a wide variety of carbohydrates ([@ref-24]). ", "Previously, good growth of *R. ilealis* on L-fucose, glucose, raffinose and sucrose was described, in addition to moderate growth on D-arabinose and D-galactose and weak growth on D-fructose, inulin, lactose, maltose and melibiose. ", "Growth on L-fucose, fructose, galactose, glucose, lactose, maltose, melibiose, raffinose and sucrose was predicted from the genome-scale metabolic model as well. ", "For these different carbohydrates, the genes encoding the specific carbohydrate degradation enzymes were found distributed throughout the genome in gene clusters together with their respective transporters and transcriptional regulator. ", "The only carbohydrate utilized by *R. ilealis* CRIB^T^ that was not predicted based on the metabolic model, was D-arabinose. ", "Although a separate arabinose transporter, similar to the maltose and sucrose transporters, could be identified in the genome *R. ilealis* CRIB^T^, no separate pathway for the use of D-arabinose could be predicted, However, it is likely that the L-fucose degradation pathway (encoded by genes CRIB_1294-CRIB_1298) is also used for D-arabinose utilization as is also observed in other intestinal species ([@ref-39]). ", "In addition to the carbohydrates for which growth was studied, a gene cluster involved in the degradation of the host-derived carbohydrate sialic acid could be predicted (CRIB_613-CRIB_619) ([@ref-2]). ", "The structure of this gene cluster is similar to the one identified in *C. difficile* ([@ref-47]). ", "The ability to degrade the predominantly host-derived carbohydrates, L-fucose and sialic acid, suggest a role in the utilization of mucin, an abundant host-derived glycoprotein in the intestinal tract ([@ref-16]; [@ref-48]). ", "However, no growth on mucin was observed ([Table S7](#supp-11){ref-type=\"supplementary-material\"}), which is in line with the lack of a predicted extracellular fucosidase and/or sialidase.", "\n\n### Other genes encoding niche-specific functionalities\n\nA gene cluster encoding a urease, consisting of three subunits (*ureABC*), and a number of urease accessory genes was identified (CRIB_1381-CRIB_1388). ", "The gene cluster identified in *R. ilealis* CRIB^T^ is very similar to the urease gene cluster in the genome of *C. sordellii* ([Fig. ", "S3](#supp-4){ref-type=\"supplementary-material\"}), a species in which the urease activity is used to phenotypically distinguish *C. sordellii* strains from *C. bifermentans* strains ([@ref-56]). ", "Furthermore, a possible ammonium transporter (CRIB_1389) was identified in the genome of *R. ilealis* CRIB^T^ next to the urease gene cluster. ", "Ureases are nickel-containing metalloenzymes that catalyse the hydrolysis of urea to ammonia and carbon dioxide, and thereby these enzymes allow microbes to use urea as nitrogen source by assimilation via glutamate. ", "They are ubiquitous proteins occurring in diverse organisms ([@ref-46]). ", "In the intestinal environment, where urea is abundantly present ([@ref-22]), some bacteria use ureases to survive the acidic conditions in the upper part of the intestinal tract as urea hydrolysis leads to a local increase in pH ([@ref-57]).", "\n\nAnother gene encoding a niche-specific functionality is the predicted choloylglycine hydrolase. ", "Proteins within the choloylglycine hydrolase family are bile salt hydrolases (BSHs), also known as conjugated bile acid hydrolases (CBAHs), that are widespread among intestinal microbes ([@ref-53]). ", "They are involved in the hydrolysis of the amide linkage in conjugated bile salts, releasing primary bile acids. ", "There is a large heterogeneity among BSHs, for example with respect to their substrate specificity. ", "The BSH of *R. ilealis* CRIB^T^ was found to be the most similar to the one found in *Clostridium butyricum*. ", "Although the physiological advantages of BSHs for the microbes are not completely understood, it has been hypothesized that they constitute a mechanism to detoxify bile salts and thereby enhance bacterial colonization ([@ref-15]).", "\n\nMetabolite and transcriptome analysis\n-------------------------------------\n\n### Metabolite and transcriptome analysis of *R. ilealis* CRIB^T^ during growth on different carbohydrates\n\nTo study key pathways predicted to be involved in carbohydrate utilization and their regulation in more detail, a genome-wide transcriptome analysis was performed, focussing on four experimental conditions. ", "Firstly, growth on glucose, a preferred substrate for many microbes present in the intestinal tract, was studied. ", "Secondly the growth on fructans, oligo-and polysaccharides present in many food items was examined. ", "Previously weak growth on inulin, a polysaccharide consisting of long chains of β1 → 2 linked fructose units, was observed ([@ref-24]). ", "For this study a shorter fructan (FOS P06, DP2-4) was chosen, because growth on shorter fructans is likely more relevant for microbes living in the small intestine ([@ref-77]). ", "Thirdly, growth on L-fucose was examined, as growth on this substrate was found to be unique for *R. ilealis* CRIB^T^ compared to other related microbes. ", "Finally, *R. ilealis* CRIB^T^ was also grown in the basal medium in the absence of an additional carbon source for comparison (control condition).", "\n\nBased on measurements of optical density and pH during growth (growth characteristics of individual cultures can be found in [Table S1](#supp-5){ref-type=\"supplementary-material\"}), samples were drawn in the mid-exponential phase (∼8--10 h incubation; used for transcriptome analysis) and in stationary phase (24 h incubation), and sugar utilization and fermentation products were measured with HPLC ([Table 2](#table-2){ref-type=\"table\"}). ", "In neither of the experimental conditions the supplied carbohydrates were depleted, and metabolites were still produced at the time of sampling at ∼8--10 h and 24 h, which further confirmed that samples obtained for transcriptome analysis at ∼8--10 h were taken during exponential growth. ", "In the FOS cultures, an accumulation of extra-cellular fructose was observed. ", "As predicted from the metabolic model, growth on glucose resulted in the production of formate, acetate and lactate ([Table 2](#table-2){ref-type=\"table\"}).", "\n\nGrowth on FOS was marginally lower than that on glucose, however, after 24 h of growth, the same fermentation products were observed in similar amounts ([Table 2](#table-2){ref-type=\"table\"}). ", "Growth on L-fucose showed production of 1,2-propanediol instead of lactate. ", "The fact that 1,2-propanediol was observed in one of the control cultures could be explained by the fact that an L-fucose grown culture was used as inoculum for this culture, leading to carry-over of minor amounts of metabolites.", "\n\nFor the genome-wide transcriptome analysis of triplicate cultures grown in the four different conditions (i.e., a total of 12 cultures), a total of 159,250,634 150 bp-reads were generated by RNA-seq (overview in [Table S2](#supp-6){ref-type=\"supplementary-material\"}). ", "Principal component analysis of the transcriptomes of the individual cultures showed that the cultures clustered by condition ([Fig. ", "2](#fig-2){ref-type=\"fig\"}).", "\n\n{#fig-2}\n\n### Differential expression of genes involved in carbohydrate degradation and fermentation in *R. ilealis* CRIB^T^\n\nTo identify differentially regulated genes, pairwise comparisons were done with cuffdiff ([@ref-67]) using a cut off of ≥1.5 log2 (fold-change) and *q*-value ≤ 0.05. [", "Figure 3](#fig-3){ref-type=\"fig\"} shows a heat map of all differentially regulated genes, and exact numbers can be found in [Tables S3](#supp-7){ref-type=\"supplementary-material\"}--[S6](#supp-10){ref-type=\"supplementary-material\"}.", "\n\n{#fig-3}\n\nThe gene cluster involved in glycolysis (CRIB_186-CRIB_191) was most abundantly expressed in the conditions that support the highest growth rates determined by the highest cell density reached in the time period that was measured (glucose, followed by FOS; [Fig.", " 3](#fig-3){ref-type=\"fig\"}). ", "This was also reflected in the fact that expression of genes encoding proteins involved in replication such as ribosomal proteins, proteins involved in cell wall biosynthesis and general cell division processes were most strongly expressed during growth in the presence of glucose and to a lesser extent FOS. ", "Other genes involved in the central sugar metabolic pathways (e.g., CRIB_1849, CRIB_140, CRIB_2223, and CRIB_105) were upregulated in these conditions, albeit not significantly differentially regulated. ", "This suggests that these genes are less tightly regulated at the transcriptional level, probably because they are also involved in other processes than sugar degradation ([@ref-13]). ", "The metabolic model suggests that this is indeed the case, as some of the enzymes produce intermediates which can be consumed by fatty acid biosynthesis and amino acid biosynthesis processes.", "\n\nAltogether, the transcriptome of *R. ilealis* CRIB^T^ grown on FOS was very similar to its transcriptome when grown on glucose ([Fig. ", "2](#fig-2){ref-type=\"fig\"}), with only 18 genes significantly upregulated during growth in the presence of FOS compared to glucose ([Table S4](#supp-8){ref-type=\"supplementary-material\"}). ", "Apparent was the upregulation of the gene clusters that code for proteins involved in the transport and degradation of the respective sugars or their derivatives ([Fig. ", "3](#fig-3){ref-type=\"fig\"}). ", "In the presence of glucose, the glucose-specific PTS system (CIRB_2017-CRIB_2018) was significantly upregulated, together with its associated transcriptional regulator (CRIB_2019). ", "In turn, in the presence of FOS, two clusters predicted to be involved in sucrose degradation (CRIB_148-CRIB_152 and CRIB_1458-1461) were significantly upregulated. ", "The third gene cluster predicted to be involved in sucrose degradation (CRIB_1399-1400) was not significantly regulated during growth on FOS. ", "However, it should be noted that these genes are located in a cluster functionally annotated to melibiose metabolism and are most likely regulated by the transcriptional regulator in this cluster. ", "In addition to the two sucrose degradation clusters, a transport cluster of unknown function (CRIB_1506-CRIB_1509) was upregulated during growth on FOS, albeit only significantly when compared to growth on glucose. ", "During growth in the presence of L-fucose, the gene cluster predicted to be involved in L-fucose degradation (CRIB_1294-CRIB_1298) was significantly upregulated, including the gene encoding the corresponding transcriptional regulator (CRIB_1299). ", "An overview of the main carbohydrate degradation pathways regulated in the different conditions is given in [Fig. ", "4](#fig-4){ref-type=\"fig\"}.", "\n\n{#fig-4}\n\nDuring growth on glucose, L-lactate dehydrogenase (CRIB_684) was significantly upregulated, albeit not significantly compared to growth on FOS. ", "This enzyme catalyses the reduction of pyruvate resulting in the production of L-lactate and the reoxidation of the NADH formed during glycolysis. ", "Only at the time point of 24 h, lactate was observed ([Table 2](#table-2){ref-type=\"table\"}). ", "This suggests that at time point ∼8--10 h the cells were starting to regenerate NAD by upregulating this gene. ", "In the presence of L-fucose, NAD^+^ regeneration is achieved via the reduction of lactaldehyde to 1,2-propanediol by lactaldehyde reductase (CRIB_1300), which was upregulated in the presence of L-fucose together with the L-fucose degradation gene cluster. ", "In the spent medium of L-fucose grown cells, 1,2-propanediol was already seen at time point ∼8--10 h, whereas no lactate production was observed. ", "Another way to regenerate NAD^+^ is to reduce pyruvate to ethanol ([Fig. ", "4](#fig-4){ref-type=\"fig\"}). ", "In the presence of both glucose and FOS, an upregulation was seen for the gene encoding the bifunctional aldehyde/alcohol dehydrogenase (CRIB_2231), which converts acetyl-CoA to ethanol. ", "However, there were no samples in which ethanol was measured by HPLC analysis.", "\n\nDuring growth on FOS, a small gene cluster (CRIB_601-CRIB_603) that includes a gene encoding an alternative sigma factor was significantly upregulated. ", "This was also apparent in the control culture that was inoculated with FOS-preconditioned cells. ", "This suggests that in the presence of FOS (or its derivatives sucrose or fructose) transcription is also regulated by RNA polymerase promoter recognition.", "\n\n### Expression and regulation of other environmentally relevant functions in *R. ilealis* CRIB^T^\n\nNoteworthy was the significant upregulation of a gene cluster related to iron transport (CRIB_892-CRIB-898) during growth on glucose and FOS compared to growth on L-fucose. ", "The significance of this gene cluster for carbohydrate utilization is not known, however, several enzymes could be identified in the genome of *R. ilealis* CRIB^T^ that use different forms of iron as cofactor, for example the hydrogenases involved in hydrogen metabolism ([@ref-11]), several ferredoxins, and the L-threonine dehydratase (CRIB-426) that was significantly upregulated during growth on L-fucose. ", "As multiple transporters involved in the transport of iron compounds were predicted, it is possible that the uptake of iron provides a competitive advantage to other microbes that are dependent on iron for respiration and other metabolic processes ([@ref-34]).", "\n\nPrevalence of *R. ilealis* in human datasets\n--------------------------------------------\n\n*R. ilealis* was found to be a natural and abundant inhabitant of the rat small intestine, specifically of the ileum ([@ref-26]). ", "To study its prevalence in humans, 16S rRNA amplicon sequencing datasets were investigated for the presence of *R. ilealis*-like 16S rRNA gene sequences. ", "Unfortunately, with respect to composition analysis of human ileum samples, there is only a limited number of datasets available due to the sampling difficulties that are the result of the inaccessibility of this part of the intestinal tract. ", "In the dataset published by [@ref-1], a paediatric human dataset with samples from both healthy individuals and inflammatory bowel disease patients, we were not able to identify any *Romboutsia*-like 16S rRNA gene sequences. ", "In the dataset published by [@ref-27], one of the biggest 16S rRNA gene datasets published to date that includes samples obtained from multiple gastrointestinal locations (ileal and rectal biopsies and faecal samples) from both healthy individuals and inflammatory bowel disease patients, only a limited number of *R. ilealis*-like 16S rRNA gene sequences could be identified. ", "In this dataset, the genus *Romboutsia* could be identified in two samples, with a relative abundance of 0.1% and 0.2%. ", "In 173 cases the family *Peptostreptococcaceae* could be identified in these samples, but it was not possible to differentiate between the genera *Romboutsia* and *Intestinibacter*, due to 100% identity of their rRNA gene sequences in this region. ", "The *Peptostreptococcaceae*-positive samples were obtained from both healthy and diseased individuals (including at least one with ileal overgrowth and a *Peptostreptococcaceae* abundance of 46%). ", "It should be noted that both datasets contain only sequence data from paediatric ileal biopsy samples and therefore only mucosa-associated microbiota could be studied limited to a human population \\<17 years of age, which could explain the low prevalence of *R. ilealis*-like 16S rRNA gene sequences. ", "Unfortunately, due to the limited number of available human datasets and the low prevalence of *R. ilealis*-like 16S rRNA gene sequences in ileal biopsy samples, it was not possible to find positive or negative correlations between prevalence and/or abundance of *R. ilealis* and specific human diseases.", "\n\nDiscussion\n==========\n\n[@ref-26] have shown by 16S rRNA gene sequence-based analysis that *R. ilealis* CRIB^T^ is a dominant member of the small intestine microbiota in rats, especially in the ileum. ", "The genomic and transcriptomic analysis of *R. ilealis* CRIB^T^ reported here provides new insights into the genetic and functional potential of this inhabitant of the small intestine. ", "Genomic analysis revealed the presence of metabolic pathways for the utilization of a wide array of simple carbohydrates in addition to a multitude of carbohydrate uptake systems that included a series of PTS systems, carbohydrate specific ABC transporters, permeases and symporters. ", "This is in agreement with prior observations by [@ref-77], who reported that the small intestinal microbiome is enriched for genes involved in the consumption of simple carbohydrates. ", "However, small disagreements with prior observations were also observed. ", "An enrichment for amino acid metabolism ([@ref-77]) was not visible in *R. ilealis* CRIB^T^, and considerable less COGs could be classified than for the average small intestinal bacterium ([@ref-41]).", "\n\nSince the small intestine is an environment in which environmental conditions change quickly due to the varying food intake of the host, microorganisms in this environment must be able to respond rapidly to such changes. ", "As previously mentioned, the high number of rRNA operons found in the genome of *R. ilealis* CRIB^T^ is an indication that this this strain is indeed able to adapt its metabolism quickly in response to changing conditions, as a high rRNA copy number has been associated with this trait ([@ref-33]). ", "Considering the small intestinal habitat, we chose to focus on key pathways involved in the utilization of specific diet- and host-derived carbon sources by whole-genome transcriptome analysis.", "\n\nDegradation of FOS and its possible role in cross-feeding\n---------------------------------------------------------\n\nIn the intestinal tract, the diet-derived carbohydrates that the host is unable to digest are important sources of energy for many microbes. ", "In return, the host is dependent on the degradation of food-derived indigestible component by microbes for the release of certain essential metabolites (e.g., SCFA). ", "Here we examined the growth of *R. ilealis* CRIB^T^ on FOS, a relatively simple oligosaccharide that is indigestible by the host, and the metabolites that were released. ", "The transcriptome of *R. ilealis* CRIB^T^ grown on FOS was very similar to its transcriptome when grown on glucose, a monosaccharide used by the majority of microbes present in the intestinal tract. ", "This is not surprising considering that glucose in addition to fructose is one of the two subunits present in FOS. ", "Noteworthy was the accumulation of fructose in the culture supernatant during growth of *R. ilealis* CRIB^T^ on FOS. ", "Based on the genomic analysis there are no apparent reasons why fructose should not be metabolized as all the necessary metabolic enzymes are present. ", "However, it has been previously observed that *R. ilealis* only grows weakly on D-fructose ([@ref-24]). ", "The absence of a fructose-specific transporter, which could be identified in close relatives that are able to grow on D-fructose, might explain the fructose accumulation during growth of *R. ilealis* CRIB^T^ on FOS.", "\n\nDifferential gene expression analysis demonstrated the apparent FOS-induced upregulation of two separate gene clusters that were predicted to be involved in sucrose transport and degradation. ", "However, based on the genomic analysis, no apparent pathways could be identified to be responsible for FOS degradation. ", "A simple explanation for the observed growth on FOS could be extracellular degradation of FOS, followed by import of sucrose and/or glucose into the cell. ", "Fructan degradation by extracellular enzymes is described for other (intestinal) microbes ([@ref-71]). ", "The observed accumulation of fructose during growth of *R. ilealis* CRIB^T^ on FOS supports the hypothesis of extracellular degradation. ", "However, no extracellular fructansucrase or glucansucrase could be predicted. ", "Furthermore, no new candidates for this activity could be identified via the differential gene expression analysis described here. ", "However, one possible candidate could be the predicted beta-fructofuranosidase present in the PTS system-containing sucrose degradation gene cluster. ", "Next to the beta-fructofuranosidase-encoding gene, a gene was found to which no function could be assigned, but that was predicted to have a transmembrane region and a domain which could be involved in transport. ", "Given that both loci overlap by a few nucleotides, and that the overlap is within a homopolymer region, it is possible that both loci form one protein due to ribosomal slippage on the homopolymer ([@ref-61]). ", "This could possibly lead to an external membrane-bound enzymatically active protein, which would explain the accumulation of fructose. ", "Future studies with mutant strains might shed more light on the specific contribution of the two predicted sucrose degradation gene clusters to the degradation of FOS, or even longer fructans (e.g., inulin), by *R. ilealis* CRIB^T^. Altogether, these results might indicate a possible role for *R. ilealis* CRIB^T^ in intestinal cross-feeding networks by releasing D-fructose during growth on fructans like FOS, which can function as growth substrate for other microbes or be directly absorbed by the host.", "\n\nFucose degradation and its advantages\n-------------------------------------\n\nBesides diet-derived carbohydrates, also host-derived carbohydrates are an important source of energy for some microbes. ", "Unlike other members of the family *Peptostreptococcaceae*, *R. ilealis* CRIB^T^ is able to grow on L-fucose, a predominantly host-derived carbon source ([@ref-24]). ", "The transcriptome analysis confirmed the presence of a functional L-fucose degradation pathway, similar to the pathways previously identified in other intestinal inhabitants such as *E. coli* ([@ref-4]), *Bacteroides thetaiotaomicron* ([@ref-29]) and *Roseburia inulinivorans* ([@ref-60]). ", "By gene sequence homology a similar pathway was found in *Clostridium perfringens* and the more closely related *C. sordellii* ([Fig. ", "S2](#supp-3){ref-type=\"supplementary-material\"}). ", "L-fucose is a common sugar present within the intestinal environment, since it is a monosaccharide that is an abundant component of many N- and O-linked glycans and glycolipids produced by mammalian cells, including the fucosylated glycans that are found at the terminal positions of mucin glycoproteins ([@ref-5]). ", "Fucosylated mucin glycoproteins are especially found in the (human) ileum ([@ref-54]; [@ref-55]). ", "For both intestinal commensals and pathogens the ability to utilize L-fucose has been demonstrated to provide a competitive advantage in the intestinal environment ([@ref-29]; [@ref-62]). ", "In *R. ilealis*, all enzymes for L-fucose degradation are present in one cluster, however, no fucosidase-encoding gene could be identified, which means that *R. ilealis* is not able to release L-fucose units from fucosylated glycans (e.g., mucin) by itself. ", "Hence, in the intestinal environment *R. ilealis* is dependent on free L-fucose monosaccharides released by other microbes. ", "Furthermore, a gene cluster involved in degradation of sialic acid ([@ref-2]; [@ref-72]; [@ref-73]) was predicted from the genome, but no extracellular sialidase could be identified, which is similar to what has been found for *C. difficile* ([@ref-47]). ", "This suggests that also for sialic acid, a common residue found in mucin glycoproteins, *R. ilealis* CRIB^T^ seems to be dependent on the activity of other microbes. ", "However, this also suggests that by its ability to use L-fucose and sialic acid monosaccharides, *R. ilealis* CRIB^T^ is dependent for these host-derived sugars that are released by the action of extracellular enzymes of with mucus-degrading microbes like *B. thetaiotaomicron* or *Akkermansia muciniphila*. ", "Besides niche competition with other commensals, fucose utilization may also be important in niche competition with pathogens. ", "It was recently suggested that the host is able to regulate fucosylation of its intestinal epithelial cells in response to pathogen-induced stress and that microbes that are able to use fucose as an energy source may contribute to the protection of the host against infections by endogenous pathogens ([@ref-49]).", "\n\nRegulation of carbohydrate catabolism\n-------------------------------------\n\nIn the intestinal environment *R. ilealis* CRIB^T^ will encounter a wide array of carbohydrates that are either continually or transiently present. ", "Prioritization of carbohydrate utilization is partly achieved at the transcriptional level by the selective expression of genes. ", "The primary mechanism by which bacteria regulate the utilization of non-preferred carbohydrates in the presence of preferred carbon sources is known as carbon catabolite repression (CCR), a hierarchical system for coordinating sugar metabolism ([@ref-17]). ", "The fact that, compared to glucose and FOS, L-fucose is utilized by a pathway that does not directly involve fructose-1,6-bisphosphate, a key metabolite in the regulation of CCR of Gram-positive bacteria, made it possible to study CCR by either glucose or FOS. ", "The transcriptome analysis suggests that some genes and operons in *R. ilealis* CRIB^T^ were indeed subject to CCR in response to the presence of glucose. ", "For example, two gene clusters predicted to be involved in hexuronate metabolism (CRIB_649-CRIB_652 and CRIB_2244-CRIB_2249), pathways that make the use of D-glucuronate and D-galacturonates as sole carbon source possible, were significantly upregulated during growth in the presence of L-fucose compared to growth on glucose ([Table S5](#supp-9){ref-type=\"supplementary-material\"}). ", "In addition, the gene cluster predicted to be involved in sialic acid utilization (CRIB_613-CRIB_616) was downregulated in the presence of glucose as well. ", "Furthermore, when comparing the expression of the gene cluster involved in L-fucose degradation during growth on glucose relative to the growth in the absence of a carbon source (control condition), this gene cluster appeared to be under CCR as well, in the presence of glucose ([Table S5](#supp-9){ref-type=\"supplementary-material\"}). ", "These results suggest that in *R. ilealis* CRIB^T^, multiple gene clusters that are involved in the use of alternative carbon sources are subject to CCR.", "\n\nExpression and regulation of niche-specific functionalities in R. ilealis CRIB^T^\n---------------------------------------------------------------------------------\n\nMicrobes residing in the intestinal tract have to withstand the harsh environmental conditions specific for the intestine. ", "In this context, it was interesting that we identified a urease gene cluster in *R. ilealis* CRIB^T^ (CRIB_1381-CRIB_1388), expression of which appeared to be induced in carbon source limiting circumstances. ", "The fact that this gene cluster was significantly upregulated when grown in the absence of an additional carbon source compared to growth on glucose, possibly suggests CCR of the urease gene cluster. ", "However, upregulation of this gene cluster in the absence of an exogenous carbon source might also be a possible mechanism. ", "Urea in the intestinal tract is derived from the breakdown of amino acids. *", "Helicobacter pylori* is a well-known example where urease activity contributes to the survival of the bacterium in the acidic environment of the stomach ([@ref-44]). ", "For some of the urease-positive bacteria, this enzyme has been shown to act as a virulence factor as it is responsible for urea hydrolysis that leads to increased pH and ammonia toxicity ([@ref-57]). ", "However, for commensal intestinal bacteria ureases can probably function as colonization factors as well, as they contribute in general to acid resistance and thereby play a role in gastrointestinal survival ([@ref-44]). ", "Urea is released into all parts of the intestinal tract via diffusion from the blood, but it has been reported that pancreatic excretions and bile are a main route of entry ([@ref-7]). ", "So far, we have not been able to demonstrate urease activity in *R. ilealis* CRIB^T^ ([@ref-24]). ", "However, different mechanisms for the expression of urease have been identified in other microbes: constitutive, inducible by urea, or controlled by nitrogen source availability ([@ref-46]). ", "For *C. perfringens* for example, the urease activity, which is plasmid borne, was shown to be only expressed in nitrogen-limiting conditions ([@ref-19]). ", "The increased urease gene expression by *R. ilealis* CRIB^T^ observed in the control condition, in the absence of an additional carbohydrate, suggests an alternative mechanism for regulation of urease gene expression.", "\n\nConclusions\n===========\n\nWe are just starting to elucidate the composition and function of the microbial communities in the mammalian small intestine. ", "Recently we have reported the isolation and characterization of *R. ilealis* CRIB^T^ from the small intestine of a rat ([@ref-24]). ", "In rats, this species was identified to be a dominant member of the ileal microbiota ([@ref-26]). ", "Here we applied a holistic systems biology approach, involving several fields of experimental and theoretical biology, to study *R. ilealis* CRIB^T^. In conclusion, *R. ilealis* CRIB^T^ is a strain that is able to utilize an array of carbohydrates using different and partially redundant pathways. ", "Its ability to use host-derived sugars that are liberated by other microbes suggests that *R. ilealis* CRIB^T^ is dependent on mucus-degrading microbes, like *B. thetaiotaomicron* or *A. muciniphila*. ", "In contrast, it has only limited ability to *de novo* synthesize amino acids and vitamins, and hence the organism shows an adaption to a nutrient-rich environment in which carbohydrates and exogenous sources of amino acids and vitamins are abundantly available. ", "In addition, we were able to pinpoint potential mechanisms that might enable this organism to survive in the competitive small intestinal environment. ", "These mechanisms include bile salt hydrolase and urease enzymes, which enhance the organism's ability to handle in particular small-intestinal conditions.", "\n\nIt has to be emphasized that the results presented in this study correspond to one specific strain and that different strains belonging to the same species could possibly encode for different functions, including utilisation of specific glycans as previously described by [@ref-14]. ", "However, a deeper investigation of key players in the intestinal tract like *R. ilealis* CRIB^T^ and others will lead to a better understanding of how the microbial communities in us function as a whole. ", "The more we understand how each organism works, and how they interact, the better we get an insight into these environments and can predict how nutrition will influence our health and well-being.", "\n\nSupplemental Information\n========================\n\n10.7717/peerj.3698/supp-1\n\n###### Supplementary materials and methods\n\nAdditional information from the materials and methods, which were shortened in the main manuscript.", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-2\n\n###### Distribution of COG categories in *R. ilealis* CRIB^T^\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-3\n\n###### Organization of the L-fucose degradation gene cluster of *R. ilealis* CRIB^T^ compared to similar gene clusters found in *C. perfringens* (strain ATCC^T^) and *C. sordellii* (strains VPI 9048 and ATCC 9714^T^)\n\nIn the current annotation of *C. sordellii* ATCC 9714^T^ open reading frame prediction seems to be suboptimal, with a considerable amount of potentially wrong stop codons. ", "Genes are color-coded by predicted function: transporter (green), metabolic enzyme with EC number (blue), metabolic enzyme with preliminary EC number/without assigned EC number (dark blue), transcriptional regulator (yellow), hypothetical/unknown protein (grey), protein involved in DNA processing (brown), protein involved in vitamin metabolism (light blue).", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-4\n\n###### Organization of the urease gene cluster of *R. ilealis* CRIB^T^ compared to similar gene clusters found in *H. pylori* (strain 26695) and close-relative *C. sordellii* (strains VPI 9048 and ATCC 9714^T^)\n\nIn the current annotation of *C. sordellii* ATCC 9714^T^ open reading frame prediction seems to be suboptimal, with a considerable amount of potentially wrong stop codons. ", "Genes are color-coded by predicted function: urease accessory proteins (red), transporter (green), metabolic enzyme with EC number (blue), metabolic enzyme with preliminary EC number/without assigned EC number (dark blue), transcriptional regulator (yellow), hypothetical/unknown protein (grey), protein involved in vitamin metabolism (light blue), ribosomal proteins (green).", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-5\n\n###### Growth characteristics of the individual cultures used for whole-genome transcriptome analysis of *R. ilealis* CRIB^T^ grown in four experimental conditions\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-6\n\n###### Summary of the RNA-seq raw data analysis for whole-genome transcriptome analysis of *R. ilealis* CRIB^T^ grown in four experimental conditions\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-7\n\n###### Overview of the genes that were significantly upregulated during growth of *R. ilealis* CRIB^T^ in the presence of glucose in comparison to at least one of the other three conditions\n\nThese three conditions included L-fucose, control (absence of additional carbon source) and FOS. ", "Differential gene expression values that did not meet the criteria for significance (≥1.5 log2(fold change) and *q* value ≤0.05) are color-coded in dark-grey.", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-8\n\n###### Overview of the genes that were significantly upregulated during growth of *R. ilealis* CRIB^T^ in the presence of FOS in comparison to at least one of the other three conditions\n\nThese conditions included glucose, L-fucose and control (absence of additional carbon source)\\]. ", "Differential gene expression values that did not meet the criteria for significance (≥1.5 log2(fold change) and *q* value ≤0.05) are color-coded in dark-grey.", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-9\n\n###### Overview of the genes that were significantly upregulated during growth of *R. ilealis* CRIB^T^ in the presence of L-fucose in comparison to at least one of the other three conditions\n\nThese conditions included glucose, FOS and control (absence of additional carbon source). ", "Differential gene expression values that did not meet the criteria for significance (≥1.5 log2(fold change) and *q* value ≤0.05) are color-coded in dark-grey.", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-10\n\n###### Overview of the genes that were significantly upregulated during growth of *R. ilealis* CRIB^T^ in absence of a carbon source (control condition) in comparison to at least one of the other conditions\n\nThese conditions included glucose, FOS and L-fucose. ", "Differential gene expression values that did not meet the criteria for significance (≥1.5 log2(fold change) and *q* value ≤0.05) are color-coded in dark-grey.", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-11\n\n###### Results of mucin and sulfite growth experiments\n\nResults of mucin and sulfite growth experiments.", "\n\n###### \n\nClick here for additional data file.", "\n\n10.7717/peerj.3698/supp-12\n\n###### Pathway tools database for *Romboutsia ilealis* CRIB^T^\n\nThe whole PGDB of the metabolic reconstruction with Pathway tools version 18 for Romboutsia ilealis CRIB^T^.\n\n###### \n\nClick here for additional data file.", "\n\nThe authors thank Hans Heilig (Wageningen University, Laboratory of Microbiology) for his help with genomic DNA isolations and Jasper Koehorst (Wageningen University, Laboratory of Systems and Synthetic Biology) for his help with the genome annotation.", "\n\nAdditional Information and Declarations\n=======================================\n\nJ Gerritsen is currently an employee of Winclove Probiotics. ", "However, these associations do not influence the objectivity, integrity and interpretation of the results that presented in this manuscript. ", "Sacha A.F.T. van Hijum is an employee of NIZO, Kernhemseweg 2, 6718 ZB, Ede, the Netherlands and Vitor A.P. Martins dos Santos is an employee of LifeGlimmer GmbH, Markelstrasse 38, Berlin, Germany. ", "Willem M. de Vos and Hauke Smidt are Academic Editors for PeerJ.\n\n[Jacoline Gerritsen](#author-1){ref-type=\"contrib\"} conceived and designed the experiments, performed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.", "\n\n[Bastian Hornung](#author-2){ref-type=\"contrib\"} performed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.", "\n\n[Bernadette Renckens](#author-3){ref-type=\"contrib\"} performed the experiments, analyzed the data, reviewed drafts of the paper.", "\n\n[Sacha A.F.T. van Hijum](#author-4){ref-type=\"contrib\"}, [Vitor A.P. Martins dos Santos](#author-5){ref-type=\"contrib\"} and [Peter J. Schaap](#author-7){ref-type=\"contrib\"} analyzed the data, reviewed drafts of the paper.", "\n\n[Ger T. Rijkers](#author-6){ref-type=\"contrib\"}, [Willem M. de Vos](#author-8){ref-type=\"contrib\"} and [Hauke Smidt](#author-9){ref-type=\"contrib\"} conceived and designed the experiments, analyzed the data, reviewed drafts of the paper.", "\n\nThe following information was supplied regarding the deposition of DNA sequences:\n\nAll related data has been deposited at the European Nucleotide Archive. ", "The raw reads for the genome can be accessed via the accession numbers [ERR366773](https://www.ncbi.nlm.nih.gov/sra?term=ERR366773), [ERX397233](https://www.ncbi.nlm.nih.gov/sra?term=ERX397233), [ERX397242](https://www.ncbi.nlm.nih.gov/sra?term=ERX397242) and [ERX339449](https://www.ncbi.nlm.nih.gov/sra?term=ERX339449). ", "The assembly can be accessed under [LN555523](http://www.ncbi.nlm.nih.gov/nuccore/LN555523)--[LN555524](http://www.ncbi.nlm.nih.gov/nuccore/LN555524). ", "The RNAseq data has been deposited under the numbers [ERS533849](https://www.ncbi.nlm.nih.gov/sra?term=ERS533849)--[ERS533860](https://www.ncbi.nlm.nih.gov/sra?term=ERS533860).", "\n\nThe following information was supplied regarding data availability:\n\nAll data has been submitted to the EBI.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0.01098901098901099, 0.005025125628140704, 0.007462686567164179, 0, 0.014492753623188406, 0.006779661016949152, 0, 0, 0, 0.010238907849829351, 0, 0.02112676056338028, 0, 0.008333333333333333, 0.0061162079510703364, 0.007751937984496124, 0.004807692307692308, 0, 0.01593625498007968, 0.013513513513513514, 0.016483516483516484, 0.014492753623188406, 0.030303030303030304, 0, 0, 0, 0, 0, 0.0234375, 0.011627906976744186, 0.017543859649122806, 0.018518518518518517, 0.028985507246376812, 0.02197802197802198, 0, 0, 0.013029315960912053, 0.01556420233463035, 0, 0, 0.011299435028248588, 0.012048192771084338, 0.02586206896551724, 0.01932367149758454, 0.013157894736842105, 0.005405405405405406, 0, 0.0136986301369863, 0.006172839506172839, 0, 0.006666666666666667, 0.007874015748031496, 0, 0.012072434607645875, 0.006666666666666667, 0.011560693641618497, 0.013245033112582781, 0.01694915254237288, 0.004329004329004329, 0, 0.006172839506172839, 0.007936507936507936, 0, 0.005376344086021506, 0, 0, 0.0009285051067780873, 0, 0, 0.009523809523809525, 0.0054446460980036296, 0.008928571428571428, 0.005917159763313609, 0.007042253521126761, 0.0041841004184100415, 0, 0, 0, 0.012987012987012988, 0.012345679012345678, 0, 0, 0.015503875968992248, 0.005555555555555556, 0, 0, 0.0136986301369863, 0.006535947712418301, 0.013245033112582781, 0, 0, 0, 0, 0.006711409395973154, 0.004830917874396135, 0.004219409282700422, 0.006622516556291391, 0, 0, 0, 0.0036101083032490976, 0.023809523809523808, 0.004645760743321719, 0, 0.011976047904191617, 0.005649717514124294, 0.006711409395973154, 0.004629629629629629, 0, 0, 0.007751937984496124, 0, 0, 0, 0.00904977375565611, 0.0033783783783783786, 0.006493506493506494, 0, 0, 0, 0, 0.002403846153846154, 0.009900990099009901, 0.010101010101010102, 0.008888888888888889, 0, 0.004739336492890996, 0.007462686567164179, 0.005154639175257732, 0, 0, 0.0136986301369863, 0.008298755186721992, 0, 0.005025125628140704, 0, 0, 0.00909090909090909, 0.004347826086956522, 0, 0, 0, 0.014705882352941176, 0.011299435028248588, 0.006493506493506494, 0.00684931506849315, 0.002257336343115124, 0.006920415224913495, 0, 0, 0.005128205128205128, 0, 0, 0.0036900369003690036, 0.007518796992481203, 0, 0, 0.003125, 0.006666666666666667, 0.002336448598130841, 0, 0, 0, 0.012307692307692308, 0, 0.003236245954692557, 0.009852216748768473, 0.00546448087431694, 0, 0.014705882352941176, 0.005291005291005291, 0.005917159763313609, 0, 0.0055248618784530384, 0.012121212121212121, 0.007042253521126761, 0, 0.004651162790697674, 0.004048582995951417, 0.008771929824561403, 0, 0, 0.009144350097975179, 0.0038022813688212928, 0.006802721088435374, 0, 0.018018018018018018, 0, 0.00684931506849315, 0.0136986301369863, 0, 0.0053475935828877, 0, 0.006493506493506494, 0, 0.012987012987012988, 0.010948905109489052, 0.0024390243902439024, 0.0038461538461538464, 0.008968609865470852, 0, 0, 0.0044444444444444444, 0.002652519893899204, 0, 0, 0, 0, 0.003289473684210526, 0.0049504950495049506, 0, 0.0035211267605633804, 0.005434782608695652, 0, 0.01, 0, 0.0033444816053511705, 0, 0, 0.006024096385542169, 0.0058823529411764705, 0.005025125628140704, 0.008695652173913044, 0.017094017094017096, 0, 0.009615384615384616, 0.004651162790697674, 0, 0.008333333333333333, 0.012903225806451613, 0.009708737864077669, 0.0072992700729927005, 0, 0, 0, 0, 0.004784688995215311, 0, 0.005928853754940711, 0, 0.006024096385542169, 0.010344827586206896, 0.007462686567164179, 0, 0.0031645569620253164, 0.02040816326530612, 0.010638297872340425, 0.007751937984496124, 0, 0.01568627450980392, 0.006024096385542169, 0.006493506493506494, 0, 0.003194888178913738, 0, 0, 0.007782101167315175, 0.01532567049808429, 0.0064516129032258064, 0.005208333333333333, 0.00641025641025641, 0.002976190476190476, 0.006535947712418301, 0.006896551724137931, 0.004807692307692308, 0.005, 0, 0, 0.006024096385542169, 0.005, 0.004524886877828055, 0.010810810810810811, 0.01020408163265306, 0.005235602094240838, 0.0064516129032258064, 0, 0, 0.007575757575757576, 0.01020408163265306, 0, 0.004975124378109453, 0.003816793893129771, 0, 0, 0.0035087719298245615, 0, 0, 0, 0, 0.014598540145985401, 0.00477326968973747, 0.008356545961002786, 0, 0.004842615012106538, 0.007978723404255319, 0, 0, 0, 0.0031545741324921135, 0, 0, 0.003194888178913738, 0, 0, 0.003215434083601286, 0, 0, 0.003436426116838488, 0, 0, 0, 0, 0, 0.015748031496062992, 0.013888888888888888, 0, 0.03535353535353535, 0.010638297872340425, 0.005714285714285714, 0.007692307692307693, 0.02242152466367713, 0.012605042016806723, 0.006369426751592357, 0.012422360248447204, 0.013245033112582781, 0.017045454545454544, 0.00909090909090909, 0 ]

[ "Londoners barter tweets for Kellogg's savory treats\n\nNew Special K Cracker Crisps are on the menu at a U.K. pop-up Tweet shop\n\nThe Offer:Playing off the term “social currency,” Kellogg's opened a pop-up store in London's Soho neighborhood—dubbed The Tweet Shop—where customers could pay for bags of the brand's new Special K cracker chips (or crisps, in U.K. parlance) with tweets instead of cash. ", "Visitors to the pop-up store could craft a tweet of their own or use one of three prewritten tweets—for example, “Love the new Special K Cracker Crisps. ", "Everything you want from a crisp, nothing you don't #tweetshop #spons”—to get their prize. ", "The shop was conceived by Mischief PR and events agency Slice.", "\n\nThe Data: The store was open for four days at the end of September 2012. ", "So, how much is a tweet worth? ", "Kellogg's cracker crisps sell for 60 pence, the equivalent of about $1 per pack. ", "The brand's U.K. Twitter handle (@KelloggsUK) had a little over 11,000 followers by the close of October 2012.", "\n\nThe Channel: Kellogg's combined social and in-store for its Twitter-centric push.", "\n\nThe Creative: Tweets were monitored for sentiment before the samples were handed over. ", "According to WaveMetrix, 96% of the Twitter buzz resulting from the campaign was positive.", "\n\nThere is a famous, oft-cited tweet that goes something like this: “I don't tell my friends about your brand because I like your brand, but because I like my friends.” ", "I would de-friend or stop following anybody in my network if I saw them do this. ", "This is just an overblown free sample pyramid scheme being spun as a “social” campaign." ]

{ "pile_set_name": "Pile-CC" }

[ 0.005025125628140704, 0, 0, 0.03225806451612903, 0, 0, 0.012345679012345678, 0.00909090909090909, 0.012048192771084338, 0, 0.011111111111111112, 0, 0, 0 ]

[ "Officials are saying that Baltimore County is the safest it has ever been. ", "But that doesn't stop criminals from trying. ", "The following briefs were posted on police blotters in the Franklin, Woodlawn and Pikesville police botters.", "\n\n\n\nChicken McNugget Thief\n\nAt 10 a.m. on Jan. 2 in the 500 block of Reisterstown Road, police said a suspect assaulted a woman and took her chicken McNuggets.", "\n\n\n\nRejecting the Robber\n\nAt 10:44 a.m. on Jan. 2 at Clarendon Road and Reisterstown Road, police said a suspect approached the victim and implied that he had a gun. ", "The suspect demanded the victim's car but the victim refused. ", "A 26-year-old Randallstown man was arrested, according to police. ", "He was later linked to another crime in Precinct 3/Franklin.", "\n\n\n\nHeld Up with a Wooden Club\n\nAt approximately 10:40 p.m. on Jan. 4, police said the victim drove to the area to make a pizza delivery. ", "The suspect approached the victim and displayed a wooden club. ", "The suspect took money from the victim's pocket and fled, police report.", "\n\n\n\nAssault with a Wooden Stick\n\nAt 9:48 p.m. on Jan. 3, police said the victim went to help some friends whose vehicle got stuck in the snow in the area of the 7200 block of Windsor Mill Rd. ", "When he arrived, an unknown suspect assaulted him with a wooden stick. ", "The suspect and the victim fought, and the victim dropped his phone, keys, and wallet. ", "The suspect picked up the items and fled, police said.", "\n\n\n\n\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0.009259259259259259, 0, 0, 0, 0.015151515151515152, 0, 0.007246376811594203, 0, 0, 0.005208333333333333, 0, 0, 0, 0 ]

[ "Location: Bavaria, Germany - the center of 15th and 16th century gunmaking\n\nPosts: 4,310\n\nExactly, Fernando,\n\nBut while our Aljubarrota barrels are still of the Romanesque rounded form, this one has yet adapted the octagonal Gothic style and should, in my opinion, be correctly dated ca. ", "1400 to early 15th century - just like the Berne gun." ]

{ "pile_set_name": "Pile-CC" }

[ 0.003472222222222222, 0.018867924528301886 ]

[ "The movement lost steam very soon after it began, but it helped bring poor peasants and farm labourers to the forefront of the nation’s imagination\n\nIt’s a ramshackle bus, lit inside by a naked bulb hanging from the roof. ", "It leaves Warangal’s Ghanpur station market, where a series of shops sell fat chickens. ", "It then takes a right turn and heads east to cross the Godavari River, and keeps going till it enters Chhattisgarh near Bhadrachalam.", "\n\nInside, about a dozen boys—in their late teens and early 20s—doze peacefully on each other’s shoulders. ", "It’s the early 1990s and one of the boys is Shambala Ravinder.", "\n\nAlso Read The village where it began\n\n“I used to put up People’s War (PW) posters on walls, run errands for senior leaders,” Ravinder tells me. ", "Soon, he ran into cops and was “beaten to a pulp”. ", "Afraid of dying and also tired of the systematic “exploitation” by landlords, he boarded the bus that night and headed to Chhattisgarh to join the CPI-ML-PW or Communist Party of India Marxist-Leninist People’s War or People’s War as it’s commonly called.", "\n\nThe decade of the 80s had been worse. “", "It was like a wave,” he recalls, “one or more members of nearly every family joined People’s War.” ", "Ravinder belonged to a lower-middle class family from the Mudrasi community, engaged in fishing and farming in Warangal.", "\n\nAlso Read The village where it began\n\nI first met Ravinder in 2010, in the hills of Abujhmarh in Bastar’s forests. ", "It was the peak of monsoon. ", "From a distance, Ravinder looked like a young Clive Lloyd. ", "By then, the various Naxalite groupings across Bihar, Telangana and Chhattisgarh had merged to become the subsequently outlawed CPI-Maoist. ", "This was their base in south Chhattisgarh, with two regional commands—south and north. ", "Ravinder was head of Northern Command.", "\n\nInspired by a name\n\nRavinder had told me then that his inspiration for revolt had sprung from a political movement that began in 1967 in a sleepy town of north Bengal nestled in the foothills of the Himalayas. ", "The movement and the place was Naxalbari.", "\n\n“When I boarded the bus that night, I knew nothing about Naxalbari. ", "But in Bastar, the party routinely referred to the peasants’ uprising of 1967.” ", "Whenever the Maoists entered a new village, one of the first things they discussed was the Naxalbari uprising, he said. “", "I often wanted to understand the magic of Naxalbari.”", "\n\nParty workers paint walls with graffiti in Naxalbari. ", "| Photo Credit: Suvojit Bagchi\n\nEarly this month, I found the answer in Buraganj village in Naxalbari, and it came from another erstwhile leader. ", "Khudan Mullick is 76, and was once a second-rung, gun-toting leader of the Naxalbari uprising. ", "Ethnically Rajbonsghi, and politically, a communist, Mullick was one of the leaders who travelled in 1967 to Peking, now Beijing, to meet Mao Tse-tung. “", "That was the magic,” Mullick laughs, “when a poor peasant like me, fighting landlords with bows and arrows, crosses borders to meet Mao.” ", "He and three comrades were given basic arms training in China.", "\n\nThe Naxalbari uprising produced many such moments for peasants from the day it was launched 50 years ago on May 25, when police opened fire in a tiny hamlet of the block, killing nine women and two children.", "\n\nThe first few battles\n\nThe incident and the uprising that followed, however, were not isolated but the product of a series of small and big peasants’ movements that had simmered since Independence.", "\n\nIn late 2016, I was in Warangal, in Kadavendi village. ", "A short queue had gathered in front of a ‘belt shop’. ", "This is nothing but a deep freezer under an asbestos awning abutting a single-storied, two-room house, that sells cheap whisky and ultra-strong beer. ", "There are about two dozen belt shops in Kadavendi that supply the daily dose of excitement, but the real excitement of the village goes back in history.", "\n\nIt was in Kadavendi that farmer Doddi Komaraiah was killed on July 4, 1946, after being “hit in the stomach by a bullet” fired from the house of one Deshmukh, writes P. Sundarayya, founding member of CPI-Marxist. ", "Komaraiah’s death, and eventually of many others, triggered the Telengana Armed Struggle of 1946, which in turn inspired the Naxalbari movement 20 years later.", "\n\n“It inspired us, but in Bengal, the idea of pushing landowners to share their crop equitably really came from the Tebhaga Movement of the 40s,” Mullick tells me. ", "This movement, where the landowners’ share of produce was reduced from half to one-third, was what “seriously influenced” Naxalbari.", "\n\nNearly six feet tall, without an ounce of extra fat, Mullick is still a card-carrying Naxalite, but of a lesser-known, overground faction of the CPI-ML. ", "He cycles to town every day to attend meetings. ", "Handing over a cup of milky, sweet tea and a party leaflet, Mullick explains why a peasants’ uprising was inevitable in Naxalbari.", "\n\n‘That was the magic,’ Mullick laughs, ‘when a poor peasant like me, fighting landlords with bows and arrows, crosses borders to meet Mao.’", "\n\n“In the early 60s, if a farmer took a loan of one mon (40 kg) of paddy, he had to return three mon. ", "We (peasants) said, we won’t pay more than 10 kg as interest on one mon,” says Mullick. ", "In the ensuing mass upsurge, peasants approached the Jotedars and told them to hand over their harvest, retaining the family’s share. ", "Land was taken over by sticking in red flags printed with the hammer and sickle.", "\n\n“It was electric, magical,” says Leela Singh. ", "She is a former Naxalite commander and belonged to one of five squads in Kharibari block bordering Nepal. “", "We had about 11 single-shot rifles, which we had taken from the Jotedars.”", "\n\nA short story\n\nThe magic didn’t last long. ", "For a movement that has sent out such wide ripples, Naxalbari was surprisingly short-lived. ", "In July 1967, the Communist Party of China published an editorial congratulating the uprising and virtually defining the road to revolution in India. “", "The Indian revolution must take the road of relying on peasants, establishing base areas in the countryside, persisting in protracted armed struggle and using the countryside to encircle and finally capture the cities. ", "This is Mao Tse-tung’s road...” it said.", "\n\nBut by winter of that year, hundreds of peasants and leaders had been arrested and the movement had started to decline. ", "The government mounted “a massive quelling operation (Operation Crossbow) and the area was dotted with police camps,” writes Khokon Majumdar, a key leader of the movement, in his memoirs.", "\n\nThe uprising had been confined to the Naxalbari area. ", "So, in 1969, Charu Majumdar, chief ideologue and co-founder of the Naxalite movement, decided to not only broad-base the struggle but also formalise it into a political party. ", "Thus was born the CPI-ML with Majumdar at its helm to pursue the “democratic revolution” and call for an armed insurrection to “seize state power”. ", "But in three years, Majumdar died in custody. ", "With that, the Naxalite movement came formally to an end.", "\n\nMuseum of movements\n\nLate last year, I visited Siliguri, north Bengal’s most populous city. ", "A bungalow with a tin roof sits on the arterial Hill Cart Road. ", "It had a sprawling room filled with memorabilia of off-mainstream political movements of Bengal. ", "Majumdar lived and worked in this room before he went underground. ", "The walls have sketches of a docile-looking Stalin lighting a pipe, a smiling Mao delivering a speech, a serious Lenin, and a Karl Marx. ", "Below Stalin is a wooden easy chair with a wide arm rest, and a photograph of Majumdar is placed in it. ", "Opposite is a black bust of the leader.", "\n\n“It’s made of fibreglass,” said Anita Majumdar, his eldest daughter and a doctor. ", "In the summer of 1972, when Majumdar died in police custody, she was studying in Kolkata. ", "She is reluctant to talk about her father but she wrote a seven-page chapter in a monograph on him where she speaks of seeing his body in a Kolkata hospital and how she “somehow didn’t feel like crying”. “", "A sense of pride filled my heart; at long last my father too had laid down his life at the altar of revolution,” she writes.", "\n\nBut in those three brief years, the movement had spread across Bengal, reaching semi-urban and urban areas and rocking Calcutta in the early 70s. ", "Thousands of women and men, mostly in their 20s, were killed in ruthless police crackdowns. ", "Then, it all folded up.", "\n\nThe second phase\n\nThe road that connects Kolkata’s south to its far south is among the city’s busiest streets. ", "It has two residential areas—Jadavpur and Santoshpur—where many Naxalite members used to live or hide. ", "Two former leaders live here now, Santosh Rana and Tilak Dasgupta.", "\n\nI visit them and in separate interviews, both agree that it was Naxalbari that inspired the Naxalite uprisings of the 1980s and ’90s in Bihar and Telengana.", "\n\nAfter the collapse of Naxalbari, Rana lost interest in bullets and chose the ballot to defeat a big landowner in the 1977 Assembly election. ", "Dasgupta worked as a journalist but remained an activist and joined the subsequently banned CPI-ML-Party Unity in Bihar. ", "He later started his own Naxalite faction. ", "Rana says the main mistake of the Indian lot was to try to implement the China model. “", "The condition in Mao’s China was different, there were sharp divisions and infighting among the landowning classes, the war lords, and no parliamentary democracy. ", "In India, the land-owning classes were fairly unified and it is a parliamentary democracy.”", "\n\nInstead, the biggest success of the Naxalbari movement might be located in that it brought agricultural labourers and peasants to the forefront of the nation’s imagination. ", "The movement may not have achieved what it intended—a democratic revolution—but “a democratisation of society” was initiated, as Dasgupta says, and “some reforms from the state flowed in.”", "\n\nNaxalite groups sing revolutionary songs during a rally in 2001. ", "| Photo Credit: REUTERS\n\nAdds Rana, “The movement substantially reduced the strength of the upper castes in Bihar and Telengana, which is a key success.”", "\n\nNow, middle-class worries\n\nAt the Warangal chicken market, from where the Bastar-bound bus turns right, another turn leads to Thambalapally-Ippaguda village.", "\n\nOnce there, I turn into the iron gate of a newly constructed house. ", "Ravinder appears in the doorway. ", "In 2010, he had hosted me inside Bastar forest, where hundreds of Maoist guerrillas awaited his orders. ", "In 2014, he had surrendered arms and taken up cotton farming. ", "And now, he is here.", "\n\nHis wife is Vetti Adme or Devi, also an armed guerrilla in her earlier avatar. ", "The couple got a settlement package as part of Telengana government’s surrender policy and settled down in Thambalapally. ", "They now have a child named Rakshita.", "\n\n“She is our only hope, our saviour, Rakshita… although I am not sure she will look after us when we grow old,” laughs Ravinder, as we sit talking in the veranda.", "\n\nFrom a Maoist in a Chhattisgarh forest to a caring husband and doting father, Ravinder has come a long way. ", "His laying down of arms is just one indication that the movement, often described as the third phase of the Naxalbari-inspired insurrection movements, is slowing down in Bastar. ", "At any rate, it is evident that Adme and Ravinder have lost interest.", "\n\n“I am more concerned with admitting Rakshita in an English medium school,” the father says, as he gives his 13-month-old infant an oil massage. ", "As I leave, he hugs me and asks me to write about him so that he may get a job as a private security guard. “", "I have training, I will do well,” he says.", "\n\nsuvojit.bagchi@thehindu.co.in" ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0.011363636363636364, 0.007518796992481203, 0, 0.016129032258064516, 0, 0, 0.00784313725490196, 0, 0.010101010101010102, 0.016666666666666666, 0.008547008547008548, 0, 0.03389830508474576, 0.02142857142857143, 0, 0.05263157894736842, 0.0047169811320754715, 0.024390243902439025, 0.014285714285714285, 0, 0.008264462809917356, 0.018867924528301886, 0, 0, 0.021052631578947368, 0.0196078431372549, 0.014492753623188406, 0, 0.004784688995215311, 0.005025125628140704, 0, 0, 0, 0, 0.018604651162790697, 0.012578616352201259, 0.012195121951219513, 0.007575757575757576, 0.01935483870967742, 0, 0.007692307692307693, 0.014285714285714285, 0, 0.011363636363636364, 0.007462686567164179, 0, 0.020833333333333332, 0.009345794392523364, 0.013513513513513514, 0, 0.010869565217391304, 0.006622516556291391, 0, 0.025, 0, 0.0053475935828877, 0, 0.011363636363636364, 0.006756756756756757, 0, 0.017543859649122806, 0.010638297872340425, 0, 0, 0, 0.029197080291970802, 0.009615384615384616, 0, 0.011904761904761904, 0.011111111111111112, 0, 0, 0, 0, 0, 0.008849557522123894, 0.009708737864077669, 0.015151515151515152, 0.012658227848101266, 0.02097902097902098, 0.008264462809917356, 0.023255813953488372, 0.011494252873563218, 0, 0, 0, 0.005319148936170213, 0.014925373134328358, 0.013071895424836602, 0.012578616352201259, 0, 0.030303030303030304, 0.009615384615384616, 0, 0, 0.024691358024691357, 0, 0.02702702702702703, 0.006134969325153374, 0.01818181818181818, 0.0056179775280898875, 0.028985507246376812, 0.00684931506849315, 0, 0, 0.03225806451612903 ]

[ "Q:\n\n¿Como puedo agregar un archivo de javascript en un proyecto de angular 6?", "\n\nMi problema es como agregar un archivo de JavaScript para usarlo dentro de mi proyecto, ya intente agregarlo a la carpeta assets y no funcionna, me aparece lo siguiente: \n\nUncaught ReferenceError: editar is not defined\n at HTMLButtonElement.onclick ((index):13)\n\nMi código es:\n<!", "doctype html>\n\n<html lang=\"en\">\n\n<head>\n <meta charset=\"utf-8\">\n\n<script src=\"../assets/jquery-1.7.2.min.js\" type=\"text/javascript\"></script>\n\n<script src=\"../assets/script.js\" type=\"text/javascript\"></script>\n\n <title>Intento</title>\n\n <base href=\"/\">\n\n <meta name=\"viewport\" content=\"width=device-width, initial-scale=1\">\n\n <link rel=\"icon\" type=\"image/x-icon\" href=\"favicon.ico\">\n\n</head>\n\n<body>\n\n <app-root></app-root>\n\n<script type=\"text/javascript\" src=\"runtime.js\"></script><script type=\"text/javascript\" src=\"polyfills.js\"></script><script type=\"text/javascript\" src=\"styles.js\"></script><script type=\"text/javascript\" src=\"vendor.js\"></script><script type=\"text/javascript\" src=\"main.js\"></script>\n\n</body>\n\n</html>\n\nEl problema es que no se como instanciar el archivo de JavaScript.", "\n\nA:\n\nA mi me pasó lo mismo. ", "Yo lo metí en el Local State del proyecto. ", "En esa carpeta puedes albergar cualquier tipo de dato para que la aplicación tire de dicha carpeta.", "\nMi carpeta se situa en esta ruta:\nC:\\Users\\usuarioWindows\\AppData\\Local\\Packages...\\LocalState\nEn la app, te referencias hacia esta carpeta de esta forma:\n<script type=\"text/javascript\" src=\"ms-appdata:///localPackages/.../LocalState/.../fichero.js\"></script>\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.03896103896103896, 0.013986013986013986, 0.0025031289111389237, 0, 0, 0.04040404040404041, 0.003816793893129771 ]

[ "\n294 S.C. 42 (1987)\n362 S.E.2d 317\nVerneva W. DOWNEY, Appellant\nv.\nWilliam M. DIXON and Lonnie M. Starnes, Respondents.", "\n1041\nCourt of Appeals of South Carolina.", "\nHeard October 13, 1987.", "\nDecided November 9, 1987.", "\n*43 Donald M. Holler, Moncks Corner, for appellant.", "\nAubrey R. Alvey, Charleston, for respondents.", "\nHeard Oct. 13, 1987.", "\nDecided Nov. 9, 1987.", "\nSANDERS, Chief Judge:\nThe single issue presented by this appeal is whether the Circuit Court erred in ruling on the motion of appellant Verneva W. Downey that sanctions by imposed against respondent William M. Dixon for his failure to answer interrogatories or attend his deposition as required by the South Carolina Rules of Civil Procedure, effective July 1, 1985. ", "We reverse and remand the case for a new trial.", "\nMs. Downey sued Mr. Dixon and respondent Lonnie M. Starnes, alleging that Mr. Dixon had caused a motor vehicle accident in which she had been seriously injured. (", "Her claim against Mr. Starnes was based on the allegation that Mr. Dixon had been acting as his \"employee, agent and/or servant.\") ", "Ms. Downey prayed for a judgment in the amount of $250,000 actual damages, as well as punitive damages in an unspecified amount.", "\n*44 Mr. Dixon and Mr. Starnes answered, alleging that the accident had been caused by the acts of Ms. Downey, asserting the defense of contributory negligence based on her acts, but not alleging any specific acts of Ms. Downey as having caused the accident or having contributed to its cause.", "\nMs. Downey served interrogatories on counsel for Mr. Dixon and Mr. Starnes asking that they state what acts of hers they were relying on to support the allegations contained in their answer. ", "Mr. Dixon and Mr. Starnes did not respond to her interrogatories.", "\nMs. Downey then served notice on counsel for Mr. Dixon and Mr. Starnes of the taking of the deposition of Mr. Dixon. ", "Mr. Dixon failed to attend the deposition, and Ms. Downey moved for an order striking his answer or, in the alternative, for an order refusing to allow him to testify at the trial of the case.[1]\nCounsel for Mr. Dixon and Mr. Starnes did not offer any excuse for their failure to respond to the interrogatories of Ms. Downey or for the failure of Mr. Dixon to attend the deposition except to say that he had \"never been able to get with the respondent, William M. Dixon.\"", "\nThe Circuit Court did not impose either of the sanctions sought by Ms. Downey but instead fined Mr. Dixon $50. ", "The *45 case thereafter proceeded to trial, which resulted in a jury verdict being returned for Mr. Dixon and Mr. Starnes and judgment being entered based on the verdict.", "\nMs. Downey contends that the Circuit Court erred in not imposing the sanctions which she sought.", "\nThe imposition of sanctions is generally entrusted to the sound discretion of the Circuit Court. ", "Cf. ", "Moran v. Jones, 281 S.C. 270, 276, 315 S.E. (2d) 136, 139 (Ct. ", "App. ", "1984) (addressing a prior Rule: \"[T]he question of what sanctions, if any, are to be imposed for failure to comply with [the Rule requiring answers to certain standard interrogatories] is left largely to the discretion of the trial judge.\"). ", "Nevertheless, whatever sanction is imposed should serve to protect the rights of discovery provided by the Rules. ", "See (addressing the comparable Federal Rule) Diaz v. Southern Drilling Corp., 427 F. (2d) 1118, 1126 (5th Cir.), ", "cert. ", "denied, 400 U.S. 878, 91 S.Ct. ", "118, 27 L.Ed. (", "2d) 115 (1970) (\"[O]verleniency [in the imposition of sanctions] is to be avoided where it results in inadequate protection of discovery.\"); ", "C. Wright, The Law of Federal Courts § 90 at 596 (4th ed. ", "1983) (\"Without adequate sanctions, the procedure for discovery would be ineffectual.\"); ", "National Hockey League v. Metropolitan Hockey Club, Inc., 427 U.S. 639, 643, 96 S.Ct. ", "2778, 2781, 49 L.Ed. (", "2d) 747 (1976) (dictum) (\"[T]he most severe in the spectrum of sanctions provided by statute or rule must be available to the district court in appropriate cases, not merely to penalize those whose conduct may be deemed to warrant such a sanction, but to deter those who might be tempted to such conduct in the absence of such a deterrent.\").", "\nThe sanction imposed in the instant case did no more than minimally enrich the county tax coffers. ", "The rights of discovery provided by the Rules were not protected in any way. ", "Neither was Ms. Downey accorded the rights of discovery provided by the Rules, nor was the sanction imposed against Mr. Dixon a meaningful deterrent to those who might fail to submit to discovery in the future. (", "It is perfectly obvious that few, if any, litigants would *46 willingly submit to the discovery provided by the Rules if the alternative were simply paying $50.)[2]\nWe reject the argument that the judgment should not be reversed because it does not appear Ms. Downey was surprised by the fact Mr. Dixon testified at trial. ", "Of course, Ms. Downey could have anticipated that Mr. Dixon was going to testify at trial. (", "This was undoubtedly why she propounded the interrogatories and sought to take his deposition.) ", "However, there is no indication she knew what he was going to say when he testified. ", "An abiding maxim of the successful trial lawyer, like the motto of the Boy Scouts, is \"Be Prepared.\" ", "See I. Younger, The Art of Cross-Examination 23 (A.B.A. Section of Litigation Monograph Series No. ", "1, 1976) (\"The fourth commandment is that you must be prepared. ", "On cross-examination, you should never ask a question to which you do not already know the answer.", "\").[3] The rights of discovery provided by the Rules give the trial lawyer the means to be prepared for trial. ", "Where these rights are not accorded, prejudice must be presumed and, unless the party who has failed to submit to discovery can show a lack of prejudice, reversal is required.", "\nFor these reasons, the judgment for Mr. Dixon and Mr. Starnes is reversed and the case is remanded for a new trial.", "\nReversed and remanded.[4]\nGARDNER and GOOLSBY, JJ., ", "concur.", "\nNOTES\n[1] Ms. Downey moved for the sanctions against Mr. Dixon pursuant to S.C.R. Civ. ", "P. 37. ", "The sanctions which she sought to have imposed against him are provided under both subdivision (b) and subdivision (d) of the Rule. ", "Rule 37(b) provides sanctions for the violation of an order of the Court to provide or permit discovery. ", "Rule 37(d), on the other hand, provides for sanctions against a party who fails to answer interrogatories or attend his own deposition. ", "The distinction between the two subdivisions is that there must be an order of the Court before sanctions are imposed under subdivision (b), while under subdivision (d) a party may move directly for the imposition of sanctions. ", "See H. Lightsey & J. Flanagan, South Carolina Civil Procedure 316 (1985) (\"[Under Rule 37(d)] sanctions may be imposed without obtaining an order compelling discovery....\"; 4A J. Moore, J. Lucas & D. Epstein, Moore's Federal Practice § 37.05 at 37-100 (2d ed. ", "1984) (addressing the comparable Federal Rule: \"In short, if the party from whom discovery is sought complies with the rule in question by making the initial response, he has a right to refuse discovery until compelled by court order, subject to the expenses of determining the justification of his refusal; but if he does not comply with the rule, he is subject to the sanctions set forth in Rule 37(d).\"); ", "8 C. Wright & A. Miller. ", "Federal Practice and Procedure § 2291 at 807 (1970) (addressing the comparable Federal Rule: \"No court order is required to bring Rule 37(d) into play.\")", "\n[2] Indeed, it can be argued that the sanction imposed in the instant case tended to encourage, rather than discourage, noncompliance with the Rules.", "\n[3] Cf. ", "William \"Green Bar Bill\" Hillcourt (\"Author, Naturalist, World Scouter\"), Official Boy Scout Handbook 9 (9th ed. ", "1986) (\"The Scout motto is `Be Prepared' — prepared to take care of yourself and to help people in need.\")", "\n[4] This opinion should not be read to require that the specific sanctions sought by Ms. Downey must be imposed against Mr. Dixon. ", "See Moran v. Jones, 281 S.C. 270, 276, 315 S.E. (2d) 136, 139 (Ct. ", "App. ", "1984) (\"Exclusion of a witness is a sanction which should never be lightly invoked.\"). ", "It may very well be that Ms. Downey can have her interrogatories answered and be given the opportunity to take the deposition of Mr. Dixon before the new trial takes place.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.04201680672268908, 0.024390243902439025, 0, 0, 0.038461538461538464, 0.021739130434782608, 0, 0, 0.010869565217391304, 0, 0.024539877300613498, 0.015267175572519083, 0.0078125, 0.013651877133105802, 0.015625, 0.03076923076923077, 0.03389830508474576, 0.014861995753715499, 0.026785714285714284, 0.011764705882352941, 0.020618556701030927, 0.01020408163265306, 0, 0.015873015873015872, 0, 0, 0, 0.008849557522123894, 0, 0, 0, 0, 0.017241379310344827, 0, 0.023255813953488372, 0, 0, 0, 0, 0.009433962264150943, 0.009287925696594427, 0.03260869565217391, 0, 0, 0.009900990099009901, 0.010101010101010102, 0, 0, 0, 0, 0.017241379310344827, 0.018867924528301886, 0, 0.02247191011235955, 0, 0, 0.009523809523809525, 0, 0.0043859649122807015, 0.023076923076923078, 0, 0.04, 0.013071895424836602, 0, 0, 0.02654867256637168, 0.009433962264150943, 0.015037593984962405, 0.014925373134328358, 0, 0, 0.011627906976744186, 0 ]

[ "In Paraguay, abortion is illegal for pregnancies that result from rape or incest. ", "It is also illegal where the pregnancy poses a serious, but not life-threatening, health risk to a woman. ", "It is illegal even where there is no hope that the fetus will survive outside the womb. ", "Therefore, abortion is illegal in almost all circumstances except where a pregnancy has life-threatening complications.", "\n\nThe name of this 14-year-old girl has not been released, but she is known as J.S.P. She was raped by a 37-year-old man which caused her pregnancy. ", "Local media reports that the man was arrested for rape this week.", "\n\nJ.S.P. spent 22 days in the hospital with pregnancy complications and a urinary tract infection before going into labor. ", "Doctors at the National Hospital of Itaugua tried desperately to save her life during the operation, but she suffered three cardiac arrests and died. ", "The doctor and director of the hospital said, ‘it was so sudden, in minutes the cardiac arrest happened. ", "Her body was not ready for a pregnancy.” ", "Fortunately, the doctors managed to save the baby.", "\n\nAs it is a deeply personal issue, there is no report of whether or not this teenager wanted an abortion. ", "Even if she had, Paraguay’s strict abortion laws took the choice away from her. ", "She did not have the option of a legal abortion. ", "This means she did not have the opportunity to discuss the situation with her doctor or evaluate the risks of carrying the child to term.", "\n\nInternational experts have said that blocking a rape survivor’s access to abortion can amount to torture. ", "The Committee against Torture commented on Paraguay’s situation saying, “the abortion ban means survivors are constantly reminded of the violation committed against them, which causes serious traumatic stress and carries a risk of long-lasting psychological problems.”", "\n\nThe Ministry of health reports that four girls suffer sexual violence every day in Paraguay. ", "Also, two girls under the age of 15 give birth every day. ", "Many of these pregnancies are the result of sexual abuse by relatives and stepfathers. ", "Correspondingly, a United Nations study found that pregnancy and childbirth are a leading cause of death for teenage girls in the area. ", "The World Health Organization points out that globally, the risk of maternal death is four times higher among teenagers less than 16-years-old than among women in their twenties.", "\n\nAmnesty International reiterated its call for Paraguay to ease abortion laws and improve protection of girls from sexual violence. ", "The Americas director at Amnesty International, Erika Guevara-Rosas, stated, ‘it’s not just the access to abortion rights, it has to be about comprehensive health care, it has to be about sex education, it has to be about prevention of violence, sexual violence in particular.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.012195121951219513, 0, 0, 0, 0, 0, 0, 0.006666666666666667, 0, 0, 0, 0, 0.0125, 0, 0, 0, 0.0037313432835820895, 0.010526315789473684, 0, 0, 0.007352941176470588, 0.0056179775280898875, 0.015037593984962405, 0.007220216606498195 ]

[ "Customs authorities seized 6,236 kilograms of gold smuggled into Japan in 2017, a new one-year high, government data showed Friday.", "\n\nBased on the average price of around ¥4,500 per gram last year, the seized gold was worth around ¥28 billion ($261 million). ", "Smugglers try to evade the 8 percent consumption tax levied on imports of gold worth over ¥200,000 and resell it at a tax-inclusive price.", "\n\nGold smuggling has been on the rise since Japan raised the consumption tax from 5 percent in 2014.", "\n\nThe number of gold smuggling cases handled by the authorities jumped 66 percent to 1,347 from 811 in 2016, the Finance Ministry said in its report.", "\n\nNinety-four percent of the cases involved air travelers, who collectively tried to smuggle 4,779 kg of gold into Japan. ", "Most of the smuggled gold came from South Korea, Hong Kong and Taiwan.", "\n\nAlarmed by the recent surge, Japan has been stepping up customs inspections and is planning to impose stricter penalties on perpetrators.", "\n\nThe possession of gold is not illegal, which authorities believe helps lower the psychological barrier for smuggling.", "\n\nAccording to Finance Ministry data, the number of smuggling cases stood at 12 in 2013 but surged to 119 in 2014.", "\n\nAs for illegal stimulants, customs authorities seized 1,159 kg with a street value of around ¥74.2 billion in 2017, down 23 percent from a year earlier.", "\n\nThe amount of smuggled stimulants from Thailand and Malaysia rose, however, with young women in their 20s and 30s traveling by air involved in many cases, according to the ministry." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.007633587786259542, 0, 0, 0, 0.006711409395973154, 0, 0, 0, 0, 0.008771929824561403, 0, 0 ]

[ "Tag Archives: famous\n\nWhat makes one famous? ", "To be included in that category, the dictionary indicates you must be celebrated, famed, far-famed, illustrious, notable, noted, renowned (widely known and esteemed), “a famous actor”; “a celebrated musician”; “a famed scientist”; “an illustrious judge”; “a notable historian”; or “a renowned painter.” ", "Celebrity culture has become so important to so many over the last decade that …" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0 ]

[ "Q:\n\nSwift - search entire struct for string\n\nTo search for a string included in a struct I use:\nlet results = myArray.filter( {$0.model.localizedCaseInsensitiveContains(\"bu\")} )\n\nBut say the struct has several properties that I'd like to search - or maybe I'd even like to search all of them at one time. ", "I can only filter primitive types so leaving 'model' out won't work. ", "\nSolution -------------------------\nWhile I really liked the idea of using key paths as Matt suggested below, I ended up adding a function to my struct that made my view controller code much cleaner:\nstruct QuoteItem {\n\n var itemIdentifier: UUID\n var quoteNumber: String\n var customerName: String\n var address1: String\n\n func quoteItemContains(_ searchString: String) -> Bool {\n if self.address1.localizedCaseInsensitiveContains(searchString) ||\n self.customerName.localizedCaseInsensitiveContains(searchString) ||\n self.quoteNumber.localizedCaseInsensitiveContains(searchString)\n {\n return true\n }\n return false\n }\n\nThen, in my controller, quotes is an array of QuoteItem that I can search by simply writing:\nsearchQuoteArray = quotes.filter({ $0.quoteItemContains(searchString) })\n\nA:\n\nThis sounds like a job for Swift key paths. ", "Just supply the key paths for the String properties you want to search.", "\nstruct MyStruct {\n let manny = \"Hi\"\n let moe = \"Hey\"\n let jack = \"Howdy\"\n}\n\nlet paths = [\\MyStruct.manny, \\MyStruct.moe, \\MyStruct.jack]\nlet s = MyStruct()\nlet target = \"y\"\nlet results = paths.map { s[keyPath:$0].localizedCaseInsensitiveContains(target) }\n// [false, true, true]\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0, 0.0022148394241417496, 0, 0 ]

[ "Introduction {#sec1}\n============\n\nCurcumin (diferuloylmethane) derived from the rhizome of *Curcuma longa* L. belongs to polyphenols. ", "It was isolated over 140 years ago by Vogel and was synthesized in 1913 by Lampe \\[[@cit0001]\\]. ", "Curcumin has been used for thousands of years in traditional Chinese medicine and Ayurvedic medicine in Asian countries as an active ingredient of herbal remedies to treat liver diseases, rheumatoid diseases, diabetes, atherosclerosis, infectious diseases and cancer \\[[@cit0002]\\]. ", "It is characterized by an antioxidant, anti-inflammatory, antimutagenic, antimicrobial and anticancer activity \\[[@cit0003]-[@cit0007]\\]. ", "Turmeric rhizome is also known as a spice widely used in cookery, fabric dying and cosmetic industry.", "\n\nCurcumin was introduced to the Western world in the 14^th^ century and is still in use. ", "Unfortunately, turmeric has poor bioavailability (poor absorption, rapid metabolism, and elimination) and selectivity \\[[@cit0008], [@cit0009]\\]. ", "Therefore, numerous curcumin analogs were produced and tested in order to improve the pharmacological profile of the natural product \\[[@cit0010]\\]. ", "Piperine, a component of black pepper, is among the bioavailability enhancers used for this purpose. ", "This agent, when used together with curcumin, improves it bioavailability by 2000%. ", "Turmeric, despite its poor bioavailability, is well tolerated and is not toxic to animals or humans even at high doses. ", "Chang *et al.* ", "\\[[@cit0011]\\] demonstrated in a clinical trial that doses of 8 or even 12 g/day were safe for humans.", "\n\nCurcumin may be used as a preventive and curative agent in many diseases, such as neurodegenerative diseases (including Alzheimer's disease), diabetes, cancer, rheumatoid diseases, atherosclerosis, pulmonary infective disease, chronic intestinal inflammation, allergy, asthma, autoimmune diseases, AIDS, psoriasis, and others \\[[@cit0012]\\]. ", "Its effectiveness was also proved for major eye diseases. ", "We focus on this subject later on in the article.", "\n\nReactive oxygen species and antioxidant properties of curcumin {#sec1.1}\n--------------------------------------------------------------\n\nReactive oxygen species (ROS), a product of normal metabolism of cells, may be either advantageous or damaging for the cell and the body, depending mainly on the concentration. ", "The level of ROS may be influenced by two things: endogenous ROS formation and exposure to exogenous ROS. ", "The main source of endogenous ROS is mitochondrial oxidative process and some enzymatic reactions catalyzed by the oxidoreductase group of enzymes \\[[@cit0013], [@cit0014]\\]. ", "Overall, ROS at low concentrations act as intracellular signal transducers and inducers of cell proliferation, transcription, and apoptosis. ", "They activate some transcription factors, including nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and activator protein 1 (AP-1) \\[[@cit0015]\\]. ", "They also contribute to angiogenesis and inflammatory processes. ", "Conversely, high levels of cellular ROS may be cytotoxic and mutagenic for cells leading to the damage of lipids, proteins, DNA, carbohydrates and, finally, inducing cell apoptosis.", "\n\nSubstances present at low concentrations compared to oxidizable compounds that delay or prevent substrate oxidation are known as antioxidants. ", "Antioxidant defense systems of the body are divided into endogenous and exogenous. ", "The endogenous antioxidant defense system consists of antioxidant enzymes, such as superoxide dismutase (SOD), catalase, glutathione peroxidase, heme oxygenase (HO-1), and non-enzymatic antioxidant system composed of low molecular weight scavengers (e.g. glutathione \\[GSH\\], uric acid, lipoic acid, ascorbic acid, tocopherol). ", "The exogenous antioxidant defense system consists of antioxidants that may be grouped into natural products and identical to natural ones but synthesized by the industry, such as vitamins and synthetic ones \\[[@cit0016], [@cit0017]\\].", "\n\nThe imbalance between the production of ROS and antioxidant mechanisms is defined as oxidative stress. ", "Oxidative stress plays a crucial role in the pathogenesis of several serious diseases and aging \\[[@cit0018], [@cit0019]\\].", "\n\nCurcumin belongs to a group of natural antioxidants. ", "It exists in the form of strong antioxidant agents, such as vitamin C or E. The effect of curcumin on free radicals is carried out by several different mechanisms. ", "It may scavenge various forms of free radicals, such as ROS and reactive nitrogen species (RNS) \\[[@cit0020]\\]. ", "Besides, it may modulate the activity of GSH, catalase, and SOD enzymes active in the neutralization of free radicals \\[[@cit0021], [@cit0022]\\]. ", "Furthermore, it may inhibit ROS-generating enzymes, such as lipoxygenase/cyclooxygenase and xanthine hydrogenase/oxidase \\[[@cit0021]\\]. ", "In addition, curcumin is a lipophilic compound, which makes it an efficient scavenger of peroxyl radicals. ", "Therefore, like vitamin E, curcumin is also considered as a chain-breaking antioxidant \\[[@cit0023]\\]. ", "It was proved that curcumin increased the GSH level in normal and cancer cells \\[[@cit0024]\\]. ", "Curcumin suppresses nitric oxide synthase (NOS) activity in murine macrophages as well as the synthesis of NOS in mouse spleen in *in vivo* studies. ", "It induces the expression of heme oxygenase in various types of cells \\[[@cit0025]\\]. ", "It is an enzyme that catalyzes the degradation of heme to biliverdin, ferrous iron, and carbon monoxide. ", "HO-1 also plays a pivotal role in cell response to oxidative stress \\[[@cit0026]\\] and in angiogenesis \\[[@cit0015]\\]. ", "Antioxidant properties of curcumin cause oxidative stress inhibition. ", "This allows people to understand the effectiveness of treatment in numerous lifestyle-related diseases.", "\n\nThe response of cells to oxidative stress induces an inflammatory process. ", "Proinflammatory gene expression is enhanced by a number of reactive oxygen/nitrogen species that initiate an intracellular signaling cascade.", "\n\nCurcumin was proved to block the activation of proinflammatory NF-κB increased by several different inflammatory stimuli \\[[@cit0027]\\]. ", "NF-κB is known to regulate tumor necrosis factor α (TNF-α), a major mediator of inflammation in most diseases.", "\n\nIn addition, curcumin suppresses TNF-α synthesis and inhibits the release of proinflammatory cytokines, such as interleukin (IL)-1, IL-6, IL-8 and chemokines. ", "Furthermore, it downregulates proinflammatory enzyme expression, i.e. cyclooxygenase 2 (COX-2), the main enzyme engaged in prostaglandin production and 5-lipoxygenase (5-LOX) \\[[@cit0021], [@cit0022]\\]. ", "Antioxidant properties of curcumin imply the influence on angiogenesis.", "\n\nAngiogenesis and curcumin angiogenic properties {#sec1.2}\n-----------------------------------------------\n\nStudies published last year indicated that ROS are critical regulators of angiogenic homeostasis.", "\n\nThe effect of ROS on the vascular function depends critically on the amount of ROS present. ", "High ROS doses induced oxidative stress and a subsequent death of cells necessary for angiogenesis, thereby inhibiting angiogenesis. ", "Low doses of ROS (mainly H~2~O~2~) were found to promote angiogenesis *via* sub-lethal cell membrane damage and subsequent FGF-2 release \\[[@cit0028]-[@cit0030]\\]. ", "It initiated the intracellular production of ROS through NAD(P)H oxidase (NOX) and SOD activation and subsequent downstream growth factor signaling for proliferation, migration and tube formation.", "\n\nAngiogenesis, a process that allows new blood vessels to be formed within a host's vasculature, plays an important role in physiology and pathology. ", "Physiologically, it occurs e.g. during the menstrual cycle, embryogenesis and wound healing.", "\n\nOne essential element for angiogenesis to work is the angiogenic switch mediated by angiogenic oncogenes. ", "They upregulate the expression of proangiogenic proteins such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) and diminish the expression of angiogenesis inhibitors. ", "VEGF and bFGF are the most stimulated factors for physiological angiogenesis and basic factors in pathological angiogenesis \\[[@cit0015], [@cit0031]\\]. ", "VEGF activates receptor tyrosine kinases (mainly VEGFR-1, VEGFR-2) present on endothelial cells, monocytes and cancer cells. ", "VEGFR-2 activates downstream signaling pathways, such as Erk, Akt, eNOS, which are necessary for early angiogenesis \\[[@cit0032]\\]. ", "The degradation of the basement membrane of the maternal vessel and surrounding extracellular matrix components mediated by the proteolytic activity of metalloproteinases (MMPs) and plasmin \\[[@cit0033]\\] is necessary for neovascularization. ", "Further steps of a new blood vessel creation process include the proliferation and migration of endothelial cells of the maternal vessels for sprouting and growth of a new capillary. ", "It depends on the ability to alter the arrangement of their adhesion membrane proteins, belonging mainly to the integrin family. ", "The stabilization of new vessels is achieved by the formation of the basement membrane and pericyte recruitment \\[[@cit0034]\\].", "\n\nMitogens and chemoattractants acting on pericytes are induced by platelet-derived growth factor (PDGF), while pericyte differentiation is assured by transforming growth factor β (TGF-β) and FGF-2. ", "Angiopoietins -- endothelial cell growth factors -- regulate the maturation and structure of new vessels at the very end of new capillary formation \\[[@cit0029], [@cit0034]\\].", "\n\nExtensive research revealed that curcumin inhibits angiogenesis *via* various mechanisms. ", "Chen *et al.* ", "demonstrated the suppression of VEGF (isoforms 165 and 121 of VEGF) secretion in U937 and Raji cells by curcumin treatment \\[[@cit0035]\\]. ", "Curcumin inhibited angiogenesis measured as network formation of endothelial cells on Matrigel. ", "It also suppressed angiogenesis in the endothelial cell line -- ECV304 cells.", "\n\nHepG2 cell line (hepatocellular carcinoma cell line) characterized by the overexpression of VEGF and cyclooxygenase-2 (COX-2) was also inhibited by curcumin \\[[@cit0036]\\]. ", "In another study, HepG2 cells were inoculated onto the upper layer of the skinfold chamber and curcumin solutions were orally fed to the HepG2 cell-implanted nude mice. ", "Angiogenesis was evaluated as tumor neocapillary density using a digital image analysis \\[[@cit0037]\\]. ", "Curcumin (3000 mg/kg BW) treatment inhibited tumor angiogenesis by the reduction of proangiogenic factors such as VEGF and COX-2. ", "Such inhibition also occurred with liposomal curcumin as shown by Li *et al.* ", "\\[[@cit0038]\\] through the attenuation of the NF-κB mechanism. ", "Curcumin was also shown to inhibit angiogenesis in bFGF-induced corneal neovascularization, as assessed by measuring vessel length and density in normally avascular cornea. ", "Curcumin reduced the proliferation of primary endothelial cells in the presence and absence of bFGF and also inhibited the proliferation of an immortalized endothelial cell line \\[[@cit0039]\\]. ", "Other investigators also described the inhibition of fibroblast growth factor (FGF)-induced neovascularization \\[[@cit0039]-[@cit0041]\\]. ", "In addition to the suppression of ligands of VEGF, it was also demonstrated to suppress angiopoietin 1 and 2 \\[[@cit0041]\\]. ", "Furthermore, curcumin indirectly modulated angiogenesis through the ability to regulate cell adhesion molecules, such as endothelial leukocyte adhesion molecule-1 (ELAM-1), intracellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and cell surface proteins involved in angiogenesis and tumor metastasis \\[[@cit0042]\\].", "\n\nA study of Aggarwal and Natarajan \\[[@cit0043]\\] showed that curcumins influenced angiogenesis through the inhibition of tube formation in a dose-dependent manner when the cells were treated before or at the time of plating on Matrigel.", "\n\nIt was reported that curcumin decreased the activity of metalloproteinases and serine protease family, the urokinase plasminogen activator system (uPA). ", "uPA interacts with a specific receptor (uPAR) through the epidermal growth factor (EGF)-like domain in the urokinase amino-terminal fragment (ATF). ", "This effect of curcumin causes the inhibition of endothelial cell migration and the stimulation of bFGF, transforming growth factor (TGF), TNF, hepatocyte growth factor (HGF), and VEGF release \\[[@cit0044]\\]. ", "It was found that curcuminoids inhibited the expression of MMP-2 acting *via* FGF-2 angiogenic signaling pathways \\[[@cit0045]\\]. ", "The inhibitory effect of curcumin was also described for mouse keratinocytes. ", "Turmeric diminished the uPA levels induced by TGF-β1 in transformed keratinocytes and TGF-β-induced synthesis of fibronectin as well as inhibited TGF-β-stimulated cell migration and invasiveness \\[[@cit0046]\\].", "\n\nDisturbances of angiogenesis may result in serious medical consequences. ", "Excessive angiogenesis exists e.g. in AMD, cancer, endometriosis, while insufficient angiogenesis is noted e.g. in neurodegenerative diseases, diabetes mellitus, stroke, atherosclerosis, hypertension, and ischemic heart disease. ", "Numerous antiangiogenic and antioxidant properties of curcumin prove that it may be sufficient in the treatment of angiogenesis-related diseases including eye diseases \\[[@cit0047]-[@cit0051]\\].", "\n\nDiseases of the cornea {#sec2}\n======================\n\nCorneal neovascularization {#sec2.1}\n--------------------------\n\nCorneal neovascularization (NV) is characterized by the invasion of new blood vessels into the cornea from the limbus. ", "Immature new blood vessels may lead to lipid exudation, persistent inflammation, and scarring, thus threatening corneal transparency and visual acuity. ", "Advanced stages, in which ingrown blood vessels reach the visual axis, can become permanently vision-threatening and are a leading cause of blindness. ", "They are triggered by a disruption of the balance between angiogenic and antiangiogenic factors, corneal hypoxia and inflammation \\[[@cit0052]\\]. ", "Concentrations of two major proangiogenic factors, VEGF and bFGF, are elevated in such conditions and lead to corneal neovascularization. ", "It was shown that curcumin suppressed the proliferation of primary endothelial cells cultured *in vitro* in the presence or absence of bFGF. ", "An *in vivo* study of the same group revealed that curcumin inhibited mouse corneal NV induced by bFGF \\[[@cit0052]\\]. ", "The results of the rabbit *in vivo* model of suturing-induced corneal NV demonstrated the efficacy of curcumin in inhibiting angiogenesis through decreasing VEGF mRNA levels and NF-κB phosphorylation \\[[@cit0053]\\]. ", "Moreover, curcumin nanoparticles (NPs) inhibit the angiogenic sprouting in mouse aortic ring *in vitro* in a dose- and time-dependent manner. ", "NF-κB inhibition by curcumin NPs was shown in an *in vitro* study of LPS-induced corneal cells by Pradhan *et al.* ", "\\[[@cit0054]\\]. ", "In the same group, curcumin NPs inhibited the level of proangiogenic VEGF, MMPs (MMP2 and MMP-9) as well as proinflammatory IL-1β and TNF-α in an *in vivo* silver nitrate-induced corneal NV study \\[[@cit0054]\\].", "\n\nCurcuminoids inhibit FGF-2-induced rabbit corneal NV *in vivo* through diminishing DNA binding activity from transcription factor activator protein-1 (AP-1) and gelatinase B promoter activity \\[[@cit0040]\\].", "\n\nCorneal wound healing {#sec2.2}\n---------------------\n\nThe risk of corneal diseases is very high in the course of diabetes. ", "Diabetic keratopathy concerns 50% of diabetic patients \\[[@cit0055]\\]. ", "Guo *et al.* ", "\\[[@cit0056]\\] demonstrated the effectiveness of intranasal nanomicelle curcumin in corneal epithelial/nerve wound healing in STZ-induced model of diabetic mice with corneal epithelium abrasion. ", "In this study curcumin recovered the enhanced accumulation of ROS, decreased free radical scavengers, decreased mRNA expression of neurotrophic factors, and increased mRNA expression of inflammatory cytokines in the cornea. ", "The authors observed trigeminal ganglion neurons in mice with corneal epithelium abrasion suggesting that intranasal curcumin may support the diabetic corneal epithelial or nerve wound healing process \\[[@cit0056]\\].", "\n\nDry eye disease {#sec2.3}\n---------------\n\nDry eye disease is characterized by a decreased secretion of tears and rapid tear evaporation \\[[@cit0057]\\] causing ocular surface damage. ", "The pathogenesis of this process includes elevated tear osmolality and an inflammation of the ocular surface. ", "Proinflammatory cytokines, including IL-6, IL-8, IL-1β, are detected in corneal cell lines and dry eye patients in hyperosmotic environment \\[[@cit0058]\\]. ", "Curcumin could exert a protective effect through its anti-inflammatory activity. ", "Notably, curcumin was shown to inhibit the expression of ovalbumin-induced proinflammatory cytokines, such as IL-4 and IL-5, in the conjunctiva in mice \\[[@cit0059]\\]. ", "In addition, an *in vitro* study demonstrated that curcumin protected hyperosmoticity-induced IL-1β upregulation in the corneal epithelial cell via p38 mitogen activated protein kinase (MAPK/NF-κB) pathways \\[[@cit0060]\\].", "\n\nConjunctivitis {#sec3}\n==============\n\nConjunctivitis is an inflammation of the conjunctiva, a thin transparent layer of tissue that lines the inner surface of the eyelid and covers the white part of the eye.", "\n\nThe most common infectious causes are viral, followed by bacterial ones. ", "It may also develop due to an allergic reaction to air irritants, such as pollen and smoke, chlorine in swimming pools, ingredients in cosmetic products, or other products that come in contact with eyes, such as contact lenses. ", "Sexually transmitted diseases, like chlamydia and gonorrhea, are among less common causes of conjunctivitis \\[[@cit0061]\\].", "\n\nChung *et al.* ", "\\[[@cit0059]\\] reported that curcumin had the potential of inhibiting ovalbumin-induced conjunctivitis caused by allergy in a mouse model. ", "Mice developed severe allergic conjunctivitis as a result of challenging with ovalbumin *via* the conjunctival sac of systemic sensitization in aluminum hydroxide. ", "Curcumin administered 1 h before the ovalbumin challenge exerted anti-inflammatory and antiallergic effects. ", "It suppressed the activation levels of inducible nitric oxide synthase (iNOS) production in mouse conjunctiva and inhibited immunoglobulin E (IgE)-mediated and eosinophil-dependent conjunctival inflammation. ", "Furthermore, IL-4 and IL-5 expression in the conjunctiva, cervical lymph nodes, and the spleen were reduced in mice treated with curcuma as compared to the control group \\[[@cit0059]\\].", "\n\n*Curcuma longa* called haridra in India and in tropical areas is available as Haridra Eye Drops. ", "It has anti-inflammatory properties and antibacterial activity against *Escherichia coli*, *S. aureus, Klebsiella*, and *Pseudomonas* organisms \\[[@cit0062]\\]. ", "A clinical study demonstrated the effectiveness of Haridra Eye Drops in treating bacterial conjunctivitis. ", "Another kind of eye drops with curcumin, Ophthacare, is produced by Himalaya Drug Company. ", "Ophthacare, which contains eight different herbs including 1.30% w/v of *Curcuma longa* (rhizome), was reported to be effective in the treatment of conjunctivitis, conjunctival xerosis (dry eye) and safe in various infective and inflammatory conjunctival diseases \\[[@cit0063]\\].", "\n\nPterygium {#sec4}\n=========\n\nA pterygium is a growth of the conjunctiva or mucous membrane forming fibrous tissue in a triangular shape that covers the white part of the eye over the cornea. ", "The first-choice treatment for this inflammatory and degenerative ocular surface disease is surgical excision, but a high rate of re-occurrence renders this method controversial. ", "Zhang *et al.* ", "\\[[@cit0064]\\] found that curcumin exerted a therapeutic action against pterygium. ", "An *in vitro* study was conducted using human pterygium fibroblasts. ", "Curcumin at a dose of 20-80 μmol/l increased the expression of spreading cell nuclear antigen, inhibited the proliferation and caused the cellular death of human pterygium fibroblasts in a dose- and time-dependent manner. ", "Ophthacare treatment of pterygium also showed positive effects in a study by Biswas *et al.* ", "\\[[@cit0063]\\].", "\n\nAnterior uveitis {#sec5}\n================\n\nAnterior uveitis is an inflammation of the middle layer of the eye. ", "This layer includes the iris and the adjacent tissue, known as the ciliary body. ", "If untreated, it can cause permanent damage and loss of vision from the development of glaucoma, cataract or retinal edema. ", "The pathomechanism of uveitis is not clear due to its heterogeneity. ", "The treatment usually involves corticosteroids and NSAIDs, although several side effects (i.e. cataract, secondary glaucoma, anterior and posterior synechiae) may occur as a result. ", "Lal *et al.* ", "\\[[@cit0065]\\] reported an improved vision in patients with chronic anterior uveitis who were administered oral capsules with 375 mg/capsule of curcumin t.i.d. ", "along with local cycloplegics (e.g. atropine). ", "Decreased aqueous flare and keratic precipitates were observed after treatment \\[[@cit0065]\\].", "\n\nA beneficial effect of Meriva (Indena, Milano, Italy), curcumin formulated with phosphatidylcholine, which improves bioavailability at least 10-fold as compared to the standard preparation, was observed in the adjunct therapy of recurrent anterior uveitis of various etiologies \\[[@cit0066]\\]. ", "Another study of a standardized aqueous extract of *Curcuma longa* applied topically led to the inhibition of *E. coli* lipopolysaccharide-induced anterior uveitis in rats and rabbits by reducing TNF-α activity \\[[@cit0067]\\]. ", "Its beneficial effects may stem from their antioxidative, anti-inflammatory, as well as antifibrinolytic properties.", "\n\nGlaucoma {#sec6}\n========\n\nGlaucoma is a group of eye diseases which result in the damage to the optic nerve and vision loss \\[[@cit0068]\\]. ", "The most common type is an open-angle glaucoma with less common types including closed-angle glaucoma and normal-tension glaucoma. ", "The development of the disease involves retinal ganglion cell loss, i.e. thinning of the retinal nerve fiber layer and progressive loss of the vision field \\[[@cit0069]\\]. ", "Several causes of glaucoma exist, with ocular hypertension (increased pressure within the eye) being the most significant risk factor in most glaucomas. ", "However, in some populations only 50% of people with primary open-angle glaucoma actually have the ocular pressure elevated. ", "In some cases, even when eye pressure decreased to normal levels, glaucoma progresses anyway. ", "Thus, neuroprotective agents are desired to prevent, limit or even fix the damage to the optic nerve.", "\n\nYou *et al.* ", "\\[[@cit0069]\\] indicated that curcumin may possess neuroprotective properties. ", "Pretreatment with curcumin in an *in vivo* rat model of chronic high intraocular pressure, resulted in significantly increased cell viability of BV-2 microglia and the increased presence of ROS and a decrease in the apoptosis of BV-2 microglia. ", "The neuroprotective effect of curcumin may be demonstrated by inhibiting oxidative damage to microglia. ", "Curcumin at low doses (\\< 50 M) attenuated staurosporine-induced ganglion cell death in *in vitro* and *in vivo* studies \\[[@cit0070]\\].", "\n\nOne of the animal models for open-angle glaucoma is acute retinal ischemia induced by high intraocular pressure followed by reperfusion (I/R). ", "The neuroprotective effect of retinal I/R injury was seen in case of dietary curcumin. ", "Curcumin decreased mitofusin 2 (mfn2), a mitochondrial fusion protein, after retinal I/R injury. ", "Nuclear factor erythroid 2-related factor 2 (Nrf2) exerts a protective effect against oxidative stress and is increased after retinal I/R injury. ", "Mfn2 suppression and Nrf2 elevation were observed after pretreatment with curcumin indicating that curcumin may alleviate retinal I/R injury by regulating the antioxidant system and may restore normal mitochondrial function \\[[@cit0071]\\].", "\n\nCataract {#sec7}\n========\n\nA cataract is a clouding of the lens in the eye which leads to a decrease in vision. ", "Cataracts often develop slowly and may affect one or both eyes. ", "The mainstream treatment for this disease is cataract extraction surgery. ", "The anti-cataract effect of curcumin may originate from its antioxidant properties. ", "Chhunchha *et al.* ", "\\[[@cit0072]\\] showed in an *in vitro* study that curcumin inhibited a pleiotropic oxidative stress-response protein (peroxiredoxin 6) in cultured human lens epithelial cells (hLECs). ", "Curcumin was examined in various cataract models. ", "It suppressed selenium-induced oxidative stress in rat organ cultured lens and delayed the formation of cataracts by inhibiting the non-enzymatic antioxidant depletion \\[[@cit0073]\\]. ", "Decreased vitamin C levels observed in selenite-induced rat cataracts suggests that weakened non-enzymatic antioxidant defenses may play a role in selenite-induced rat cataracts. ", "The administration of curcumin was found to increase vitamin C levels \\[[@cit0074]\\]. ", "Padmaja and Raju \\[[@cit0075]\\] observed an increase in superoxide dismutase and catalase enzyme activity in Wistar rats after pretreatment with curcumin, which may prevent oxidative damage and delay the development of cataracts. ", "Curcumin was shown to delay the progression of diabetic cataract by preventing hyperglycemia-mediated lenticular oxidative stress in rats. ", "It significantly decreased GSH levels and prevented the alteration of protein carbonyls, antioxidant enzymes glutathione peroxidase (GPx), glucose-6-phosphate dehydrogenase (G6PD) \\[[@cit0076]\\].", "\n\nGSH is known to protect cells against lipid peroxidation. ", "Manikandan *et al.* ", "\\[[@cit0077]\\] demonstrated an elevation of lipid peroxidation in rat lens by selenite leading to the downregulation of GSH in the lens. ", "Curcumin administration caused the normalization of GSH levels that was detected in tissues and sera in selenite-treated lenses *in vivo*. ", "It confirms the protective role of curcumin against oxidative stress \\[[@cit0078]\\].", "\n\nAge-related macular degeneration {#sec8}\n================================\n\nAge-related macular degeneration (AMD) is a condition of the central part of the macula and results in visual loss at its advanced stages. ", "The early stages of age-related maculopathy are distinguished by the occurrence of drusen in the eyeground and abnormalities of retinal pigment epithelium. ", "Geographical atrophy and choroidal neovascularization are observed at late atrophic and exudative stages of the AMD \\[[@cit0079]\\]. ", "Neovascular AMD is characterized by choroidal neovascularization that invades the subretinal space, often leading to exudation and hemorrhage \\[[@cit0079]\\]. ", "This type of AMD is caused by abnormally high pathological angiogenesis \\[[@cit0050], [@cit0051]\\]. ", "The neovascular form of the disease represents approximately 10% of the overall disease prevalence, but it is responsible for 90% of severe vision loss. ", "If the condition is left untreated, damage to photoreceptors and loss of central vision usually occur, and after several months to years, the vessels are largely replaced by a fibrovascular scar. ", "The main risk factors for the disease include age, sex, ethnicity, genetic predisposition, visible light, arterial hypertension, atherosclerosis, smoking and antioxidant deficiency.", "\n\nCurcumin was found to prevent cell death across different cellular models of AMD. ", "The mechanisms of action include decreasing apoptotic rates of retinal pigment epithelial (RPE) cells and decreasing overall inflammation. ", "Zhu *et al.* ", "\\[[@cit0080]\\] used the model of AMD based on pulsed H~2~O~2~ induction of retinal pigment cell aging. ", "They demonstrated that curcumin reduced free radicals as well as gene expression of the oxidative biomarkers, including superoxide dismutase, maleic dialdehyde, and GSH. ", "Curcumin suppressed apoptosis and thus increased cell viability. ", "Specific microRNAs (miRNAs) that regulate the antioxidant system were reported to be regulated by curcumin \\[[@cit0081]\\]. ", "Besides, HO-1, an enzyme that serves cellular defense mechanisms in AMD, was increased due to curcumin effects. ", "The results of the light-induced retinal degeneration model of AMD indicated that curcumin inhibits nuclear factor jB (NfjB) and downregulates cellular inflammatory genes \\[[@cit0082]\\].", "\n\nDiabetic retinopathy {#sec9}\n====================\n\nDiabetic retinopathy (DR) is a metabolic disorder and a chronic inflammatory state that leads to damage to both photoreceptors and blood vessels of the retina. ", "In the course of diabetes mellitus, the vasculature shows signs of local hypertension that includes basement membrane thickening that disrupts tight connections between the pericytes. ", "It results in pericyte apoptosis and the release of cellular mediators that promote angiogenesis \\[[@cit0083]\\]. ", "The accumulation of advanced glycation end products causes a release of ROS which cross-links proteins and damages vascular and extravascular structures. ", "Oxidative stress induced by hyperglycemia and pathological neovascularization contributes to the pathogenesis of DR. ", "ROS may cause the loss of pericytes and formation of micro-aneurysms that leads to the vascular syndrome of DR \\[[@cit0084], [@cit0085]\\].", "\n\nGupta *et al.* ", "\\[[@cit0086]\\] found that curcumin prevented the degeneration of cellular organelles and increased the capillary basement membrane thickness in the retina. ", "The mechanism of curcumin action involved decreasing TNF-α, decreasing proangiogenic vascular endothelial growth factor (VEGF), and increasing the levels of antioxidant enzymes SOD and catalase. ", "Extracellular matrix production decreases as cells are affected by retinopathy in the course of DR. ", "Curcumin enhances extracellular matrix production by increasing levels of mammalian excision repair cross-complementing (ERCC) 1 and ERCC4 enzymes \\[[@cit0087]\\]. ", "Furthermore, curcumin exerts the antiangiogenic action of the choroidal vasculature of rat retina. ", "Curcumin normalizes diabetic microvasculature, attenuates its tortuosity, shrinkage, narrowing and micro-aneurysms. ", "The processes of regeneration and repair are observed in choroidal microvasculature after curcumin treatment \\[[@cit0088]\\].", "\n\nConclusions {#sec10}\n===========\n\nCurcumin, a natural polyphenol agent isolated from C*urcuma longa* L. exhibits a wide range of pharmacological properties including antioxidant, anti-inflammatory, antimutagenic, antimicrobial and anticancer activity. ", "The influence of curcumin on oxidative stress, angiogenesis and inflammatory processes indicates that it may inhibit these pathological conditions and restore homeostasis. ", "The analysis of a number of clinical and preclinical investigations shows that curcumin may be used as a therapeutic agent in the treatment of various eye diseases such glaucoma, cataract, age-related macular degeneration, diabetic retinopathy, corneal neovascularization, corneal wound healing, dry eye disease, conjunctivitis, pterygium, and anterior uveitis.", "\n\nThe authors declare no conflict of interest.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0, 0.020618556701030927, 0.01060070671378092, 0.014492753623188406, 0, 0, 0.0136986301369863, 0.006711409395973154, 0.009900990099009901, 0, 0.008333333333333333, 0.06666666666666667, 0.00980392156862745, 0.005813953488372093, 0, 0, 0.0031645569620253164, 0.009433962264150943, 0.011428571428571429, 0, 0.011764705882352941, 0, 0, 0, 0, 0, 0.008547008547008548, 0, 0.016260162601626018, 0, 0, 0.017857142857142856, 0.02054794520547945, 0.014598540145985401, 0.009345794392523364, 0.009708737864077669, 0.021052631578947368, 0.020134228187919462, 0.011627906976744186, 0, 0.01680672268907563, 0, 0, 0, 0, 0.014388489208633094, 0.00909090909090909, 0.006211180124223602, 0.009852216748768473, 0, 0, 0, 0, 0.018292682926829267, 0.01020408163265306, 0, 0, 0, 0.004878048780487805, 0.02631578947368421, 0.016, 0.022727272727272728, 0.004132231404958678, 0, 0, 0.007874015748031496, 0.010050251256281407, 0.011428571428571429, 0, 0.07142857142857142, 0.02158273381294964, 0.020833333333333332, 0, 0.011428571428571429, 0, 0.009615384615384616, 0.015384615384615385, 0.01282051282051282, 0.015873015873015872, 0.005780346820809248, 0.010309278350515464, 0.014492753623188406, 0.016, 0.0028735632183908046, 0.012605042016806723, 0, 0.006756756756756757, 0.023923444976076555, 0.007692307692307693, 0, 0.01904761904761905, 0, 0.004366812227074236, 0.010309278350515464, 0.004149377593360996, 0, 0, 0.00684931506849315, 0.014492753623188406, 0, 0.008403361344537815, 0.013888888888888888, 0, 0.02608695652173913, 0.0625, 0.014218009478672985, 0.004784688995215311, 0, 0.014084507042253521, 0, 0.010256410256410256, 0, 0.004629629629629629, 0.005405405405405406, 0, 0.01282051282051282, 0.012345679012345678, 0.005952380952380952, 0.009009009009009009, 0, 0, 0, 0.008130081300813009, 0, 0.007194244604316547, 0, 0, 0, 0.010810810810810811, 0.010101010101010102, 0.0125, 0.009345794392523364, 0.02197802197802198, 0.007168458781362007, 0, 0, 0, 0.012048192771084338, 0, 0, 0.010752688172043012, 0.06666666666666667, 0, 0, 0, 0, 0.005494505494505495, 0.07692307692307693, 0.00625, 0, 0.010638297872340425, 0.006756756756756757, 0.004405286343612335, 0, 0.006993006993006993, 0, 0.005813953488372093, 0, 0, 0, 0, 0, 0.012658227848101266, 0, 0, 0.007352941176470588, 0, 0, 0, 0.00684931506849315, 0.008368200836820083, 0, 0, 0, 0, 0, 0.005434782608695652, 0.02, 0.005434782608695652, 0, 0.011627906976744186, 0.008695652173913044, 0, 0.010256410256410256, 0.016666666666666666, 0, 0.014598540145985401, 0.007194244604316547, 0.011904761904761904, 0.004629629629629629, 0, 0.015151515151515152, 0.012658227848101266, 0.03, 0, 0, 0, 0.011904761904761904, 0.007194244604316547, 0, 0.02912621359223301, 0.0058823529411764705, 0.015384615384615385, 0.008130081300813009, 0.008928571428571428, 0.016129032258064516, 0, 0, 0.008849557522123894, 0, 0, 0.021739130434782608, 0.058823529411764705, 0.00641025641025641, 0.005128205128205128, 0, 0.012269938650306749, 0, 0.008620689655172414, 0.008064516129032258, 0, 0, 0, 0, 0 ]

[ "Q:\n\nSSH disconnects active session after 20 minutes\n\nI’ve just set up a new Linux box (OpenSuSE 12.3 on VmWare). ", "Now I stated that my SSH shell sessions are disconnected exactly after 20 minutes, clearly with activity. (", "Putty: “Network error: Software caused connection abort”)\nI already set Putty to send keep alives every 64 sec.", "\nIn sshd_config, I set\nClientAliveInterval 50\nClientAliveCountMax 2\n\nand did a deamon reload. ", "Didn’t help. ", "About two minutes after the link breakdown, ssh reports to /var/log/messages:\n… … sshd[…]: Timeout, client not responding.", "\n… … sshd[…]: pam_unix(sshd:session): session closed for user root\n\nI don’t encounter this behaviour when connecting to other virtual machines, so I guess the problem isn’t in the network. ", "Any help is appreciated.", "\n\nA:\n\nThe cause was network misconfiguration: The IP address of new box was already held by an unused and forgotten Windows Server instance.", "\nIf you fear to be in the same situation, the command line tool “arping” will help you clarify. ", "See the man page…\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.017699115044247787, 0.009345794392523364, 0.018018018018018018, 0, 0, 0, 0, 0, 0.014285714285714285, 0, 0 ]

[ "The web is often said to be inferior to native apps, and poor user experiences frequently take the blame for this. ", "Most criticism revolves around the inability for a web app to provide a fast, animated, touch- and gesture-friendly environment, not around the lack of support for Web Components. ", "Why bother with technical limitations when you can’t even get the basic user-facing stuff right?", "\n\nChrome is unfortunately contributing to the web’s bad reputation by caring more about developers than end-users. ", "Mobile Safari can easily handle, say, a Photos.app-like interface with a translucent navigation bar, native-like swipe gestures and smooth animations. ", "Chrome handles none of this. ", "No position:sticky, no backdrop-filter, no scroll-snap-type (heck, even IE supports it). ", "It’s concerning that Apple is doing better on a phone than Google is on the most powerful desktop.", "\n\nBut it’s not just about the lack of support for newer CSS properties: the features that actually are supported often perform poorly. ", "Gradients are very expensive to draw, fixed elements hurt scrolling performance, paint times often prevent you from reaching a steady 60FPS, and so on.", "\n\nThe answer is not to embrace these limitations and create simpler interfaces. ", "These limitations are only the consequence of unfortunate priorities. ", "The web deserves efficient, innovative, delightful experiences, and Chrome is holding the web back by making it hard (if not impossible) to create them. ", "Google’s staunchly engineer-driven culture is damaging the perception of the platform they seem to foster." ]

{ "pile_set_name": "OpenWebText2" }

[ 0, 0, 0, 0, 0.013245033112582781, 0.034482758620689655, 0, 0.01020408163265306, 0.007407407407407408, 0, 0, 0, 0.006535947712418301, 0 ]

[ "Tags: Rory Smith\n\nPutting safety first\nFor Lafarge’s Calera Quarry, safety is more than a priority…it’s a way of life.", "\nAll aggregate operations must adhere to strict safety rules and regulations as set forth by the Mine Safety and Health Administration (MSHA), but Lafarge chooses ..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.01694915254237288, 0.018072289156626505 ]

[ "Q:\n\npandoc - replace heading with custom style for Word docx\n\nI'm using panflute to write a python filter for pandoc to convert Markdown into a Word document. ", "Normally, pandoc converts Markdown headers into Word's built-in styles called Heading 1, Heading 2, etc. ", "But due to the particulars of the Word template I have to use, I instead need to change all Markdown headers into corresponding custom styles in Word such that Header level 1 => Header1, level 2 => Header2, etc.", "\nHere's a quick sample Markdown file I made to test my filter:\n# Heading 1\n\nsome text in a paragraph\n\n## Heading 2\n\na little bit more text down below\n\nEssentially, I want to convert that Markdown as if I had written it like:\n<div custom-style=\"Header1\">Heading 1</div>\n\nsome text in a paragraph\n\n<div custom-style=\"Header2\">Heading 2</div>\n\na little bit more text down below\n\nSo that way, when I run:\npandoc -S test_input.md -o test_output.docx --reference-docx ./custom_styles.docx --filter ./test_filter.py\n\nThe resulting Word docx will use the appropriate custom styles.", "\nFollow?", "\nAnyway, here's the filter I've written using panflute:\n#! ", "/usr/bin/env python\n#coding: utf-8\n\nfrom panflute import *\n\ndef action( elem, doc ):\n if isinstance( elem, Header ):\n return Div( elem, classes=['Header{}'.format(elem.level)] )\n\ndef main(doc=None):\n return run_filter( action, doc=doc )\n\nif __name__ == \"__main__\":\n main()\n\nWhich, unfortunately, does not replace the Markdown headers with my custom divs for styling. ", "It basically comes out the other end as if there was no filter in place at all.", "\nI'm not sure what I'm doing wrong here.", "\n\nA:\n\nAha! ", "Finally figured it out on my own.", "\nfrom panflute import *\n\ndef action( elem, doc ):\n if isinstance( elem, Header ):\n #return Div( elem, attributes={'custom-style': 'Header{}'.format(elem.level)} )\n return Div( Para(*elem.content), attributes={'custom-style': 'Header {}'.format(elem.level)} )\n\ndef main(doc=None):\n return run_filter( action, doc=doc )\n\nif __name__ == \"__main__\":\n main()\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.009523809523809525, 0, 0.0017452006980802793, 0, 0, 0.013054830287206266, 0.012658227848101266, 0, 0, 0, 0.013227513227513227 ]

[ "Affiliate Disclaimer\n\nIt is important that I am completely transparent with you at all times. ", "Now, I want to help you make more money and be happier doing it...the beautiful thing is that as a blogger, you can do this AND make some money yourself in the process.", "\n\nWhen I write an article, I often include relevant links to 3rd party content, tools and services. ", "Some of these outbound links pay me a commission if you purchase as a result of clicking through my links.", "\n\nThese affiliates make me thousands of dollars each month (this blog actually shows you how to do it too, if your interested) and this comes at no additional cost to you.", "\n\nPlease understand that there are thousands of different tools and services that relate to making money as an entrepreneur. ", "I only promote the products that I have tested and truly believe can provide you with more value than they cost (if you use them).", "\n\nIf you have any questions regarding this information, please feel free to contact me via my contact page at any time.", "\n\nThanks for being a member of the Entreresource.com community and good luck in your business journey!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.010638297872340425, 0, 0.01, 0, 0, 0, 0, 0, 0.00980392156862745 ]

[ "Q:\n\nreact redux - reset other state\n\nI am new in react redux. ", "\ni have implement like: \nStore : \nimport { createStore } from \"redux\";\n\nconst initialState = {\n layersFlag : {\n baseDistrictADhabi: \"none\", \n baseDistrictAAin: \"none\"\n }\n};\n\nconst reducer = (state = initialState, action)=>{\n switch (action.type) {\n case \"layerChange\":\n return Object.assign({}, state, {\n ...state, \n layersFlag : { \n baseDistrictADhabi: action.payload.baseDistrictADhabi,\n baseDistrictAAin: action.payload.baseDistrictAAin\n }\n })\n default:\n return state;\n }\n}\n\nconst Store = createStore(reducer, initialState);\n\nexport default Store;\n\nHomeScreen:\n<Text> {this.props.baseDistrictADhabi} </Text>\n<Text> {this.props.baseDistrictAAin} </Text> \n\nconst mapStateToProps = function(state) {\n return {\n baseDistrictADhabi: state.layersFlag.baseDistrictADhabi, \n baseDistrictAAin: state.layersFlag.baseDistrictAAin\n }\n}\n\nexport default connect(mapStateToProps)(HomeScreen);\n\nIt is working but problem is when I am changing baseDistrictADhabi state then baseDistrictAAin(undefined) get reset. ", " \n\nA:\n\nIf your action is only returning the value you want to update, you can just spread it into the layersFlag object.", "\nChange your reducer to the following:\n case \"layerChange\":\n return {\n ...state, \n layersFlag : {\n ...state.layersFlag,\n ...action.payload\n }\n }\n\nThis will keep all previous keys in your layersFlag object as they are, and only update the one that is returned in the action.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.005106382978723404, 0, 0.0028328611898017, 0 ]

[ "Weekend Wrap-up\n\nRun\n\nEven though it was a holiday weekend, that didn’t deter me from getting a long run in on Saturday morning.", "\n\nDistance: 11 miles\n\nTime: 1:40\n\nWeather: cold and cloudy, 20 degrees\n\nMy body does do well in cold weather!! ", "Somehow I managed to run 11 miles on Saturday, but it was sure slow going!! ", "My body and muscles get so stiff and tight during the winter when it is so cold. ", "I probably ran at about a 9:00 minutes/mile pace, which is about one minute slower than my normal pace during the warmer months. ", "Needless to say, it wasn’t that great of a run.", "\n\nWhile on my run, naturally I was planning what I wanted to eat for my second breakfast of the day. ", "The usual did not sound appetizing: cereal, yogurt, eggs, but then I thought about pancakes and couldn’t get them off my mind. ", "So when I got back, I whipped up some pancakes–vegan pancakes to be exact!!", "\n\nI’m always a little worried when I make a new recipe, but have no fear!", "\n\nThese were ah-mazing!! ", "I couldn’t believe how delicious they were!!! ", "And they were vegan to boot!!", "\n\nThe rest of my weekend was filled with running errands, cleaning, and laundry–all that fun stuff. ", "Actually, I enjoy doing those things, so it doesn’t bother me. ", "I like to have all my ducks in a row before going into the week.", "\n\n[…] headed over to a friend’s for a little holiday gathering at her place, and I decided to make Peppermint Walnut Crunch Blondies. ", "They were such a hit last time I made them, I couldn’t resist making them […]" ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.007462686567164179, 0 ]

[ "Q:\n\nXSLT - transform several sibling tags, but keep the rest intact\n\nI'm trying to transform my input XML:\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<request>\n <customer_data>\n <contact_info>\n <name>john doe</name>\n <dob_year>1984</dob_year>\n <dob_month>09</dob_month>\n <dob_date>14</dob_date>\n <gender>m</gender>\n </contact_info>\n </customer_data>\n</request>\n\nso that it looks like this:\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<request>\n <customer_data>\n <contact_info>\n <name>john doe</name>\n <dob>1984-09-14</dob>\n <gender>m</gender>\n </contact_info>\n </customer_data>\n</request>\n\nHere is the XSLT, that I'm using:\n<?", "xml version=\"1.0\" encoding=\"ISO-8859-1\"?", ">\n<xsl:stylesheet version=\"2.0\" xmlns:xsl=\"http://www.w3.org/1999/XSL/Transform\">\n\n <xsl:template match=\"@*|node()\">\n <xsl:copy>\n <xsl:apply-templates select=\"@*|node()\"/>\n </xsl:copy>\n </xsl:template>\n\n <xsl:template match=\"contact_info\">\n <xsl:copy>\n <dob>\n <xsl:value-of select=\"(dob_year, dob_month, dob_date)\" separator=\"-\"/>\n </dob>\n </xsl:copy>\n </xsl:template>\n\n</xsl:stylesheet>\n\nAnd here is the result that I get:\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?><request>\n <customer_data>\n <contact_info><dob>1984-09-14</dob></contact_info>\n </customer_data>\n</request>\n\nHow do I transform the dob_* tags, keeping the rest of contact_info intact?", "\nUPDATE \nBased, on the answers below, my current solution is \n<xsl:template match=\"contact_info\">\n <xsl:copy>\n <xsl:apply-templates select=\"*[not(starts-with(name(), 'dob'))]\"/>\n <dob>\n <xsl:value-of select=\"(dob_year, dob_month, dob_date)\" separator=\"-\"/>\n </dob>\n </xsl:copy>\n</xsl:template>\n\nThis works for me, but isn't there more elegant way to express \"apply transformation to given elements, and apply-templates to the rest\"? ", "Now, I'm kind of stuck with this expression *[not(starts-with(name(), 'dob'))] which is not that bad, but if the names of \"DOB\" attributes change, I'll have to fix this too.", "\n\nA:\n\nHere's one way you could look at it:\n<xsl:stylesheet version=\"2.0\" \nxmlns:xsl=\"http://www.w3.org/1999/XSL/Transform\">\n<xsl:output method=\"xml\" version=\"1.0\" encoding=\"UTF-8\" indent=\"yes\"/>\n<xsl:strip-space elements=\"*\"/>\n\n<!-- ", "identity transform -->\n<xsl:template match=\"@*|node()\">\n <xsl:copy>\n <xsl:apply-templates select=\"@*|node()\"/>\n </xsl:copy>\n</xsl:template>\n\n<xsl:template match=\"dob_year\">\n <dob>\n <xsl:value-of select=\"(., ..", "/dob_month, ../dob_date)\" separator=\"-\"/>\n </dob>\n</xsl:template>\n\n<xsl:template match=\"dob_month|dob_date\"/>\n\n</xsl:stylesheet>\n\nHere's another:\n<xsl:stylesheet version=\"2.0\" \nxmlns:xsl=\"http://www.w3.org/1999/XSL/Transform\">\n<xsl:output method=\"xml\" version=\"1.0\" encoding=\"UTF-8\" indent=\"yes\"/>\n<xsl:strip-space elements=\"*\"/>\n\n<!-- ", "identity transform -->\n<xsl:template match=\"@*|node()\">\n <xsl:copy>\n <xsl:apply-templates select=\"@*|node()\"/>\n </xsl:copy>\n</xsl:template>\n\n<xsl:template match=\"contact_info\">\n <xsl:copy>\n <xsl:copy-of select=\"name|gender\"/>\n <dob>\n <xsl:value-of select=\"(dob_year, dob_month, dob_date)\" separator=\"-\"/>\n </dob>\n </xsl:copy>\n</xsl:template>\n\n</xsl:stylesheet>\n\nEdit:\nIn order to enumerate only the DOB elements and to do so only once, you could do:\n<xsl:template match=\"contact_info\">\n <xsl:variable name=\"dob-fields\" select=\"(dob_year, dob_month, dob_date)\" />\n <xsl:copy>\n <xsl:apply-templates select=\"* except $dob-fields\"/>\n <dob>\n <xsl:value-of select=\"$dob-fields\" separator=\"-\"/>\n </dob>\n </xsl:copy>\n</xsl:template>\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0, 0.02857142857142857, 0, 0.02857142857142857, 0, 0.025, 0.0038910505836575876, 0.004291845493562232, 0.0021231422505307855, 0.005780346820809248, 0.008583690987124463, 0, 0.0058997050147492625, 0.003667481662591687 ]

[ "UPDATE: Here is another look at the stone well thanks to EggFooYoung. ", "I assume this is what leads to the FDW?", "\n\nUPDATE: Thanks to all of you that pointed out the NEW Numbers? ", "Also added a larger version of the image\n\nBelow are some set pics thanks to several fans who have sent them into Ryan.", "\n\n1) Hurley accepting his lottery winnings with NEW Numbers!?", "\n2) Jack (we see his back) as Desmond is walking by. ", "Also there is a blonde woman that appears to be maybe Claire?? ", "This is from filming that took place a couple of days ago at the building that was listed as \"Constellation Tower\"\n3) Set of a stone well being built\n\nSeveral more pics over at Ryan's Flickr including more pics of John's camp that we recently posted and the Ajira set." ]

{ "pile_set_name": "Pile-CC" }

[ 0, 0, 0.015384615384615385, 0.00847457627118644, 0.01639344262295082, 0.03773584905660377, 0.015873015873015872, 0.011194029850746268 ]

[ "Brachymetatarsia\n\nBrachymetatarsia is a condition in which there is one or more abnormally short or overlapping toe bones (metatarsals). ", "This condition may result due to a congenital defect or it may be an acquired condition. ", " It most frequently involves the fourth metatarsal. ", " If it involves the first metatarsal, the condition is known as Morton's syndrome. ", " Treatment is via a number of differing surgical procedures.", "\n\nDiagnosis\n\nDifferential diagnosis\nCongenital causes include: Aarskog syndrome, Turner syndrome, Albright's hereditary osteodystrophy, maternal ingestion of thalidomide during pregnancy and Apert syndrome. ", "Can be caused by a trauma, although the exact mechanism is not known.", "\n\nTreatment\n\nSymptoms may be treated by wearing wider shoes to relieve pressure, or patient can wear padding around the toes. ", " Surgery is also an option, if the pain and discomfort cannot be treated, or for cosmetic reasons. ", " In this procedure, the short metatarsal is typically cut and a piece of bone is grafted between the two ends. ", "In some cases an external fixator may be attached to the metatarsal with pins. ", " Within the external fixator is an adjustable screw that must be turned (per doctors' orders) to lengthen the gap between bone segments, so the bone will regrow to the appropriate shape.", "\n\nFollowing surgery, crutches or a knee scooter should be used to keep all weight off the surgically repaired foot for 3 months. ", " After this period, orthopedic shoes or boots may be used.", "\n\nEpidemiology\nBrachymetatarsia is found to occur more frequently in women than men.", "\n\nReferences\n\nCategory:Foot diseases\nCategory:Skeletal disorders" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0, 0, 0, 0.012048192771084338, 0, 0.01932367149758454, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]

[ "It’s been a while since we last heard from Project Wing, X‘s moonshot drone delivery project. ", "But after a few fallow months, the team posted an update today and it looks like the project has made quite some progress. ", "Alphabet’s X unit is now testing the Project Wing drones in southeastern Australia, where its flying machines are making deliveries right to its testers’ yards.", "\n\nThis being southeastern Australia, we’re talking about pretty sizable yards, but that’s still a step forward for the project. ", "Indeed, Google is now working with Guzman y Gomez to deliver Mexican food (there are echoes of the TacoCopter here) and Chemist Warehouse, a pharmacy chain.", "\n\nThe current Project Wing drones can fly at about 120 kilometers per hour, and from what we can tell, the basic setup here is a drone that can take off and land vertically with the help of a dozen or more rotors — and then switch to vertical flight for going longer distances. ", "The deliveries hang under the drone and are then lowered to their final delivery point so the drone itself doesn’t have to land. ", "While Google doesn’t say how big these drones are, we’re not talking about a little DJI drone here, but rather a pretty sizable craft.", "\n\nThe location in Australia obviously means that the drones can fly over pretty wide open land with few obstacles. ", "Google notes that while its flight planning software takes care of pre-planning a route, it’s the drone’s on-board sensors that are responsible for avoiding obstacles both during flight and at the delivery location. ", "For now, only a select number of testers can get their food delivered by drone, of course, but the idea behind all of these projects is to study the viability of a larger delivery network.", "\n\nGoogle’s announcement comes about 10 months after Amazon started its own drone delivery tests in England. ", "Both companies have been pretty quiet about their efforts in recent months, though it looks like we’re in for a few more updates as the end-of-year shopping season heats up (Amazon typically offers an update on its efforts around Thanksgiving)." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.010638297872340425, 0, 0.00625, 0, 0.019230769230769232, 0.0035971223021582736, 0, 0, 0, 0, 0, 0.009259259259259259, 0.004098360655737705 ]

[ " TEXAS COURT OF APPEALS, THIRD DISTRICT, AT AUSTIN\n\n\n JUDGMENT RENDERED JULY 17, 2013\n\n\n\n NO. ", "03-12-00205-CV\n\n\n Brad Livingston, in his Official Capacity as the Executive Director of the\n Texas Department of Criminal Justice, Appellant\n\n v.\n\n Laura Beeman and Janet Lock, Appellees\n\n\n\n\n APPEAL FROM 419TH DISTRICT COURT OF TRAVIS COUNTY\n BEFORE JUSTICES PURYEAR, PEMBERTON, AND ROSE\n REVERSED AND RENDERED -- OPINION BY JUSTICE PEMBERTON\n\n\n\n\nTHIS CAUSE came on to be heard on the record of the court below, and the same being\n\nconsidered, because it is the opinion of this Court that there was error in the district court’s\n\njudgment: IT IS THEREFORE considered, adjudged and ordered that the judgment of the\n\ndistrict court is reversed, and judgment is rendered dismissing appellees’ Laura Beeman and\n\nJanet Lock’s claims for want of subject-matter jurisdiction. ", "It is FURTHER ordered that the\n\nappellees pay all costs relating to this appeal, both in this Court and the court below; and that this\n\ndecision be certified below for observance.", "\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.018404907975460124, 0.00995575221238938, 0.00558659217877095, 0 ]

[ "Sen. Elizabeth Warren Elizabeth WarrenJudd Gregg: The Kamala threat — the Californiaization of America GOP set to release controversial Biden report Biden's fiscal program: What is the likely market impact? ", "MORE (D-Mass.) apologized to the Cherokee nation for increasing confusion over tribal citizenship by publishing her DNA tests.", "\n\n“Senator Warren has reached out to us and has apologized to the tribe,\" Executive Director of Cherokee Nation Communications Julie Hubbard told The Hill Friday.", "\n\n\"We are encouraged by this dialogue and understanding that being a Cherokee Nation tribal citizen is rooted in centuries of culture and laws not through DNA tests. ", "We are encouraged by her action and hope that the slurs and mockery of tribal citizens and Indian history and heritage will now come to an end.\"", "\n\nADVERTISEMENT\n\nWarren's team did not immediately respond to The Hill's request for confirmation of the apology.", "\n\nThe call to Cherokee Nation, which The Intercept first reported, is the first time Warren has flat-out apologized for using DNA tests.", "\n\nWarren announced her 2020 presidential campaign on Dec. 31.", "\n\nIn October, Warren announced the results of a DNA test that showed \"strong evidence\" that she has Native American ancestry, in a move to dispel scrutiny that she had falsely claimed Native American ancestry in the past.", "\n\nPresident Trump Donald John TrumpBubba Wallace to be driver of Michael Jordan, Denny Hamlin NASCAR team Graham: GOP will confirm Trump's Supreme Court nominee before the election Southwest Airlines, unions call for six-month extension of government aid MORE frequently refers to Warren as \"Pocahontas,\" a racially charged remark that has drawn intense criticism, and has questioned her heritage.", "\n\nHowever, pursuing a DNA test to respond to that kind of criticism quickly drew backlash from some Native American groups who see such genetic tests as problematic, by diminishing an ethnicity and identity to a genealogy test.", "\n\nPreviously she had said that she was \"not a person of color,\" but did not respond to criticism of how DNA tests perpetuate flawed views of tribal citizenship." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.028985507246376812, 0, 0.018518518518518517, 0, 0, 0.008849557522123894, 0.014705882352941176, 0, 0.004524886877828055, 0.020151133501259445, 0, 0 ]

[ "---\nabstract: 'We model the dynamics of Jupiter’s jets by the stochastic barotropic beta-plane model. ", "In this simple framework, by analytic computation of the averaged effect of eddies, we obtain three new explicit results about the equilibrium structure of jets. ", "First we obtain a very simple explicit relation between the Reynolds stresses, the energy injection rate, and the averaged velocity shear. ", "This predicts the averaged velocity profile far from the jet edges (extrema of zonal velocity). ", "Our approach takes advantage of a timescale separation between the inertial dynamics on one hand, and the spin up (or spin down) time on the other hand. ", "Second, a specific asymptotic expansion close to the eastward jet extremum explains the formation of a cusp at the scale of energy injection, characterised by a curvature that is independent from the forcing spectrum. ", "Finally, we derive equations that describe the evolution of the westward tip of the jets. ", "The analysis of these equations is consistent with the previously discussed picture of barotropic adjustment, explaining the relation between the westward jet curvature and the beta effect. ", "Our results give a consistent overall theory of the stationary velocity profile of inertial barotropic zonal jets, in the limit of small scale forcing.'", "\nauthor:\n- 'E. Woillez'\n- 'F. Bouchet'\nbibliography:\n- 'All-2016-05.bib'\n- 'Fbouchet\\_2016\\_05.bib'\ntitle: 'Barotropic theory for the velocity profile of Jupiter turbulent jets: an example for an exact turbulent closure'\n---\n\nAuthors should not enter keywords on the manuscript, as these must be chosen by the author during the online submission process and will then be added during the typesetting process (see http://journals.cambridge.org/data/relatedlink/jfm-keywords.pdf for the full list)\n\nIntroduction\n============\n\nThe giant gaseous planets like Jupiter and Saturn can be seen as paradigmatic systems to study geostrophic turbulent flows (see [@vasavada2005jovian] for Jupiter). ", "Gallileo and Cassini gave high resolution observations of Jupiter’s troposphere dynamics [@salyk2006interaction; @porco2003cassini]. ", "The large alternating colored bands at the top of the troposphere are correlated with the zonal wind vorticity. ", "Vortices with a scale of about a thousand kilometers often appear after three dimensional convective activity in the atmosphere. ", "The interaction between those vortices and the zonal jets continuously transfers energy to the barotropic component [@ingersoll1981interaction; @salyk2006interaction], and equilibrates the dissipation mechanisms. ", "The dynamics of large scale jet formation may be qualitatively well understood within the framework of two-dimensional geostrophic turbulence in a $\\beta$ plane [@PedloskyBook], although more refined models are needed to understand their quantitative features [@li2006interaction; @Schneider_Liu_2009JAtS...66..579S]. ", "As the aim of this work is to make progresses in the theoretical understanding of turbulent flows, we consider geostrophic turbulence in the simple barotropic $\\beta$ plane model. ", "Despite all its limitations, for instance the lack of dynamical effects related to baroclinic instabilities, we will show that this model reproduces the main qualitative features of the velocity profiles.", "\n\nAn interesting property of two dimensional turbulent flows is their inverse energy transfer from small scales to large scales, sometimes through a cascade among scales, but much more often through a direct transfer from small scale to large scale mediated by the large scale flow. ", "This inverse energy transfer is responsible for the self organization of the flow into large scale coherent structures that may evolve much slower than the eddies. ", "Among those structures, giant vortices and zonal jets have raised strong interest in the scientific community. ", "The $\\beta$ effect favors the formation of jets, but without $\\beta$ effect both jets and vortices can be observed in numerical simulations  [@Sommeria1986; @Bouchet_Simonnet_2008; @frishman2017jets]. ", "Both structures are also observed in the atmosphere of gaseous planets [@ingersoll1990atmospheric; @galperin2014cassini; @galperin2001universal]. ", "The computation of statistical equilibrium theory of the two-dimensional Euler and quasi-geostrophic equations [@BouchetVenaille-PhysicsReport], using large deviation theory, led to the conclusion that zonal jets as well as large vortices are stable equilibrium states of the flow, and thus natural attractors. ", "However, planetary flows are continuously damped and forced and a non-equilibrium theory must explain the selection between all such possible attractors.", "\n\nThe exact shape of zonal winds on Jupiter reveals an astonishing asymmetry between eastward jets and westward jets [@porco2003cassini; @sanchez2008depth; @garci2001study]. ", "Whereas eastward jets form cusps at their maximum velocity, westward jets are smoother, close to a parabolic velocity profile. ", "At the same time, the profile of potential vorticity (PV) looks like “staircases” [@Dritschel_McIntyre_2008JAtS], and all those prominent features are well reproduced in direct numerical simulations of $\\beta$ plane turbulence. ", "One could ’postulate’ a potential vorticity staircase profile and derive the corresponding mean flow [@Dritschel_McIntyre_2008JAtS]. ", "This exercice is very enlightening, as it roughly relates jet spacing to other flow properties. ", "Nevertheless, the physical mechanism leading to the staircase profile remains unclear. ", "Moreover as our discussion will clearly show, the potential vorticty staircase is just a useful idealised approximation: the actual jet profile will depend on the control parameters, for instance friction, force spectrum, and $\\beta$.\n\nStarting from the stochastic barotropic beta plane model, our aim is to derive simple general relations for the jet velocity profile. ", "A promising nonequilibrium statistical theory explaining jet formation is the stochastic structural stability (S3T) theory [@Farrel_Ioannou; @Farrell_Ioannou_JAS_2007] or the closely related second order cumulant expansion theory (CE2) [@Marston_Conover_Schneider_JAS2008]. ", "The key ingredient in those theories is to neglect eddy-eddy interactions, keeping only the interaction between eddies and the mean flow. ", "With this quasilinear approximation, there is no inverse energy cascade in Fourier space anymore, and the inverse energy flux goes through interactions with the mean flow. ", "This may be relevant only when the inverse energy cascade flux are negligible. ", "The flow governed by the S3T equations, with or without phenomenological added stochastic forcing, produces spontaneous emergence and equilibration of zonal jets [@BakasIoannou2013SSST; @constantinou2012emergence] which velocity profiles reproduce quite well the main features of jets obtained in rotating-tank experiments [@read2004jupiter], numerical experiments [@vallis1993generation; @williams1978planetary] or in the atmosphere of gaseous planets.", "\n\nThe question of why and when this quasilinear approximation should give such good results has been addressed in [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys]. ", "The main result is that the quasilinear approximation is self-consistent in the inertial limit of weak stochastic forcing and dissipation, when the inertial time scale is much smaller than the spin up or spin down time scale. ", "For Jupiter the inertial time scale is of order of a day or a month, while the spin up or spin down time scale, related to dissipative phenomena (radiative balance on Jupiter) may be of order of ten years (see e.g [@porco2003cassini]). ", "Moreover it follows from [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys] analysis that the quasilinear equations are expected to be valid above a crossover scale, that tends to zero in the limit of weak stochastic forces and dissipation limit. ", "Using this justified approximation in the inertial limit, it is then possible to write a *closed* equation for the evolution of the mean velocity.", "\n\nIf we assume that all the energy injected by the force is locally transferred to the mean flow, we obtain $$\\left\\langle uv\\right\\rangle =\\frac{\\epsilon}{U'},\\label{eq:result}$$ where $U$ is the mean zonal velocity profile, $U'$ its derivative with respect to the South-North coordinate $y$, $\\left\\langle uv\\right\\rangle$ the Reynolds stress, and $\\epsilon$ the energy injection rate per unit of mass. ", "Such a formula for the Reynolds stress might give a closed equation for the zonal jet, and is consequently very appealing. ", "This expression is very similar to the one discussed in [@laurie2014universal] for a vortex without $\\beta$ effect. ", "In this paper this formula was obtained by neglecting the pressure term and the cubic terms in the energy balance relation, without justification. ", "A more general formula, taking into account possible small scale dissipation, was actually obtained previously by [@srinivasan2014reynolds], through explicit computation assuming a constant shear flow $U'=Cst$. A similar result also holds in the case of dipoles for the 2D Navier–Stokes equations [@kolokolov2016structure; @kolokolov2016velocity]. ", "Through numerical computations [@laurie2014universal] have shown that the analogous result for the 2D Navier–Stokes equations actually predicts correctly the velocity profile in a restricted part of the domain, far from the core of the vortex and far from the flow separatrix. [", "@kolokolov2016structure] give scaling arguments to show in which domain of the flow the theoretical expression for the velocity profile is expected to hold.", "\n\nIn section \\[sec:Inertial-small-scale\\], following preliminary results in [@woillez2017theoretical], we prove that equation (\\[eq:result\\]) can be deduced as a consequence of the two limits of weak forces and dissipation on one hand, and of small scale forcing on the other hand. ", "This first result justifies equation (\\[eq:result\\]) and clarifies the required hypothesis. ", "By contrast with our previous work [@woillez2017theoretical], in the present paper we discuss completely the mathematical justification when taking the limit of small scale forces before the inertial limit of weak forces and dissipation. ", "The other order for these limits is way simpler mathematically, but is not relevant for turbulent flows.", "\n\nIn section \\[sub:predictions\\], we use result (\\[eq:result\\]) to write a closed equation for the mean velocity profile $U$. We solve it for the resulting stationary profile. ", "With such an equation, the stationary profile diverges at some finite latitude. ", "We thus conclude that the appealing formula (\\[eq:result\\]) is valid only far from the jet tips, where $U'$ does vanish. ", "A more refined analysis is required to deal with the zonal jet velocity extrema.", "\n\nIn section \\[sub:Cusps-for-eastward\\], using Laplace transform tools, we derive an equation for the Reynolds stress divergence in the inertial limit. ", "Taking afterwards the small-scale forcing limit, we give a set of equations that describes the zonal velocity extremum of the eastward jet. ", "Although the full numerical calculation of the solution is avoided, we give some arguments to show that this set of equations leads to the formation of a “cusp” of typical size $\\frac{1}{K}$ where $\\frac{1}{K}$ is a typical scale of the stochastic forcing. ", "We explain that this cusp has no universal shape: it depends on the stochastic forcing spectrum and on the dissipative mechanism. ", "Yet we derive a relation, valid when viscous phenomena are negligible at the size of the cusp, that relates the curvature of the cusp to the maximal velocity $U(y_{cr})$. It writes $$U(y_{cr})U''(y_{cr})=-\\frac{\\epsilon K^{2}}{r},\\label{eq:result2}$$ where $r$ is the linear friction coefficient in $s^{-1}$ (see equation (\\[eq:curvature\\])). ", "Remarkably this relation does not depends on the forcing spectrum, but just on $\\epsilon$.\n\nOn the contrary, the westward jet cannot form this cusp because it would violate the Rayleigh-Kuo criterion of stability. ", "In section \\[sub:Computation-of-Reynold’s\\], we derive a self-consistent equation for the westward jet extrema. ", "We explain that an instability can develop at the extremum, and how it stops the westward jet growth such that the zonal flow form a parabolic profile of curvature about $\\beta$. This is compatible with the classical idea of barotropic adjustment. ", "We also demonstrate that the appearance of neutral modes (modified Rossby waves) is not sufficient to arrest the growth of the jet extremum velocity, and that a marginal and transient instability is necessary.", "\n\nReynolds stresses from energy, enstrophy, and pseudomomentum balances\\[sec:Reynolds-stresses-from\\]\n===================================================================================================\n\nThe stochastic barotropic $\\beta$ plane model\n---------------------------------------------\n\nWe start from the equations for a barotropic flow on a periodic beta plane with stochastic forces $$\\begin{aligned}\n\\partial_{t}\\Omega+V.\\nabla\\Omega & = & -r\\Omega-\\beta_{d}V_{y}+\\sqrt{2\\epsilon}\\eta\\label{eq:Navier-stokes}\\\\\n\\nabla.", "V & = & 0,\\nonumber \\end{aligned}$$ where the vorticity $\\Omega:=\\left(\\nabla\\wedge V\\right).e_z$ is the curl of the two dimensional velocity field $V:=\\begin{pmatrix}V_{x}\\\\\nV_{y}\n\\end{pmatrix}$, $r$ models a linear friction, $x$ and $y$ are the East–West and North–South coordinates respectively, $\\beta_d$ the Coriolis parameter, and $\\eta$ is a stochastic force that we assume white in time: $\\mathbb{E}\\left[\\eta(x,y,t)\\eta(x',y',t')\\right]=\\delta(t-t')C_{d}(x-x',y-y'')$. We assume that $C_{d}$ is statistically homogeneous such that it depends only on the difference $x-x'$ and $y-y'$. We choose a particular normalization for the correlation function $C_{d}$, such that $\\epsilon$ is the energy injection rate per unit mass: $\\epsilon$ has dimensions $m^{2}s^{-3}$. In the following, we will always assume that there is no direct energy injection in the zonal velocity profile, i.e that $\\frac{1}{L_{x}}\\int{\\rm d}x\\eta(r,t)=0.$\n\nNondimensional equations and nondimensional numbers are the clearest way to determine the flow regime. ", "We choose here to set temporal and spatial units such that the mean kinetic energy is 1, and $L_{x}=1$ (please see [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys] for more details, or ([@Bouchet_Nardini_Tangarife_2016_kinetic_Zonal_Jets] page 2-3) for comparison with other common nondimensionalizations of the stochastic barotropic equations). ", "For simplicity, we use the same notations for the dimensional and nondimensional velocity and vorticity. ", "The nondimensional equations are $$\\begin{aligned}\n\\partial_{t}\\Omega+V.\\nabla\\Omega & = & -\\alpha\\Omega-\\beta V_{y}+\\sqrt{2\\alpha}\\eta,\\label{eq:Navier-stokes adim}\\\\\n\\nabla. ", "V & = & 0.\\nonumber \\end{aligned}$$ Now $\\alpha=L\\sqrt{r^{3}/\\epsilon}$ is a nondimensional parameter although we will often refer to it as the “friction”. ", "$\\beta=\\sqrt{r/\\epsilon}L^{2}\\beta_{d}$ is the new nondimensional Coriolis parameter, while $\\beta_{d}$ is the dimensional one. ", "We note that $\\beta=L^{2}/L_{R}^{2}$, where $L_{R}=\\left({\\epsilon/r\\beta_{d}^{2}}\\right)^{1/4}$ is the Rhines scale. ", "The zonostrophy index used in many references would be $R_{\\beta}=\\beta^{1/10}\\epsilon^{1/20}r^{-1/4}$. We find that $\\alpha\\propto(R_{\\beta})^{-5}$, which implies that the inertial limit of vanishing $\\alpha$ corresponds to the limit of large $R_{\\beta}$. Let $C(r)$ be the nondimensional expression of the noise correlation function $C_{d}(r)$. We denote $\\hat{C}_{k,l}$ the Fourier coefficients of $C$, $$C(x,y):=\\underset{k,l}{\\sum}\\hat{C}_{k,l}e^{ikx+ily},\\label{eq:Correlation_Fourier}$$ and $K^{2}=k^{2}+l^{2}$. As a correlation function, $C$ is a definite positive function and as a conseuence $\\hat{C}_{k,l}$ is real and positive. ", "Moreover, if we assume the symmetry $x\\rightarrow-x$ and $y\\rightarrow-y$, the function $\\hat{C}_{k,l}$ is symmetric with respect to $k\\rightarrow-k$ and $l\\rightarrow-l$. The constrain that the mean kinetic energy is one writes $$\\frac{1}{2}\\iint{\\rm d}k{\\rm d}l\\frac{\\hat{C}_{k,l}}{K^{2}}=1.$$ From now on, the computations will be done with nondimensional quantities. ", "If we want to write a result in its dimensional formulation, we will reintroduce $\\left[\\frac{\\epsilon}{r}\\right]=m^{2}.s^{-2}$ and $[L_{x}]=m$.\n\nWe separate the flow $V$ in two parts, $V(r,t)=U(y,t)e_{x}+\\begin{pmatrix}u(r,t)\\\\\nv(r,t)\n\\end{pmatrix}$. The mean velocity $Ue_{x}=\\left\\langle V\\right\\rangle $ is defined as the zonal and stochastic average of the velocity field. ", "More precisely, we assume that the mean flow is parallel and we take $\\left\\langle V\\right\\rangle=\\frac{1}{L_{x}}\\int{\\rm d}x\\mathbb{E}[V(x,y)]$. In the following, the bracket $\\left\\langle \\right\\rangle $ will be used for both the zonal and stochastic averages. ", "The vorticity then separates in $\\Omega(r,t)=-U'(y,t)+\\omega(r,t)$, where the prime denotes the derivative with respect to $y$. We will refer to $U$ indifferently as the *mean flow* or *zonal flow*.", "\n\nUsing this decomposition and the continuity equation, we can obtain an equation for the zonal component of the vorticity, and then integrate over $y$ to get the equation for the mean velocity $U$ $$\\partial_{t}U+\\partial_{y}\\left\\langle uv\\right\\rangle =-rU.\\label{eq:meanvelocity}$$ Equation (\\[eq:meanvelocity\\]) shows that the mean flow is forced by the divergence of the Reynolds stress $\\partial_{y}\\left\\langle uv\\right\\rangle $. ", "In order to reach an equilibrium, this latter term has to balance the dissipation coming from linear friction.", "\n\nQuasilinear approximation and pseudomomentum balance\n----------------------------------------------------\n\nIn this section we define the quasilinear approximation. ", "We recall basic concepts about linear dynamics and the relation between stochastic and deterministic linear dynamics.", "\n\nIn the following we are interested in the small $\\alpha$ regime (the inertial or weak forces and dissipation regime). ", "In the limit where $\\alpha$ goes to zero in equation (\\[eq:Navier-stokes adim\\]), we can neglect the nonlinear eddy-eddy interactions. ", "This approximation is called the *quasilinear approximation*. ", "The quasilinear approximation has been shown self-consistent by [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys] with some assumptions on the profile $U$ (stability, no zero modes). ", "We will not develop the full justification of the quasilinear approximation here, the interested reader is referred to [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys]. ", "Let us simply recall the heuristic ideas leading to the quasilinear approximation. ", "First, we notice that the strength of the noise is of order $\\sqrt{\\alpha}$. As fluctuations are sheared and transferred to the largest scales on a timescale of order one, this is a natural hypothesis to expect fluctuations $(u,v)$ to be of the same order. ", "This was proven to be self-consistent in [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys]. ", "We make the rescaling $(u,v):=\\sqrt{2\\alpha}(u',v')$ in equation (\\[eq:Navier-stokes adim\\]), and we omit the prime in the following for clarity. ", "The eddy-eddy interaction terms are of order $\\alpha^{\\frac{3}{2}}$, and can then be neglected. ", "We are left with the set of equations $$\\partial_{t}U=-\\alpha\\left[\\partial_{y}\\left\\langle uv\\right\\rangle +U\\right]\\label{eq:quasilinear}$$ $$\\partial_{t}\\omega+U\\partial_{x}\\omega+(\\beta-U'')v=-\\alpha\\omega+\\eta\\label{eq:quasilinear2}$$ where $\\omega=\\partial_{x}v-\\partial_{y}u=\\triangle\\psi$ is the rescaled vorticity fluctuations. ", "Equation (\\[eq:quasilinear\\]) shows that the typical timescale for the evolution of the mean flow $U$ is $\\frac{1}{\\alpha}$. By contrast, equation (\\[eq:quasilinear2\\]) shows that the timescale for eddy dynamics is of order one. ", "Using this timescale separation, we will consider that $U$ is a constant field in the second equation (\\[eq:quasilinear2\\]), and we will solve $\\omega(t)$ for a given profile $U$. Once $U$ is considered as given, the eddy equation is linear. ", "This time scale separation is observed for example on Jupiter where the typical time of eddies evolution ranges from few days to few weeks whereas significant changes in the mean flow are only detected over decades (see e.g [@porco2003cassini]).\\\nWithout forces and dissipation, the quasilinear equations conserve energy and enstrophy as do the full barotropic flow equations. ", "One of the key relations we will use in this paper comes from the fluctuation enstrophy balance $$\\frac{1}{2}\\partial_{t}\\left\\langle \\omega^{2}\\right\\rangle -(\\beta-U'')\\partial_{y}\\left\\langle uv\\right\\rangle =-\\alpha\\left\\langle \\omega^{2}\\right\\rangle +\\frac{1}{2}C(0).$$ where we have used $$\\left\\langle v\\omega\\right\\rangle =-\\partial_{y}\\left\\langle uv\\right\\rangle,\\label{eq:tenseur2}$$ which a consequence of incompressibility.", "\n\nAs a consequence, if $U''-\\beta$ has a constant sign in the flow, without forces and dissipation, the left-hand side of equation (\\[eq:quasilinear2\\]) conserves the pseudomomentum $\\int\\frac{\\left\\langle \\omega^{2}\\right\\rangle }{U''-\\beta}\\rm{d}y$. The pseudomomentum does not allow any instability to occur and the flow is stable. ", "This is called the Rayleigh-Kuo criterion for stability of shear flows. ", "If $U''-\\beta$ vanishes somewhere in the flow, an instability may or may not exist. ", "The fact that $U''-\\beta$ vanishes is a necessary condition for instability, not a sufficient one.", "\n\nAs we assume a timescale separation between the zonal flow and fluctuation dynamics, we are interested in the long-term behavior of the Reynolds stress $\\partial_{y}\\left\\langle uv\\right\\rangle$. When the vorticity fluctuations $\\omega$ reach its stationary distribution, we have the relation $$\\partial_{y}\\left\\langle uv\\right\\rangle = -\\frac{1}{U''-\\beta}\\left[\\alpha\\left\\langle \\omega^{2}\\right\\rangle -\\frac{1}{2}C(0)\\right].\\label{eq:tenseur}$$ This equation for the Reynolds stress will be extremely useful.", "\n\nWe now take the Fourier transform of (\\[eq:quasilinear2\\]) in $x$: $\\omega_{k}(y):=\\frac{1}{L_{x}}\\int{\\rm d}x\\omega(x,y)e^{-ikx}$ with $k$ taking the values $\\frac{2\\pi}{L_{x}}n$, $n$ is an integer. ", "We also use the linearity to express the solution as the sum of particular solutions for independent stochastic forcings $\\eta_{l}(y,t)$. We denote $\\omega_{k,l}(y,t)$ the solution of $$\\partial_{t}\\omega_{k,l}+L_{k}[\\omega_{k,l}]=-\\alpha\\omega_{k,l}+\\eta_{l},\\label{eq:quasilinearcomplex}$$ where $$L_{k}[\\omega_{k,l}]=ikU\\omega_{k,l}+ik(\\beta-U'')\\psi_{k,l},\\label{eq:Lk}$$ and where $\\eta_{l}$ is a Gaussian white noise with correlations ***$\\mathbb{E}\\left[\\eta_{l}(y,t)\\eta_{l}(y',t)\\right]=e^{il(y-y')}\\delta(t-t')$***. ", "From equation (\\[eq:tenseur\\]) we obtain $$\\partial_{y}\\left\\langle uv\\right\\rangle = -\\frac{1}{U''-\\beta}\\underset{k,l}{\\sum}\\frac{\\hat{C}_{k,l}}{2}\\left[2\\alpha\\left\\langle |\\omega_{k,l}|^{2}\\right\\rangle -1\\right],\\label{eq:tenseur decompose}$$ where the positive constants $\\hat{C}_{k,l}$ are defined by (\\[eq:Correlation\\_Fourier\\]). ", "We stress that **** in this formula the bracket $\\left\\langle |\\omega_{k,l}|^{2}\\right\\rangle $ denotes a stochastic average, because the zonal average is already taken into account by the sum over all vectors $k$.\n\nWe now proceed to a further simplification, showing that the stochastic eddy dynamics can be computed from a set of deterministic linear problems, following ** [@Bouchet_Nardini_Tangarife_2013_Kinetic_JStatPhys]. ", "We use that equation (\\[eq:Lk\\]) is a linear operator for a given $U$ and that the noise $\\eta_{k,l}$ is white in time and has an exponential correlation function **$c_{l}(y)=e^{ily}$** to express the stationary average $\\left\\langle |\\omega_{k,l}|^{2}\\right\\rangle $ as $$\\left\\langle |\\omega_{k,l}|^{2}\\right\\rangle =\\int_{-\\infty}^{0}{\\rm d}t~e^{2\\alpha t}\\left|e^{tL_{k}}[c_{l}]\\right|^{2},\\label{eq:omegacarre}$$ where $e^{tL_{k}}[c_{l}]$ is the solution at time $t$ of the *deterministic equation* $$\\partial_{t}\\omega_{d}+L_{k}[\\omega_{d}]=0, \\label{eq:deterministic}$$ with initial condition $c_{l}:=y\\rightarrow e^{ily}$.\n\nEquations (\\[eq:tenseur decompose\\]), (\\[eq:omegacarre\\]) and (\\[eq:quasilinear\\]) give a way to compute Reynolds stresses and the velocity profile $U$ from classical and much studied deterministic hydrodynamic problems. ", "Equation (\\[eq:deterministic\\]) is however tricky and has no simple explicit expression in the general case. ", "We will be able to get explicit result only in asymptotic regimes.", "\n\nSimplifications in asymptotic regimes\n-------------------------------------\n\nExpression (\\[eq:omegacarre\\]) is still complicated because to get explicit results, it requires **** to know the behavior of the solution **$e^{tL_{k}}[c_{l}]$** up to times of order $\\frac{1}{\\alpha}$. Two parameters can be used to further simplify the problem, the vector $\\mathbf{k}=(k,l)$ and the damping $\\alpha$. We denote $K:=|\\mathbf{k}|$. We will be interested both in the regime $K\\rightarrow\\infty$ and $\\alpha\\rightarrow0$. The large $K$ regime is a small scale forcing regime.", "\n\nThe inertial limit $\\alpha\\rightarrow0$ is the most difficult one, because turbulence can develop on a very long time. ", "But the inertial limit is also the most interesting from a physical point of view because it corresponds to fully turbulent regimes, and is the most relevant one to describe Jupiter’s atmosphere. ", "In this section we prove that equation (\\[eq:tenseur decompose\\]) and (\\[eq:omegacarre\\]) can be further simplified and computed through the asymptotic behavior of a linear dynamics without dissipation, in the inertial regime.", "\n\nThe result in the inertial regime crucially depends on whether the deterministic equation without dissipation $$\\partial_{t}\\omega_{d}+ikU\\omega_{d}+ik(\\beta-U'')\\psi_{d}=0\\label{eq:deterministic}$$ with initial condition $\\omega_d(y,0)=c_l$, sustains neutral modes or not. ", "A neutral mode is defined as a solution of this equation of the form $\\omega_d(y,t)=\\xi^{a}(y)e^{ic_{a}t}$ where $c_{a}$ is a real constant. ", "It is also sometimes called “modified Rossby waves” in this context, when the jet velocity is nonzero. ", "Two cases can be encountered. ", "In the first case, without neutral modes, [@Bouchet_Morita_2010PhyD] have shown that $\\omega_{d}$ behaves asymptotically for long time as $\\omega_{d}(y,t)\\underset{t\\rightarrow\\infty}{\\sim}\\omega^{\\infty}(y)e^{ikUt}$, even for non monotonous velocity profiles $U$. Please note that we should write $\\omega_{kl}^{\\infty}(y)$ because the asymptotic limit of $\\omega_d$ depends on the wavevector, but we choose to omit the indices $k,l$ for clarity. ", "Moreover [@Bouchet_Morita_2010PhyD] give a method to compute this $\\omega^{\\infty}$ using Laplace transform tools. ", "In this case, in the limit $\\alpha\\rightarrow0$, the Reynolds stress writes $$\\partial_{y}\\left\\langle uv\\right\\rangle = -\\frac{1}{U''-\\beta}\\underset{k,l}{\\sum}\\frac{\\hat{C}_{k,l}}{2}\\left[|\\omega^{\\infty}|^{2}-1\\right].\\label{eq:inertial}$$ We give the full justification of this result in appendix \\[sec:The-Reynold’s-stress\\].", "\n\nIn the second case, with neutral modes, we have to modify expression (\\[eq:inertial\\]) to take into account the presence of modes. ", "Again, we leave the technical details to appendice \\[sec:The-Reynold’s-stress\\] and we give the final result $$\\partial_{y}\\left\\langle uv\\right\\rangle = -\\frac{1}{U''-\\beta}\\underset{k,l}{\\sum}\\frac{\\hat{C}_{k,l}}{2}\\left[|\\tilde{\\omega}^{\\infty}|^{2}-1+\\underset{modes~a}{\\sum}|\\omega^{a}|^{2}\\right].\\label{eq:inertialmodes}$$ This result means that we have to project first the initial condition $c_{l}$ over the modes labeled by $a$. The component over the $a$ mode gives the term $\\omega^{a}(y)$. This new terms are related to the wave pseudomomentum balance. ", "Then we compute the asymptotic solution $\\tilde{\\omega}^{\\infty}$ of (\\[eq:deterministic\\]) using as initial condition not $c_{l}$ but $c_{l}-\\sum\\omega^{a}$. Briefly speaking, a first reason why there are no cross terms of the form $\\omega^{a}\\tilde{\\omega}$ between modes and the remaining part of the spectrum is because the frequencies $c_{a}$ of the modes are always outside of the range of $U$ as shown by [@drazin1982rossby; @pedlosky1964stability]. ", "The cross terms have an oscillatory part of frequency $\\frac{1}{\\alpha}(c_{a}-U)$ that gives a vanishing contribution in the small $\\alpha$ limit.", "\n\nBoth formulas (\\[eq:inertial\\]-\\[eq:inertialmodes\\]) are independent from $\\alpha$ in the limit of vanishing $\\alpha$. This is a non-trivial result. ", "The formulas will be used to study the inertial limit in section \\[sec:Inertial-small-scale\\].", "\n\nExplicit velocity profile in the inertial and small scale forcing regime\\[sec:Inertial-small-scale\\]\n====================================================================================================\n\nObservations collected by the Gallileo and Cassini probes (see [@porco2003cassini] and others) allows to estimate typical values for $K$ and $\\alpha$. $1/K$ is the forcing length scale. ", "It can be estimated to be or order $1000$ km, the typical size of cyclones due to convective activity in Jupiter’s troposphere. ", "The dissipation on Jupiter involves different mechanisms, which are roughly modelled by our linear friction. ", "What could is a relevant typical timescale for dissipation is not obvious. ", "Based on Jupiter observations, many authors [@porco2003cassini; @vasavada2005jovian; @salyk2006interaction] consider a large scale dissipation time $1/r$ of the order of a few years. ", "To compute an order of magnitude for the non dimensional parameter $\\alpha$, we have chosen $1/r=5$ years. ", "$U$ is easily estimated from the observations, and the Coriolis parameter $\\beta$ is easily computed from the rotation rate of Jupiter. ", "After non-dimensionalisation, following the discussion in the previous section, we estimate the orders of magnitude for $K\\sim10$ and $\\alpha\\sim10^{-3}$. Jupiter is thus in the asymptotic regime $\\alpha\\rightarrow0$ and $K\\rightarrow+\\infty$. Both limits do not necessarily commute, we thus have to be careful which limit we are going to take first. ", "The turbulent nature of the dynamics at the forcing scale suggests the limit $\\alpha\\rightarrow0$ first, and then $K\\rightarrow+\\infty$.\n\nComputation of the long-time limit of eddy vorticity\\[sub:Computation-of\\]\n--------------------------------------------------------------------------\n\nIn the following and until section \\[sub:Computation-of-Reynold’s\\], we assume there are no Rossby waves in the flow. ", "It has been shown long ago that those waves travel in a barotropic flow at a velocity $c<U_{min}$ [@drazin1982rossby; @pedlosky1964stability]. ", "In section \\[sub:Computation-of-Reynold’s\\], we will explain how we can compute Rossby waves in case of a parabolic profile.", "\n\nIn this subsection, we summarize the main result obtained by Bouchet and Morita [@Bouchet_Morita_2010PhyD] that allows us to compute the function $\\omega^{\\infty}$ appearing in (\\[eq:inertial\\]). ", "$\\omega^{\\infty}$ gives then an easy access to the small $\\alpha$ limit, independently of the large $K$ limit.", "\n\nWe start from equation (\\[eq:deterministic\\]) that describes the linear evolution of a perturbation $\\omega(y,t)\\mbox{e}^{ikx}$ of meridional wave number $k$, and with streamfunction $\\psi(y,t){\\rm e}^{ikx}$. In the following, we will stop using the subscript $d$ for the deterministic solution $\\omega_{d}$ in (\\[eq:deterministic\\]). ", "We introduce the function $\\varphi_{\\epsilon}(y,c)$ which is the Laplace transform of the stream function $\\psi(y,t)$ i.e $\\varphi_{\\epsilon}(c):=\\int_{0}^{\\infty}{\\rm d}t\\psi(y,t)e^{ik(c+i\\epsilon)t}$. To avoid any confusion, we stress that in this section, $\\epsilon$ will always denote a small parameter and not the energy injection rate. ", "The Laplace transform $\\varphi_{\\epsilon}$ is well defined for any non zero value of the real variable $\\epsilon$ with a strictly positive product $k\\epsilon$. $c$ has to be understood as the phase speed of the wave, and $k\\epsilon$ is the exponential growth rate of the wave. ", "Note that $k\\epsilon$ exactly corresponds to a linear friction in equation (\\[eq:deterministic\\]), such that the inertial limit $\\alpha\\rightarrow0$ is equivalent to the limit $\\epsilon\\rightarrow0$. The equation for $\\varphi_{\\epsilon}$ is $$\\left(\\frac{d^{2}}{dy^{2}}-k^{2}\\right)\\varphi_{\\epsilon}(y,c)+\\frac{\\beta-U''(y)}{U(y)-c-i\\epsilon}\\varphi_{\\epsilon}(y,c)=\\frac{\\omega(y,0)}{ik(U(y)-c-i\\epsilon)},\\label{eq:inhomogeneous rayleigh}$$ (see [@Bouchet_Morita_2010PhyD]), with vanishing boundary conditions at infinity. ", "We do not have an infinite flow in the $y$ direction, but the properties of the flow become local for large $K$. The choice to take vanishing boundary conditions at infinity is done for convenience and it is expected that this particular choice does not modify the physical behavior of the perturbation.", "\n\nFor all $\\epsilon>0$ the function $\\varphi_{\\epsilon}$ is well defined. ", "The inhomogeneous Rayleigh equation (\\[eq:inhomogeneous rayleigh\\]) is singular for $\\epsilon=0$ at any critical point (or critical layer) $y_{c}$ such that the zonal velocity is equal to the phase speed: $U(y_{c})=c$. One can show that $\\varphi_{\\epsilon}$ has a limit denoted $\\varphi_{+}$ when $\\epsilon$ goes to zero. ", "The function $\\omega^{\\infty}$ is then given by $$\\omega^{\\infty}(y)=ik(U''(y)-\\beta)\\varphi_{+}(y,U(y))+\\omega(y,0),\\label{eq:omegainfini}$$ see [@Bouchet_Morita_2010PhyD]. ", "The function $\\omega^{\\infty}$ depends on the Laplace transform of the stream function but for a phase velocity $c$ equal to the zonal velocity at latitude **$y$**. ", "From a mathematical point of view, it corresponds to the value of $\\varphi_{+}$ exactly at its singularity. ", "The singularity in equation (\\[eq:inhomogeneous rayleigh\\]) is of degree one (proportional to $\\frac{1}{y}$) except at the extrema of the jets where it is of degree two. ", "A singularity of order two would create a divergence for the solution, but it happens that the numerator in (\\[eq:inhomogeneous rayleigh\\]) vanishes at such points and the solution is still defined at the extrema of a jet. ", "A nontrivial consequence of that is $$\\omega^{\\infty}(y_{cr})=0$$ at all critical latitudes $y_{cr}$ where $U'(y_{cr})=0.$ This result, called depletion of vorticity fluctuation at the jet critical points in [@Bouchet_Morita_2010PhyD], has important physical consequences that influence the dynamics of a jet.", "\n\nAs described in [@Bouchet_Morita_2010PhyD], using formula (\\[eq:inhomogeneous rayleigh\\]) and (\\[eq:omegainfini\\]), one can numerically compute the function $\\omega^{\\infty}$ : we first have to solve a set of boundary value problems for ordinary differential equations parameterized by $c$ and $\\epsilon$ to obtain a solution family **$\\varphi_{\\epsilon}(c)$**. ", "Then we evaluate, for small enough $\\epsilon$ each solution $\\varphi_{\\epsilon}(c)$ at the value $y_{c}$ satisfying $U(y_{c})=c$. This method is much faster and has less numerical cost than computing the long time evolution of the partial differential equation (\\[eq:deterministic\\]). ", "We use this method in the following of this section.", "\n\nLimit of small scale forcing for monotonic profiles, and explicit expression of the Reynolds stress {#sub:limit of small scale}\n---------------------------------------------------------------------------------------------------\n\nAgain, we assume there are no Rossby waves. ", "We will now consider the limit of small scale forcing $K\\rightarrow\\infty$. The calculations are rather technical and can be skipped in the first lecture. ", "The result of this section is equation (\\[eq:formule1 adim\\])\n\nWe start from equation (\\[eq:inhomogeneous rayleigh\\]) that describes the inertial behavior of a deterministic evolution of a perturbation $\\omega(y,0)$ when $\\epsilon$ vanishes. ", "Using the Green function $H_{k}(y)$ of $(\\partial_{y}^{2}-k^{2})$ we write $$\\varphi_{\\epsilon}(y,c)=\\left(U''(y)-\\beta\\right)\\int{\\rm d}y'H_{k}(y')\\frac{\\varphi_{\\epsilon}(y-y',c)}{U(y-y')-c-i\\epsilon}+\\int{\\rm d}y'H_{k}(y')\\frac{\\omega(y-y',0)}{ik(U(y-y')-c-i\\epsilon)}.$$ Now we make the change of variable $Y=ky'$ . ", "The Green function has the scaling $H_{k}(y'):=-\\frac{1}{2k}H_{0}(Y)$. Recalling that $\\varphi_{+}(y,c)=\\lim_{\\epsilon\\downarrow0}\\varphi_{\\epsilon}(y,c)$, it follows $$\\begin{gathered}\n\\varphi_{+}(y,c)=-\\frac{\\left(U''(y)-\\beta\\right)}{2k^{2}}\\underset{\\epsilon\\rightarrow0}{\\lim}\\int{\\rm d}YH_{0}(Y)\\frac{\\varphi_{\\epsilon}(y-\\frac{Y}{k},c)}{U(y-\\frac{Y}{k})-c-i\\epsilon}\\\\\n-\\frac{1}{2ik^{3}}\\underset{\\epsilon\\rightarrow0}{\\lim}\\int{\\rm d}YH_{0}(Y)\\frac{\\omega(y-\\frac{Y}{k},0)}{U(y-\\frac{Y}{k})-c-i\\epsilon}.\\label{eq:phiplus}\\end{gathered}$$ Please note that we are making the asumption that $\\frac{l}{k}:=\\tan\\theta$ is finite and thus $K\\rightarrow\\infty$ implies $k\\rightarrow\\infty$. Let us remind here that it is crucial to take the limit $\\epsilon\\rightarrow0$ first before $K\\rightarrow\\infty$ because $\\epsilon$ exactly plays the role of the nondimensional linear friction $\\alpha$. If we want to study the inertial regime, we have to take first a vanishing friction limit.", "\n\nConsider now the magnitude of both terms in the right-hand side of (\\[eq:phiplus\\]). ", "We have a term depending on $\\varphi_{\\epsilon}$ and another depending on the initial condition $\\omega(y,0)$. The initial condition is of order 1, and then the second term will be of order $\\frac{1}{k^{3}}$. As a consequence, the first term in the asymptotic expansion of $\\varphi_{+}$ will be of order $\\frac{1}{k^{3}}$. The first term in the right-hand side of (\\[eq:phiplus\\]) gives the next order of the asymptotic expansion and is thus negligible. ", "We write $$\\varphi_{+}(y,c)\\underset{K\\rightarrow\\infty}{\\sim}-\\frac{1}{2ik^{3}}\\underset{\\epsilon\\rightarrow0}{\\lim}\\int{\\rm d}YH_{0}(Y)\\frac{\\omega(y-\\frac{Y}{k},0)}{U(y-\\frac{Y}{k})-c-i\\epsilon}.\\label{eq:phiplus-asymptotic}$$ Combining equations (\\[eq:omegainfini\\]) and (\\[eq:phiplus-asymptotic\\]) we find that $$|\\omega^{\\infty}(y)|^{2}\\underset{K\\rightarrow\\infty}{\\sim}|\\omega(y,0)|^{2}-\\frac{U''-\\beta}{k^{2}}\\mathcal{R}e\\left\\{ \\underset{\\epsilon\\rightarrow0}{\\lim}\\int{\\rm d}YH_{0}(Y)\\frac{\\omega^{*}(y,0)\\omega(y-\\frac{Y}{k},0)}{U(y-\\frac{Y}{k})-U(y)-i\\epsilon}\\right\\} .$$ The final step is to use $\\omega(y,0)=e^{ily}$, and $H_{0}(Y)=e^{-|Y|}$. We use also the SokhotskiPlemelj formula: $\\underset{\\epsilon\\rightarrow0}{\\lim}\\frac{1}{x-i\\epsilon}=i\\pi\\delta(x)+\\mathcal{P}\\left(\\frac{1}{x}\\right),$ to obtain $$\\begin{aligned}\n|\\omega^{\\infty}(y)|^{2} & \\underset{K\\rightarrow\\infty}{\\sim} & |\\omega(y,0)|^{2}-\\frac{U''-\\beta}{k^{2}}\\mathcal{R}e\\left\\{ \\underset{\\epsilon\\rightarrow0}{\\lim}\\int{\\rm d}Ye^{-|Y|}\\frac{e^{-iY\\tan\\theta}}{U(y-\\frac{Y}{k})-U(y)-i\\epsilon}\\right\\} \\\\\n & \\underset{K\\rightarrow\\infty}{\\sim} & |\\omega(y,0)|^{2}-\\frac{U''-\\beta}{k^{2}}\\mathcal{R}e\\left\\{ i\\pi\\int{\\rm d}Ye^{-|Y|}e^{-iY\\tan\\theta}\\delta\\left(U\\left(y-\\frac{Y}{k}\\right)-U(y)\\right)\\right\\} \\\\\n & & -\\frac{U''-\\beta}{k^{2}}\\mathcal{R}e\\left\\{ \\mathcal{P}\\left\\{ \\int{\\rm d}Ye^{-|Y|}\\frac{e^{-iY\\tan\\theta}}{U(y-\\frac{Y}{k})-U(y)}\\right\\} \\right\\} \\\\\n & \\underset{K\\rightarrow\\infty}{\\sim} & |\\omega(y,0)|^{2}-\\frac{U''-\\beta}{k^{2}}\\mathcal{P}\\left\\{ \\int{\\rm d}Ye^{-|Y|}\\frac{cos(Y\\tan\\theta)}{U(y-\\frac{Y}{k})-U(y)}\\right\\} ,\\end{aligned}$$ where we have used that the term $i\\pi\\int{\\rm d}Ye^{-|Y|}e^{-iY\\tan\\theta}\\delta\\left(U\\left(y-\\frac{Y}{k}\\right)-U(y)\\right)$ is purely imaginary. ", "Injecting this result in (\\[eq:inertial\\]) gives the contribution of one Fourier mode $k,l$ with $\\frac{k}{l}=\\tan\\theta$ to the Reynolds stress divergence $$\\mathcal{R}e\\left\\langle v_{\\theta}^{*}\\omega_{\\theta}\\right\\rangle \\underset{K\\rightarrow\\infty}{\\sim}-\\frac{\\hat{C}_{k,l}}{2k^{2}}\\mathcal{P}\\left\\{ \\int{\\rm d}Ye^{-|Y|}\\frac{\\cos(Y\\tan\\theta)}{U(y-\\frac{Y}{k})-U(y)}\\right\\} .$$ Some lengthy but straightforward calculations are then required to show that this expression coincides with $\\frac{U''}{U'^{2}}$ (for an energy injection rate set to one). ", "The computation is discussed in appendix \\[sec:Equivalence-of-the\\_limits\\]. ", "But we have to do an additional assumption: the asymptotic expansion is valid only if $\\frac{kU'}{U''}\\rightarrow\\infty$. There should exist a small region in the vicinity of the extremum $U'=0$ where the calculation breaks down. ", "The formula can be valid only for strictly monotonic profiles or for the monotonic part between two extrema of a jet.\\\nWe have derived the first main result of the present paper, $$\\partial_{y}\\left\\langle uv\\right\\rangle =-\\frac{U''}{U'^{2}},\\label{eq:formule1 adim}$$ in the limits $\\alpha\\rightarrow0$ and $K\\rightarrow+\\infty$ taken in this order. ", "With the dimensional physical fields, the result (\\[eq:formule1 adim\\]) writes $$\\partial_{y}\\left\\langle uv\\right\\rangle =-\\epsilon\\frac{U''}{U'^{2}},\\label{eq:formule1 dim}$$ where $\\epsilon$ is the energy injection rate.", "\n\nWe have proven that in the limit of vanishing friction and small scale forcing, we are able to give an explicit expression for the Reynolds stress divergence that does not depend on the shape of the stochastic forcing. ", "The result (\\[eq:formule1 dim\\]) has been obtained taking the limit $\\alpha\\rightarrow0$ first. ", "It has been shown by [@woillez2017theoretical] that the result (\\[eq:formule1 dim\\]) can also be recovered taking the limit $K\\rightarrow+\\infty$ before $\\alpha\\rightarrow0$, which means that both limits do commute in the present case. ", "It is worth emphasizing that our results are asymptotic results. ", "The behavior may be really different for finite friction and finite $K$. The work done in [@srinivasan2014reynolds] shows that the shape of the stochastic forcing matters in the general case.", "\n\nPrediction of the stationary velocity profile {#sub:predictions}\n---------------------------------------------\n\nWith the asymptotic result (\\[eq:formule1 dim\\]), we are now able to derive a close equation for the mean velocity profile $U$. Relation (\\[eq:formule1 dim\\]) together with equation (\\[eq:meanvelocity\\]) gives $$\\partial_{t}U-\\frac{\\epsilon U\"}{U'^{2}}=-rU.\\label{eq:close equation velocity}$$ From the latter result, we deduce that the stationary velocity profile $U_{0}$ satisfies the equation $$\\frac{\\epsilon U_{0}\"}{U_{0}'^{2}}=rU_{0}.\\label{eq:stationary1}$$ Equation (\\[eq:stationary1\\]) surprisingly has a Newtonian structure, it has a first integral that can be interpreted as the sum of a kinetic energy and a potential energy. ", "Multiplying both sides by $U_{0}'$ and integrating over $y$ leads to $$\\frac{1}{2}U_{0}^{2}-\\frac{\\epsilon}{r}\\ln\\left(\\left|U_{0}'\\right|\\right)=C,\\label{eq:particle in potential}$$ where $C$ is an integration constant.", "\n\nIn equation (\\[eq:particle in potential\\]), the function $V(x):=-\\frac{\\epsilon}{r}\\ln\\left(\\left|x\\right|\\right)$ plays the role of a potential. ", "The dynamics defined by (\\[eq:particle in potential\\]) is completely similar to a particle moving in a potential $V$ with equation $$\\frac{1}{2}\\dot{x}^{2}+V(x)=C.$$ The only difference is that the roles of $U$ and $U'$ are exchanged compared to the role of $x$ and $\\dot{x}$ for a particle in a potential. ", "The situation is represented in figure (\\[fig:potential\\]).", "\n\n![", "Newtonian structure of the mean flow dynamics. ", "The stationary zonal flow satisfies a Newtonian equation similarly to a particle in a potential. ", "Whatever the value of the integration constant $C$, two classes of solutions exist: one profile has an increasing velocity, the other one has a decreasing velocity. ", "\\[fig:potential\\]](potential.pdf){height=\"7cm\"}\n\nWhatever the value of the constant $C$, the velocity profile $U_{0}$ always diverges. ", "The derivative $U_{0}'$ cannot change sign. ", "There are two classes of solutions, either solutions with $U_{0}'>0$ or solutions with $U_{0}'<0$. The two classes of solutions correspond to the two sides of a jet. ", "The solution of equation (\\[eq:particle in potential\\]) is represented in figure (\\[fig:diverging profiles\\]). ", "Equation (\\[eq:particle in potential\\]) predicts that zonal jets are composed by a succession of diverging velocity profiles, with successively increasing and decreasing values of the velocity. ", "The side of increasing velocity of a jet is totally independent of the side with decreasing velocity. ", "The velocity profiles of westward and eastward jets are symmetric, with in both cases a diverging value of the velocity at the extremum. ", "Such a velocity profile is of course not realistic because the velocity of zonal winds have finite values. ", "By contrast, the qualitative shape of a real profile is displayed by the blue curve in figure (\\[fig:diverging profiles\\]). ", "Equation (\\[eq:particle in potential\\]) predicts the velocity profile in the intermediate regions of monotonic velocity, away from the jet edges.", "\n\n![", "Mean velocity profile in the inertial small scale forcing limit. (", "Color online) The red curve displays the stationary velocity profile of the zonal flow predicted by equation (\\[eq:particle in potential\\]), in the inertial small scale forcing limit. ", "Equation (\\[eq:particle in potential\\]) predicts symmetric eastward and westward jets, with diverging values of the velocity at the extrema. ", "The blue curve displays the qualitative shape of a real profile as observed on Jupiter or in numerical simulations (see e.g. figures (\\[fig:The-eastward-jet\\]) and (\\[fig: jupiter jets\\])). ", "Two different regularization mechanisms prevent the jet divergence in the eastward part and in the westward part respectively. ", "\\[fig:diverging profiles\\]](divergence.pdf){height=\"9cm\"}\n\nThe fact that equation (\\[eq:particle in potential\\]) predicts divergent velocity profiles means that some of the hypotheses leading to the result (\\[eq:formule1 dim\\]) are broken at the extrema of zonal jets. ", "The asymptotic expansion has been obtained using two major asumptions: first, the limit $\\frac{kU'}{U''}\\rightarrow\\infty$ should be satisfied, and second the mean flow should be hydrodynamically stable (no unstable modes in equation (\\[eq:inhomogeneous rayleigh\\])). ", "The first assumption is broken at the eastward extrema of jets, and the second is broken at the westward extrema. ", "Section \\[sub:Cusps-for-eastward\\] explains the regularization mechanism that creates a cusp at the eastward extremum, and section \\[sub:The-question-of\\] shows that an hydrodynamic instability stops the growth of the westward jet at the maximal curvature $\\beta$. By taking those physical mechanisms into account, it is possible to get realistic jets that correspond to the observations on Jupiter’s troposphere. ", "The width of jets is not constrained by equation (\\[eq:stationary1\\]). ", "The typical width of a jet is set by the limit curvature $\\beta$ at the westward extremum that imposes a minimal spacing between two consecutive jets.\\\n\nInterpretation of eq.(\\[eq:formule1 dim\\]) from the energy balance {#sub:interpretation}\n------------------------------------------------------------------\n\nWe now give a very enlightening interpretation of the result (\\[eq:formule1 dim\\]) in terms of the energy balance. ", "Multiplying both sides of equation (\\[eq:meanvelocity\\]), we obtain the energy balance equation for the large scales of the flow $$\\partial_{t}\\left(\\frac{1}{2}U^{2}\\right)+\\partial_{y}\\left(U\\left\\langle uv\\right\\rangle \\right)=U'\\left\\langle uv\\right\\rangle -rU^{2}.", "\n\\label{eq:energy bilan}$$ We interpret the different terms in equation (\\[eq:energy bilan\\]). ", "$\\frac{1}{2}U^{2}$ is the kinetic energy density. ", "The term $\\partial_{y}\\left(U\\left\\langle uv\\right\\rangle \\right)$ is a divergence, and thus the quantity $U\\left\\langle uv\\right\\rangle$ can be interpreted as the spatial energy flux at large scales. ", "Energy is dissipated by the term $-rU^2$. Finally, the term $U'\\left\\langle uv\\right\\rangle$ can be interpreted as the energy injection rate in the zonal component of the flow. ", "On the other hand, equation (\\[eq:formule1 dim\\]) can be written as $$U'\\left\\langle uv\\right\\rangle =\\epsilon \\label{eq:energy transfer}$$ after integration over $y$. From the energy balance (\\[eq:energy bilan\\]), the term $U'\\left\\langle uv\\right\\rangle $ can be interpreted as the rate of energy transferred from the small-scale eddies to the mean flow. ", "$\\epsilon$ is the total energy injection rate. ", "Relation (\\[eq:energy transfer\\]) thus means that all energy injected at small scale is transferred *locally* to the largest scale of the flow. ", "The fact that all energy is transferred to the largest svale before being dissipated can be explained by the limits $\\alpha\\rightarrow0$ and $K\\rightarrow+\\infty$. The inertial limit $\\alpha\\rightarrow0$ corresponds to a vanishing value of the friction coefficient $r$. In the limit of vanishing friction, the system has no time to dissipate energy at small scale and all energy is transferred to the largest scale. ", "The small scale forcing limit $K\\rightarrow+\\infty$ prevents energy transfers between the different parts of the flow. ", "The velocity fluctuations at latitude $y$ only interact with the flow in a small region of size of order $\\frac{1}{K}$ around. ", "Thus, spatial energy transfer is impossible and energy has to be transferred to the mean flow at the same latitude $y$. For the local velocity fluctuations, the mean flow at scale $\\frac{1}{K}$ looks like a parabolic profile with derivative $U'(y)$ and second derivative $U''(y)$, that’s why the asymptotic development of the Reynolds stress divergence is expressed in terms of $U'$ and $U''$.\n\nTo sum up this idea, we can say that the energy transfer is local in physical space, but nonlocal in Fourier space. ", "Energy is transferred directly from the scale $\\frac{1}{K}$ to the mean flow through direct interaction between the mean flow and the eddies, and not through an inverse energy cascade in Fourier space. ", "Energy transfer is possible only if $U'\\neq0$. At the extrema of jets, expression (\\[eq:energy transfer\\]) breaks because direct energy transfer from small scales to the mean flow is impossible.\\\n\nCusps for eastward jets\\[sub:Cusps-for-eastward\\]\n=================================================\n\nWe now assume that there are no hydrodynamical instabilities in the eastward part of zonal jets. ", "In the previous parts of this paper, we saw that the formula (\\[eq:formule1 dim\\]) $\\partial_{y}\\left\\langle uv\\right\\rangle =-\\epsilon\\frac{U''}{U'^{2}}$ gives a divergent mean velocity profile and we discussed that this formula can be valid only in the limit $\\frac{KU'}{U''}\\rightarrow\\infty$. The latter limit is not satisfied close to the eastward extrema. ", "The result (\\[eq:particle in potential\\]) shows that the ratio $\\frac{KU'}{U''}$ behaves as $K(y_{cr}-y)$, where $y_{cr}$ is the critical latitude of the eastward divergence. ", "Even for large values of $K$, the asymptotic expansion breaks down in a narrow region of size $\\frac{1}{K}$ around the eastward peak. ", "The limit (\\[eq:formule1 dim\\]) is only valid between the extrema of the jet. ", "But in a region of size $\\frac{1}{K}$ around the extremum, another mechanism takes place to stop the jet growth, and regularize the mean velocity profile at scale $\\frac{1}{K}$. On Jupiter, the data collected by Gallileo and Cassini probes, displayed in figure (\\[fig:The-eastward-jet\\]), indicate that the eastward jets have “cusps”, while westward jets seem smoother. ", "We first discuss eastward jet cusps.", "\n\nLooking more precisely on the cusp of figure (\\[fig:The-eastward-jet\\]), we see that its size is approximately 1 degree i.e a scale of about $1000$ km. ", "When we observe Jupiter’s surface, we can see the fluctuating vortices evolving in a timescale of a few days ([@porco2003cassini]). ", "The size of those vortices are related to three dimensional motions, producing convection plumes, that develop potential vorticity disturbances at a scale which approximately the Rossby deformation radius of order $1,000\\,\\mbox{km}$ and with potential vorticity of order $\\beta$, the Coriolis parameter. ", "In our effective model of barotropic flows, all these convective phenomena are modeled by the stochastic force. ", "Accordingly, we choose the forcing scale $\\frac{1}{K}$ to be of the order of a thousand kilometers.", "\n\n![", "The $24^{o}$N Jupiter eastward jet (taken from [@sanchez2008depth]). ", "The vertical scale is the mean velocity of the wind ($m.s^{-1}$). ", "\\[fig:The-eastward-jet\\]](jet.pdf)\n\nA natural question is: can we have a cusp solution of the stationary equation $$\\left\\langle v\\omega\\right\\rangle [U]=U,$$ in the limit $K\\rightarrow\\infty$?", "\n\nIn order to adress this question, we consider equation (\\[eq:inhomogeneous rayleigh\\]) and study its large $K$ asymptotic after changing the scale $y\\leftarrow Ky$. We denote $\\theta$ the angle defined through the relation $\\cos\\theta:=\\frac{k}{K}$. As we are looking for a cusp of size $\\frac{1}{K}$, it will be convenient to set $\\tilde{U}(y)=U\\left(\\frac{y}{K}\\right)$. This implies that $\\frac{1}{K^{2}}U''\\left(\\frac{y}{K}\\right)=\\tilde{U}\"(y)$. Equation (\\[eq:inhomogeneous rayleigh\\]) becomes $$\\left(\\frac{d^{2}}{dy^{2}}-\\cos^{2}\\theta\\right)\\varphi_{\\epsilon}(y/K,c)+\\frac{\\beta/K^{2}-\\tilde{U}\"(y)}{\\tilde{U}(y)-c-i\\epsilon}\\varphi_{\\epsilon}(y/K,c)=\\frac{\\omega(y/K,0)}{ikK^{2}(\\tilde{U}(y)-c-i\\epsilon)}.$$ We set $ikK^{2}\\varphi(y/K,c):=\\phi(y,c)$. From (\\[eq:omegainfini\\]) the function $\\omega^{\\infty}$ satisfies $$\\omega^{\\infty}\\left(\\frac{y}{K}\\right)=\\omega\\left(\\frac{y}{K},0\\right)+\\left(\\tilde{U}\"(y)-\\frac{\\beta}{K^{2}}\\right)\\phi_{+}(y,c).\\label{eq:omega_inf_Klim}$$ Expression (\\[eq:omega\\_inf\\_Klim\\]) shows that the limit of large $K$ completely cancels the effect of the parameter $\\beta$. However the solution $\\tilde{U}$ still depends on $\\theta$. We first consider the case where the spectrum has only one component $\\theta$ . ", "Let $w_{\\theta}(y):=\\omega^{\\infty}\\left(\\frac{y}{K}\\right)$ . ", "Equations (\\[eq:inhomogeneous rayleigh\\]),(\\[eq:omegainfini\\]) and (\\[eq:inertial\\]) give the set of equations defining the Reynolds stress divergence $\\left\\langle v\\omega\\right\\rangle [\\tilde{U]}$ in the large $K$ limit $$\\begin{aligned}\n\\left(\\frac{d^{2}}{dy^{2}}-\\tan^{2}\\theta\\right)\\phi_{\\epsilon}(y,c)-\\frac{\\tilde{U}\"(y)}{\\tilde{U}(y)-c-i\\epsilon}\\phi_{\\epsilon}(y,c) & = & \\frac{e^{i\\sin\\theta y}}{\\tilde{U}(y)-c-i\\epsilon}\\nonumber \\\\\ne^{i\\sin\\theta y}+\\tilde{U}\"(y)\\phi_{+}(y,\\tilde{U}(y)) & = & w_{\\theta}(y)\\nonumber \\\\\n\\frac{1}{\\tilde{U}\"(y)}[|w_{\\theta}(y)|^{2}-1] & = & \\left\\langle v\\omega\\right\\rangle _{\\theta}[\\tilde{U]}.\\label{eq:system-cusp}\\end{aligned}$$ The first equation is the inhomogenous Rayleigh equation without $\\beta$ effect. ", "The second one is the modified expression to compute $\\omega^{\\infty}$, and the last one is the pseudomomentum balance giving access to the Reynolds stress divergence.", "\n\nBefore we go on with numerical analysis, let us give some analytic results on the set of equations (\\[eq:system-cusp\\]).", "\n\n- We have already given expression (\\[eq:formule1 adim\\]) for the Reynolds stress divergence in the limit $K\\rightarrow+\\infty$, away from the extremum of the jet. ", "As we have used the scaling $y\\leftarrow Ky$ to find (\\[eq:system-cusp\\]), we expect to recover the asymptotic (\\[eq:formule1 adim\\]) in the limit $y\\rightarrow\\infty$. For a given profile $\\tilde{U}$, we have the asymptotic result $\\left\\langle v\\omega\\right\\rangle [\\tilde{U}]\\underset{y\\rightarrow\\infty}{\\sim}-\\frac{\\tilde{U}\"}{\\tilde{U}'^{2}}.$\n\n- We know that the relation $\\omega^{\\infty}(y_{cr})=0$ holds at the extremum (see subsection \\[sub:Computation-of\\]), which corresponds here to $w_{\\theta}(y_{cr})=0$. At the extremum, the third equality in (\\[eq:system-cusp\\]) shows that $\\left\\langle v\\omega\\right\\rangle =-\\frac{1}{\\tilde{U}\"}$. At a maximum of $U$ (eastward jet), $\\tilde{U}\"<0$ and the Reynolds stress divergence thus forces the profile $\\tilde{U}$ to grow. ", "The contrary happens at a minimum of $U$: we have $\\tilde{U}\">0$ and the velocity decays, such that its magnitude grows. ", "The consequence is that the turbulence always forces the jet to grow. ", "The growth can be stopped by either linear friction or non linear effects beyond the quasilinear approximation. ", "For westward jets, we will see in section (\\[sub:The-question-of\\]) that it can also be stopped by an hydrodynamic instability.", "\n\n- The formula $$\\left\\langle v\\omega\\right\\rangle (y_{cr})=-\\frac{1}{\\tilde{U}\"(y_{cr})}\\label{eq:relation_cusp1}$$ is in itself noteworthy. ", "It comes from the phenomenon of depletion of vorticity at the stationary streamlines, which has been already emphasized by [@Bouchet_Morita_2010PhyD]. ", "To reach the stationary profile, $\\left\\langle v\\omega\\right\\rangle $ has to equilibrate the linear friction. ", "At the jet extremum, the stationary state of $U$ in (\\[eq:quasilinear\\]) gives the equality $$\\left\\langle v\\omega\\right\\rangle (y_{cr})=\\tilde{U}(y_{cr}).\\label{eq:relation_cusp2}$$ We can thus link the value of the velocity at the extremum of the jet and the curvature of the cusp. ", "Relations (\\[eq:relation\\_cusp1\\]-\\[eq:relation\\_cusp2\\]) give the second important result of this paper $$\\tilde{U}(y_{cr})=-\\frac{1}{\\tilde{U}''(y_{cr})}.\\label{eq:curvature adim}$$ Coming back to dimensional fields, the eastward cusp satisfies the relation $$U(y_{cr})=-\\frac{\\epsilon K^{2}}{rU''(y_{cr})},\\label{eq:curvature}$$ where $\\epsilon$ is the energy injection rate. ", "Relation (\\[eq:curvature\\]) is a universal property of stationary jet profiles. ", "It relates the strength of a jet to its curvature, and the physical parameters $\\epsilon,r$ and $K$. It does not depends on the forcing Fourier spectrum, but only on the scale $\\frac{1}{K}$ at which energy is injected.\\\n\n![", "Reynolds stresses close to an eastward jet. ", "Left: the Reynolds stress divergence $-\\partial_{y}\\left\\langle uv\\right\\rangle $ from (\\[eq:system-cusp\\]) for a parabolic profile $\\tilde{U}(y)=-\\frac{y^{2}}{2}$, and **$\\theta=\\frac{\\pi}{8}$**. (", "thick curve). ", "The thin curve depicts the theoretical asymptote $\\frac{\\tilde{U}\"}{\\tilde{U}'^{2}}$. As one can notice, $-\\partial_{y}\\left\\langle uv\\right\\rangle (0)=-\\frac{1}{\\tilde{U}\"}=1$ in agreement with the theoretical result (\\[eq:relation\\_cusp1\\]). ", "Right: the total Reynolds stress divergence resulting from the sum over $\\theta\\in\\left[-\\frac{\\pi}{3};\\frac{\\pi}{3}\\right]$. The Reynolds stress divergence has no universal expression in the intermediate region between the cusp (at $y=0$) and the asymptotic region $y\\gg1$. The cusp velocity profile has thus to be computed numerically using the particular shape of the force Fourier spectrum. ", "\\[fig:quadratic extremum\\]](Reynoldstress.pdf \"fig:\") ![", "Reynolds stresses close to an eastward jet. ", "Left: the Reynolds stress divergence $-\\partial_{y}\\left\\langle uv\\right\\rangle $ from (\\[eq:system-cusp\\]) for a parabolic profile $\\tilde{U}(y)=-\\frac{y^{2}}{2}$, and **$\\theta=\\frac{\\pi}{8}$**. (", "thick curve). ", "The thin curve depicts the theoretical asymptote $\\frac{\\tilde{U}\"}{\\tilde{U}'^{2}}$. As one can notice, $-\\partial_{y}\\left\\langle uv\\right\\rangle (0)=-\\frac{1}{\\tilde{U}\"}=1$ in agreement with the theoretical result (\\[eq:relation\\_cusp1\\]). ", "Right: the total Reynolds stress divergence resulting from the sum over $\\theta\\in\\left[-\\frac{\\pi}{3};\\frac{\\pi}{3}\\right]$. The Reynolds stress divergence has no universal expression in the intermediate region between the cusp (at $y=0$) and the asymptotic region $y\\gg1$. The cusp velocity profile has thus to be computed numerically using the particular shape of the force Fourier spectrum. ", "\\[fig:quadratic extremum\\]](tenseurintegrated.pdf \"fig:\")\n\nLet us illustrate those results by a numerical computation of the nondimensional equations (\\[eq:system-cusp\\]). ", "The numerical computation goes the following way: we solve the first equation of (\\[eq:system-cusp\\]), for given values of the Laplace transform parameter $\\epsilon$ and the phase velocity $c$, and given boundary conditions. ", "We impose vanishing boundary conditions at infinity for $\\phi_{\\epsilon}$. $\\epsilon$ has to be small because we want to compute the solution $\\phi_{+}$ when $\\epsilon$ goes to zero. ", "The left panel of figure (\\[fig:quadratic extremum\\]) has been obtained with $\\epsilon=10^{-5}$. Because the solution $\\phi_{+}$ has a singularity at $U(y_{c})=c$, an extreme precision is required to obtain convergence of the numerical calculations. ", "To obtain the value of $\\left\\langle v\\omega\\right\\rangle _{\\theta}(y)$, we have to compute the solution $\\phi_{+}$ for $c=\\frac{y^{2}}{2}$, and this has to be done for each value of $y$. On the left of figure (\\[fig:quadratic extremum\\]), about 20 values of $y$ were used to plot the blue curve.", "\n\nThe plot of the Reynolds stress divergence in figure (\\[fig:quadratic extremum\\]) clearly displays two regions with a sharp transition (located around $y=2$ in the figure). ", "In the first region, the mean velocity profile forms a cusp, which joins continuously the second region of large $y$ values. ", "The second region corresponds to the domain where the expression $\\left\\langle v\\omega\\right\\rangle =-\\frac{U''}{U'^{2}}$ is valid. ", "The velocity profile joining the cusp to the asymptotic profile of figure (\\[fig:diverging profiles\\]) is non-universal with respect to the forcing spectrum. ", "In the right panel of figure (\\[fig:quadratic extremum\\]), we plot $-\\partial_{y}\\left\\langle uv\\right\\rangle $ for a uniform forcing spectrum in the range $\\theta\\in\\left[-\\frac{\\pi}{3};\\frac{\\pi}{3}\\right]$.\n\nWith the system of equations (\\[eq:system-cusp\\]), we have been able to show that a cusp of typical size $\\frac{1}{K}$ forms at the eastward extremum of the jet. ", "This cusp regularizes the velocity profile at its maximum and stops the divergence observed in figure (\\[fig:diverging profiles\\]). ", "The relation between the curvature of the jet at the extremum and its maximal velocity (\\[eq:curvature\\]) is universal as it does not involve the explicit expression of the spectrum of the stochastic force. ", "However, the exact velocity profile joining the cusp to the asymptotic profile of figure (\\[fig:diverging profiles\\]) is rather complicated and is not at all universal.", "\n\nComputation of Reynolds stress divergence for westward jets\\[sub:Computation-of-Reynold’s\\]\n===========================================================================================\n\nAs explained in section \\[sub:Cusps-for-eastward\\], the parameter $\\beta$ disappears from the equations when we try to compute the equilibrium profile in the small scale forcing limit $K\\rightarrow\\infty$, because the $\\beta$ effect becomes irrelevant at the scale $\\frac{1}{K}$. Using this approach, we could expect the jet to be symmetric with respect to the transformation $U\\rightarrow-U$. At a formal level, nothing in equations (\\[eq:close equation velocity\\]) nor (\\[eq:system-cusp\\]) seems to make any difference between the eastward and the westward part of a jet. ", "However, a look at the jets observed on Jupiter shows a clear asymmetry between eastward and westward jets, especially at high latitudes. ", "One key point is that, as clearly stated, the previous sections assume that the linearized equations close to the jet are stable, and do not sustain neutral modes.", "\n\nOn Jupiter’s jets, cusps only exist on the eastward part whereas the westward part looks like a parabolic profile with curvature between $2\\beta$ and $3\\beta$ (see figure (\\[fig: jupiter jets\\]) and [@ingersoll1981interaction] for a discussion on the value of the curvature). ", "Numerical simulations of the barotropic model also show this asymmetry. ", "In [@constantinou2015formation] for example, the curvature at the eastward jet is almost exactly $\\beta$ and seems to be trapped at this value whatever large the coefficients $K$ and $\\frac{1}{\\alpha}$ are. ", "The value of $\\beta-U''$ is always positive, and the Rayleigh-Kuo criterion for jet stability is satisfied. ", "The aim of this section is to understand what is the behavior of a parabolic jet with $U''$ close to $\\beta$ and see if the profile $\\beta\\frac{y^{2}}{2}$ can or not be a stationary solution of the barotropic model (\\[eq:Navier-stokes adim\\]).", "\n\n ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n ![", "Left panel: zonal jets on Jupiter. ", "Data collected by the Gallileo and Cassini probes (from [@porco2003cassini]). ", "Right panel: A numerical simulation of the quasilinear barotropic equations (S3T system) performed in [@constantinou2015formation].The top figure displays the mean velocity profile $U$ and the bottom figure displays $\\beta-U''$. The cusp is obvious on both figures, the peak on the bottom figure corresponds to the eastward extremum of the jet. ", "$\\beta-U''$ is always positive, thus satisfying the Rayleigh-Kuo criterion except possibly at the westward extremum.\\[fig: jupiter jets\\]](jupiterjets.pdf \"fig:\") ![", "Left panel: zonal jets on Jupiter. ", "Data collected by the Gallileo and Cassini probes (from [@porco2003cassini]). ", "Right panel: A numerical simulation of the quasilinear barotropic equations (S3T system) performed in [@constantinou2015formation].The top figure displays the mean velocity profile $U$ and the bottom figure displays $\\beta-U''$. The cusp is obvious on both figures, the peak on the bottom figure corresponds to the eastward extremum of the jet. ", "$\\beta-U''$ is always positive, thus satisfying the Rayleigh-Kuo criterion except possibly at the westward extremum.\\[fig: jupiter jets\\]](numericaljet.pdf \"fig:\")\n ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\nModified Rossby waves\n---------------------\n\nWe consider in equation (\\[eq:inhomogeneous rayleigh\\]) a parabolic profile $U(y)=\\gamma\\frac{y^{2}}{2}$, and we want to study the behavior of the Reynolds stress divergence when $\\gamma$ is close to $\\beta$. For $\\gamma=\\beta$, any perturbation is carried freely by the mean flow, and equation (\\[eq:deterministic\\]) reduces to $$\\partial_{t}\\omega+ikU\\omega=0,$$ which is easily solved by $\\omega(y,t)=\\omega(y,0)e^{-ikUt}$. Expression (\\[eq:inertial\\]) is then singular, because $U''-\\beta$ vanishes in the denominator, and $|\\omega^{\\infty}|^{2}-1=|\\omega(y,0)|^{2}-1=0.$ If we try to compute directly the Reynolds stress divergence $\\left\\langle v\\omega\\right\\rangle $, we will find a singularity in $y=0$. Therefore, the aim is to compute $\\left\\langle v\\omega\\right\\rangle $ for $\\gamma$ smaller and larger than $\\beta$ and let then $\\gamma\\rightarrow\\beta$.\n\nIt has been proved long ago that for $0<\\gamma<\\beta$ we have modified Rossby waves in the flow [@drazin1982rossby], with at least one Rossby wave as soon as $\\gamma<\\beta$. In [@brunet1990dynamique], the case of a parabolic profile is thoroughly studied and a method is found to compute the Rossby waves and their velocity. ", "Basically, it consists in doing a Fourier transform in $y$ and transform the Rayleigh equation into a one dimensional Schr[ö]{}dinger equation. ", "The one dimensional Schr[ö]{}dinger equation describes a particle in a potential vanishing at infinity. ", "Possible bound states of the Schr[ö]{}dinger equation correspond to modified Rosby waves.", "\n\nFor $\\gamma>\\beta$, the Schr[ö]{}dinger equation potential is positive, and classical results prove that there is no bound state, and thus there is no Rossby waves. ", "In that case expression (\\[eq:inertial\\]) will be valid to compute the Reynolds stress divergence. ", "By contrast, for $0<\\gamma<\\beta$, the Sch[ö]{}dinger equation potential is negative (the position zero is attractive). ", "Classical results [@reed1978modern] shows that there exists a least one bound state. ", "There is thus at least one modified Rossby wave. ", "Moreover as the potential deepens for decreasing $\\gamma/\\beta$, the number of bound states and thus the number of modified Rossby waves increases when $\\gamma/\\beta$ decreases. ", "When $0<\\gamma<\\beta,$ because of the presence of waves, we have to use expression (\\[eq:inertialmodes\\]) to compute the Reynolds stress divergence.", "\n\nWe discuss more precisely the existence of Rossby waves and their computation for a parabolic profile in appendix \\[sec:Modified-Rossby-waves\\].", "\n\nSingularity of the Reynolds stress for a jet curvature close to $\\beta$ \\[sub:Singularity-of-the\\]\n--------------------------------------------------------------------------------------------------\n\nWe now compute the Reynolds stress divergence $\\left\\langle v\\omega\\right\\rangle $ using the same method as for the cusp case discussed in section \\[sub:Cusps-for-eastward\\], but without taking the limit $K\\rightarrow\\infty$. It happens that the parabolic profile has an additional symmetry, it is invariant under the transformation $y\\leftarrow Ky$. For a parabolic profile, equation (\\[eq:inhomogeneous rayleigh\\]) only depends on the parameter $\\tan\\theta:=\\frac{l}{k}$ and $\\mu:=1-\\frac{\\beta}{\\gamma}$. As discussed previously, Rossby waves appear when $\\mu<0$ (equivalently for $0<\\gamma<\\beta$).", "\n\nUsing equations (\\[eq:inhomogeneous rayleigh\\]),(\\[eq:omegainfini\\]) and (\\[eq:inertialmodes\\]), the self-consistent equations for the jet write $$\\begin{aligned}\n\\left(\\frac{d^{2}}{dy^{2}}-\\tan^{2}\\theta\\right)\\varphi_{\\epsilon}(y,c)-\\frac{\\mu}{\\frac{y^{2}}{2}-c-i\\epsilon}\\varphi_{\\epsilon}(y,c) & = & \\frac{\\mathcal{P}e^{i\\sin\\theta y}}{\\frac{y^{2}}{2}-c-i\\epsilon}\\nonumber \\\\\n\\mathcal{P}e^{i\\sin\\theta y}+\\mu\\varphi_{+}\\left(y,\\frac{y^{2}}{2}\\right) & = & w_{\\theta}(y)\\nonumber \\\\\n\\frac{1}{\\mu}\\left[\\left|\\left(1-\\mathcal{P}\\right)e^{i\\sin\\theta y}\\right|^{2}+\\left|w_{\\theta}(y)\\right|^{2}-1\\right] & = & \\frac{1}{\\gamma}\\left\\langle v\\omega\\right\\rangle _{\\theta}[\\tilde{U]}.\\label{eq:system-cusp-1}\\end{aligned}$$ We have denoted by $\\mathcal{P}$ the projector on the space orthogonal to the neutral modes.", "\n\n![", "Reynolds stresses close to a westward jet. ", "Left: Minus the Reynolds stress divergence $<v\\omega>$ obtained for $\\mu=0.3$ (green), $\\mu=0.1$ (red) and $\\mu=0.05$ (blue). ", "When the parameter $\\mu$ comes closer to zero, the divergence at $y=0$ becomes more and more pronounced. ", "Right: Minus the Reynolds stress divergence for $\\mu=-0.3$ (green), $\\mu=-0.1$ (red) and $\\mu=-0.05$ (blue). ", "Other parameters are $\\theta=\\frac{\\pi}{8}$ and $\\beta=1$.\\[fig:Reynold for parabola\\]](compilation.pdf \"fig:\") ![", "Reynolds stresses close to a westward jet. ", "Left: Minus the Reynolds stress divergence $<v\\omega>$ obtained for $\\mu=0.3$ (green), $\\mu=0.1$ (red) and $\\mu=0.05$ (blue). ", "When the parameter $\\mu$ comes closer to zero, the divergence at $y=0$ becomes more and more pronounced. ", "Right: Minus the Reynolds stress divergence for $\\mu=-0.3$ (green), $\\mu=-0.1$ (red) and $\\mu=-0.05$ (blue). ", "Other parameters are $\\theta=\\frac{\\pi}{8}$ and $\\beta=1$.\\[fig:Reynold for parabola\\]](compilationalpha_0.pdf \"fig:\")\n\nThe result of the numerical integration of (\\[eq:system-cusp-1\\]) is shown in figure (\\[fig:Reynold for parabola\\]). ", "The main result is that the stress $\\left\\langle v\\omega\\right\\rangle $ has the same qualitative behavior both for $\\gamma<\\beta$ and for $\\gamma>\\beta$. For $\\gamma>\\beta$, i.e $\\mu>0$, we still have the result that $w_{\\theta}(0)=0$, which implies that the stress $\\left\\langle v\\omega\\right\\rangle $ is diverging as $-\\frac{1}{\\mu}$ when $\\mu\\rightarrow0^{+}$. For $0<\\gamma<\\beta$, i.e $\\mu<0$, the stress is diverging as $\\frac{[|\\omega_{\\theta}^{1}(0)|^{2}-1]}{\\mu}$ when $\\mu\\rightarrow0^{-}$. $\\omega_{\\theta}^{1}$ is the projection of $e^{i\\sin y}$ on the first neutral mode. ", "It happens that $|\\omega_{\\theta}^{1}(0)|^{2}-1$ is always positive. ", "Hence, $\\frac{[|\\omega_{\\theta}^{1}(0)|^{2}-1]}{\\mu}$ is negative. ", "We conclude that whatever the sign of $\\mu$, the stress $\\left\\langle v\\omega\\right\\rangle $ has a negative divergence at the minimum of the jet that makes the jet grow.", "\n\nIf the curvature $\\gamma$ is smaller than $\\beta$, the effect of the Reynolds stress divergence is to narrow the jet and increase the curvature. ", "When $\\gamma$ becomes larger than $\\beta$, the quasilinear theory predicts that the jet should continue its growth, and form a cusp exactly the same way as for the eastward jet. ", "No mechanism in the quasilinear dynamics can stop the growth of the westward jet. ", "To explain the numerical simulations, we thus have to consider other hypothesis than the ones considered so far. ", "Among those, we have assumed there is no hydrodynamic instability in the set of equations (\\[eq:system-cusp-1\\]), i.e a mode with nonzero imaginary part of the velocity. ", "With $\\gamma>\\beta$ the Rayleigh–Kuo criterion is violated, the stability of a jet is no longer guaranteed. ", "In the last section of this paper, we will study qualitatively the effect of an instability to see whether it can really stop the growth of the westward jet.", "\n\nHydrodynamic instability in the westward jet\\[sub:The-question-of\\]\n-------------------------------------------------------------------\n\nAn unstable mode is a solution of the homogeneous Rayleigh equation $$\\left(\\frac{\\partial^{2}}{\\partial y^{2}}-k^{2}\\right)\\psi+\\frac{\\beta-U''}{U-c}\\psi=0\\label{eq:Rayleigh homogene}$$ with *complex* phase speed $c$. In particular for unstable modes, the imaginary part satisfies $kc_{i}>0$ and the consequence is the exponential growth of a disturbance $\\left|\\psi(y,t)\\right|\\propto e^{kc_{i}t}$. An unstable mode has a contribution to the Reynolds stress divergence. ", "In stationary state, the flow can only sustain unstable modes satisfying $kc_{i}<\\alpha$, otherwise the exponential growth of the unstable mode would create a divergence in the Reynolds stress. ", "If the flow sustain unstable modes, we have to modify expression (\\[eq:inertialmodes\\]) taking into account the presence of unstable modes. ", "We do not report the computation, it is similar to the one developed in appendix \\[sec:The-Reynold’s-stress\\] for neutral modes. ", "Please note that by contrast to neutral modes, the real part $c_{r}$ of the (complex) speed $c$ lies within the range of $U$ ([@drazin2004hydrodynamic; @drazin1982rossby]). ", "The contribution of an instability in the Reynolds stress has been already computed in the deterministic case ([@PedloskyBook] p 576), and we modify here the classical result to adapt it to the stochastic case.", "\n\nLet $\\omega^{c}(y)$ be the projection of the initial condition $e^{ily}$ on the unstable mode, and $\\psi^{c}$ the associated stream function defined by $\\left(\\frac{\\partial^{2}}{\\partial y^{2}}-k^{2}\\right)\\psi^{c}=\\omega^{c}$. The projection refers to the scalar product induced by the pseudomomentum conservation law (see appendix \\[sec:The-Reynold’s-stress\\] for the discussion). ", "Then the dominant contribution of the unstable mode in the computation of $2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle $ writes $$\\begin{aligned}\n2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle & = & 2\\alpha\\int_{-\\infty}^{0}{\\rm d}t~e^{2\\alpha t}\\left|\\omega^{c}(y)e^{ikct}\\right|^{2}\\\\\n & = & |\\omega^{c}(y)|^{2}\\frac{2\\alpha}{2\\alpha-2kc_{i}}\\label{eq:resultat5-1}.\\end{aligned}$$ Equation (\\[eq:Rayleigh homogene\\]) shows that $$\\omega^{c}=-\\frac{\\beta-U''}{U-c}\\psi^{c}.\\label{eq:resultat5-2}$$ Equations (\\[eq:resultat5-1\\]) and (\\[eq:resultat5-2\\]) give the main contribution of an hydrodynamic instability to the Reynolds stress divergence $$\\frac{2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle }{U''-\\beta}=-\\frac{2\\alpha}{2\\alpha-2kc_{i}}\\frac{|\\psi^{c}|^{2}}{|U-c|^{2}}(\\beta-U'').\\label{eq:contribution instable}$$ Let us emphasize once more that this term is a *contribution* to the Reynolds stress adding to the other terms coming from the effect of neutral modes and from $\\omega^{\\infty}$. The important point in (\\[eq:contribution instable\\]) is that the coefficient $\\frac{2\\alpha}{2\\alpha-2kc_{i}}\\frac{|\\psi^{c}|^{2}}{|U-c|^{2}}$ is strictly positive, which means that the term coming from the unstable mode *opposes* a change of sign of $\\beta-U''$. In order to equilibrate, the jet needs to make a continuous barotropic adjustment of the mean flow curvature at the westward edge.\\\nIn order to illustrate this assertion, we consider a configuration where the instability develops. ", "We perform a direct numerical integration of the equation $$\\partial_{t}\\omega+ikU\\omega+ik(\\beta-U'')\\psi=0,$$ using periodic boundary conditions in $y$ and the initial condition $\\omega(y,0)=e^{ily}$. We use a Runge-Kutta algorithm of order 4. ", "The profile $U$ is parabolic with $0<\\gamma<\\beta$ but we add a small disturbance at the extremum in 0 of the form of a gaussian $-\\eta e^{-\\frac{y^{2}}{\\sigma^{2}}}$. The disturbance mimics qualitatively the effect of the forcing described in figure (\\[fig:Reynold for parabola\\]), it models the fact that the mean velocity profile has a narrow curvature at its extremum. ", "$$U(y)=\\gamma\\frac{y^{2}}{2}-\\eta e^{-\\frac{y^{2}}{\\sigma^{2}}}.\\label{eq:velocity_perturbation}$$ The values of the chosen parameters are $\\beta=1$, $\\mu=1-\\frac{\\beta}{\\gamma}=-0.3$, $k=l=10$. $\\sigma$ quantifies the width of the disturbance, we chose $\\sigma=0.1$. $\\eta$ describes the magnitude of the disturbance and is the control parameter of the simulation. ", "Results are displayed in figure (\\[fig:instabilite\\]). ", "The red curve is the graph of $\\beta-U''(y)$. When this quantity is strictly positive everywhere in the flow, the Rayleigh-Kuo criterion is satisfied and the flow is stable. ", "With the velocity profile chosen in (\\[eq:velocity\\_perturbation\\]), the Rayleigh-Kuo criterion is violated around $y=0$ as displayed by the red curve in figure (\\[fig:instabilite\\]). ", "The blue curve displays the quantity $|\\omega|^{2}(y,t)-1$ at $T=30$. In our simulations, we clearly see the three peaks of the blue curve growing exponentially with time, which indicates the existence of an hydrodynamic instability. ", "From left to right, we have increased the value of the parameter $\\eta$. The larger $\\eta$, the more the Rayleigh-Kuo criterion is violated, and the faster the instability grows. ", "It has been already emphasized that $|\\omega|^{2}-1$ has to vanish at the same time where $\\beta-U''=0$ in the flow, and this is confirmed by our simulation and displayed in figure (\\[fig:instabilite\\]). ", "The largest peak of the blue curve corresponds exactly to the region in the flow where $\\beta-U''$ is negative.", "\n\n![", "Instability growth for a perturbation of an unstable westward jet. ", "We show here the tensor $|\\omega|^{2}-1$ at $T=30$ for different values of $\\eta$, and we compute the value of $c$ whenever possible. ", "The thiner curve (red color online) shows $\\beta-U''$. Close to the instability threshold, it is no longer possible to determine the value of $c$ because the instability growth rate is too slow. ", "\\[fig:instabilite\\]](instabilite1.pdf \"fig:\") ![", "Instability growth for a perturbation of an unstable westward jet. ", "We show here the tensor $|\\omega|^{2}-1$ at $T=30$ for different values of $\\eta$, and we compute the value of $c$ whenever possible. ", "The thiner curve (red color online) shows $\\beta-U''$. Close to the instability threshold, it is no longer possible to determine the value of $c$ because the instability growth rate is too slow. ", "\\[fig:instabilite\\]](instabilite2.pdf \"fig:\") ![", "Instability growth for a perturbation of an unstable westward jet. ", "We show here the tensor $|\\omega|^{2}-1$ at $T=30$ for different values of $\\eta$, and we compute the value of $c$ whenever possible. ", "The thiner curve (red color online) shows $\\beta-U''$. Close to the instability threshold, it is no longer possible to determine the value of $c$ because the instability growth rate is too slow. ", "\\[fig:instabilite\\]](instabilite3.pdf \"fig:\")\n\nTo obtain the mode $\\omega^{c}(y)$, we simply look at the convergence of $\\omega(y,t)e^{ikct}$. The real and imaginary parts of the unstable mode $\\omega^{c}(y)$ are displayed in the left panel of figure (\\[fig:tenseur instable\\]) in respectively blue and red. ", "The curve $\\beta-U''$ has been superimposed in yellow. ", "We see again that the unstable mode is vanishing at points where $\\beta-U''=0$ and that the mode is larger in the region where $\\beta-U''<0$. In the right panel of figure (\\[fig:tenseur instable\\]) we display the Reynolds stress divergence $\\left\\langle v\\omega\\right\\rangle =\\frac{|\\omega|^{2}-1}{U''-\\beta}$ obtained from equation (\\[eq:inertial\\]) with one single Fourier component. ", "As can be checked directly in figure (\\[fig:tenseur instable\\]) right, the effect of the instability is exactly the opposite as the one in figure (\\[fig:Reynold for parabola\\]). ", "The Reynolds stress divergence is positive in the region where the Rayleigh-Kuo criterion is violated, and thus the tensor in figure (\\[fig:tenseur instable\\]) reequilibrates the profile $U$ and damps the perturbation $-\\eta e^{-\\frac{y^{2}}{\\sigma^{2}}}$.\\\n\n![", "Unstable mode at the westward jet edge. ", "Left: real part (blue curve) and imaginary part (red curve) of the unstable mode $\\omega^{c}$. The value of $\\eta$ is $0.05$. The thiner curve (green) displays $\\beta-U''(y)$, the Rayleigh-Kuo criterion is violated in the vincinity of zero. ", "Right: The tensor $\\frac{|\\omega|^{2}-1}{U''-\\beta}$ that contributes to the Reynolds stress divergence obtained for T=30. ", "The artefact comes from the fact that $U''-\\beta$ vanishes and that we use a finite discretisation in $y$. The effect of this tensor is to reequilibrate the velocity $U$ to satisfy $\\beta-U''>0$. The value of $c$ is $c=-2.02+1.04i~e-2$\\[fig:tenseur instable\\]](unstablemode.pdf \"fig:\") ![", "Unstable mode at the westward jet edge. ", "Left: real part (blue curve) and imaginary part (red curve) of the unstable mode $\\omega^{c}$. The value of $\\eta$ is $0.05$. The thiner curve (green) displays $\\beta-U''(y)$, the Rayleigh-Kuo criterion is violated in the vincinity of zero. ", "Right: The tensor $\\frac{|\\omega|^{2}-1}{U''-\\beta}$ that contributes to the Reynolds stress divergence obtained for T=30. ", "The artefact comes from the fact that $U''-\\beta$ vanishes and that we use a finite discretisation in $y$. The effect of this tensor is to reequilibrate the velocity $U$ to satisfy $\\beta-U''>0$. The value of $c$ is $c=-2.02+1.04i~e-2$\\[fig:tenseur instable\\]](tenseurT30000.pdf \"fig:\")\n\nLet us summarize the results of the present section. ", "We have first investigated the behavior of the Reynolds stress divergence for a parabolic profile, because numerical simulations show that the mean velocity profile is almost parabolic for westward jets. ", "The Reynolds stress divergence is the tensor that forces the mean flow according to equation (\\[eq:meanvelocity\\]). ", "Even if we cannot always compute exactly this tensor, we can study its sign and its qualitative properties to see whether it damps the flow or not. ", "We first did the assumption that there is no hydrodynamic instability in the flow. ", "This assumption leads to a contradiction for the parabolic profile because the Reynolds stress divergence distorts the parabolic profile at $y=0$ as shown in figure (\\[fig:Reynold for parabola\\]). ", "Thus, we conclude that another mechanism takes place to equilibrate the parabolic profile. ", "When we consider a small violation of the Rayleigh-Kuo criterion near $y=0$, we see numerically the growth of an instability that opposes exactly to the distortion of the parabolic profile where the Rayleigh-Kuo criterion is violated. ", "Those results are qualitative, we did not compute the equilibrium velocity profile. ", "But it is consistent to assume that the equilibration mechanism is a kind of barotropic adjustment of the mean flow: an instability develops as soon as $\\beta-U''$ changes sign. ", "The flow has to adjust itself such that the instability is not too large, i.e close to a parabolic profile with $U''\\sim\\beta$, and such that the instability can be damped by linear friction.", "\n\nConclusion and perpectives\n==========================\n\nThe stochastic barotropic $\\beta$ plane model is the simplest model in the hierarchy of models aiming at understanding jet formation in atmosphere dynamics. ", "The precise structure of jets in this simple and fundamental model is still not really understood beyond qualitative description and orders of magnitude estimates, although thousands of papers have been written on the subject. ", "In this paper we have proposed three main contributions to the theoretical understanding of these zonal jets to make progresses in this direction. ", "Our analytical results are valid when assuming both the inertial and the small scale forcing limits. ", "The inertial limit is valid when the timescales related to the inviscid dynamics (perfect transport, shearing and mixing, Rossby waves, and so on) are much smaller than the timescale for spin up and spin down (related to forcing and dissipation). ", "In the the stochastic barotropic model, this is quantified by a small value of the nondimensional parameter $\\alpha = L\\sqrt{r^3/\\epsilon}$ . ", "The limit of small scale forces is relevant when the typical scale for the forcing, $1/K$, is much smaller than the typical jet width, of the order of the Rhines scale. ", "Those two limits are relavant for instance for the largest zonal jets of Jupiter.", "\n\nWith these two limits, the interaction between the large scale zonal jets and the small scale turbulence becomes local in physical space. ", "The energy is transferred directly from its injection scale to the zonal jet through the direct interaction between the jet and turbulence. ", "Our first contribution has been to justify the local formula $\\left\\langle uv\\right\\rangle =\\frac{\\epsilon}{U'}$. This formula could have been obtained directly taking the limit of small friction in the formula of [@srinivasan2014reynolds], or by neglecting the nonlinear and pressure terms in the energy balance as done by [@laurie2014universal] for the case of 2D turbulence. ", "Our justification is based on the double limit discussed in the previous paragraph. ", "The mathematical difficulty resides in considering the inertial limit before the limit of small scale forces. ", "This order of the limits is necessary if one wants to deal with situations for which the dissipation mechanism is much smaller than the inertial one at the forcing scale, which is the case for most geophysical turbulent flows.", "\n\nBecause jets have non-monotonic velocity profiles, the asymptotic expansion and the formula $\\left\\langle uv\\right\\rangle =\\frac{\\epsilon}{U'}$ break down at the jet edges where $U'=0$. The first naive computation of the velocity profile in the limit $K\\rightarrow\\infty$ leads to a divergence of the velocity at the extremum, and confirms that the dynamics may lead to several velocity sign reversal. ", "For the asymptotic expansion to be valid, the parameter $\\frac{KU'}{U''}$ has to be large. ", "At the eastward jet edges, we have established that the velocity profile is regularized by a cusp at a typical scale of $1/K$. In the inertial limit $\\alpha\\rightarrow0$, we have derived a system of equations that describes the cusp velocity profile. ", "The resulting shape depends on the forcing spectrum. ", "Nevertheless, the mechanism of depletion of vorticity at the stationary streamlines leads to an interesting relation between the curvature of the cusp and the maximal velocity (\\[eq:curvature\\]), $U(y_{cr})U''(y_{cr})=-\\epsilon K^{2}/r$, which does not depend on the force spectrum but just on the energy injection rate $\\epsilon$.\n\nAs observed in previous numerical studies of the barotropic model, the westward jet edges have a curvature $U''$ of order $\\beta$ in the inertial limit. ", "Based on observations in numerical studies, the mechanism of barotropic adjustment has been discussed for this selection of the jet curvature (see for instance [@constantinou2012emergence]). ", "In the present work we have for the first time derived and analyzed the equations that describe the westward jet edges in the inertial limit. ", "This theoretical analysis confirms the mechanism of barotropic adjustment. ", "Bellow the stability threshold, the Reynolds stress divergence forces the mean flow to grow. ", "But as soon as the mean flow has a curvature $U''>\\beta$, an hydrodynamic instability opposes the growth of the velocity profile. ", "Therefore, the parabolic profile is stabilized with a curvature fluctuating close to $\\beta$. The flow remains close to marginal stability.", "\n\nOur work gives an overall picture of the equilibration mechanism and the stationary velocity profile of barotropic zonal jets. ", "Our work can be considered as a theoretical derivation that the jet velocity profile is close to the “PV staircase” in the inertial and small scale forcing limit. ", "The “PV staircase” idea is closely related to the qualitative ideas of homogenization of potential vorticity first proposed by Rhines and Young, and can be justified qualitatively by equilibrium statistical mechanics. ", "However those qualitative ideas do not allow for clear predictions. ", "In the context of barotropic jets and Jupiter jets, The “PV staircase” empirical evidence or the “PV staircase” assumption were discussed thoroughly by [@Dritschel_McIntyre_2008JAtS]. ", "For instance, [@Dritschel_McIntyre_2008JAtS] showed that the “PV staircase” assumption allows to derive straightforwardly the number and the size of jets in a flow configuration. ", "One should bear in mind that the “stairs” are an idealization of the real profile: the discontinuity in the staircase profile corresponds to the cusp at the eastward extremum. ", "It has thus a finite width typically given by $\\frac{1}{K}$, where K is the typical wavevector of small-scale energy injection. ", "Besides, the “stairs” are not perfectly flat, because the curvature of the jet is close to $\\beta$ at the westward extremum, but not between the extrema. ", "In the monotonic region between the extrema, the mean velocity profile is described by equation (3.9). ", "The “PV staircase” profile can thus be seen as a very good approximation, our theoretical approach gives a more precise mathematical description of the actual profile which is valid within the asymptotic regime of inertial and small scale forcing limit. ", "Moreover, a given flow can sustain different numbers of jets [@BakasIoannou2013SSST; @constantinou2012emergence] for the same value of the parameter. ", "This observation cannot be predicted neither from the “PV staircase” approximation, nor from the results we presented in this work. ", "Complementing this work results in order to determine the correct number and spacing between those jets is a challenging problem that might be addressed in the future.", "\n\nWestward jets on Jupiter display a parabolic profile, but with a curvature $U''$ clearly larger than $\\beta$. This is one reason why the barotropic model is not sufficient to describe Jupiter’s atmosphere. ", "We believe our analysis could be extended to more refined models, for example a two-layer model. ", "The generalization of our analytical results for a two-layer quasi-geostrophic model would be a very interesting extension of this work. ", "Another natural extension would be the study of rare transitions between states with a different number of jets, within the theoretical framework discussed in this paper.", "\n\nWe thank P. Ioannou for interesting discussion during the preliminary stage of this work.", "\n\nThe research leading to these results has received funding from the European Research Council under the European Union’s seventh Framework Program (FP7/2007-2013 Grant Agreement No. ", "616811).", "\n\nThe Reynolds stress divergence in the inertial limit\\[sec:The-Reynold’s-stress\\]\n================================================================================\n\nThe aim of this section is to give the proof of formula (\\[eq:inertial\\]) and (\\[eq:inertialmodes\\]). ", "We have to compute $$2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle =2\\alpha\\int_{-\\infty}^{0}{\\rm d}t~e^{2\\alpha t}\\left|e^{tL_{k}}[c_{l}]\\right|^{2},\\label{eq:formuleannexeA}$$ where $e^{tL_{k}}[c_{l}]:=\\omega_{d}$ is the solution to the deterministic equation $$\\begin{aligned}\n\\partial_{t}\\omega_{d}+ikU\\omega_{d}+ik(\\beta-U'')\\psi_{d} & = & 0\\label{eq:perturbationannexeA}\\\\\n\\left(\\partial_{y}^{2}-k^{2}\\right)\\psi_{d} & = & \\omega_{d}\\nonumber \\end{aligned}$$ with initial condition $c_{l}(y)=e^{ily}$. We will first assume there are no neutral modes solutions of (\\[eq:perturbationannexeA\\]). ", "First, we do the change of timescale $2\\alpha t\\rightarrow t$ in the integral of (\\[eq:formuleannexeA\\]). ", "It gives us $$2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle =\\int_{-\\infty}^{0}{\\rm d}t~e^{t}\\left|e^{\\frac{t}{2\\alpha}L_{k}}[c_{l}]\\right|^{2}.$$ When $\\alpha$ goes to zero, the term $e^{\\frac{t}{2\\alpha}L_{k}}[c_{l}]$ is the long time limit of the solution of (\\[eq:perturbationannexeA\\]). ", "We use the nontrivial result for the case of non monotonous flows, of [@Bouchet_Morita_2010PhyD] already mentioned, that there exists a function $\\omega_{d}^{\\infty}(y)$ such that $\\omega_{d}(y,t)\\underset{t\\rightarrow\\infty}{\\sim}\\omega_{d}^{\\infty}(y)e^{-ikUt}$ when there are no neutral modes. ", "Hence $\\left|e^{\\frac{t}{2\\alpha}L_{k}}[c_{l}]\\right|\\rightarrow|\\omega_{d}^{\\infty}(y)|$ , and the presence of the exponential in the integral ensures the convergence of the whole. ", "This proves that without neutral modes $$2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle \\underset{\\alpha\\rightarrow0}{\\longrightarrow}|\\omega_{d}^{\\infty}|^{2}.$$\n\nThe second case, with neutral modes, is a bit more subtle. ", "The result of [@Bouchet_Morita_2010PhyD] relies on a Laplace transform of $\\omega_{d}$ denoted $\\hat{\\omega}_{d}$. To do the inverse Laplace transform, one has to know where the singularities of **$\\hat{\\omega_{d}}$** are. ", "The presence of modes in the equation is exactly equivalent to the presence of poles of order 1 in the complex plane for $\\hat{\\omega}_{d}$. For unstable modes, these poles have an imaginary part, whereas for neutral modes, they are located on the real axis. ", "We also assume in our calculation that there are no instabilities, which means that all singularities of $\\hat{\\omega}_{d}$ are on the real axis. ", "Some of these singularities are outside the range of $U$ (outside of [\\[]{}$U_{min},U_{max}$[\\]]{}) and are isolated, they correspond to neutral modes or “modified Rossby waves”. ", "But there is also a continuum of singularities all along the range of U. The integration around the isolated singularities will give the contribution of neutral modes, and it is of the form $\\underset{a}{\\sum}\\omega^{a}(y)e^{ikc_{a}t}$ where $a$ is the mode index, $c_{a}$ is the mode frequency, and the $\\omega^{a}(y)$ are the projections of the initial condition $c_{l}$ on the modes $\\zeta^{a}(y)$. The projections are defined with the natural scalar product induced by the pseudomomentum conservation law, that is $\\ll\\omega_{1}^{*}\\omega_{2}\\gg=\\int\\frac{\\omega_{1}^{*}\\omega_{2}}{U''-\\beta}{\\rm d}y$. For this particular scalar product, the operator $\\omega\\rightarrow U\\omega+(\\beta-U'')\\psi$ is self-adjoint, and this implies that its eigenvectors are orthogonal with respect to this scalar product. ", "We substract the contribution of the modes $\\zeta^{a}(y)$ from the initial condition $c_{l}$, that is, we use $c_l-\\underset{a}{\\sum}\\omega^{a}$ as initial condition in (\\[eq:perturbationannexeA\\]). ", "We are left with the continuum part of the singularities and the result of [@Bouchet_Morita_2010PhyD] holds. ", "As a consequence, there exists a function $\\tilde{\\omega}_{d}^{\\infty}(y)$ such that the remaining part of the solution behaves at infinity like $\\tilde{\\omega}_{d}^{\\infty}(y)e^{-ikU(y)t}.$ We eventually find that for long time, the solution of the deterministic equation behaves like $$\\omega_{d}(y,t)\\underset{t\\rightarrow\\infty}{\\sim}\\underset{a}{\\sum}\\omega^{a}(y)e^{-ikc_{a}t}+\\tilde{\\omega}_{d}^{\\infty}(y)e^{-ikU(y)t}.$$\n\nWhen we inject this result in the expression of $\\left|e^{\\frac{t}{\\alpha}L_{k}}[e_{l}]\\right|^{2}$ we get three different terms.", "\n\n1. ", " Terms coming from the mode-mode contribution of the form $\\underset{a}{\\sum}|\\omega^{a}(y)|^{2}$. The time integration is then trivial.", "\n\n2. ", " The term coming from the continuum gives us immediately the contribution $|\\tilde{\\omega}_{d}^{\\infty}(y)|^{2}$.\n\n3. ", " What happens for terms of the form $\\omega^{a*}\\tilde{\\omega}^{\\infty}e^{-ik(U-c_{a})\\frac{t}{\\alpha}}$ and $\\omega^{a*}\\omega^{b}e^{-ik(c_{b}-c_{a})\\frac{t}{\\alpha}}$ ? ", "The frequencies $\\frac{1}{\\alpha}k(U-c_{a})$ and $\\frac{1}{\\alpha}k(c_{a}-c_{b})$ grow to infinity as $\\alpha$ vanishes. ", "We have an oscillating integral with frequency growing to infinity. ", "It is a well known result that such an integral asymptotically decays. ", "The cross terms gives no contributions.", "\n\nWe have then proved the desired result that $$2\\alpha\\left\\langle |\\omega|^{2}\\right\\rangle \\underset{\\alpha\\rightarrow0}{\\longrightarrow}\\underset{a}{\\sum}|\\omega^{a}|^{2}+|\\tilde{\\omega}_{d}^{\\infty}|^{2}.$$\n\nComputation of the Reynolds stress in the inertial and small scale forcing regime \\[sec:Equivalence-of-the\\_limits\\]\n====================================================================================================================\n\nIn this appendix we prove that $$\\mathcal{R}e\\left\\langle v_{\\theta}^{*}\\omega_{\\theta}\\right\\rangle \\underset{K\\rightarrow\\infty\\alpha\\rightarrow0}{\\rightarrow}\\frac{U''}{U'^{2}}\\label{eq:resultat-annexeB1}.$$\n\nIn section \\[sec:Inertial-small-scale\\], we found the expression $$\\mathcal{R}e\\left\\langle v_{\\theta}^{*}\\omega_{\\theta}\\right\\rangle \\underset{K\\rightarrow\\infty}{\\sim}-\\frac{\\hat{C}_{k,l}}{2k^{2}}\\mathcal{P}\\left\\{ \\int{\\rm d}Ye^{-|Y|}\\frac{\\cos(Y\\tan\\theta)}{U\\left(y-\\frac{Y}{k}\\right)-U(y)}\\right\\} .$$ This expression has no meaning for $y_{c}$ such that $U'(y_{c})=0$ because we have a quadratic singularity in the integral. ", "We therefore assume that $U'(y)$ does not vanish. ", "With this assumption we get [ $$\\begin{aligned}\n \\mathcal{P}\\left\\{ \\int{\\rm d}Ye^{-|Y|}\\frac{\\cos(Y\\tan\\theta)}{U\\left(y-\\frac{Y}{k}\\right)-U(y)}\\right\\}\n & = \\underset{\\eta\\rightarrow0}{\\lim}\\int_{-\\infty}^{-\\eta}{\\rm d}Ye^{-|Y|}\\frac{\\cos(Y\\tan\\theta)}{U\\left(y-\\frac{Y}{k}\\right)-U(y)}+\\int_{\\eta}^{+\\infty}{\\rm d}Ye^{-|Y|}\\frac{\\cos(Y\\tan\\theta)}{U\\left(y-\\frac{Y}{k}\\right)-U(y)}\\\\\n & = \\int_{0}^{+\\infty}{\\rm d}Ye^{-|Y|}\\cos(Y\\tan\\theta)\\left\\{ \\frac{1}{U\\left(y-\\frac{Y}{k}\\right)-U(y)}+\\frac{1}{U\\left(y+\\frac{Y}{k}\\right)-U(y)}\\right\\} \\\\\n & = \\int_{0}^{+\\infty}{\\rm d}Ye^{-|Y|}\\cos(Y\\tan\\theta)\\left\\{ \\frac{U\\left(y-\\frac{Y}{k}\\right)+U\\left(y+\\frac{Y}{k}\\right)-2U(y)}{\\left(U\\left(y-\\frac{Y}{k}\\right)-U(y)\\right)\\left(U\\left(y+\\frac{Y}{k}\\right)-U(y)\\right)}\\right\\} \\\\\n & \\underset{k\\rightarrow\\infty}{\\rightarrow} \\frac{U''}{U'^{2}}\\int_{0}^{+\\infty}{\\rm d}Ye^{-|Y|}\\cos(Y\\tan\\theta)=\\frac{U''}{U'^{2}}\\frac{1}{1+\\tan^{2}\\theta}.\\end{aligned}$$]{} We have used the relations $$U\\left(y-\\frac{Y}{k}\\right)+U\\left(y+\\frac{Y}{k}\\right)-2U(y)\\sim U''\\frac{Y^{2}}{k^{2}}$$ and $$\\left(U\\left(y-\\frac{Y}{k}\\right)-U(y)\\right)\\left(U\\left(y+\\frac{Y}{k}\\right)-U(y)\\right)\\sim U'^{2}\\frac{Y^{2}}{k^{2}}.$$\n\nWe have thus $$\\mathcal{R}e\\left\\langle v_{\\theta}^{*}\\omega_{\\theta}\\right\\rangle \\underset{K\\rightarrow\\infty}{\\sim}-\\frac{\\hat{C}_{k,l}}{2k^{2}}\\frac{U''}{U'^{2}}\\frac{1}{1+\\tan^{2}\\theta}=-\\frac{\\hat{C}_{k,l}}{2K^{2}}\\frac{U''}{U'^{2}}\\label{eq:resultat-annexeB}.$$ Finally, we use the power input relation $\\frac{1}{2}\\iint{\\rm d}k'{\\rm d}l'\\frac{\\hat{C}_{k',l'}}{K'^{2}}=1$. When we integrate relation (\\[eq:resultat-annexeB\\]) over the whole spectrum, we get the desired result (\\[eq:resultat-annexeB1\\]).", "\n\nModified Rossby waves\\[sec:Modified-Rossby-waves\\]\n==================================================\n\nIn this appendix, we discuss the neutral modes of parabolic jets $U(y)=\\gamma\\frac{y^{2}}{2}$. We first note that for any parabolic jet, $U''-\\beta$ does not change sign. ", "Hence the Rayleigh-Kuo criteria is satisfied and the jet has no unstable modes.", "\n\nFor a mean velocity $U(y)=\\gamma\\frac{y^{2}}{2}$, we are looking for solutions of (\\[eq:deterministic\\]) of the form $\\omega_{k}(y)e^{-ikct}$. The equation writes $$-ikc\\omega_{k}+ik\\gamma\\frac{y^{2}}{2}\\omega_{k}+ik(\\beta-\\gamma)H_{k}*\\omega_{k}=0.$$ We do the Fourier transform $\\hat{\\omega}_{k}(l):=\\int{\\rm d}y\\omega_{k}(y)e^{-ily}$ to obtain $$-\\frac{1}{2}\\frac{{\\rm d}^{2}}{{\\rm d}l^{2}}\\hat{\\omega}_{k}+\\frac{\\mu}{k^{2}+l^{2}}\\hat{\\omega}_{k}=\\frac{c}{\\gamma}\\hat{\\omega}_{k},\\label{eq:schrodinger}$$ where $\\mu:=1-\\frac{\\beta}{\\gamma}$. We recognize the eigenvalue problem for a Schr[ö]{}dinger operator for a particle with potential $\\frac{\\mu}{k^{2}+l^{2}}$, a result already obtained by Brunet [@brunet1990dynamique]. ", "Using classical results for this type of 1D Schr[ö]{}dinger equation, we can immediately conclude that\n\n- There exists a solution $\\hat{\\omega}_{k}$ in $L_{2}$ iff $\\mu<0$ (attractive potential). ", "In that case, the corresponding eigenvalue is negative which implies that $\\frac{c}{\\gamma}<0.$ The condition $\\mu<0$ imposes already $\\gamma>0$, so the phase velocity of Rossbywave is $c<0$ and the wave is outside of the continuous spectrum. ", "We find for this particular configuration the classical result that Rossby waves propagate with $c<U_{min}$.\n\n- The number of modes $n\\left(\\left|\\mu\\right|\\right)$ increases with $\\left|\\mu\\right|$, the depth of the potential well. ", "Modes organize into continuous families $\\left\\{ \\Omega_{i}\\left(\\left|\\mu\\right|\\right)\\right\\} _{1\\leq i\\leq n\\left(\\left|\\mu\\right|\\right)}$, with energies $E_{i}\\left(\\left|\\mu\\right|\\right)=\\frac{c}{\\gamma}$, when $\\left|\\mu\\right|$ is changed. ", "$E_{i}\\left(\\left|\\mu\\right|\\right)$ are decreasing functions of $\\left|\\mu\\right|$. The families $\\Omega_{i}$ are alternatively even and odd functions with a number of nodes that increases with $i$. A new set of modes appears for critical values $\\mu_{i}$. For $\\mu=\\mu_{i}$, the mode of the new family has a zero energy $E_{i}\\left(\\left|\\mu_{i}\\right|\\right)=0$.\n\nTo compute the eigenfunction of (\\[eq:schrodinger\\]), for a given $\\mu$ we use a bisection algorithm. ", "We divide the interval $[\\mu,0]$ in sufficiently small intervals $[\\tau_{i},\\tau_{i+1}]$ and compute the solution of (\\[eq:schrodinger\\]) with $\\frac{c}{\\gamma}=\\tau_{i}$. The solution diverges like an exponential at infinity, and when this divergence changes sign between $\\tau_{i}$ and $\\tau_{i+1}$, it means that we have an eigenfunction in the interval, and we iterate the algorithm until $\\tau_{i+1}-\\tau_{i}$ is small enough. ", "This way, we obtain the Fourier transform of a mode, we just have to inverse the Fourier transform to get the mode in real space. ", "Then we project $e^{ily}$ on these modes with the standard scalar product on $L_{2}$. Figure (\\[fig:modes\\]) displays the 3 first eigenfunctions obtained with $\\mu=-1$.\n\n![", "The first three neutral modes (modified Rossby waves) obtained for $\\mu=-1$. Even modes and odd modes alternate. ", "The first mode vanishes only at infinity, and each new mode has an additional zero.[]{data-label=\"fig:modes\"}](modesalpha-1.pdf)\n" ]

{ "pile_set_name": "ArXiv" }

[ 0, 0, 0.007194244604316547, 0, 0, 0, 0, 0, 0, 0.00436046511627907, 0.015037593984962405, 0, 0, 0, 0.0031446540880503146, 0, 0, 0, 0, 0, 0.009950248756218905, 0.00684931506849315, 0.006430868167202572, 0, 0.005747126436781609, 0, 0, 0, 0, 0, 0, 0.0036496350364963502, 0, 0, 0, 0.004415011037527594, 0, 0, 0.00423728813559322, 0, 0, 0.0049382716049382715, 0, 0, 0, 0.0028735632183908046, 0.0035971223021582736, 0, 0.0035460992907801418, 0.010869565217391304, 0, 0, 0, 0, 0.008264462809917356, 0, 0.006578947368421052, 0, 0, 0, 0.0029154518950437317, 0, 0, 0, 0.004784688995215311, 0.0018867924528301887, 0.002881844380403458, 0, 0, 0.005681818181818182, 0.00641025641025641, 0, 0.00847457627118644, 0.003125, 0.0026954177897574125, 0.0026455026455026454, 0, 0.005050505050505051, 0, 0, 0, 0, 0, 0.007407407407407408, 0, 0, 0, 0, 0, 0, 0.00684931506849315, 0, 0, 0.008733624454148471, 0.004132231404958678, 0.002652519893899204, 0.002288329519450801, 0.005970149253731343, 0, 0, 0, 0, 0.0049504950495049506, 0.0076045627376425855, 0.0029498525073746312, 0, 0.004689331770222743, 0.009174311926605505, 0, 0.0035149384885764497, 0, 0, 0.008849557522123894, 0, 0, 0.009708737864077669, 0, 0, 0.008695652173913044, 0.0030211480362537764, 0.007518796992481203, 0, 0, 0, 0.006622516556291391, 0, 0.0076726342710997444, 0, 0, 0, 0.00546448087431694, 0, 0.007352941176470588, 0, 0.002457002457002457, 0, 0.008064516129032258, 0.005050505050505051, 0, 0.002967359050445104, 0.0029239766081871343, 0.0036101083032490976, 0.005703422053231939, 0, 0, 0.003105590062111801, 0.005747126436781609, 0.006060606060606061, 0, 0.0058823529411764705, 0, 0, 0.005494505494505495, 0.0035087719298245615, 0, 0.0036363636363636364, 0, 0.008264462809917356, 0.003125, 0.0010141987829614604, 0.011494252873563218, 0.0022026431718061676, 0.00389321468298109, 0, 0, 0.004347826086956522, 0, 0.004484304932735426, 0, 0.010416666666666666, 0.00423728813559322, 0, 0, 0.005319148936170213, 0, 0.006756756756756757, 0.003257328990228013, 0, 0, 0, 0, 0, 0, 0, 0, 0.009009009009009009, 0, 0, 0, 0, 0, 0, 0, 0, 0.005434782608695652, 0, 0, 0, 0.007434944237918215, 0.0037313432835820895, 0, 0, 0.014084507042253521, 0.002352941176470588, 0.0037313432835820895, 0.010526315789473684, 0.02, 0.004975124378109453, 0, 0.0056022408963585435, 0, 0, 0, 0, 0, 0, 0, 0.002531645569620253, 0.0027624309392265192, 0, 0, 0.01282051282051282, 0.005405405405405406, 0, 0, 0, 0.006578947368421052, 0, 0, 0, 0, 0, 0, 0.007137192704203013, 0, 0.006578947368421052, 0, 0, 0.005952380952380952, 0.0012755102040816326, 0, 0, 0, 0, 0.006896551724137931, 0, 0, 0, 0.002638522427440633, 0.0125, 0, 0, 0, 0, 0, 0.005063291139240506, 0, 0, 0, 0, 0, 0.005063291139240506, 0, 0.0044444444444444444, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.004830917874396135, 0, 0.001314060446780552, 0, 0, 0, 0, 0, 0.009259259259259259, 0.00411522633744856, 0, 0, 0.02564102564102564, 0, 0.005988023952095809, 0, 0.02564102564102564, 0, 0.0030131826741996233, 0, 0.009615384615384616, 0.011235955056179775, 0.011976047904191617, 0.010101010101010102, 0, 0.011764705882352941, 0.02040816326530612, 0.0056179775280898875, 0.006756756756756757, 0.00684931506849315, 0.0037359900373599006, 0.006112469437652812, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.009259259259259259, 0, 0.0032733224222585926, 0, 0.007142857142857143, 0, 0, 0.004761904761904762, 0, 0.0039946737683089215, 0, 0, 0.00546448087431694, 0, 0.005747126436781609, 0.005434782608695652, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0051813471502590676, 0, 0.0038314176245210726, 0, 0.008298755186721992, 0, 0, 0, 0.008298755186721992, 0, 0, 0, 0.008620689655172414, 0, 0, 0, 0, 0.00425531914893617, 0, 0, 0.005235602094240838, 0, 0, 0, 0, 0.004048582995951417, 0, 0.005917159763313609, 0, 0, 0, 0.0026455026455026454, 0, 0, 0, 0, 0, 0, 0, 0.00205761316872428, 0, 0, 0, 0, 0, 0, 0, 0, 0.009174311926605505, 0, 0, 0, 0, 0.0078125, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.01098901098901099, 0.016304347826086956, 0, 0.011235955056179775, 0.00333889816360601, 0.009433962264150943, 0.003424657534246575, 0, 0, 0.0045045045045045045, 0.008968609865470852, 0, 0, 0.00558659217877095, 0.0012376237623762376, 0, 0, 0.0017889087656529517, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0.0017321016166281756, 0.0036231884057971015, 0, 0.0013679890560875513, 0, 0.00411522633744856, 0.00425531914893617, 0, 0.0021321961620469083, 0.0023148148148148147, 0, 0, 0.008849557522123894, 0 ]

[ "Naked Instinct - Naked Muscle Nude Men DVD/Video\n\nORDER NOW\nMale Instinct\n\nMust be 18+ to order\n\nUnrated\nFull Frontal Nudity\n90 minutes\n$39.95\n\nDVD\nor VHS\n\nSeven young studs\nsatisfy their sexual hungers in multiple episodes of erotic lust. ", "Intensely focusing\non these fresh hunks, the camera captures their every move as their lean, hard,\nsinewy bodies flex and writhe in hot sensual passion. ", "If you've ever fantasized about what straight young bucks do with hot babes behind closed doors, this 90 minute, shot-on-film feature is a must! ", "Follow your naked instinct and push your passion to the limit!", "\n\nClick on any of these pictures for a closer\nlook\nat these buffed-out muscle men" ]

{ "pile_set_name": "Pile-CC" }

[ 0.008333333333333333, 0, 0, 0, 0 ]